INTERNATIONAL EURASIAN CONFERENCE ON BIOLOGICAL AND CHEMICAL SCIENCES 26 - 27 April 2018 (EurasianBioChem 2018) Ankara / Turkey PROCEEDING BOOK EurasianBioChem International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018) April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org PROCEEDING BOOK International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Chairman of Conference Assoc. Prof. Dr. Muhittin DOĞAN Gaziantep University, Turkey Organizing Committee Prof. Dr. Osman GÜLNAZ Chairman Assoc. Prof. Dr. Aygül KÜÇÜKGÜLMEZ YAND)M Assoc. Prof. Dr. Belgin GÖZMEN SÖNMEZ Çukurova University, Turkey Çukurova University, Turkey Mersin University, Turkey International Scientific Committee* Prof. Dr. Abdullah MART Prof. Dr. Abdunnasır Y)LD)Z Prof. Dr. Adem ÖNAL Prof. Dr. Adil M. ALLA(VERDİYEV Prof. Dr. Adnan AYHANCI Prof. Dr. Ahmet AKSOY Prof. Dr. Ahmet ASAN Prof. Dr. Ahmet KARADAĞ Prof. Dr. Aida SAHMUROVA Prof. Dr. Ali ERDOĞAN Prof. Dr. Atila YILDIZ Prof. Dr. Ayla BALABAN GÜNDÜZALP Prof. Dr. Belma ASLIM Prof. Dr. Bülent KAYA Prof. Dr. Dilek DEMİREZEN Y)LMAZ Prof. Dr. Ebru Gül ASLAN Prof. Dr. E. Sümer ARAS Prof. Dr. Elif Şahin )ŞG)N Prof. Dr. Emin SARIPINAR Prof. Dr. Emine ARSLAN Prof. Dr. Emir Baki DENKBAŞ Prof. Dr. Engin TİLKAT Prof. Dr. Erdoğan Ç)ÇEK Prof. Dr. Erdal BALCAN Prof. Dr. Fatma Jale GÜLEN Prof. Dr. Fatma ÜNAL Prof. Dr. Ferda CANDAN Prof. Dr. Gönül DÖNMEZ Prof. Dr. Gülay BAYRAMOĞLU Prof. Dr. Gülay ÖZCENGİZ Prof. Dr. Güldeniz SELMANOĞLU Prof. Dr. Gülsen ASMAN Prof. Dr. Güray UYAR Prof. Dr. Handan UYSAL Prof. Dr. Hasan Basri ILA Prof. Dr. (asan (üseyin DOĞAN Prof. Dr. (ayati TÜRKMEN Prof. Dr. (ülya ÖLÇER FOOT)TT Prof. Dr. (üseyin GÜ(ER Prof. Dr. (üsniye AKA SAĞL)KER Prof. Dr. İbrahim ÖRÜN Prof. Dr. İhsan AKYURT Prof. Dr. Jitendra PANWAR Prof. Dr. Kadir YURDAKOÇ Prof. Dr. Kamil KOÇ Prof. Dr. Kayahan FISKIN Prof. Dr. Mehmet Rüştü KARAMAN Prof. Dr. Muhammet GAFFAROĞLU Prof. Dr. Murat ÇELİK Prof. Dr. Mustafa ATEŞ Prof. Dr. Mustafa ÖZCAN Prof. Dr. Mustafa TÜRKMEN Prof. Dr. Naime Funda TAY Prof. Dr. Nazime MERCAN DOĞAN Prof. Dr. Nilgün ÖZPOZAN Prof. Dr. Noor Hasima NAGOOR Prof. Dr. Numan HODA Prof. Dr. Nursel PEKEL BAYRAMGİL Prof. Dr. Oktay ARSLAN Prof. Dr. Osman DUMAN Prof. Dr. Ömer )Ş)LDAK Prof. Dr. Ömer KOZ Prof. Dr. Ömür BAYSAL Prof. Dr. Özlem ÇETİN ERDOĞAN ii Osmaniye Korkut Ata University, Turkey Dicle University, Turkey Gaziosmanpaşa University, Turkey Yıldız Technical University, Turkey Eskişehir Osmangazi University, Turkey Akdeniz University, Turkey Trakya University, Turkey Bartın University, Turkey Okan University, Turkey Akdeniz University, Turkey Ankara University, Turkey Gazi University, Turkey Gazi University, Turkey Akdeniz University, Turkey Erciyes University, Turkey Süleyman Demirel University, Turkey Ankara University, Turkey Dokuz Eylul University, Turkey Erciyes University, Turkey Selçuk University, Turkey Hacettepe University, Turkey Batman University, Turkey Nevşehir (acı Bektaş Veli University, Turkey Manisa Celal Bayar University, Turkey Yıldız Technical University, Turkey Gazi University, Turkey Cumhuriyet University, Turkey Ankara University, Turkey Gazi University, Turkey Middle East Technical University, Turkey Hacettepe University, Turkey Gazi University, Turkey Gazi University, Turkey Atatürk University, Turkey Cukurova University, Turkey Selçuk University, Turkey Ege University, Turkey Dumlupınar University, Turkey Trakya University, Turkey Osmaniye Korkut Ata University, Turkey Aksaray University, Turkey Giresun University, Turkey Birla Institute of Technology & Science (BITS), India Dokuz Eylül University, Turkey Manisa Celal Bayar University, Turkey Akdeniz University, Turkey Afyon Kocatepe University, Turkey Ahi Evran Üniversitesi University, Turkey Atatürk University, Turkey Ege University, Turkey İstanbul Technical University, Turkey Giresun University, Turkey Eskişehir Osmangazi University, Turkey Pamukkale University, Turkey Erciyes University, Turkey University of Malaya, Malaysia Akdeniz University, Turkey Hacettepe University, Turkey Balıkesir University, Turkey Akdeniz University, Turkey Gaziosmanpasa University, Turkey Bursa Technical University, Turkey Muğla Sıtkı Koçman University, Turkey Trakya University, Turkey International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Prof. Dr. Pınar ÇAMURLU Prof. Dr. Ramazan ERENLER Prof. Dr. Remziye DEVECİ Prof. Dr. Rıdvan ŞEŞEN Prof. Dr. Sadık D)NCER Prof. Dr. Sait Aykut AYTAÇ Prof. Dr. Salih DOĞAN Prof. Dr. Sema İŞİSAĞ ÜÇÜNCÜ Prof. Dr. Semra İL(AN Prof. Dr. Serpil YENİSOY KARAKAŞ Prof. Dr. Sevda K)RBAĞ Prof. Dr. Sevil TOROGLU Prof. Dr. Sevim AKYÜZ Prof. Dr. Sibel AKAR Prof. Dr. Süheyla K)RM)Z)GÜL Prof. Dr. Şenay ÇETİNUS Prof. Dr. Şengül ALPAY KARAOĞLU Prof. Dr. Şule Coşkun CEV(ER Prof. Dr. Talat ÖZPOZAN Prof. Dr. Tamer AKAR Prof. Dr. Tülin ASKUN Prof. Dr. Tülin AYDEMİR Prof. Dr. Ümmühan Özdemir ÖZMEN Prof. Dr. Yüksel ABAL) Prof. Dr. Zehra Nur YÜKSEKDAĞ Prof. Dr. Zeliha SELAMOĞLU Assoc. Prof. Dr. Aygül KÜÇÜKGÜLMEZ YAND)M Assoc. Prof. Dr. Ayşe Gül MUTLU Assoc. Prof. Dr. Ayşe Dilek ÖZŞA(İN KİREÇCİ Assoc. Prof. Dr. Belgin GÖZMEN SÖNMEZ Assoc. Prof. Dr. Berrin DURAN Assoc. Prof. Dr. Ebru GÜREL-GÜREVİN Assoc. Prof. Dr. Elif Damla ARISAN Assoc. Prof. Dr. Elif ÖZTETİK Assoc. Prof. Dr. Erol AKPINAR Assoc. Prof. Dr. Gizem Dinler DOĞANAY Assoc. Prof. Dr. (asan ÇABUK Assoc. Prof. Dr. (ikmet Yeter ÇOĞUN Assoc. Prof. Dr. Ilgaz AKATA Assoc. Prof. Dr. )şık PERÇİN DEMİRÇELİK Assoc. Prof. Dr. İ. Çağatay KARAASLAN Assoc. Prof. Dr. M. Burcu )rmak YAZ)C)OĞLU Assoc. Prof. Dr. Mehmet GÖNEN Assoc. Prof. Dr. Mehtap TEKŞEN Assoc. Prof. Dr. Mikail AKBULUT Assoc. Prof. Dr. Mustafa BOGA Assoc. Prof. Dr. Nazlı SAR)KA(YA Assoc. Prof. Dr. Özcan YALÇ)NKAYA Assoc. Prof. Dr. Özgur ARAR Assoc. Prof. Dr. Özlem ÖZBEK Assoc. Prof. Dr. Róbert GYEPES Assoc. Prof. Dr. Serap Yalçın AZARKAN Assoc. Prof. Dr. Sevgi SEVSAY Assoc. Prof. Dr. Şule BARAN Assoc. Prof. Dr. Şükran Y)LD)Z Dr. Banu Şebnem ÖNDER Dr. Chong Yee LING Dr. Engin BAT Dr. Jana SOBOTNÍKOVÁ Dr. Meghane TARE Dr. Mostafa NORİZADE( Dr. Nur Airina MUHAMMAD Dr. Önder YUMRUTAŞ Dr. Ryan BAIDYA *This list is arranged in alphabetical order. Akdeniz University, Turkey Gaziosmanpasa University, Turkey Ege University, Turkey Dicle University, Turkey Cukurova University, Turkey Hacettepe University, Turkey Erzincan University, Turkey Ege University, Turkey Eskişehir Osmangazi University, Turkey Abant Izzet Baysal University, Turkey Fırat University, Turkey Kahramanmaraş Sütçü İmam University, Turkey İstanbul Kültür University, Turkey Eskişehir Osmangazi University, Turkey Ege University, Turkey Cumhuriyet University, Turkey Recep Tayyip Erdoğan University, Turkey Gazi University, Turkey Erciyes University, Turkey Eskişehir Osmangazi University, Turkey Balıkesir University, Turkey Manisa Celal Bayar University, Turkey Gazi University, Turkey Manisa Celal Bayar University, Turkey Gazi University, Turkey Niğde Ömer (alisdemir University Cukurova University, Turkey Mehmet Akif Ersoy University, Turkey Bitlis Eren University, Turkey Mersin University, Turkey Eskişehir Osmangazi University, Turkey İstanbul University, Turkey İstanbul Kültür University, Turkey Anadolu University, Turkey Abant Izzet Baysal University, Turkey İstanbul Technical University, Turkey Bülent Ecevit University, Turkey Cukurova University, Turkey Ankara University, Turkey Hacettepe University, Turkey Hacettepe University, Turkey Halic University, Turkey Süleyman Demirel University, Turkey Aksaray University, Turkey Erciyes University, Turkey Niğde Ömer (alisdemir University, Turkey Ege University, Turkey Gazi University, Turkey Ege University, Turkey Hitit University, Turkey Charles University, Czech Republic Ahi Evran University, Turkey Erzincan University, Turkey Sakarya University, Turkey Manisa Celal Bayar University, Turkey Hacettepe University, Turkey Universiti Malaysia Sarawak, Malaysia Middle East Technical University, Turkey Karlova University, Czech Republic Birla Institute of Technology & Science (BITS), India Bülent Ecevit University, Turkey University of Malaya, Malaysia Adıyaman University, Turkey California Takshila University, USA Conference Secretariats Dr. Mustafa PE(LİVAN Dr. Demet DOĞAN Dr. Celal BAL Dr. Mustafa SEVİNDİK Serap ŞA(İN YİĞİT Nazrin MURGUZOVA iii Gaziantep University, Turkey Gaziantep University, Turkey Gaziantep University, Turkey Gaziantep University, Turkey Gaziantep University, Turkey Çukurova University, Turkey ORAL PRESENTATIONS International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org A Comparison on Antibacterial Activity of Silver Nanoparticles and Chitosan Hüsnügül Yilmaz Atay İzmir Katip Çelebi University, Faculty of Engineering and Architecture, Materials Science and Engineering, İzmir, Turkey. Corresponding author e-mail: hgulyilmaz@gmail.com Abstract Antibacterial and antimicrobial agents have been studied for possible use in a variety of the healthcare applications, industries, laboratories and environments, in addition to houses. It can be said that the most important application is to set medical environments and equipment for the sterilization in order to prevent thousands of deaths resulted from hospital-associated infections. Many different materials have been used by civilizations throughout the world for thousands of years with this respect. Silver, comes first among these materials, has been used as an antibacterial agent in our previous works. However, as some toxic effects have also been reported for silver, the need for the use of organic materials has emerged. Chitosan is one of the prominent materials in this sense. It can be called environment purification functional material that they can effectively control the growth, reproduction of hazardous bacteria and also control toxic pollutants. They are defined as non-toxic, biodegradable, biocompatible and hydrophilic, in addition to having antimicrobial and antibacterial characteristics. In this study, an acrylic resin was converted to antibacterial composite materials by using silver nanoparticles and chitosan. Different amount of additives were inserted to the polymer matrix individually. Glass substrates were coated with this polymeric matrix. Obtained samples were characterized by Scanning Electron Microscope (SEM) and scratch test. Antibacterial activity against Staphylococcus aureus (S. Aureus) was studied by applying entitled in vitro test so called percent decreasing test. It was concluded that chitosan can be considered as an effective antibacterial additive as an alternative to silver nanoparticles. Keywords: Antibacterial materials; Silver nanoparticles; Chitosan; Staphylococcus aureus. 1. INTRODUCTION Unwanted bacterial adhesion, colonization and subsequent biofilm formation, so called bacterial infections, may cause pain and death. It also brings tremendous additional costs to health care worldwide. It causes major problems in many sectors such as food processing/storage, marine transport/management, and water treatment. Although scientists have done countless research on this issue, they have not found a comprehensive solution for controlling bacterial surface colonization. Over the last few decades plenty of antibacterial materials and coatings have been developed. Some of them even transferred from the laboratory to the hospital to prevent the buildup, spread and transfer of harmful bacteria and viruses (Brown, 1998). Silver, is one of the antibacterial agents, has been used by civilizations throughout the world even by the Ancient Greek and Roman Empires. It was employed as a germicide and antibiotic long prior to the development of modern pharmaceuticals. Also used for storing wine to prevent spoilage, storing milk to keep it fresh, and storing drinking water to save it from bacteria and algae (Purest Colloids, 2014). Unlike other materials, silver works for destroying the enzymes of microorganisms for disabling them. In addition, comparing with antibiotics, which are only useful for bacteria, silver is also effective for other microorganisms such as anaerobic bacteria, viruses, yeasts, and fungus (Thurman et al, 1989, Domek et al. 1984). However, some toxic effects have been reported for silver. In this case the need for the use of organic materials has emerged. Chitosan to be used in place of antibacterial agent was chosen in this study. It is the largely used natural biopolymer material is produced from wastes of crab and shrimp shells. It can be called as functional and environmental purification materials which can effectively control the growth, reproduction of hazardous bacteria and toxic pollutants (Hu et al., 2004). Chitosan has positively charged amino group which interacts with negatively charged microbial cell membranes (Rabea et al., 2003). This leads to the ORAL PRESENTATION 1 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org leakage of proteinaceous and other intracellular constituents of the microorganisms. That may be one of the reasons of having antimicrobial feature of chitosan (Shahidi et al., 1999). Another reason is related to the moves of chitosan on the outer surface of bacteria. At a lower concentration (0.2 mg/mL), polycationic chitosan can be probably bound to the negatively charged bacterial surface for causing agglutination. The larger number of positive charges may impart a positive charge to the bacterial surfaces in order to keep them in suspension at a higher concentration (Dutta et al., 2009). In this study, an acrylic resin was converted to antibacterial coating materials by using silver nanoparticles and chitosan. They were inserted to the polymer matrix individually. Glass substrates were coated with this polymeric matrix. Then, the samples were characterized by Scanning Electron Microscope (SEM) and scratch test. Antibacterial activity against Staphylococcus aureus (S. Aureus) was studied by applying percent decreasing test. 2. MATERIALS AND METHODS 2.1 Preparation of the additives Ag nanoparticles were synthesized by a reduction reaction (Yan at al, 2005). An aqueous solution of silver nitrate and an aqueous solution of a nonammonia reducing agent were mixed to form a nano silver particlecontaining solution at room temperature. Glucose was used as a reducing agent wherein silver nitrate and glucose was at a ratio of about 2:1 by weight (Figure 1-a). Chitosan (Poly-(D) glucosamine, Sigma) colloids were prepared as presented in Figure 1-b. Different amounts of chitosan were dissolved in the acid solution. After a complete mixture by using magnetic stirrer at 25 OC for 20 minutes, homogeneous chitosan colloids were obtained. (a) (b) Figure 1. Production of a) Ag Nanoparticles and b) Chitosan colloid 2.2. Coating Preparation Acrylic composite coatings were prepared by adding Ag nanoparticles and chitosan colloids to the polymeric matrix. Polymethyl acrylate was used as an acrylic resin supplied from DYO, Turkey. Additives were incorporated into the acrylic resin with different loading level to assess the concentration dependence of material’s antimicrobial affect. Glass substrates were coated with produced polymeric composites. The sample codes and descriptions coatings are demonstrated in Table 1. ORAL PRESENTATION 2 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 1. Description and sample codes of composite coatings Sample codes P00 PS1 PS2 PS3 PS4 PC1 PC2 PC3 PC4 Ag nanoparticles percentage in the composites (%) Chitosan percentage in the composites (%) 0 0 0.01 0.05 0.50 1.00 0 0 0 0 0 0 0 0 0.01 0.05 0.50 1.00 2.3. Characterisation Elemental analysis and the microstructural cross-sectional area of the coatings were examined through SEMEDS with a JEOL JJM 6060 model equipment. Antibacterial properties of the samples were measured by percent decreasing test. A plate counter agar solid culture medium was poured into the plates that were subsequently incubated at γ7 °C for β4 hours so that the Vital cells, eventually presented, could grow into colonies. The microorganisms’ colonial presence was then evaluated, by counting the colony-forming units per Petri plate (CFU/mL). Used bacteria were Staphylococcus aureus (S. Aureus) (ATTC 11228). The difference between the number of the bacteria obtained at zeroth hour and the one obtained after 24 hours will show the antibacterial performance (Equation 1). *  A  B % decrease    x100 ………………….. (Eq. 1)  A  in which, A: Bacteria number at zeroth hour and B: Bacteria number after 24 hours. 3. RESULTS Figure 2 depics SEM micrographs of the composite coatings. It can be clearly seen that by adding Ag nanoparticles and chitosan to the composites, the microstructure regularly changed. Smooth surface is obtained at the pure coating, some defects such as porosity, rough surface and so on are produced at Ag nanoparticle and chitosan reinforced composites. Scratch test has been performed to the composite coatings for estimating the adhesion properties of the coatings. The test results are shown in Table 2. It can be clearly seen that pure resin’s cohesive force is the highest value. Adhesion properties were deteriorated by adding Ag nanoparticle and chitosan. Corresponding adhesion strengths are calculated as following; 94.76 Mpa, 80.12 MPa, 82.54 MPa, 65.97 MPa, 66.54 MPa, 91.65 MPa, 89.76 MPa, 78.65 MPa and 75.18 MPa, respectively. Chitosan colloid addition made worse the adhesion as stated in SEM results which showed that formation of flocculation and cracks lead to split up the contact points (Renevier et al., 2000). ORAL PRESENTATION 3 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org a) b) c) Figure 2. SEM micrographs of (a) P00, (b) PS3 (c) PC3 samples Ag Nanoparticles and chitosan reinforced composite samples were subjected to antibacterial test called “percent decreasing test”. The initial number of bacteria was 22.3x104, and they were counted again after 24 hours. The results are shown in Table 3 below. It can be seen that all Ag nanoparticles reinforced composites revealed very good antibacterial property. Even the lowest quantity of Ag nanoparticles (0.1%) in the polymer matrix caused a 100% destroying on the bacteria of S. aureus. Antibacterial activity of chitosan reinforced composites is a little bit different. 100% destroying of bacteria was achieved with PC3 and PC4 samples which have 0.50 and 1.00% chitosan. However, the percent decrease values were 94.62% and 95.52% for PC1 and PC2, respectively. ORAL PRESENTATION 4 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 2. Scratch test results of composite coatings Sample codes P00 PS1 PS2 PS3 PS4 PC1 PC2 PC3 PC4 Corresponding adhesion strengths (MPa) 94.76 80.12 82.54 65.97 66.54 91.65 89.76 78.65 75.18 Table 3. Percent ecreasing test results of the composite samples Sample codes P00 PS1 PS2 PS3 PS4 PC1 PC2 PC3 PC4 Bacteria quantity after 24 hours 16.8x104 0 0 0 0 1.2x104 1.0x104 0 0 Decrease, %* 24,67 100 100 100 100 94.62 95.52 100 100 4. DISCUSSION The results are supported our preivous works (Yilmaz Atay et al. 2015) for silver nanoparticles reinforced composites. Excellent ahis antibacterial activity was achieved with silver nanoparticles reinforced composites. This activity is thought that it results from the interaction of silver and thiol groups in bacteria proteins (Li et al, 2008). For the chitosan reinforced composites, also it can be expressed that they showed antibacterial property. Colloid chitosan allows reaction with the counterparts to a sufficient degree by existing as a disassociating form in solution and an extending confirmation (Phaechamud et al. 2008). By extending conformation contact to solution, hydrogels can be formed by covalently cross-linking chitosan with itself. Chitosan particulate systems can form dispersion in solution with the considerable reactive surface area (Kong et al. 2008). In addition, the prohibition activity of Ag nanoparticels and chitosan depends on different types of factors, such as solid surface characteristic and the morphology. Particle size, membrane and fiber thickness cause to occur different results. It was investigated the effect of particle size and shape of the additives, and it was recorded that antibacterial activity was improved by decreasing the particle size. Moreover, the antibacterial property of those additives depends on shape as well as specific surface area. 5. CONCLUSION In this study, the antibacterial behaviour and effectiveness of Ag nanoparticles and chitosan reinforced polymer composites were investigated. With SEM photographs it was seen that smooth surface is obtained at the pure coating, some defects such as porosity, rough surface and so on are produced at Ag nanoparticle and chitosan reinforced composites. Antibacterial activity against Staphylococcus aureus (S. Aureus) was studied by applying entitled in vitro test so called percent decreasing test. As chitosan is non-toxic, biodegradable, biocompatible and ORAL PRESENTATION 5 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org hydrophilic, in addition to having antimicrobial and antibacterial characteristics, it can be considered as an effective antibacterial additive as an alternative to silver nanoparticles. Using this nontoxic, harmless and environmentally friendly vegetable material material at the points of our life will be more healthful for people. That will inspire research towards the next generation of antibacterial materials and coatings. REFERENCES Brown SD, 1998. Investigation into the suitability of using water ionized with copper and silver to treat E. coli infection in slaughtering house. MSc thesis, Cranfield Biotechnology Centre. Domek M J, LeChevallier MW, Cameron SC, McFeters GA, 1984. Evidence for the role of copper in the injury process of coliform bacteria in drinking water. Appl. Environ Microbiol. 48: 289–293. Dutta PK, Tripathi S, Mehrotra GK, Dutta J, 2009. Perspectives for chitosanbased antimicrobial films in food applications, Food Chem. 114; 1173–1182. Hu SG, Jou CH, Yang MC, 2004. Biocompatibility and antibacterial activity ofchitosan and collagen immobilized poly (3-hydroxybutyricacid-co-3-hydroxyvaleric acid), Carbohydr. Polym. 58; 173–179. Kong M, Chen XG, Xing K, Park HJ, 2010. Antimicrobial properties of chitosan andmode of action: a state of the art review, Int. J. Food Microbiol. 144: 51–63. Li B, Liu X, Cao C, Meng F, Dong Y, Cui T, Ding C, 2008.. Preparation and antibacterial effect of plasma sprayed wollastonite coatings loading silver. Appl. Surf. Sci. 255: 452–454. Phaechamud T, 2008. Hydrophobically modified chitosans and theirpharmaceutical applications, J. Pharm. Sci. Technol. 1: 2–9. Purest Colloids, 2014. A Brief History of the Health Support Uses of Silver. http://www.purestcolloids.com/history-silver.php [Erişim16Octoberβ014]. Rabea EI, Badawy MET, Stevens CV, Smagghe G, Steurbaut W, 2003. Chitosan asantimicrobial agent: applications and mode of action, Biomacromolecules 4; 1457–1465. Renevier NM, Fox VC, Teer DG, Hampshire J, 2000. Coating characteristics and tribological properties of sputter-deposited MoS2/metal composite coatings deposited by closed field unbalanced magnetron sputter ion. Surface and Coatings Technology, 127: 24-37. Shahidi F, Arachchi JKV, Jeon YJ, 1999. Food application of chitin and chitosans, Trends Food Sci. Technol. 10; 37–51. Thurman R, Gerba CA, 1989. small sample of research and articles supporting the efficacy of silver as an antimicrobial agent follow: The molecular mechanisms of copper and silver ion disinfection of bacteria and viruses. CRC Crit. Rev. Environ. Control. 18: 295–315. Yan J, Cheng J, 2005. Antimicrobial Yarn Having Nano silver Particles and Methods for Manufacturing the Same. U.S. Patent No. 6,979,491 B2. Yılmaz Atay H, Yaşa I, Çelik E, β015. Antibacterial polymer composite coatings with synthesized silver nanoparticles. Synthesis and Reactivity in Inorganic, Metal-Organic, and Nano-Metal Chemistry. 45: DOI:10.1080/15533174.2013.843561 ORAL PRESENTATION 6 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Influence of Tartaric Acid on Phase Transformation Behavior of Glycine Sevgi Polat*, Perviz Sayan Marmara University, Faculty of Engineering, Chemical Engineering Department, Istanbul, TURKEY Corresponding author e-mail: sevgi.polat@marmara.edu.tr Abstract Phase transformation of -glycine to α-glycine was investigated in the absence and presence of tartaric acid, a type of carboxylic acid, used as an additive. XRD, SEM, morphology, and FTIR analysis were performed to characterize the crystals. XRD results showed that all crystals obtained in the presence of tartaric acid were in α form and the addition of tartaric acid caused to prolong the phase transformation time. In terms of morphological characteristics, rod shape glycine crystals experienced morphological change in the presence of the additive. Compared to the pure media, the crystals obtained in the presence of tartaric acid had agglomeration tendency and the aspect ratio of the crystals were changed remarkably. The functional groups of the crystals were determined using FTIR analyzer and this result confirmed the adsorption of tartaric acid on glycine crystal surface. In addition, filtration characteristics of the crystals were investigated and the specific cake resistance increased significantly in the presence of the additive. From the experimental results, it is possible to conclude that tartaric acid addition to crystallization media has created significant variations in the glycine characteristics especially in terms of morphology. Keywords: polymorphic phase transformation, crystallization, glycine, tartaric acid. 1. INTRODUCTION Glycine is the simplest amino acid found in the protein of all living organisms. Structurally, glycine exhibits in three different polymorphic forms at ambient conditionsμ α, ί and γ (Srinivasan 2008). Polymorphs can exhibit different mechanical, thermal, and physical properties, such as compressibility, melting point, solubility, and crystal habit, which can have a great influence on the bioavailability, filtration, and tableting processes of pharmaceutical, food, and specialty materials (Liu et., al 2008). Therefore, it is important to make sure that the desired polymorph is consistently obtained since problems can arise when a transformation between two forms occurs during the production process (Ferrari et., al 2003). In literature, several studies have shown that the phase transformation process and the physical properties of the product can be changed with the presence of the additives in crystallization media (Yang et., al 2008). There are several types of additives such as amino acids, carboxylic acids, metal ions but there is no study examined the influence of tartaric acid, a type of carboxylic acid, phase transformation process of glycine. Therefore, in this study, tartaric acid was chosen as the additive and its effects on glycine transformation of  to α form were investigated. 2. MATERIALS AND METHODS All chemicals used were of analytical reagent grade and α-glycine, tartaric acid and ethanol were provided from Merck Company. The phase transformation experiments were performed in a double jacketed glass crystallizer with 2L capacity. The inside temperature of the crystallizer was kept constant at 25 C by means of a thermostat. Phase transformation process was continuously followed by an ultrasonic speed measurement system that was placed at the crystallizer base and can do inline measurement. The stirring velocity was 75 rpm and the stirring was done by a mechanic stirrer including a paddle type stirring element. At the beginning of the experiment, saturated α-glycine solution was prepared with triple distilled water at 25 C and it was put in the crystallizer. After the solution reached to the thermal equilibrium, ethanol, which was ORAL PRESENTATION 7 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org cooled off to 5 C, was added to the crystallizer at once. With sudden addition of ethanol, -glycine crystals were appeared and then slowly transformed into the α-form. This transformation process was monitored by the ultrasonic probe. After the completion of the phase transformation, samples characterizing the end products was taken from the crystallizer, filtered and then dried. During the experiments, tartaric acid was used as additive. The same experimental procedure was also applied to the experiments which tartaric acid were used. Tartaric acid was added to the crystallizer alongside with ethanol at 500 ppm concentration. Experiments were repeated at least three times. To characterize the crystals obtained in pure and tartaric acid media, X-ray diffraction (XRD), scanning electron microscopy (SEM), morphology, and Fourier-transform infrared spectroscopy (FTIR) were carried out. In addition, filtration rate measurements were conducted under constant vacuum conditions. The obtained results were evaluated according to Darcy’s Law to detect the filtration characteristics. 3. RESULTS 3.1. Ultrasonic velocity measurements The phase transformation time of glycine was determined by measuring the ultrasonic velocity change with time. Figure 1 shows the ultrasonic velocity change results for both pure and additive media. During the phase transformation process, first -glycine crystals dissolved, then α-glycine nuclei formed and these nucleus formed the α-glycine crystal by growing. 1487 Sonic velocity (m/s) 1485 1483 1481 1479 1477 1475 Pure media Additive media 1473 0 10 20 30 40 Time (min) 50 60 70 Figure 1. Change of ultrasonic velocity with time in pure media and in the presence of tartaric acid As it can be seen in Figure 1, the transformation process was completed in 45 minutes for pure media. With the addition of tartaric acid to crystallization media, the transformation process was slowed down and this duration was found to be 63 minutes. From the results, it is noticeable that tartaric acid drastically affected the transformation time and it had a retardant effect on the phase transformation process. 3.2. XRD analysis To identify the structure of crystals formed during the phase transformation process, XRD analysis was conducted for the crystals obtained in pure media and media containing 500 ppm tartaric acid. X-Ray diffraction patterns of the crystals are provided in Figure 2. ORAL PRESENTATION 8 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 2. XRD results of the crystals obtained in pure media and in the presence of tartaric acid X-ray diffraction patterns of the crystals obtained in additive and non-additive media were compared to reference card. As can be seen in the Figure 2, the crystals formed with the completion of the transformation process were in α formν and did not contain crystals with  form. Compared to pure media, there was an increase observed in the intensity of XRD peaks for the crystals obtained in the existence of tartaric acid. This situation may be resulting from the change in the crystal lattice strains due to tartaric acid. 3.3. Morphology analysis To determine the influence of tartaric acid on glycine crystal morphology, firstly SEM analysis was performed for the crystals obtained at the completion of the phase transformation. In Figure 3, there are SEM images of αglycine crystals obtained in pure media and media containing 500 ppm tartaric acid media. Glycine crystals obtained in pure media was prismatic shaped and long formed. The average particle size of the crystals was 85 µm. The surface of the crystals was smooth and there was no agglomeration tendency in crystals. On the contrary, the crystals obtained in the presence of tartaric acid lost their rod form and acquired a different morphology. It was also clear that the presence of tartaric acid created significant changes in the width and length of the crystals, especially in length. The obtained crystals had a hexagonal form and had high agglomeration tendency. To get more information about the crystal morphology and to compare the morphological change quantitatively, detailed morphology analysis were conducted for the crystals obtained in both media by using a Malvern Morphologi G3 device. In this context, HS circularity, elongation and aspect ratio of the crystals were determined. While aspect ratio can be defined as width/length value, elongation value is 1 – width/length or 1aspect ratio. The elongation value is between 0 and 1. This value is 0 for a circle while the value is close to 1 for rod-type crystals (Malvern 2010). The elongation value of the crystals obtained in pure media was found as 0.517, HS circularity value was 0.552 and aspect ratio was 0.483. In tartaric acid media, the values of elongation, HS circularity and aspect ratio were are 0.272, 0.784, and 0.728 in order. As it can be clearly seen in these results, tartaric acid significantly affected glycine morphology, and caused the formation of shorter, more rounded and more compact crystals. ORAL PRESENTATION 9 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org (a) (b) Figure 3. SEM images of the crystals obtained in pure media (a) and in the presence of additive (b) 3.4. FTIR analysis The FTIR spectra of the crystals obtained in pure media and in the presence of the tartaric acid media were collected for the qualitative determination of their functional groups. Figure 4 shows the FTIR spectra of the crystals in the range of 650-4000 cm-1. 100 Transmittance (%) 95 90 85 80 Pure media Additive media 75 70 650 1150 1650 2150 2650 Wavenumber (cm-1) 3150 3650 Figure 4. FTIR spectra of the crystals obtained in pure media and in the presence of additive The 3300-2200 cm-1 was associated with NH stretching vibrations. The peak at 15λλ and 1406 cm−1 were assigned to the asymmetric and symmetric stretching vibration of the COO- group, respectively. The bands at 8λ1 and 6λγ cm−1 denoted the presence of bending vibration of C-C symmetric stretching and O-C=O bending vibrations, respectively (Polat et al., 2017). On the other hand, new functional group were detected on the surface of glycine crystals obtained in the presence of tartaric acid. It was observed that the absorbance band had peak at around 1700 cm-1 indicating the presence of C=O stretching vibrations of the carboxylic acid group in tartaric acid. Thus the presence of characteristic band showed the tartaric acid adsorbed on the crystal surface. 3.5. Filtration analysis In this study, phase transformation process of glycine was investigated in non-additive and additive media. XRD determine the impact of tartaric acid on filtration characteristics of glycine crystals, filtration rate measurements of the crystals obtained in the pure media and media consisting 500 ppm tartaric acid were carried out in ORAL PRESENTATION 10 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org standard filtration test unit under 700 mbar constant pressure. The specific cake resistance and average cake porosity values were calculated according to Darcy’s law (Rushton et al., 2000). While specific cake resistance and average cake porosity values of the crystals obtained in pure media was 1.0λ5×1011 m/kg and 0.421, these values were determined to be 1.48×1011 m/kg and 0.421 and 0.0412 Hence, with the addition of tartaric acid into the media, filtration became harder due to intense agglomeration tendency, and in relation to this, specific cake resistance increased as well. 4. CONCLUSION In this study, phase transformation process of glycine was investigated in non-additive and additive media. Experiments performed in the tartaric acid media resulted in change in phase transformation time. XRD, SEM, morphology and FTIR analysis were successfully used to characterize the crystals obtained. The characterization results showed that the presence of additive in crystallization media caused to morphological change. Prismatic shaped crystals obtained in pure media transformed into the hexagonal form with more rounded, shorter and more compact crystals. In addition to SEM analysis, the detailed morphology analysis provided better information about the morphological changes especially in terms of quantitative identification. The morphology analysis results showed that the elongation value of the crystals in the presence of tartaric acid was smaller approximately 50 % than that of in pure media. The morphological change drastically affected the filtration characteristics of the crystals. In conclusion, the present investigation showed that tartaric acid can be effectively used as a retarder for the transformation of glycine  into α form. ACKNOWLEDGEMENTS This work was supported by Marmara University Scientific Research Projects Commission under the funding FEN-C-DRP-131216-0547. REFERENCES Ferrari ES, Davey RJ, Cross WI, Gillon AL, Towler CS 2003. Crystallization in Polymorphic Systems: The Solution-Mediated Transformation of ί to α Glycine. Crystal Growth & Design, 3: 53-60. Liu Z, Zhong L, Ying P, Feng Z, Li C 2008. Crystallization of metastable ί glycine from gas phase via the sublimation of α or γ form in vacuum. Biophysical Chemistry, 1γβμ 18-22. Morphologi G3 User Manual, Malvern Instruments Ltd., United Kingdom 2010. Polat S, Sayan P 2017. Kinetic analysis and polymorphic phase transformation of glycine in the presence of lauric acid. Journal of Crystal Growth, 481: 71-79. Rushton A, Ward AS, Holdich RG, 2000. Solid-Liquid Filtration and Separation Technology, second ed., WileyVCH Verlag GmbH, Weinheim, Germany. Srinivasan K 2008. Crystal growth of α and γ glycine polymorphs and their polymorphic phase transformations. Journal of Crystal Growth, 311: 156-162. Yang X, Lu J, Wang XJ, Ching CB 2008. Effect of sodium chloride on the nucleation and polymorphic transformation of glycine. Journal of Crystal Growth, 310: 604-611. ORAL PRESENTATION 11 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Bor Mineral ve Bileşiklerinin Sarıçam (Pinus sylvestris L.) Tohumlarının Çimlenmesine Etkisi Handan Ucun Özel1, Mehmet Akif Barış1, Halil Barış Özel2* 1 Bartın Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Bartın, TÜRKİYE *2 Bartın Üniversitesi, Orman Fakültesi, Orman Mühendisliği Bölümü, Bartın, TÜRKİYE Sorumlu yazar e-mail: halilbarisozel@gmail.com Özet Bu çalışmada, bor mineralinin sarıçam tohumlarının çimlenme yüzdesi ve çimlenme gücü üzerindeki etkileri incelenmiştir. Bu amaçla değişik konsantrasyon düzeylerinde sıvı bor kullanılarak oluşturulan çimlenme ortamları Eskişehir-Çatacık orijinli sarıçam (Pinus sylvestris L.)tohumlarına uygulanmıştır. Yapılan deneylerde sıvı bor maddesinin konsantrasyonlarına bağlı olarak tohumların çimlenme yüzdesini %γ8.5-100 arasında düşürdüğü ve çimlenme sürecini negatif yönde etkilediği belirlenmiştir. Bu durumun özellikle tohumların çimlenmesi sırasında endosprem ve embriyoda meydana gelen sıvı alış verişinden kaynaklanan fizyolojik bozukluklar sonucunda ortaya çıktığı düşünülmektedir. Anahtar Kelimeler: Bor, sarıçam, tohum, çimlenme. 1. GİRİŞ Bor, yeryüzünde yüzden fazla minerali bulunan, değişik amaçlarla kullanılan çok sayıda kimyasal bileşiği olan bir elementtir. Bor kristali, elmastan sonra elementlerin en sertidir. Bor, bitkilerin gelişmesi için gerekli bir elementtir. Fakat suda fazla bulunması halinde bitki gelişmesi için zararlı olur hatta bitkiyi öldürür. Bor, canlıların hayatında eksikliği ya da fazlalığıyla önemli rol oynayan bir elementtir. Örneğin, eksikliği durumunda bitkilerde yetişme sorunları yaşanırken, fazlalığı durumunda doğrudan bitkisel hayata zararlı bir elementtir. Topraklarda ve sularda aşırı bor birikimi bitkilerin kök ve yeşil aksam büyümesini engelleyen ve tane verimini ciddi bir şekilde sınırlayan bir mikro element problemidir. Birçok sanayi sektöründe bor kullanılması (zirai ilaçlama, tıp, plastik ve cam sanayi vb. ), borun rafinasyonu sonucu oluşan fazla bor , bilinçsiz gübreleme vb. problemler yüksek miktarda borun toksisitesiyle karşı karşıya bırakmıştır. Aynı zamanda bor mikro elementine borca fakir olan yerlerde ihtiyaç duyulması ile bor fazlalığının buralarda değerlendirilmesi borun geri kazanımı yönünden önem teşkil etmektedir (Yenialaca, 2009). Bor bitkileri geliştirmek için kullanıldığı gibi gelişimi önlemek için de kullanılabilir. Yabani ot kontrolünde ve toprak sterilizasyonunda, yanmayı geciktirici özelliği ile otoyollar ve demiryolları kenarlarındaki alanlar, petrol rafinerileri ve kereste depolan gibi alanlarda bitkileri tamamen yok etmede kullanılır (Kalafatoğlu ve ark., 1997; Uygan ve Çetin, β004). İçme sulan için, farklı bor sınır değerleri verilmektedir. 1λ68'de Su Kalite Kriterleri Komitesi (Committee on Water Quality Criteria) izin verilen sının 1 mg/l olarak belirlemiştir. 1λ71'de İçme Suları Teknik Komitesinin (Drinking Water Standarts Technical Review Committee) incelemeleri sonucunda l mg/1 sınırını gerektirecek kanıt olmadığını, insan sağlığı yönünde 0,γ mg/' nin güvenilir bir sımr olduğuna karar vermiştir (Kalafatoğlu ve ark., 1λλ7). Ülkemizde ise, Su Kirliliği Kontrol Yönetmeliği 'nde doğrudan içme suyu olarak kullanılabilecek I. sınıf su kalite sınıfına giren suda bor için izin verilen sınır değer 1 mg/L'dir. 1λλ7'de resmi gazetede ise içme suyu sınır değeri γ mg/1 olarak verilmiştir (Uygan ve Çetin, β004). Her bitkinin bor gereksinmesi farklıdır. Tek çenekliler çift çeneklilerden daha az B'a gereksinme gösterirler. Süt özsuyu sistemine sahip bitkiler ise özellikle B'a büyük ölçüde gereksinme duyarlar. Örneğin, bor eksikliği olan topraklarda, buğdayda yapılan bir çalışmada 4 kg B/ha bor uygulaması ile verim önemli oranda artmıştır. Daha yüksek bor uygulamalarında ise verimde azalma görülmüştür (Güneş ve ark., 2000; Uygan ve Çetin, β004) 2. MATERYAL VE METOD 2.1 Materyal Bu araştırma kapsamında gerçekleştirilen ve farklı sıvı bor maddesi olarak kullanılan çimlenme ortamlarının hazırlanmasında yararlanılan bor hammaddesi Eskişehir Bor Enstitüsünden araştırma amaçlı olarak temin ORAL PRESENTATION 12 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org edilmiştir. Bu amaçla sızdırmaz kap ve kutularda 1,5 l olarak gelen dinlendirilmiş ve tamamen atıklarından arındırılmış sıvı bor hammaddesi doğrudan doğruya çimlenme ortamlarının hazırlanmasında ortam ana maddesi olarak kullanılmıştır. Araştırmanın materyal kısmını oluşturan ikinci ana faktör ise sarıçam (Pinus sylvestris L.) tohumlarıdır. Araştırmada kullanılan sarıçam tohumları Eskişehir-Çatacık orijinli olup, 11γ0m yükseklikte, kuzeybatı bakılı ve orta yamaçta bulunan tohum meşceresinden β015 yılı Eylül-Kasım ayları arasında özel bir ekipman yardımıyla toplanmış ve Bartın Üniversitesi Orman Fakültesi, Silvikültür Anabilim Dalı tohum koleksiyonuna dahil edilmiştir 2.2 Metod Araştırmamızda sarıçam tohum meşceresinden alınan tohumlar üzerinde bor minerali kullanılarak çimlendirme testlerine tabi tutulmuştur. Bu doğrultuda sıvı bor için %10, %γ0, %50 ve %70 düzeylerinde çözeltiler hazırlanmıştır. Hazırlanan bu çözeltilerde oluşan parametreleri karşılaştırmak için bor olmayan kontrol örneği hazırlanmıştır. Her bir bor çözeltisi için γ tekerrürlü çözeltiler hazırlanmıştır. Hazırlanan bu tekerrürler için γ00 adet tohum kullanılmıştır. Her bir bor çözeltisi için λ00 adet tohum ile testler gerçekleştirilmiştir. Araştırmada yapılan çimlendirme testlerinde kullanılan tohum sayılarının γ00 adet olması orijinler üzerinde yapılan ölçümlerin daha sağlıklı olması için yeterlidir (Genç, β007). Bu araştırmada, sıvı ve dehidre olmuş 4 farklı konsantrasyon düzeyinin (%10, %γ0, %50, %70, %100 ve kontrol) sarıçam tohumlarının çimlenmesi üzerindeki etkileri incelenmiştir (Şekil 1). Şekil 1. Sıvı bor ile çimlenme ortamlarının hazırlanması, tohumlara aplikasyonu ve çimlendirme dolabına örneklerin yerleştirilmesi. Araştırmada farklı bor minerali için hazırlanan değişik oranlardaki (%10, %γ0, %50, %70, %100 ve kontrol) çözeltilerin sarıçam tohumlarının ortalama çimlenme yüzdesi üzerindeki etkilerini belirleyebilmek için hazırlanan tohum örnekleri çimlendirme dolabında çimlendirme testlerine tabi tutulmuştur. Bu kapsamda borun her bir çözelti seviyesi için γ replikasyonlu olarak hazırlanan sarıçam tohum örnekleri plastik petri kaplarda, filtre kâğıdı üzerinde β0ºC sıcaklıkta ve %70 ışık altında γ0 gün süreyle çimlenme testlerine tabi tutulmuş, Genç (β007) tarafından açıklanan ve aşağıda belirtilen formül kullanılarak ortalama çimlenme yüzdesi ve çimlenme gücü parametreleri hesaplanmıştır. MGP (%) = ORAL PRESENTATION (1) 13 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org MGP (%): Çimlenme yüzdesi, ni: gündeki çimlenen tohum sayısı, N: Teste tabi tutulan toplam tohum sayısını göstermektedir. Araştırmada genel bor mineraline ait farklı konsantrasyonlarının belirlenmesinde öncelikli olarak SPSS programında verilerin normal dağılım gösterip göstermediğini belirlemek için Kolmogorov-Simirnov testi uygulanmıştır. Daha sonra elde edilen ölçüm ve çimlendirme testlerinden P<0,05 güven düzeyinde elde edilen ham veri setlerine tek yönlü varyans analizi uygulanmıştır. Varyans analizi sonucunda ortaya çıkan istatistiki farklılıkların gruplandırılmasında P<0,05 güven düzeyinde Duncan testi uygulanmıştır. Ayrıca morfolojik özellikler arasındaki ilişkileri bir arada inceleme amacıyla çoklu kolerasyon analizi uygulanmıştır. 3. SONUÇ VE TARTIŞMA Sıvı bor ile farklı konsantrasyonlarda hazırlanan çimlenme ortamlarından 7, 14, β1 ve γ0. Günlerde yapılan çimlenme sayıları ile hesaplanan çimlenme yüzdesine ilişkin sonuçlar Tablo 1’de verilmiştir. Tablo 1. Farklı konsantrasyondaki bor çözeltilerinde ve kontrol numunesinde belirlenen çimlenme yüzdesi değerlerine ait varyans analizi ve Duncan testi sonuçları Mineral Bor Kontrol (% 0) 100a %10 61.5b F=97.56*** %30 %50 11,2b 0,0c %70 0,0c %100 0,0c Çimlenme yüzdelerine Arc. Sin transformasyonu uygulanarak gerçekleştirilen varyans analizi sonucunda P<0,001 güven düzeyinde anlamlı farklılık ortaya çıkmıştır. Bu kapsamda uygulanan Duncan testinin sonuçlarına göre γ farklı grup ortaya çıkmış olup, P<0.05 güven düzeyinde belirlenen bu gruplar arasında en yüksek çimlenme yüzdesi bor mineralinin sıvı olarak uygulanmadığı kontrol grubunda belirlenmiştir (%100). %50 ve %70 konsantrasyon düzeylerinde tohumlarda hiçbir şekilde çimlenme aktivitesi tespit edilmemiştir (Tablo 1). Bu sonuca göre çimlenme ortamında aktif madde olarak kullanılan dehidrasyona uğramış sıvı bor maddesinin tohumların çimlenme yüzdesini %γ8.5-100 arasında düşürdüğü ve çimlenme sürecini negatif yönde etkilediği belirlenmiştir. Bu durumun özellikle tohumların çimlenmesi sırasında endosprem ve embriyoda meydana gelen sıvı alış verişinden kaynaklanan fizyolojik bozukluklar sonucunda ortaya çıktığını söylemek mümkündür. Çünkü kısmen de olsa toksik etkiye sahip olan bor maddesinin embriyoya fiziksel ve anatomik olarak zarar verdiği ve çimlenme reaksiyonlarını tamamen ortada kaldırdığı düşünülmektedir. Nitekim bor konsantrasyonlarında artışa bağlı olarak çimlenme yüzdesinde ortaya çıkan belirgin düşüşler de bu durumu kanıtlar niteliktedir. Nitekim arpa bitkisinde gerçekleştirilen bir araştırmada da bor sıvı olarak çimlenme ortamında kullanılmış ve çimlenme engeline sahip olmayan hatta çimlenme enerjisi çok yüksek olan arpa tohumlarının çimlenme yüzdesinin %45,6-78,7 oranında azaldığı tespit edilmiştir (Ashagre ve ark., 2014). Salatalık bitkisinde yapılan bir başka araştırmada da toz olarak kullanılan hem büyüme hem de çimlenme ortamlarına dahil edilen bor maddesinin gelişmeyi ve çimlenme yüzdesini önemli ölçüde azalttığı ve bunun tamamen borun çimlenme ortamında toksik bir madde olarak davranmasına bağlı olduğu belirlenmiştir (Alparslan ve Güneş, β001). Diğer taraftan günlük çimlenen tohum sayısı üzerinden belirlenen çimlenme gücü grafiği de çalışma kapsamında oluşturulmuştur (Şekil 2). Tablo 1 incelendiğinde aktif madde olarak çimlenme ortamında kullanılan sıvı bor maddesinin sarıçam tohumlarının gücünü önemli ölçüde düşürdüğü tespit edilmiştir. Buna göre yapılan sayım sonuçları üzerinden gerçekleştirilen hesaplamalar sonucunda %10’luk bor konsantrasyonunda dahi %γ8.5’ye varan çimlenme kayıplarının olduğu belirlenmiştir. Buna göre genel olarak sıvı çimlenme ortamının sarıçam tohumlarının çimlenme gücü ve çimlenme yüzdesi üzerinde olumsuz etkiler meydana getirdiği saptanmıştır. Bu konuda yapılan bir araştırmada domates tohumlarına ilişkin deneyde kullanılan bor sıvı maddesinin çimlenme gücü ORAL PRESENTATION 14 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org indeks değerini %45,6 oranında azalttığı saptanmıştır (Shaikh ve ark., β01γ). Yine bor ve çimlenme gücü indeks değeri ile ilişkili olarak gerçekleştirilen bir diğer araştırmada da buğday bitkisinde yapılmış olup, çimlenme ortamında bulunan bor maddesindeki %β,5’lik artışın dahi çimlenme endeks değerini %γ5,7 oranında azalttığı tespit edilmiştir (Ashagre ve ark., β014). Diğer taraftan çimlenme prosesi üzerindeki etkileri yönünden Kinfemichael (β011) tarafından gerçekleştirilen bildirime göre, borun çimlenme ortamında yaklaşık %4’lük eşik değerinden sonra tohum fizyolojisinde önemli tahribatlar yaptığı ve çimlenme ile ilgili tüm parametreleri düşürdüğü bildirilmektedir. KONTROL %10'LUK BOR KONSANTRASYONU 140 Çimle me gü ü i deks değeri 120 100 80 60 40 20 0 1 -20 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Çimle me i takip edildiği gü ler Şekil 2. Çimlenme gücü eğrisi 4. ÖNERİLER En yüksek çimlenme yüzdesi bor mineralinin sıvı olarak uygulanmadığı kontrol grubunda belirlenmiştir (%100). %50 ve %70 konsantrasyon düzeylerinde tohumlarda hiçbir şekilde çimlenme aktivitesi tespit edilmemiştir (Tablo 1). Bu sonuca göre çimlenme ortamında aktif madde olarak kullanılan dehidrasyona uğramış sıvı bor maddesinin tohumların çimlenme yüzdesini %γ8.5-100 arasında düşürdüğü ve çimlenme sürecini negatif yönde etkilediği belirlenmiştir. Bu durumun özellikle tohumların çimlenmesi sırasında endosprem ve embriyoda meydana gelen sıvı alış verişinden kaynaklanan fizyolojik bozukluklar sonucunda ortaya çıktığını söylemek mümkündür. Çünkü kısmen de olsa toksik etkiye sahip olan bor maddesinin embriyoya fiziksel ve anatomik olarak zarar verdiği ve çimlenme reaksiyonlarını tamamen ortada kaldırdığı düşünülmektedir. Aktif madde olarak çimlenme ortamında kullanılan sıvı bor maddesinin sarıçam tohumlarının gücünü önemli ölçüde düşürdüğü tespit edilmiştir. Buna göre yapılan sayım sonuçları üzerinden gerçekleştirilen hesaplamalar sonucunda %10’luk bor konsantrasyonunda dahi %γ8.5’ye varan çimlenme kayıplarının olduğu belirlenmiştir. Buna göre genel olarak sıvı çimlenme ortamının sarıçam tohumlarının çimlenme gücü ve çimlenme yüzdesi üzerinde olumsuz etkiler meydana getirdiği saptanmıştır (Şekil β). Dolayısıyla tohum çimlenme ortamının bor atıklarıyla kirlenmemiş olması önem arz etmektedir. ORAL PRESENTATION 15 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org TEŞEKKÜR Bu çalışmanın gerçekleştirilmesinde bizden yardımlarını esirgemeyen sayın Dr. Mustafa BARIŞ’a ve bor hammaddesinin temini konusunda destek veren Eskişehir Bor Enstitüsüne teşekkür ederiz. KAYNAKLAR Alpaslan, M., Güneş, A. β001. Interactive effects of boron and salinity stress on the growth, membrane permeability and mineral composition of tomato and cucumber plants. Plant and Soil 236:123-128 Ashagre, H., Hamza, I.A., Fita, U., Nedesa, W. 2014. Influence of boron on seed germination and seedling growth of wheat (Triticum aestivum L.), African Journal of Plant Science, 8(2): 133-139. Genç, M. β007. Fidan standardizasyonu, Süleyman Demirel Üniversitesi, Orman Fakültesi, Yayın Noμ75, 55γ pp. Güneş, A., Alpaslan, M., Özcan, H., Çıkılı, Y. β000. Türkiye’de Yaygın Olarak Yetiştirilen Mısır (Zea mays L.) Çeşitlerinin Bor Toksitesine Duyarlılıkları. Turkish Agricultural and Foresty. β4μ β77-β8β. TÜBİTAK. Ankara. Kalafatoğlu, E., Ors, N, Sain, S., Yüzer, H., Erbil, AÇ., 1λλ7. Bor Bileşikleri İçeren Atık Suların Arıtılması. TUBITAK Marmara Araştırma Merkezi, 1-9. Gebze- Kocaeli. Kinfemichael, GA. 2011. The response of some haricot bean (Phaseolus vulgaris) varieties for salt stress during germination and seedling stage. Cur. Res. J. Biol. Sci. 3(4):282-288. Shaikh IRS, Rafique AS, Shaikh AA 2013. Phytotoxic effects of heavy metals Parveen Rajjak (Cr, Cd, Mn and Zn) on Wheat (Triticum aestivum L.) seed germination and seedlings growth in black cotton soil of Nanded. India. Res. J. Chem. Sci. 3(6):14-23 Uygan, D., Çetin, Ö., β004. Borun tarımsal ve çevresel etkileri Seydisuyu Su Toplama Havzası, II.Uluslararası Bor Sempozyumu. 23-β5 Eylül. Maden Mühendisleri Odası Yayınları, Ankara. Yenialaca, Ç. β00λ. Bor ve Kullanım Alanları. Gazi Üniversitesi, Fen Bilimleri Enstitüsü, Ortaöğretim Fen ve Matematik Alanları Eğitim Anabilim Dalı Yüksek Lisans Tezi, Ankara, 35pp. ORAL PRESENTATION 16 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org İnsan Astrositoma Hücre Hatlarında HIV-1 Tat Geninin BDNF ve c-fos Ekspresyonu Üzerine Etkisinin Araştırılması Selçuk Özdemir Atatürk Üniversitesi, Veteriner Fakültesi, Genetik Anabilim Dalı, Erzurum, Türkiye Sorumlu yazar e-mail: selcuk.ozdemir@atauni.edu.tr Özet Bu çalışmanın amacı, HIV-1 tat geni ile transfekte olmuş insan astrositoma hücrelerinde ((U373.MG) BDNF ve c-fos gen ekspresyon farklılıklarını qRT-PCR yöntemiyle belirlemektir. Bu amaç için, öncelikle hücreler HIV-1 Tat geni ile transfekte edildi. Daha sonra bu hücrelerden total RNA izolasyonu yapılarak cDNA elde edildi. Son olarak qRT-PCR ile HIV-1 Tat, BDNF ve c-fos genlerine ait mRNA transkript seviyeleri belirlendi. HIV-1 Tat genin transfekte edildiği hücrelerde tat geninin, kontrol gruplarına göre yüksek oranda eksprese edildiği gözlendi (p<0.001). BDNF ekspresyonunun ise HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol gruplarına göre istatistiksel olarak önemli derece de arttığı görüldü (p<0.01). Son olarak c-fos ekspresyonunun BDNF’ye benzer şekilde HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol grubuna göre arttığı, ancak BDNF’ye göre bu artışın daha az olduğu belirlendi (p<0.05). Sonuç olarak, HIV-1 Tat geninin insan Astrositoma hücrelerine transfeksiyonu sonucu artan Tat ekspresyonu, BDNF ve c-fos genlerine mRNA transkript seviyelerinin artışına neden olmaktadır. Bu sonuç, bize HIV-1 Tat geninin beyin hücrelerinde nörotoksik bir etki oluşturduğunu göstermektedir. Ayrıca BDNF ve c-fos ekspresyonunun artması astrositlerin HIV-1 Tat nedeniyle strese maruz kaldığını doğrulamaktadır. Anahtar Kelimeler: HIV-1 Tat; BDNF; c-fosν Astrositoma hücreleriν qRT-PCR. 1. GİRİŞ İnsan immün yetmezlik virüsü tip 1 (HIV-1), enfeksiyonun akut fazı sırasında merkezi sinir sistemine (MSS) girer ve viral proteinlerin üretilmesine, mikroglia / makrofajların aktivasyonuna ve nöronların yaralanmasına neden olur (Valcour ve ark., β01βν Atluri ve ark., β015). Antiretroviral kombinasyon tedavisinden önce, MSS'in HIV-1 enfeksiyonu, enfekte kişilerin % 15'in de rastlandığı rapor edilmiştir (Hult ve ark., β008). Aktif HIV replikasyonunun bastırılmasında antiretroviral kombinasyon tedavisinin başarısı, HIV-1'e bağlı bunama vakalarında % β düşüş ile belirgin olduğu gibi, nörobilişsel bozuklukların şiddetini önemli ölçüde azalttığı gösterilmiştir (Ghafouri ve ark., β008). Buna ek olarak, HIV ile ilişkili nörobilişsel bozukluklarının daha hafif bir biçimi, HIV ile enfekte kişilerin % 50'sinde saptanmaktadır (Bell ve ark., β006). Tat, HIV-1 transkripsiyonu ve replikasyonu için vazgeçilmezdir (Kingsman, 1λλ6). Tat, aynı zamanda nörobilişsel bozukluklar için önemlidir çünkü güçlü bir nörotoksindir ve hem in vitro hem de in vivo olarak nöronlarda doğrudan akut hasara neden olur (Li ve ark., β00λν Kim ve ark., β00γ). Astrositlerin HIV-1 enfeksiyonu, HIV-1 erken gen ürünlerini olan Tat, Nef ve Rev proteinlerinin yüksek oranda ekspresyonuna yol açar (Gorry ve ark., β00γν Messam ve Major, β000). Tat önemli bir özelliğe sahiptir, diğer bir deyişle bir hücreden salınır ve diğer hücre tarafından alınır (Ma ve Nath, 1λλ7). Bu bulgularla uyumlu olarak, Tat, HIV ile enfekte olmuş bireylerin MSS'lerinde bulunur ve HIV-1 tarafından latent olarak enfekte olmuş astrositler tarafından eksprese edilir (Hudson ve ark., β000ν Chauhan ve ark., β00γ). Bunlara ek olarak, Tat, sitokin ifadesi, eksitatör özellikler, hücre içi işaretleme, otofaji yoluyla nöronun sağkalımını (survival) olumsuz yönde etkiler (Eugenin ve ark., 2007). Beyin türevi nörotrofik faktör (BDNF), nörotrofin ailesine ait bir proteindir (Chao, β00γ). BDNF, nöronal sağkalım (survival), büyüme, farklılaşma ve sinaptik esneklik (Huang ve Reichardt, β001), nöronal göç (Carter ve ark., β00γ), miyelinasyon (Cosgaya ve ark., β00β) ve nöronal apoptozda önemli rol oynamaktadır (Bamji ve ark. , 1λλ8ν Boyd ve Gordon, β00β). Dahası BDNF, bellek, öğrenme süreçlerini (Yamada ve ark., 2002) ve nörodejeneratif hastalıklarının modülasyonu için önemlidir (Fumagalli ve ark., β006ν Peng ve ark., β00λν Zhang ve ark., 2012). c-fos bir protoonkojendir ve bir nörotransmitterin uyarılmasıyla (Greenberg ve diğerleri, 1λ86) ORAL PRESENTATION 17 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org aktive edilebilir, dolayısıyla erken erken cevap geni olarak adlandırılır. c-Fos, zararlı uyarı ve doku hasarından sonra nöronal aktivasyon için belirteç olarak kullanılabilir (Gao ve Ji, β00λ). Daha önce yapılan çalışamalra bakıldığında HIV-1 tat geninin insan astrositoma hücrelerindeki yüksek ifadesinin, BDNF ve c-fos gen expresyon profili üzerine olan etkisiyle ilişkili çok az bilgi bulunmaktadır. Bu çalışmanın amacı, HIV-1 tat geniyle transfekte olmuş insan astrositoma hücrelerinde BDNF ve c-fos gen ekspresyon farklılıklarını qRT-PCR yöntemiyle belirlemektir. 2. MATERYAL VE METOD 2.1. Hücre Kültürü İnsan astrositoma hücresi (Uγ7γ.MG) Amerikan Tipi Kültür Koleksiyonundan (ATCC, Manassas, VA) satın alındı. Hücreler % 10 fetal sığır serumu ile takviye edilmiş (FBS) Dulbecco'nun modifiye Eagle’s (DMEM), 50 U / ml penisilin ve 50 ug / ml streptomisin ortamı içerisinde γ7 ° C ve % 5 CO 2 ayarlanmış inkübatör de çoğaltıldı. 2.2. Plazmit ve Tranfeksiyon Bu çalışmada 4 adet plazmit kullanıldı. Bu plazmitler, pTZ57R/T, pJET1.2/blunt (Fermentas), pBudCE4.1 (Invitrogen), pBudCE4.1-Tat (Şengez, β011ν Özdemir, β016). pBudCE4.1 ve pBudCE4.1-Tat plazmitleri insan astrositoma hücrelerine Lipofectamine β000 (Invitrogen, Carlsbad, CA) kullanılarak transfekte edildi. 2.3. Total RNA İzolasyonu Transfeksiyon işleminden sonra insan astrositoma hücrelerinden, Trizol (Invitrogen, USA) kullanılarak total RNA izolasyonu yapıldı. Total RNA izolasyonu kitin prosedürüne uygun olarak yapıldı. Total RNA izolasyonunda sonra RNA konsantrasyonu NanoDrop (Epoch Microplate Spectrophotometer, USA) ile ölçüldü. Total RNA kalitesini kontrol etmek amacıyla RNA’lar %1.5’lik agaroz jel de 1XTBE solüsyonu içerisinde 80 voltta bir saat yürütüldü ve jel görüntüleme sistemi ile görüntülenerek RNA kalitesi belirlendi. 2.4. DNaz I uygulaması ve cDNA çevrimi İzole edilen RNA örneklerinde DNA kontaminasyonuna karşı DNaz I (Thermo Scientific, USA) kullanıldı. Dnaz I uygulaması kitte verilen protokole uygun olarak yapıldı. Daha sonra bu RNA’lardan 1 µg alındı ve miScript Reverse Transcription Kiti (Qiagen, Germany) verilen protokole uygun şekilde kullanılarak cDNA sentezlendi. Elde edilen cDNA’nın saflığı ve miktarı spektrofotometrede (Epoch Microplate Spectrophotometer, USA) yapılan β60-β80 nm absobans ölçümleri ile belirlendi ve cDNA’lar aynı oranlarda sulandırıldı. Daha sonra cDNA örnekleri Real Time PCR çalışmalarında kullanılmak üzere -β0 °C de muhafaza edildi. 2.5. Real time PCR HIV-1 Tat, BDNF ve c-fos genlerinin mRNA transkript seviyelerini ölçmek amacıyla CFXλ6 BioRad marka cihaz kullanılarak qRT-PCR yapıldı. İnternal kontrol olarak GAPDH geni kullanıldı. Real time PCR deneylerinde oluşturulan master mix içeriğiν Syber Green βX Rox Dye Master mix (Qiageni Germany), genler için tasarlanmış forward ve reverse primerler, template olarak cDNA’lar ve nükleaz free su. Master mixler hazırlandıktan sonra örnekler Real Time cihazında analiz edildi ve elde edilen Ct değeleri β -DeltaDeltaCt metoduna uygun olarak hesaplanarak ilgili genlerin ekspresyon seviyeleri belirlendi (Livak ve Schmittgen, 2001). Genlerin reaksiyon koşulları ve primer dizileri Çizelge 1’de gösterilmiştir. 2.6. İstatistiksel Analiz İstatistiksel analizlerde IBM SPSS β0 programı kullanılmıştır. HIV-1 Tat, BDNF ve c-fos genlerinin mRNA transkript seviyelerinin istatistiksel farkları Tek Yönlü Varyans Analizi (ANOVA) kullanılarak saptandı. Göreceli mRNA ekspresyon grafikleri, Graph pad prism software Inc., (Version 7.0, California, ABD) kullanılarak oluşturuldu. qRT-PCR sonuçları, ortalama ± SEM (ortalamanın standart hatası) olarak ifade edilmiştir. İstatistiksel olarak anlamlı farklar p <0.05, p <0.01 ve p <0.001 arasında anlamlı kabul edildi. ORAL PRESENTATION 18 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tablo 1. Kullanılan primerlerin dizilimleri ve reaksiyon koşulları. Primer Diziler (5’-3’) GAPDH F: TCGACAGTCAGCCGCATCTTCTTT R: ACCAAATCCGTTGACTCCGACCTT F: AGA TCC TAG ACT AGA GCC CTG GAA R: CAA ACT TGG CAA TGA AAG CAA CAC F: CCTGGTGGAACTTCTTTGCGG R: GAAAGCGAGCCCCAGTTTGG HIV-1 Tat BDNF F: CAAGCGGAGACAGACCAACT R: AGTCAGATCAAGGGAAGCCA c-fos Bağlanma sıcaklığı 0C 57 57 57 57 Reaksiyon Koşulları Kaynak λ4°C 15 s / 57°C γ0 s / 7β°C γ0 s (40 cycles) λ4°C 15 s / 57°C γ0 s / 7β°C γ0 s (40 cycles) λ4°C 15 s / 57°C γ0 s / 7β°C γ0 s (40 cycles) Donnio ve ark., 2017 λ4°C 15 s / 57°C γ0 s / 7β°C γ0 s (40 cycles) Donnio ve ark., 2017 Şengez, β011 Rahimian ve He, 2016 3. SONUÇ 3.1. Transkripsiyonel Analiz HIV- Tat geniyle transfekte olmuş insan astrositoma hücrelerinde HIV-1 Tat, BDNF ve c-fos genlerine ait mRNA transkript seviyeleri qRT-PCR ile belirlendi. qRT-PCR ile ilgili parametreler Tablo β’de verildi. HIV-1 Tat genin transfekte edildiği hücrelerde tat geninin, kontrol gruplarına göre (tat içermeyen plasmit ile transfeksiyon yapılmış ve trasfeksiyon yapılmamış hücreler) yüksek oranda eksprese edildiği gözlemlenmiştir p<0.001) (Şekil 1A). BDNF ekspresyonunun ise HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol gruplarına göre istatistiksel olarak önemli derece de arttığı görüldü (p<0.01) (Şekil 1B). Son olarak c-fos ekspresyonunun BDNF’ye benzer şekilde HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol grubuna göre arttığı, ancak BDNF’ye göre bu artışın daha az olduğu belirlendi (p<0.05) (Şekil 1C). Tablo 2. Real-Time RT-PCR ile ilgili parametreler Parametreler Algılama Limiti Quantifikasyon Limiti Quantifikasyon Aralığı PCR Verimliliği HIV-1 Tat 7 ag 400 ag r= 0.996 1.86 BDNF 12 ag 402 ag r=0.997 1.91 c-fos 9 ag 200 ag R=0.994 1.84 Şekil 1. İnsan astrositoma hücrelerindeki HIV-1 Tat, BDNF ve c-fos genlerine ait mRNA transkript seviyeleri. Değerler γ bağımsız örneklemin ortalama ± SD' sini temsil ederν Hata çubukları standart sapmayı gösterir. İstatistiksel anlamlılık (* P <0.05, ** P<0.01, p<0.001) faktöriyel ANOVA ile analiz edildi. A) HIV-1 Tat geninin göreceli mRNA ekspresyon seviyelerini temsil eder. B) BDNF geninin göreceli mRNA ekspresyon seviyelerini temsil eder. C) c-fos geninin göreceli mRNA ekspresyon seviyelerini temsil eder. 4. TARTIŞMA Bu çalışma HIV-1 Tat geniyle transfekte olmuş insan astrositoma hücrelerinde BDNF ve c-fos genlerine ait ekspresyon seviyelerinin ortaya koymaktadır. HIV-1 Tat’ın, beyinde nörotoksik etkilere neden olduğu ORAL PRESENTATION 19 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org bilinmektedir. Ayrıca HIV-1 Tat, dendritik yapılara zarar verir, nöritleri kısaltır ve sinaptik protein seviyelerini azaltır (Hargus ve Thayer, β01γν Kim ve ark., β008). HIV ile enfekte olmuş MSS’deki hücrelerde yaygın olarak ifade edilen bu proteinin salgılanması, sinaptodendritik hasar ile güçlü bir korelasyona sahiptir (Masliah ve ark., 1997; Everall ve ark., 1999). HIV-1 Tat’ın astrositome hücrelerinde BDNF ve c-fos gen ekspresyonu üzerine olan etkisini açıklayan yeterli bilgi bulunmamaktadır. Bu çalışmada HIV-1 Tat geniyle transfekte olmuş hücrelerde yüksek oranda Tat geninin eksprese olduğunu gösterdik. Bu sonuç transfeksiyon işleminin başarılı olduğunu göstermektedir. BDNF’nin neuronal proliferasyon, survival, farklılaşma ve plasticity ile ilişkili olduğu ve ayrıca neuronal aktivitede görev aldığı bilinmektedir (Reichardt, β006ν Theodoridi et al., β017). Beyin korteksi ve hipokampusün gelişmesi süresince BDNF, nöral kök hücrelerinin nöronlara farklılaşmasını tetikler ve yeni nesil nöronların canlılığını teşvik eder. Ayrıca, BDNF stres süresince nöron ölümlerinin önlenmesinde önemli rol oynar ve erişkin beyninde enfeksiyon, toksikasyon, iskemi ve travma gibi stresli olaylar süresince hücre canlılığını destekler (Cheng et al., β00γν Lee et al., β00β). Bu çalışmada HIV-1 Tat geniyle transfekte olmuş hücrelerde BDNF mRNA transkript seviyesinin önemli düzeyde arttığı gözlemlenmiştir. BDNF mRNA transkript seviyesinin artmasının intraselüler kalsiyum konsantrasyonunun artması, endogenous BDNF/TrkB-mediated MAPK ve mTOR yolaklarının aktive olmasıyla ilişkili olabileceği düşünülmektedir. Buna ek olarak, HIV-1 Tat ekspresyonu sonucu neuronal aktivitenin artması astrositoma hücrelerinde BDNF ekspresyonunu arttırabilir. Son olarak, HIV-1 Tat ekspresyonu sırasında hücreler stres sürecine girer ve bu süreçte hücrelerin canlılığını korumak için BDNF ekspresyon seviyesi artabilir. c-fos geni hücrede herhangi bir uyarana karşı ilk yanıt veren genlerdendir. Bu gruba giren genler hücre büyümesi, çoğalması, farklılaşması ve apoptosis ile ilgili transkripsiyon faktörleridir (Roche et al., 1λλλν Schofl et al., 2002). Büyüme faktörleri gibi hücrenin devamlılığını sağlayan faktörler olan Protoonkogenler, mutajenik kimyasal ve viral enfeksiyonların bu genler üzerindeki olumsuz etkileri nedeniyle onkoge dönüşür. Onkogenezisi aktive etmek, hücrelerin kansere dönüşmesine yardımcı olan bazı proteinlere gerek vardır. c-fos, DNA'ya bağlanan nükleer protein ailesinden kaynaklanan kanserojenlerin bir üyesidir (Greenberg ve diğerleri, 1λ86). Bu çalışmada HIV-1 Tat geninin transfekte edildiği hücrelerde c-fos gen expresyonunun arttığı gösterilmiştir. HIV-1 Tat geninin eksprese edildiği hücrelerde c-fos ekspresyon seviyesinin artışı neuronal yolakta rol alan intraselüler cAMP sinyal seviyesinin azalması, alpha-7-nicotinic receptors ve serebral acetylcholinesterase inhbisyonundan dolayı olabilir (Carvajal et al., β007). Ayrıca, protoonkojen olarak bilinen c-fos geninin ekspresyon düzeyindeki artış (Milde-Langosch, 2005), HIV-1 Tat geninin yüksek ekspresyonunun astrositoma hücrelerinin kanserleşmeye doğru gidebileceğini göstermektedir. Sonuç olarak, HIV-1 Tat geninin insan Astrositoma hücrelerine tranfeksiyonu sonucu artan Tat ekspresyonu, BDNF ve c-fos genlerine mRNA transkript seviyelerinin artışına neden olmaktadır. Bu sonuç, bize HIV-1 Tat geninin beyin hücrelerinde gerçekten nörotoksik bir etki oluşturduğunu göstermektedir. Ayrıca BDNF ve c-fos ekspresyonunun artması astrositlerin HIV-1 Tat nedeniyle strese maruz kaldığını doğrulamaktadır. TEŞEKKÜR Bu çalışmanın moleküler kısımları Atatürk Üniversitesi Doğu Anadolu Yüksek Teknoloji Uygulama ve Araştırma Merkezinde (DAYTAM) yapılmıştır. KAYNAKLAR Atluri V, Hidalgo M, Samikkannu T, Kurapati KRV, Jayant RD, Sagar V, Nair M 2015. Effect of HIV infection and its proteins on blood-brain barrier integrity and function: an update. Frontiers in Cellular Neuroscience, 9: 212. Bamji SX, Majdan M, Pozniak CD, Belliveau DJ, Aloyz R, Kohn J, Causing CG, Miller FD 1998. The p75 neurotrophin receptor mediates neuronal apoptosis and is essential for naturally occurring sympathetic neuron death. J Cell Biol, 140: 911-923. Bell JE, Arango JC, Anthony IC. 2006. Neurobiology of multiple insults: HIV-1- associated brain disorders in those who use illicit drugs. J Neuroimmune Pharmacol, 1(2): 182–91. ORAL PRESENTATION 20 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Boyd JG, Gordon T 2002. A dose-dependent facilitation and inhibition of peripheral nerve regeneration by brain-derived neurotrophic factor. Eur J Neurosci, 15: 613-626. Burcu ŞENGEZ β011. Investıgatıon of the Effects of HIV-1 Regulatory Genes on Afrıcan Green Monkey Cell Lines. Izmir Technology of Institute Library, Master Thesis. Carter AR, Berry EM, Segal RA 2003. Regional expression of p75NTR contributes to neurotrophin regulation of cerebellar patterning. Mol Cell Neurosci, 22: 1-13. Carvajal F, Lopez-Grancha M, Navarro M, Sanchez-Amate Mdel C, Cubero I 2007. Long-lasting reductions of ethanol drinking, enhanced ethanol-induced sedation, and decreased c-fos expression in the EdingerWestphal nucleus in Wistar rats exposed to the organophosphate chlorpyrifos. Toxicol Sci, 96: 310-320. Chao MV 2003. Neurotrophins and their receptors: a convergence point for many signalling pathways. Nat Rev Neurosci, 4: 299-309. Chauhan A, Turchan J, Pocernich C, Bruce-Keller A, Roth S, Butterfield DA, Major EO, Nath A 2003. Intracellular human immunodeficiency virus Tat expression in astrocytes promotes astrocyte survival but induces potent neurotoxicity at distant sites via axonal transport. J Biol Chem, 278(15): 13512-9. heng A, Wang S, Cai J, Rao MS, Mattson MP 2003. Nitric oxide acts in a positive feedback loop with BDNF to regulate neural progenitor cell proliferation and differentiation in the mammalian brain. Dev Biol, 258: 319-333. Cosgaya JM, Chan JR, Shooter EM 2002. The neurotrophin receptor p75NTR as a positive modulator of myelination. Science, 298: 1245-1248. Donnio LM, Bidon B, Hashimoto S, May M, Epanchintsev A, Ryan C, Allen W, Hackett A, Gecz J, Skinner C3, Stevenson RE, de Brouwer APM, Coutton C, Francannet C, Jouk PS, Schwartz CE, Egly JM 2017. MED12-related XLID disorders are dose-dependent of immediate early genes (IEGs) expression. Hum Mol Genet, 26(11): 2062-2075. Eugenin E, King J, Nath A, Calderon M, Zukin R, Bennett M, Berman J 2007. HIV-tat induces formation of an LRP–PSD-95– NMDAR–nNOS complex that promotes apoptosis in neurons and astrocytes. Proc Natl Acad Sci U S A, 104: 3438–43. Everall IP, Heaton RK, Marcotte TD, Ellis RJ, McCutchan JA, Atkinson JH, Grant I, Mallory M, Masliah E 1999. Cortical synaptic density is reduced in mild to moderate human immunodeficiency virus neurocognitive disorder. HNRC Group. HIV Neurobehavioral Research Center. Brain Pathol, 9(2): 209–17. Fumagalli F, Racagni G, Riva MA 2006. The expanding role of BDNF: a therapeutic target for Alzheimer's disease? Pharmacogenomics J, 6: 8-15. Gao YJ, Ji RR 2009. c-Fos and pERK, which is a better marker for neuronal activation and central sensitization after noxious stimulation and tissue injury? Open Pain J, 2: 11-17. Ghafouri M, Amini S, Khalili K, Sawaya BE 2006. HIV-1 associated dementia: symptoms and causes. Retrovirology, 3: 28. Gorry PR, Ong C, Thorpe J, Bannwarth S, Thompson KA, Gatignol A, Vesselingh SL, Purcell DF 2003. Astrocyte infection by HIV-1: mechanisms of restricted virus replication, and role in the pathogenesis of HIV-1-associated dementia. Curr HIV Res, 1(4): 463–73. Greenberg ME, Ziff EB, Greene LA 1986. Stimulation of neuronal acetylcholine receptors induces rapid gene transcription. Science, 234: 80-83. Hargus NJ, Thayer SA 2013. Human immunodeficiency virus-1 Tat protein increases the number of inhibitory synapses between hippocampal neurons in culture. J Neurosci Off J Soc Neurosci, 33(45): 17908–20. Huang EJ, Reichardt LF 2001. Neurotrophins: roles in neuronal development and function. Annu Rev Neurosci, 24: 677-736. Hudson L, Liu J, Nath A, Jones M, Raghavan R, Narayan O, Male D, Everall I, 2000. Detection of the human immunodeficiency virus regulatory protein Tat in CNS tissues. J Neurovirology, 6(2): 145–55. Hult B, Chana G, Masliah E, Everall I 2008. Neurobiology of HIV. Int Rev Psychiatry, 20(1): 3–13. Kim BO, Liu Y, Ruan Y, Xu ZC, Schantz L, He JJ.2003. Neuropathologies in transgenic mice expressing human immunodeficiency virus type 1 Tat protein under the regulation of the astrocyte-specific glial fibrillary acidic protein promoter and doxycycline. Am J Pathol, 162(5): 1693–707. Kim HJ, Martemyanov KA, Thayer SA 2008. Human immunodeficiency virus protein Tat induces synapse loss via a reversible process that is distinct from cell death. J Neurosci Off J Soc Neurosci, 28(48): 12604–13. ORAL PRESENTATION 21 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Kingsman SM, Kingsman AJ 1996. The regulation of human immunodeficiency virus type-1 gene expression. European journal of biochemistry/FEBS, 240(3): 491–507. Lee J, Duan W, Mattson MP 2002. Evidence that brain-derived neurotrophic factor is required for basal neurogenesis and mediates, in part, the enhancement of neurogenesis by dietary restriction in the hippocampus of adult mice. J Neurochem, 82: 1367-1375. Li W, Li G, Steiner J, Nath A 2009. Role of Tat protein in HIV neuropathogenesis. Neurotox Res, 16(3): 205– 20. Livak KJ, Schmittgen TD 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and The 2 (-Delta Delta C(T)) Method. Methods, 25: 402–408. Ma M, Nath A 1997. Molecular determinants for cellular uptake of Tat protein of human immunodeficiency virus type 1 in brain cells. J Virol, 71(3): 2495–9. Masliah E, Heaton RK, Marcotte TD, Ellis RJ, Wiley CA, Mallory M, Achim CL, McCutchan JA, Nelson JA, Atkinson JH 1997. Dendritic injury is a pathological substrate for human immunodeficiency virus-related cognitive disorders. HNRC Group. The HIV Neurobehavioral Research Center. Ann Neurol, 42(6): 963– 72. Messam CA, Major EO 2000. Stages of restricted HIV-1 infection in astrocyte cultures derived from human fetal brain tissue. J Neurovirology, 6(1): 90–94. Peng S, Garzon DJ, Marchese M, Klein W, Ginsberg SD, Francis BM, Mount HT, Mufson EJ, Salehi A, Fahnestock M 2009. Decreased brain-derived neurotrophic factor depends on amyloid aggregation state in transgenic mouse models of Alzheimer's disease. J Neurosci, 29: 9321-9329. Rahimian P, He JJ 2016. HIV-1 Tat-shortened neurite outgrowth through regulation of microRNA-132 and its target gene expression. Journal of Neuroinflammation, 13: 247. Roche E, Buteau J, Aniento I, Reig JA, Soria B, Prentki M 1999. Palmitate and oleate induce the immediateearly response genes c-fos and nur-77 in the pancreatic beta-cell line INS-1. Diabetes, 48: 2007-2014. Schofl C, Waring M, Bergwitz C, Arseniev L, von zur Muhlen A, Brabant G 2002. Cyclic-adenosine 3',5'monophosphate-stimulated c-fos gene transcription involves distinct calcium pathways in single betacells. Mol Cell Endocrinol, 186: 121-131. Selçuk ÖZDEMİR β016. Investigation of The Effects of The HIV-1 Tat Gene on The Expression of Secretory Leukocyte Protease Inhibitor in Primate Cell Lines. Izmir Technology of Institute Library. Doctor of Philosophy Thesis. Valcour V, Chalermchai T, Sailasuta N, Marovich M, Lerdlum S, Suttichom D, Suwanwela NC, Jagodzinski L, Michael N, Spudich S 2012. Central nervous system viral invasion and inflammation during acute HIV infection. J Infect Dis, 206(2): 275–82. Yamada K, Mizuno M, Nabeshima T 2002. Role for brain-derived neurotrophic factor in learning and memory. Life Sci, 70: 735-744. Zhang F, Kang Z, Li W, Xiao Z, Zhou X 2012. Roles of brain-derived neurotrophic factor/tropomyosin-related kinase B (BDNF/TrkB) signalling in Alzheimer's disease. J Clin Neurosci, 19: 946-949. ORAL PRESENTATION 22 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The Activity of Aqueous Bananas Peel Extract against the Fungi that Isolated from Milk Samples Israa A. Al-Temimay*, Faiza Kadhim Emran*, Nada Abdulrahman F. Al-Easawi* *University of Baghdad, Collage of Science, Biology Department. Baghdad, Iraq. israaahmed51@yahoo.com, faizakadhim@scbaghdad.edu.iq , indayda@yahoo.com. Abstract Milk and dairy products are a permanent part of our everyday life. Milk and milk products can be affected by fungal spoilage in a variety of ways. In this study fungi were isolated and diagnosis from 15 types of milk were available in local market in Baghdad from several companies and originals, some of them powder and another liquid such as 1) Al-Tazege milk powder 2) Dielac milk for infant 3) KDD milk without flavor 4) Al-Safi milk with cacao 5) Hamoda milk and another types..…. The most isolated fungi were Aspergillus spp., Penicillium spp., Rhizopus spp. and Microsporum spp. With the following percentage: 100% Aspergillus spp., 15.4% Penicillium spp., 15.4% Rhizopus spp. and 7.7% Microsporum spp. from the total milk samples, while fresh cow milk don’t give any fungal growth. Ca ++ and Fe++ elements were estimated in this milk samples to compare this results with the typical amounts. Aqueous extract of fresh yellow bananas peels could be considered as a good antifungal agent against the most frequently isolated fungus Aspergillus fumigatus from milk samples. This result involves replacing the synthetic medicines in treatment of diseases caused by this fungus. Keywords: Milk spoilage, Bananas Peel, Aspergillus fumigatus, fungi in milk. 1. INTRODUCTION Milk and dairy products are a permanent part of our everyday life. Milk and milk products such as butter, cheese, ice cream, milk powder, yoghurt etc. can be affected by fungal spoilage in a variety of ways (Pal, 2014). Presently, over 250,000 fungi are present in our environment. The fungi are ubiquitous in distribution, and are found in the soil, water, and air (Pal, 2007).The fungi which include molds and yeasts are responsible for the spoilage of milk and milk products (Pal and Jadhav, 2013). Molds are filamentous fungi with branching hyphae, multi-cellular, generally aerobic and grow at a pH range of 3 to 8.The spores can tolerate harsh environmental conditions but sensitive to heat treatment. Acremonium, Alternaria, Aspergillus, Cladosporium, Curvularia, Fusarium, Mucor, Penicillium etc., are some of the examples of molds (Pal, 2014). Many types of fungi which include molds and yeasts are isolated from different milk products on mycological media by employing standard techniques. Among these fungi, Aspergillus , Fusarium and Penicillium are important as they produce mycotoxins which can cause serious health hazards among the susceptible individuals. Hence, it is advised that fungal contaminated milk products should not be consumed as it can be potential source of mycotoxicosis in humans (Pal, 2007). Plant extracts derived from their parts (roots, stems, leaves, fruits) are now increas-ingly used in research due to their widespread, immediate availability and cheaper cost, besides having potential medicinal properties and ability to manage certain health conditions which have been growing in recognition. Banana has long been used as a medicinal agent due to its nutritional rich properties. Banana is thought to have antibacterial activity, antioxidant activity and other biological activities such as antidiabetic, antidiarrheic, antitumoral, antimutagenic, antihelminthic and antiulcerogenic (Jalani et al., 2014). The phytochemical components of banana, tannins, eugenol and tyra-mine have been proven to have antibacterial effects. Other active compounds present in banana such as alkaloids, glycosides, flavonoids, saponins, steroids, serotonin and dopamine also contribute to pharmacological effects (Subrata et al., 2011). Moreover, Banana peel contains Vitamin A, Vitamin C, Gallocatechin, dopamine, Vitamin E, Vitamin B6, â- sitosterol, malic acid, succinic Acid, palmatic acid, Magnesium, phosphorus, potassium, fiber, Iron. Fatty acids present in the Banana peel are responsible for their antimicrobial activity (Sumathy and Sumathy, 2011). The study of Chabuck et al., 2013 in Babylon/ Iraq, showed that this the aqueous extract of banana peel give a good inhibition effect against Grampositive bacteria including S. aureus and S. pyogenes with inhibition zone 30 and 18mm respectively, with no effect against C. albicans. ORAL PRESENTATION 23 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The aims of this study: 1. Fungal isolation from many types of milk (powder, liquid) available in local markets in Baghdad/ Iraq. 2. To assess the antifungal capacity of the aqueous extracts of fresh banana peels against different fungal isolates from milk. Banana peel was selected because of its cheap edible source. 2.MATERIALS AND METHODS 2.1 Culture Media In this study Potatose Dextros Agar (PDA) (Himedia/India) was used as culture media to growth and isolated fungi from milk samples. This medium was prepare depending to the manufactory by dissolved 39 g powder of PDA in one liter of D.W. and sterilized by autoclave at 15 psi pressure and 121 C for 15 minute. This medium (with antibiotic Ceftriaxone (5ml/L) Nevakson/Turky) was used for culture purposes to isolated fungi ( Koneman et al,1978; Ali, 2017 ). 2.2 Milk cultured in PDA In this study 15 types of milk (powder and liquid) (Table 1) which were available in local market (fresh milk cow was obtain from the cow directly and put in sterile container) in Baghdad/Iraq were cultured on PDA medium by put 0.5ml milk on this medium (powder milk was solved by D.W. (W/V)) and incubated in to two temperatures β8Cº and γ7Cº to detected of fungal contamination in milk if it found. 2.3 Estimate the elements in milk samples. Sample preparation: 1-The milk samples were put in glass plate and then dried in oven (Memmert/ Germany) with temperature 70Cº for 48h., then grinding and take 1 gm. from dry material in glass baker for making digestion process. 2-Added 5 ml from concentrated nitric acid H 2NO3 (Laboratory reagent/ China) and then leaved for 24 h. with covering the samples by putting glass watch and avoid a boiling of acid. 3- The samples was put on hot plate for 1h., then leave to cooled. 4-Hydrogen peroxide H2O2 (Laboratory reagent/ China) 1.5ml was added gradually with moving on hot plate for 1 hr. to cooled. 5-The samples return to hot plate for digestion complete, cooled and transfer to sterilized bottle with capacity 25 ml after the baker washing by D.W. and filtered, then estimate the elements in ATOMIC ABSORPTION SPECTROPHOTOMETER model 5000 (Apha, 1975). Table (1): The milk samples were cultured on PDA medium, available in local market in Baghdad/Iraq. N Milk samples Origin of company o. 1 Al-Tazege milk powder China 2 Dielac milk for infant UA/ Dubi 3 KDD milk without flavor Kuwait 4 Al-safi milk with cacao Saudi Arabia 5 Milk with banana Aynes Turkey 6 Hamoda milk Jordan 7 Milk with strawberry Anyes Turkey 8 Without flavor milk Anyes Turkey 9 Spiky milk with strawberry Egypt 0 Spiky milk with banana Egypt 1 Spiky milk with cacao Egypt 2 Anchor powdery milk New Zealand 3 Munish powdery milk China 4 Howlera Iraq 5 Fresh milk cow Iraq ORAL PRESENTATION 24 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2.4 Plant collection Fresh bananas were obtained from the local market at Baghdad city, Iraq, 2017. Bananas were washed with running tap water in laboratory, surface sterilized with 70% alcohol, rinsed in sterile distilled water, then peels were taken. Distilled water was boiled, peels were added to the water and left to cool. Later on, these contents were mixed by the blender and filtered to remove large, un homogenized particles to get clear aqueous extract, the extract was kept at 4Cº until to be use (Chabuk el at., 2013). 2.5 Agar well diffusion method This method was used to determine the antifungal activity of aqueous banana peel extract. The solution of aqueous banana peel extract (β5 ,50, 75 ,100) µl, are added in wells by using cork porer to make four grooves well in each one plates then the extract was incubated into the groove and the D.W. was used as control (sheyin et al., 2015). 3.RESULTS AND DISCUSSION 3.1 The isolated Fungi from milk samples In this study different types of Fungi were isolated from different milk samples (15 samples) When the samples were cultured on PDA media such as Rhizopus, Aspergillus spp., Penicilinum spp. Table (2) in this results 5 species of fungi were isolated from Al-Tazege milk powder (Rhizopus, Penicilium, Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus) this type of milk was recorded high percentage of fungi contamination followed by Anyes milk with strawberry flavor, 4 species of fungi were isolated from this type of milk (Aspergillus niger, Aspergillus flavus, Penicilium, Aspergillus fumigatus). While the Fresh milk cow doesn’t give any fungi growth it was No fungal contamination. Asprergillus spp. was recorded the highest percentage of isolated fungi from all milk samples 93.3 %, while microsporum flavum recorded the lowest percentage of fungi from all milk samples 6.6% (table 3). Aspergillus spp. was appear by many different species, the highest percentage was for Aspergillus fumigatus 80% and the lowest percentage for Aspergillus terreus 20% (table4). Table (2): The fungi were isolated from milk samples. samples No. of Isolated fungi o. fungi isolated Al-Tazege milk powder 5 Dielac milk for infant 1 Rhizopus Penicilium Aspergillus niger Aspergillus flavus Aspergillus fumigatus Aspergillus flavus KDD milk without flavor 1 Aspergillus fumigatus Al-safi milk with cacao 2 Milk with banana Aynes 1 Aspergillus fumigatus Rhizopus Aspergillus fumigatus Hamoda milk 2 Aspergillus niger Aspergillus fumigatus Milk with strawberry Anyes 4 Aspergillus niger Aspergillus flavus Aspergillus fumigatus Penicilium Without Anyes 2 Aspergillus flavus Aspergillus fumigatus 3 Aspergillus fumigatus Aspergillus flavus . Spiky ORAL PRESENTATION flavor milk milk with 25 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org strawberry Aspergillus terreus Spiky milk with banana 1 Aspergillus fumigatus Spiky milk with cacao 1 Aspergillus fumigatus Aspergillus flavus Anchor powdery milk 3 Munish powdery milk 3 Howlera 2 Aspergillus fumigatus Aspergillus flavus Aspergillus terreus Aspergillus fumigatus Aspergillus niger Aspergillus terreus Aspergillus niger Microsporum fulvum Fresh milk cow - 0 1 2 3 4 No growth 5 Table (3): Percentage of fungi species from milk samples. Fungi Percentage o. Aspergillus spp. 93.3% Rhizopus spp. 13.3% Penecilium spp. 13.3% Microsporum flavum 6.6% Figure (1): fungi growth on PDA were isolated from milk samples, (A): Aspergillus spp., (B): A. niger , (C): A. fumigatus,(D): Microsporum flavum, (E): Penecilium spp., (F): Rhizopus spp. ORAL PRESENTATION 26 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table (4): The percentage of Aspergillus spp. was isolated from all milk samples. Aspergillus spp. Percentage o. Aspergillus fumigatus 80% Aspergillus niger 33.3% Aspergillus flavus 46.6% Aspergillus terreus 20% The Activity of Aqueous Bananas Peel Extract The antifungal prosperities of aqueous banana peels extract were tested by well diffusion assay against the most fungi isolated frequently (Aspergillus spp. 93.3% (A. fumigatus and A. niger). The results of this test was presented in (figure ( 2)) show that the aqueous extract of banana peel exhibited a variable antifungal agent. These results showed that this extract give an excellent inhibition effect against A. fumigatus with inhibition zone 4γmm at 100 µl concentration, wile the β5, 50, 75 µl were give les of inhibition zone 11, 24, 31 mm respectively. The extract was act as a good inhibition agent against A. niger with inhibition zone 7, 19, 23, 28 mm when the extract concentration was β5, 50, 75, 100 µl respectively. Figure (2): (A) The inhibition zone to A. fumigatus by the aqueous banana peels extract 100 µl concentration , (B) the inhibition zone of A. niger with β5, 50, 75, 100 µl concentration respectively from the same extract. 4. DISCUSSION Many study have been done to evaluate the phytochemical compositions and antimicrobial activities of different parts of diverse plants, such as banana peels (Hsieh et al., 2001). The study of Chabuck et al. (2013) of aqueous extract of banana peel found that this extract give a good inhibition effect against Gram-positive bacteria including S. aureus and S. pyogenes with inhibition zone 30 and 18 mm respectively, with no effect against C. albicans. There are many composition of banana skin like enzymes such as polyphenoloxidase, pectin as gelling agent and that the banana peel extract is used alone or combined with a cream or ointment, medicinal benefits of the extract include relief of pain, swelling and itching (Daniells et al., 2000 and Wuyts et al.). Additionally, Flavonoids, tannins, phlobatannins, alkaloids, glycosides and terpenoids were found to be present in the peels of genus Musa. These phytochemicals have been reported to exert multiple biological and pharmacological effects (antibacterial, antihypertensive, antidiabetic and anti-inflammatory activities). The presence of these bioactive substances in banana peels therefore suggests that the peels possess valuable medicinal potential yet to be explored. As the bioactive compounds contained in plants are majorly responsible for their medicinal properties (Ighodaroro et al., 2009). Moreover, Banana peel contains Vitamin A, Vitamin C, Gallocatechin, dopamine, Vitamin E, Vitamin B6, âsitosterol, malic acid, succinic Acid, palmatic acid, ORAL PRESENTATION 27 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Magnesium, phosphorus, potassium, fiber, Iron. Fatty acids present in the Banana peel are responsible for their antifungal activity. REFERENCES Ali, A. A. 2017. Isolation, identification and determination of antifungal Sensitivity of Fungi Isolated from A Sample of Patients with Rhinosinusitis in Baghdad City. Iraqi JMS 2017; Vol. 15(1), PP: 64-70. Chabuck , Z. A. G.; Al-Charrakh, A. H.; Hindi, N. K. K. and Hindi, S. K. K. 2013. Antimicrobial Effect of Aqueous Banana Peel Extract, Iraq. Research Gate: Pharmaceutical Sciences, 1:73-75. Daniells, S. 2000. Banana skin could offer cheap pectin from waste. Dry tech, 18, 1327-7. Hsieh PC, Mau J, Huang SH. Antimicrobial effect of various combinations of plant extracts. Food Microbiology 2001; 18, 35-43. Ighodaroro, O.M.; Mairiga, J.P. and Adeyi, A.O. 2009. Reducing and Antiproxidant profiles of flavonoids in Ocimum gratissimum. Inter J Chem Sci , 2, 85-9. Jalani, F. F. M.; Mohamad, S.; Shahidan, W. N. S. (2014). Antibacterial effects of banana pulp extracts based on different extraction methods against selected microorganisms. Asian Journal of Biomedical and Pharmaceutical Sciences; 4(36): 14-19. Koneman, E.W.; Roberts, G.D. and Wright, S.E. 1978. Practical laboratory mycology, 2nd ed. Williams and Wilkins Company. Baltimor USA. pp: 139-140. Pal, M. 2007. Veterinary and Medical Mycology. 1st Edition. Indian Council of Agricultural Research, New Delhi, India. Pal, M. 2014. Spoilage of Dairy Products due to Fungi. Beverage and Food World. Vol. 41, No. 7, PP: 37-40. Pal, M. and Jadhav,V.J. 2013. Microbial contamination of various India milk products. Beverage and Food World 40:43-44. Sheyin, Z., Maimako, J., Shindang, J., Essien, C. U., Bigwan, E. I. and Ede, F. R. 2015. Antimicrobial Activity of Albizia lebbeck leafe extract on some Medically Important Bacteria. Int. J. Curr. Microbiol. App. Sci. 4(9): 473-477. Subrata, K. B, Anusua, C., Joysree, D., Sheikh, Z. R., Manik, C. S., Utpal, K. K. 2011. Investigation of antibacterial activities of ethanol extracts of Musa paradisiaca Lam. Journal of applied pharmaceutical science. 1 (6), 133-135. Sumathy, N.H.; Sumathy, J.H. 2011. Antibacterial and Antifungal Activity of Musa Fruit Peels against Skin and Gastrointestinal Tract Diseases. Herbal Tech Industry. Short communication. 9-11. Sumathy, N. H., Sumathy, J. H. 2011. Antibacterial and Antifungal Activity of Musa Fruit Peels against Skin and Gastrointestinal Tract Diseases. Herbal Tech Industry. Short communication. PP: 9-11. Wuyts, N.; Dewaele, D.; Swennen, R. 2006. Extraction and partial characterization of polyphenol oxidase from banana (Musa acuminate Grand naine) roots. Blant Physiol Biochem. 44, 308-4. ORAL PRESENTATION 28 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Modifiye Aljinik Asid Reçinesi ile Bor İçeren İyonların Sulu Ortamdan Alıkonması Adnan Aydın 1, Sabahattin Deniz 2* 1 İstanbul Bilim Üniversitesi, Sağlık Bilimleri Fakültesi, Beslenme ve Diyetetik Bölümü, İstanbul, Türkiye *2 Marmara Üniversitesi, Teknoloji Fakültesi, Tekstil Mühendisliği Bölümü, İstanbul, Türkiye Sorumlu yazar e-mail: sdeniz@marmara.edu.tr Özet Sulu ortamlardan bor içeren bileşiklerin alıkonması için bor tutucu özelliği yüksek olan bileşiklerin sentezi ve kullanımları gerek çevre koruması ve gerekse endüstriyel açılardan önem arz etmektedir. Jeotermal sulardaki yüksek bor içeriği son derece yüksek tarımsal önemi haizdir. Bor gerek toprakta gerekse sulama sularında oldukça düşük miktarda bulunmasına karşın tutulma ve yıkanmasının güçlüğü nedeniyle toprakta hızla birikmektedir. Tarımsal ekonomik kıymeti olan bitkilerin büyük çoğunluğu yüksek bor içeriğinden olumsuz etkilenmektedir. Bu çalışmada doğal bir makromolekül olan aljinik asid (AA), 2,4,6–trikloro–1,3,5–triazin (TTC) ile modifiye edilmiş ve modifiye aljinik asid reçinelerinin yaklaşık kimyasal bileşimi, elementel analiz ve IR spektroskopisi yardımı ile ortaya konmuştur. Sonrasında sentezlenen reçinenin bor tutma kapasitesinin sabit sıcaklıkta zamana bağlı olarak değişimi incelenmiştir. Aljinik asid ile 2,4,6–trikloro–1,3,5–triazin aralarındaki reaksiyon, AA:TTC, (1μ1) ve (βμ1) mol oranlarında, oda sıcaklığında (β5°C) gerçekleştirilmiştir. Ele geçen iki ürünün bor tutma kapasiteleri belirlenmiştir. Sentezlenen modifiye aljinik asid reçineleriyle bor tutulması yaklaşık γ0 dakika temas ile tamamlanmaktadır. (1μ1) oranında modifiye edilmiş aljinik asidin bor tutma kapasitesi 1,60 mg B.g-1 reçine, (βμ1) oranında modifiye edilmiş aljinik asid reçinesinin bor tutma kapasitesi 1,5β mg B.g-1 reçine olarak bulunmuştur. Sentezlenen modifiye edilmiş aljinat reçinelerinin bor tutma kapasiteleri aljinik aside göre 4 kat fazla olduğu görülmüştür. Bu sonuçlara göre ele geçen modifiye edilmiş aljinik asid reçinelerinin borun sulardan uzaklaştırılmasında kullanılan mevcut endüstriyel bazı reçinelere yakın bor tutma özelliğine sahip olduğu görülmüştür. Anahtar Kelimeler: Bor, aljinik asid, 2,4,6–trikloro–1,3,5–triazin 1. GİRİŞ Bor, yeryüzünde yüzden fazla minerali bulunan, değişik amaçlarla kullanılan çok sayıda kimyasal bileşiği olan bir elementtir. Çok çeşitli sektörlerde kullanılan bor mineralleri ve ürünlerinin kullanım alanları giderek artmaktadır. Üretilen bor minerallerinin %10' a yakın bir bölümü doğrudan mineral olarak tüketilirken geriye kalan kısmı bor ürünleri elde etmek için kullanılmaktadır. Bor bileşikleri çok çeşitli alanlarda kullanım alanına sahip önemli bileşiklerdir. Tarımdan seramik ve cam sanayiine, temizlik ürünlerinden enerji sektörüne ve hatta askeri alanlarda kullanımı olan bor bileşikleri vardır (Deniz ve Aydın, β00γ). Tüm bu önemli kullanım alanlarından dolayı stratejik bir öneme de sahiptir. Bor ürünlerinin pek çok alanda yaygın kullanımının olmasına rağmen bazı durumlarda sulu ortamlardan uzaklaştırılması gerekmektedir. Bitkilerin büyümesi için az miktarda da olsa Bor’ a ihtiyaç vardır. Bununla birlikte Bor’ un gerektiğinden fazla bulunması onun zararlı bir etki göstermesine neden olmaktadır (Badruk ve ark., 1λλλ). Ülkemiz dünya bor kaynaklarının yaklaşık %60’ ına sahiptir. Bununla birlikte jeotermal sularda yüksek bor içeriklerinin olması ve bor madenlerinin drenaj sularında bulunan bor, tarım arazilerinin sulanmasında kullanılan su kaynaklarında kirliliğe neden olmakta ve tarım ürünlerine zarar vermektedir (Dilek ve ark., β00β). Bor gerek toprakta gerekse sulama sularında oldukça düşük miktarda bulunmasına karşın tutulma ve yıkanmasının güçlüğü nedeniyle toprakta hızla birikmektedir. Toprak ve sularda bulunan bor bileşikleri çeşitli toksik etkileri olan ağır metallerle kompleksler oluşturmakta bu da elementlerin potansiyel zehirliliklerini ORAL PRESENTATION 29 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org arttırmaktadır. Tüm bu sağlık problemlerinin yanı sıra jeotermal sulardaki yüksek bor içeriği bu sulardan enerji elde edilmesine ilişkin projeleri de kısıtlamaktadır. Bor atomu içeren iyonlar sulu ortamdan uzaklaştırılması zor olan iyonlardır. Özel yapıya sahip reçineler yardımı ile bor içeren iyonlar sulu ortamdan uzaklaştırılabilmektedir. Bor’un ortamdan uzaklaştırılmasında ultrafiltrasyon yöntemi kullanılsa da reçineler ile borun alıkonması kullanılan en yaygın yöntemdir. Tablo 1.’ de bor tutma amaçlı kullanılan bazı ticari reçineler ve bor tutma miktarları verilmiştir (Badruk ve ark., 1999; Beker ve ark., 1996; Bhatnagar ve Mathur, 1977; Okay ve ark., 1985; Sarri ve ark., 2018). Reçine Diaion CRB 02 Örnek 0,1 M Borik Asid Tutulma Miktarı 4,15 mg B.cm-3 reçine Purolite S108 0,1 M Borik Asid 2,73 mg B.cm-3 reçine Diaion CRB 02 Kızıldere jeotermal atık suyu 3,80 mg B.cm-3 reçine Purolite S108 Kızıldere jeotermal atık suyu 2,94 mg B cm-3 reçine Diaion SAN-1 0,0647 M Borik Asid 4,22 mol B L-1 reçine Diaion SAN-1 0,00925 M Borik Asid 1,46 mol B L-1 reçine Diaion SAN-1 0,β78 M Borik Asid, 5° C 3,78 mol B L-1 reçine Diaion SAN-1 0,β78 M Borik Asid, 70° C 2,94 mol B L-1 reçine Diaion SAN-1 0,00λβ5 M Borik Asid, 5° C 1,58 mol B L-1 reçine Diaion SAN-1 0,00λβ5 M Borik Asid, 70° C 1,15 mol B L-1 reçine Amberlite IRN 78LC 0,00λβ5 M Borik Asid, 60° C 1,6 B atomu monomer-1 Amberlite IRN 78LC 0,00λβ5 M Borik Asid, 10° C 2,1 B atomu monomer-1 Amberlite IRA 743 Kızıldere jeotermal atık suyu 5,12 mg B mL-1 reçine Nalcite HCR (Dowex 50) Borik Asid çözeltisi 3,93 mg B 50 mL-1 reçine Nalcite WBR–Nalcite HCR Borik Asid çözeltisi 3,95 mg B 50 mL-1 reçine Guar gum–siyanurik klorür Borik Asid çözeltisi 4,2 meg B g-1 reçine Selüloz Bigadiç Bor madeni drenaj suyu 0,3–0,54 mg B g-1 reçine Polietilenimin-epiklorhidrin reçinesi 100-500 ppm bor çözeltisi 55 mg B g-1 reçine Tablo 1. Bor giderimi amacıyla kullanılan bazı ticari reçineler Bor giderimi için kullanılan bu reçineler bilinen klasik iyon değiştirici reçineler olmayıp bor seçici reçinelerdir. Bu reçinelerde bulunan fonksiyonel gruplar bor atomu ile kompleks yapmaya uygun gruplardır. Bu reçinelerin yapıları Şekil 1.’ de gösterilmiştir. * H C H2 C H C H2 C * n n * * OH C C H H2 C H2 N CH3 C H2 H C H C H C H C R N N CH3 CH3 C H2 H C OH OH CH2OH OH OH OH OH (1) OH H C H C H C CH2OH OH OH (2) OH OH OH OH (3) Şekil 1. Bor seçici reçinelerin yapıları. (1) Diaion CRB0β, (β) Purolite S108, (γ) Amberlite IRA-743 ORAL PRESENTATION 30 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Aljinik asid, farklı tipteki deniz yosunlarından ekstrakte edilerek elde edilir. Aljinik asidin temel kaynağı olan kahverengi deniz yosunu macrosystis pyrifera, modern teknoloji ile ideal bir hammadde özelliği sağlayabilmek için yetiştirilmektedir. Macrosystis pyrifera, nispeten durgun ve geniş sularda yetişir. Bitki yıllıktır ve hızlı büyümesi sebebiyle yılda dört defa hasat edilebilmektedir (Deniz ve Aydın, β00γ). Aljinik asid, D-mannuronik asid ve L-guluronik asid zincirlerinden oluşan bir polimerdir. Kahverengi deniz yosunundan elde edilen aljinik asid, lineer yapıda bulunur ve %61 D-mannuronik asid ile %39 L-guluronik asid içerir. Kimyasal yapılar Şekil β.’ de gösterildiği gibidir (Bertoni ve ark., β014). Şekil 2. Aljinik asidin kimyasal yapısı 2. MATERYAL VE METOD 2.1. 1:1 (AA:TTC) Modifiye Edilmiş Aljinik Asid Sentezi λ,β5 g (0,05 mol) TTC tartıldı. Oda sıcaklığında yaklaşık 40 mL destile suda süspanse edildi. β50 mL’ lik reaksiyon balonunda iyice karıştırıldı. pH sının β–γ civarında olduğu gözlendi. Na2CO3 çözeltisi ile pH sı yaklaşık 7–8’ e ayarlandı. 8,8 g (0,05 mol) aljinik asid tartıldı ve katı olarak oda sıcaklığında yukarıdaki karışıma yavaş yavaş ilave edildi. Aljinik asid sebebiyle pH’ nın β civarına düştüğü gözlendi. Derişik NaOH çözeltisi ile pH yeniden 7–8 civarına ayarlandı. Reaksiyonun yürümesi sırasında açığa çıkan H + iyonları pH’ nın hızlı bir şekilde düşmesine neden olmaktadır. O sebeple pH ayarı, pH’ nın bir-iki dakika sabit kalmasına kadar yapıldı. Yaklaşık 1 saat sonra pH kontrol edildi ve tekrar düştüğü gözlendi. Derişik NaOH çözeltisi ile tekrar ayarlandı. Reaksiyon pH kontrolü yapılarak β gün devam ettirildi. İkinci günün sonunda beyaz bir karışım gözlendi. Elde edilen karışımın 6–7 civarında olan pH’ sı seyreltik HCl ile yaklaşık β,5’ a ayarlandı. Böylece taneciklerin çözünürlüğünün azaldığı ve büyüdüğü gözlendi. Karışım sinterlenmiş cam filtreden süzüldü. Çökelek metanolle β defa yıkandı. Ele geçen beyaz renkli ürün vakum desikatöründe kurutuldu. 2.2. 2:1 (AA:TTC) Modifiye Edilmiş Aljinik Asid Sentezi 4,6β5 g (0,0β5 mol) TTC ve 8,8 g (0,05 mol) aljinik asid alınarak bir önceki reaksiyonda olduğu gibi sentezlendi. 2.3. Aljinik Asid ve Modifiye Aljinat Reçinelerinin Bor Tutma Kapasitelerinin İncelenmesi Sentezlenen iki ayrı modifiye edilmiş aljinat reçinesinin ve aljinik asidin bor tutma kapasitesini belirlemek için borik asid çözeltisi kullanıldı. Her iki reçineden ve aljinik asidden ayrı ayrı 0,500’ er gram tartıldı. Bir beher ORAL PRESENTATION 31 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org içine 50 mL β00 ppm borik asid çözeltisi ve tartılan reçineden konuldu. Manyetik karıştırıcı ile karıştırıldı. Oda sıcaklığında 10 - 60 dakikalık karıştırma sürelerinde tutulan bor miktarı belirlendi. Yukarıda verilen sürelerde borik asid çözeltisi sentezlenen reçine ile manyetik karıştırıcıda karıştırıldıktan sonra süzüldü. Süzüntüde tutuklanmadan kalan bor miktarı mannitol ile borik asid tayini yöntemiyle belirlendi. Süzüntü 100 mL’ ye seyreltildi. Üzerine yaklaşık β g mannitol ilave edildi. Mannitol çözündükten sonra birkaç damla fenolftalein indikatörü katıldı ve 0,1 N NaOH ile titre edildi. Renk kalıcı pembe olduktan sonra yaklaşık 0,5 g mannitol daha ilave edildi. Renkte bir açılma gözlenmedi. Dönüm noktasına kadar sarf edilen NaOH miktarına göre süzüntüdeki bor miktarı hesaplandı (Cson) ve başlangıç konsantrasyonundan (Cilk) çıkarılarak tutulan bor miktarı (Ctutulan) bulundu. � � 3. SONUÇ = − � 3.1. Sentezlenen Reçinelerin Karakterizasyonu Aljinik asid, 1μ1 (AAμTTC) ve βμ1 (AAμTTC) oranında modifiye reçinelerin IR spektrumları alınmış ve Şekil γ.’ te gösterilmiştir. Aljinik asidin spektrumunda yer alan γ46γ cm -1’ deki pik OH bandını göstermektedir. Sentezlenen reçinelerin spektrumlarında γ46γ cm -1 civarında bulunan omuz sentezlenen reçinelerde OH grubunun bulunduğunu göstermektedir. Reçinelerin IR spektrumlarında bulunan 106γ cm-1’ deki pik aljinik asiddeki OH gruplarının TTC ile reaksiyonu sonucu eter bağlarının (C–O–C) oluştuğunu göstermektedir. TTC’ nin IR spektrumunda bulunan 8γ4 cm-1’ deki pik maddede C–Cl bağının olduğunu göstermektedir. Sentezlenen polimerlerin IR spektrumlarında 8γ4 cm -1’deki pikin kaybolması reaksiyonun gerçekleştiğini göstermektedir (Erdik, 1λλ8). Şekil 3. IR spektrumları. (1) AA, (β) TTC, (γ) 1μ1 ve βμ1 (AAμTTC) reçinesi 3.2. Sentezlenen Reçinelerin Elementel Analizleri Sentezlenen reçinelerin elementel analizleri TÜBİTAK M.A.M.’ de yaptırıldı. Elde edilen sonuçlar Tablo β.’ de verilmiştir. ORAL PRESENTATION 32 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tablo 2. Sentezlenen reçinelerin elementel analiz sonuçları Reçine %C %H %N %Cl 1:1 (AA:TTC) 29,07 3,22 12,10 0,50 2:1 (AA:TTC) 29,90 3,90 5,15 0,61 3.2. Sentezlenen Reçinelerin Bor Tutma Kapasiteleri 0,500 g aljinik asid (AA), 0,500 g 1μ1 (AAμTTC) ve 0,500 g βμ1 (AAμTTC) oranındaki modifiye edilmiş aljinik asid reçinelerine ait bor tutma kapasitesini gösteren veriler Tablo γ’ de verilmiştir. Yine aynı maddelerin bor tutma kapasitesinin zamanla değişimini gösteren grafik Şekil 4’ te verilmiştir. Tablo 3. 0,500’ er gram aljinik asid ve sentezlenen reçinelerin zamana bağlı bor tutma kapasiteleri Süre (dak.) Aljinik Asid (AA) (mg.g-1) 1:1 (AA:TTC) (mg.g-1) 2:1 (AA:TTC) (mg.g-1) 0 10 15 20 25 30 35 40 45 50 60 0 0,15 0,20 0,20 0,20 0,21 0,21 0,20 0,21 0,20 0,19 0 0,54 0,73 0,75 0,83 0,82 0,81 0,78 0,81 0,80 0,81 0 0,51 0,70 0,76 0,76 0,76 0,77 0,76 0,76 0,78 0,76 2 Bor tutma kapasitesi (mg.g-1) 1,8 Aljinik Asid (AA) 1,6 1,4 1:1 (AA:TTC) 1,2 2:1 (AA:TTC) 1 0,8 0,6 0,4 0,2 0 0 10 20 30 40 50 60 70 Zaman (dak.) Şekil 4. Aljinik asid ve modifiye aljinatların bor tutma kapasitelerinin zamanla değişimi ORAL PRESENTATION 33 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4. TARTIŞMA Bu çalışmada aljinik asid (AA), β,4,6–trikloro–1,3,5–triazin (TTC) ile 1μ1 ve βμ1 mol oranlarında reaksiyona sokularak modifiye edildi. Elde edilen modifiye aljinat reçinelerinin bor tutma kapasiteleri belirlendi ve aljinik asid ve diğer bor tutucu reçinelerin kapasiteleri ile kıyaslandı. 2,4,6–trikloro–1,3,5–triazin, farklı reaktiflikte üç klor atomuna sahiptir. Bu klor atomlarının yer değiştirmeleri reaksiyon ortamının sıcaklık ve pH’ sına bağlı olarak farklılık göstermektedir. β,4,6–trikloro–1,3,5–triazindeki klor atomlarının ilki reaksiyon ortamının sıcaklığı 0 °C civarında iken yer değiştirir. İkinci klor atomu β5 °C civarında, üçüncü klor atomu da 60 °C civarında iken yer değiştirmektedir (Hoog ve ark., β00βν Attardi ve ark., β000ν Menicagli ve ark., β000). Ancak bunların dışında ortamın pH’ sının ve reaksiyon süresinin de etkisi vardır (Su ve ark., β001ν Mahler ve ark., 1λλλ). Bu çalışmada aljinik asidin β,4,6–trikloro–1,3,5–triazin ile reaksiyonu β5°C’ de pH=7’ de ve 48 saatte yapıldı. Reaksiyon sonucunda; 2,4,6–trikloro–1,3,5–triazinin, aljinik asid zincirleri arasında köprü görevi gördüğü ve eter bağları ile hacimli bir yapı oluşturduğu ve bu reaksiyon şartlarında, β,4,6–trikloro–1,3,5–triazinde bulunan 2 adet Cl atomunun büyük oranda sübstitüe olduğu düşünülmektedir. Sentezlenen reçinelerin ve aljinik asidin bor tutma miktarları incelendiğinde; aljinik asidin 15. dakikadan sonra bor tutma miktarının sabit olduğu ve kapasitesinin 0,40 mg B.g-1 aljinik asid olduğu görülmüştür. Sentezlenen modifiye aljinat reçineleri için deν 1μ1 oranında modifiye edilmiş aljinik asidin γ0. temas dakikasından sonra bor tutma miktarının sabit olduğu ve kapasitesinin 1,6β mg B.g-1 reçine olduğu, βμ1 oranında modifiye edilmiş aljinik asidin β0. temas dakikasından sonra bor tutma miktarının sabit olduğu ve kapasitesinin 1,54 mg B.g -1 reçine olduğu görülmüştür. Bu da çalışmada sentezlenen reçinelerin bor tutma kapasitelerinin, aljinik asidin bor tutma kapasitesine göre 4 kat daha fazla olduğunu göstermektedir. Bu çalışmada sentezlenen reçinelerde bulunan polimer zincirlerin, rijid bir moleküler yapı oluşturularak, yığışımın önlenmiş olduğu ve böylelikle zincirlerdeki aktif yüzeylerin korunduğu düşünülmektedir. Bor tutma amaçlı kullanılan reçinelere göre bu çalışmada sentezlenen reçineler kıyaslandığındaν Diaion CRB 0β, Purolite S108, Diaion SAN-1, Amberlite IRA 78LC, Amberlite IRA 743, polietilenimin-epiklorhidrin reçinesi ve 2,4,6-trikloro-1,3,5-triazin ile modifiye edilmiş guargum’ ın sentezlenen reçinelerden daha yüksek kapasiteli bor tutucu reçineler oldukları görülmüştür. Ancak bu çalışmada sentezlenen reçinenin bor tutma kapasitesinin Nalcite HCR (Dowex 50), Nalcite WBR-Nalcite HCR ve selüloza göre daha fazla olduğu Tablo 1.’ de görülmektedir. Bu sebeple bu çalışmada sentezlenen modifiye aljinat reçinelerinin bazı bor seçici reçinelere alternatif olarak kullanılabileceği düşünülmektedir. TEŞEKKÜR Bu çalışma Marmara Üniversitesi Bilimsel Araştırma Projeleri Komisyonu (BAPKO) tarafından BSE– 038/210701 numaralı proje ile desteklenmiştir. KAYNAKLAR Attardi ME, Falchi A, Taddei M 2000. A Sensitive Visual Test for Detection of OH Groups on Resin. Tetrahedron Letters, 41: 7395-7399. Badruk M, Kabay N, Demircioğlu N, Mordoğan H, İpekoğlu U 1λλλ. Removal of Boron from Wastewater of Geotgermal Power Plant by Selective Ion Exchange Resins. I. Batch Sorption – Elution Studies. Speration Science And Techonology, 34(13): 2553-2569. Beker ÜG, Çergel A, Recepoğlu O 1λλ6. Removal of Boron from Geothermal Power Plant Wastewater in Kızıldere, Turkey. Energy Sources, 18μ 645-654. Bertoni AF, Bellu SE, Gonzalez JC, Sala LF 2014. Reduction of Hypervalent Chromium in Acidic Media by Alginic Acid. Carbohydrate Polymers, 114: 1-11. Bhatnagar R, Mathur NK 1977. A New Boron–Selective Resin Derived from Guar Gum. Talanta, 24:466-467. Dilek Ç, Özbelge HÖ, Biçak N, Yılmaz L β00β. Removal of Boron from Aqueous Solutions by Continuous Polymer–Enhanced Ultrafiltration with Polyvinyl Alcohol. Seperation Science And Technology, 37(6): 1257- 1271. ORAL PRESENTATION 34 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Deniz S, Aydın A β00γ. Aljinik Asidden Yeni Bir Reçine Sentezlenmesi ve Bor İçeren İyonların Alıkonmasının İncelenmesi. Marmara Üniversitesi Fen Bilimleri Enstitüsü, 1-8pp. Erdik E 1998. Organik Kimyada Spektroskopik Yöntemler. Ankaraμ Gazi Kitabevi, λ8pp. Hoog P, Gamez P, Driessen WL, Reedijk J 2002. New Polydentate and Polynucleating N–Donor Ligands from Amines and 2,4,6–trichloro–1,3,5–triazine. Tetrahedron Letters, 43: 6783-6786. Mahler J, Rafler G, Stiller B 1999. Modified Melamines and Melamine Resins for E/Z–Isomerization. Materials Science & Engineering C, 8–9: 407-410. Menicagli R, Samaritani S, Zucchelli V 2000. 2–Alkyl–4,6–dialkylamine–1,3,5–triazines via Grignard Alkylation of Cyanuric Chloride: An Aged Reaction Revisited. Tetrahedron, 56: 9705-9711. Okay O, Güçlü H, Soner E, Balkaş T 1λ85. Boron Pollution in the Simav River, Turkey and Various Methods of Boron Removal. Water Res.,19(7): 857-862. Sarri S, Misaelides P, Zamboulis D, Warchoł J 2018. Boron Removal from Aaqueous Solutions by a Polyethylenimine – Epichlorohydrin Resin. Journal of the Serbian Chemical Society, (accepted manuscript), http://dx.doi.org/10.2298/JSC170704114S. Su MH, Ma H.M, Ma QL, Wang ZH, Xiong SX, Liang SC 2001. Fluorescent Labeling of Phenol Using 8–(4,6– dichloro–1,3,5–triazinylamino)quinoline. Analytica Chimica Acta, 426: 51-56. ORAL PRESENTATION 35 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Use of Benthic Macroinvertebrate in Water Quality Assessment of Kodi Creek (Turkey, Tunceli) Serap Koşal Şahin1*, Esra Albayrak2 1* 2 Istanbul University, Faculty of Aquatic Sciences, Istanbul -Turkey Istanbul University, Institute of Science, Department of Basic Sciences, Istanbul-Turkey Corresponding author e-mail: serap@istanbul.edu.tr Abstract Kodi Creek is an important running water in the East Anatolian Turkey and is one of the main tributary of Munzur River. 5 sites were investigated during the summer season using benthic macroinvertebrate fauna and physicochemical properties to assess ecological quality of Kodi Creek. Various macro invertebrate based metrics were used to assess water quality of Kodi Creek. Four sites were classified as reference sites with high ecological status. Only the 5th station is a little polluted. Keywords: Water quality, Macroinvertebrate, Tunceli, EPT Taxa (%). 1. INTRODUCTION Benthic macroinvertebrates are accepted the most useful biological indicators of water quality of running water ecosystems. The benthic macroinvertebrate based assessment of running water quality is prefered because of its advantages. The benthic macroinvertebrates tend to move slightly, they have long life cycles when compared with macrophyte and algae. They have short life cycle when compared with fishes enough to react to the changes in the environment by their community structure (Kazancı et al. ,1λλ7ν Reece and Richardson, 2000). Benthic macroinvertebrates have high species richness, collection of them is easy and cheap, family and genus identifications is not problematic in many parts of the world (Rosenberg and Resh, 1993; Bonada et al., 2006). Due to all of these features, benthic macroinvertebrates are most useful group for water quality studies. The information on abundance, taxonomic composition of communities, diversity, presence or absence of major taxa and number of sensitive and tolerant taxa render possible to classify ecological status of running waters. Especially communities of EPT are usually dominant in rivers and the evaluation of water quality using these three insects orders are decent enough and satisfactorily accurate. 2. MATERIALS AND METHODS Tunceli province is located at the upper Fırat River basin in the Taurus orogenic belt of the mountainous district of the Eastern Anatolia and has a rich position regarding streams. This study was carried out in Kodi Creek of Tunceli. Kodi Creek is the tributary of Munzur River. A total of five stations were chosen on the creek for this study. The water samples and benthic macroinvertebrate were gathered from these stations in Jun 2017. Water temperature (ºC), pH, dissolved oxygen (DO mg/l), and electrical conductivity (EC µs cm-1) were measured during sampling in situ by using portable multiparameter equipment. Flow velocity was detected by using flow meter. Ca+2 (mg/l), NO2--N (mg/l), NO3--N (mg/l), PO4--P (mg/l) values were determined based on standard methods (APHA, 1998). Benthic macroinvertebrates were sampled from each station by using Surber net (475 µm mesh, area of base 0.0λ m2). The samples were taken from an area of nearly 100 m 2 in order to include all possible microhabitats at each station. The collected material was fixed in formaldehyde (4%) in the field and then kept in 80% ethylalcohol and sorted in the laboratory. All samples were identified at the lowest possible level under a stereomicroscope (family, genus or species). 3. RESULTS During the survey 29 taxa were found, of which 2 taxa belong to Plecoptera (Protonemura sp., Leuctra sp.) 7 taxa belong to Ephemeroptera (Ephemerella ignita, Ephemerella sp, Baetis sp., Electrogena sp., Epeorus ORAL PRESENTATION 36 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 1. Benthic macroinvertebrates of Kodi Creek of identified from 5 stations Species List Trichoptera Agapetus fuscipes Curtis, 1834 Glossosoma conformis Neboiss, 1963 Goera pilosa Wallengren,1891 Silo sp. Hydropsyche bulbifera McLachlan, 1878 Hydropsyche fulvipes Curtis, 1834 Hydropsyche instabilis Curtis, 1834 Hydropsyche incognita Pitsch, 1993 Lepidostoma hirtum Fabricius, 1775 Lepidostoma sp. Drusus simplex Martynov, 1927 Micropterna testacea Gmelin, 1789 Sericostoma sp. Sericostoma personatum Kirby&Spence,1826 Plecoptera Protonemura sp. Leuctra sp. Ephemeroptera Baetis sp. Ephemerella ignita Poda, 1761 Ephemerella sp. Electrogena sp. Epeorus sp. Ecdyonurus sp. Epeorus magnus Braasch, 1978 Simulium sp. Mollusca Ancylus fluviatilis Müller, 1774 Acroloxus lacustrisLinnaeus, 1758 Malacostraca Gammarus pseudosyriacus Karaman & Pinkster, 1977 Gammarus sp. Oligochaeta Bıodıversıty Indıces BMWP EPT Taxa % ORAL PRESENTATION 1 Stations 2 3 * * 4 5 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * 151 86 86 78 75 89,14 88,29 75,98 69,89 69,32 37 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org sp., Epeorus magnus, Ecdyonurus sp.) 14 taxa belong to Trichoptera (Agapetus fuscipes, Glossosoma conformis, Goera pilosa, Silo sp., Hydropsyche bulbifera, Hydropsyche fulvipes, Hydropsyche instabilis , Hydropsyche incognita, Lepidostoma hirtum, Lepidostoma sp. Drusus simplex Micropterna testacea, Sericostoma sp., Sericostoma personatum) 2 taxa belong to Mollusca (Ancylus fluviatilis, Acroloxus lacustris) 2 taxa belong to Malacostraca (Gammarus pseudosyriacus, Gammarus sp) 1 taxa belong to Simuliidae (Simulium sp.) and 1 taxa belong to Oligochaeta (Table 1). In also dissolved oxygen (DO mg/l), water temperature (ºC), pH, electrical conductivity (EC µs cm-1), flow velocity (m/s) , NO2 -N (mg/l), NO3-N (mg/l), PO4-P (mg/l )and Ca (mg/l) variables were analyzed. The values of measured physical and chemical variables are shown in Table 2. Table 2. 9 physicochemical variables of Kodi Creek of measured from 5 stations. Water DO Temperature Stations Substrate (mg/l) (°C) Stones 8,1 9,3 1 Stones 8,7 9,2 2 Stones 7,7 8,6 3 Stones 8,7 5,4 4 Gravel 7,6 8,2 5 pH 8,07 8,11 7,63 7,16 7,27 EC Flow µs cm-1 velocity NO2-N (mg/l) m/s 209,3 8,4 0,0001 301,25 3 0,0001 198,9 3,1 0,0001 183,4 2,9 0,0001 285,5 1,4 0,0001 NO3-N (mg/l) 1,45 1,59 1,23 1,87 3,11 PO4-P (mg/l) 0,0001 0,0001 0,0001 0,0001 0,0001 Ca (mg/l) 34,23 42,21 56,31 39,33 59,52 4. DISCUSSION The highest number of benthic macroinvertebrate taxa indicating highest diversity and highest habitat quality was found in Site 1 in this study,. EPT taxa values are useful to determine water pollution because of sensitivity of these taxa to pollution. The highest EPT taxa value was recorded at Site 1, the lowest value was recorded at Site 5. The scores of Site 1, Site 2, Site 3, Site 4 and Site 5 were higher than 65, so according to BMWP scores, these sites were slightly contaminated sites. 5. CONCLUSION The EPT taxa Richness Index is sensitive to environmental impairment as EPT taxa are potentially sensitive to changes (especially increasing disturbances) in various headwater water parameters. Therefore using the EPT taxa Richness Index is a relatively accurate biological parameter to detect aquatic disturbances although more investigation is required to further improve the application of the index. The survival of EPT depends strongly on the good ranges of the river physicochemical environment that indirectly indicates healthy river status, hence increases reliability of water quality assessment especially in pristine environments. The reference sites and their benthic macroinvertebrate communities of Kodi Creek was determined in family level in this study. Reference sites and their benthic macroinvertebrate communities could be used to evaluate ecological quality of the same types of streams in East Anatolian Region. ACKNOWLEDGEMENTS This research has been supported by Unit of Scientific Research Projects, Istanbul University (Project No: 24781). We are deeply grateful to them for their financial support. REFERENCES American Public Health Association (APHA), 1998. Standard methods for examination of water and wastewater. Washington, D.C.: American Water Works Association and Water Pollution Control Federation. ORAL PRESENTATION 38 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Bonada, N, Prat N, Resh VH, Statzner B 2006. Developments in aquatic insect biomonitoring: a comparative analysis of recent approaches. AnnualReview of Entomology, v. 51, n. 1, p. 495-523. Kazancı N, Girgin S, Dügel, M, Oğuzkurt D 1λλ7. Türkiye İç Suları Araştırmaları Dizisi II (Ed. N. Kazancı)μ Akarsuların çevre kalitesi yönünden değerlendirilmesinde ve izlenmesinde biyotik indeks yöntemi, İmaj Yayınevi, Ankara. 100pp. Reece PF, Richardson JS 2000. Biomonitoring with the Reference Condition Approach forthe Detection of Aquatic Ecosystems at Risk. Proceeding of a conference on the biology and managment of species and habitats at risk. 549-552 Rosenberg D.M, Resh V H 1993. Introduction to freshwaterbiomonitoringandbenthicmacroinvertebrate. – InRosenberg, D. M. andResh V. H. (eds): FreshwaterBiomonitoringandbenthicmacroinvertebrates: 1-9.Chapman&Hall. 488 pp ORAL PRESENTATION 39 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Steril Vücut Sıvılarından İzole Edilen Kandida Türlerinin Antifungal Duyarlılık Oranları Merih ŞİMŞEK Afyon Kocatepe Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Afyonkarahisar, Türkiye Sorumlu yazar e-mail: smerih16@gmail.com Özet Çeşitli infeksiyonlardan antifungallere dirençli kandida türlerinin izolasyonunda son yıllarda önemli derecede bir artış olması, bu infeksiyonlardan izole edilecek kandida suşlarının tür düzeyinde tanımlanmasını ve antifungallere duyarlılık testlerinin yapılmasını zorunlu hale getirmiştir. Bu nedenle bu çalışmada, Tıbbi Mikrobiyoloji laboratuvarına son üç yıl içinde gönderilen 1γ1γ7 adet steril vücut sıvısı örneği sonuçları taranarak, kandida türlerinin dağılımının ve antifungal direnç profillerinin belirlenmesi amaçlanmıştır. Çalışmamıza, kan kültürü, beyin omurilik sıvısı, periton, plevra, perikard kültürü örnekleri dahil edilmiştir. Kan kültürü inkübasyonu için BACTEK FX tam otomatize kan kültür sistemi kullanılmıştır. Pozitif üreme sinyali veren örneklerin %5 koyun kanlı ve Eozin-Metilen Blue (EMB) agara pasajı alınmıştır. Rutin laboratuvara mantar kültürü amacıyla gönderilen diğer vücut sıvı örnekleri %5 koyun kanlı, EMB, Çikolata ve Subaroud Dekstroz (SDA) agara ekilerek β5ºC ve γ7ºC de 48 saat inkübe edilmiştir. Maya üremesinden şüphe edilen örneklerden gram boyama alınmıştır. İdentifikasyon ve antifungal duyarlılık testleri için VITEK β Tam Otomatize İdentifikasyon sistemi kullanılmıştır. VITEK β sistemi ile elde edilen antifungal duyarlılık sonuçlarında dirençli olarak belirlenen antifungal ajanlar için E-test yöntemi ile doğrulamaya gidilmiştir. Çalışmamızda elde edilen sonuçlara göre, 1β4 steril vücut sıvısı örneğinde Kandida üremesi olmuştur. Bunlardan, (67)%54’ünde C.albicans, (β0)%16.1’inde C.parapsilosis, (17)%1γ.7’sinde C.glabrata, (4)%γ.β’sinde C.tropicalis, (γ)%β.4’ünde C. famata, (β)%1.6’sında C.ciferrii, (β)%1.6’sında C.kefyr , (1)%0.8’inde C. lusitaniae, (1)%0.8’inde C.dubliniensis, (1)%0.8’inde C.krusei, (6)%4.8’inde Candida spp. türleri üremiştir. Flusitozin’e karşı hiçbir kandida suşunda direnç’e rastlanmazken, genel olarak kandida türleri Flukanozole karşı en yüksek direnci göstermiştir. Flukanozole en yüksek direnci %41.1 oranında C. glabrata gösterirken, bunu %β.λ oranıyla C.albicans takip etmektedir. Sonuç olarak, steril sıvı örneklerinden izole edilen non-albicans kandida türleri oldukça geniş bir yelpazede yer almaktadır. Bu da, kandida infeksiyonlarının tedavisinde zorlukların artması anlamına gelmektedir. Bununla birlikte, flukonazole dirençli suşlarla oluşan infeksiyonların tedavisinde alternatif ilaç olarak sırasıyla, Flusitozin, Mikafungin, Amfoterisin B, Kaspofungin ve Vorikonazol kullanılabileceği sonucuna varılmıştır. Anahtar Kelimeler: Steril vücut sıvıları, Candida türleri, Antifungal duyarlılık 1.GİRİŞ Kandida türleri doğada oldukça yaygın olarak bulunan mantarlardandır. Sağlıklı bireylerde özellikle gastro-intestinal sistemde ve vajinal florada kolonizasyonu bulunmaktadır. Kandida türleri arasında özellikle Candida albicans infeksiyon etkeni olarak sıklıkla görülmektedir. Son yıllarda, kemik iliği, organ nakilleri gibi tedavi yöntemlerinin yaygınlaşması ile Kandida kaynaklı fırsatçı infeksiyonların oranında ciddi artışlar yaşanmıştır. Normal florada bulunmaları nedeniyle birçok klinik örnekte bu tür mantarların üretilmesi gereksiz tedavilere neden olmaktadır. Steril vücut sıvılarından, doku örneklerinden izolasyonları ve üretilmeleri ya da kültürde fazla sayıda olmaları invaziv kandidiyazis tanısı koymada önemli bir faktördür. (Yücel ve Kantarcıoğlu, 1999 - Kuştimur, 1λλλ) Günümüzde invaziv fungal infeksiyonların öneminin artışındaν epidemiyolojik faktörler, risk faktörleri, mortalite, yeni etkenler, tanı zorluğu, antifungal tedavideki gelişmeler (yeni antifungaller, antifungal ajanlara ORAL PRESENTATION 40 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org direnç gelişimi, kombine tedavi gereksinimlerinin otaya çıkışı) gibi pek çok faktörün katkısı vardır. Antifungal ilaçlara direnç gelişmesi ve fungal infeksiyonların önemli bir sağlık sorunu haline gelmesi, daha geniş spektrumlu ve farklı hedefleri etkileyen yeni ilaçlara ve tedavi rejimlerine ihtiyaç oluşturmuştur. Böylece, hem dirençli suşların saptanması hem de yeni antifungallerin klinik kullanım öncesi değerlendirilmesinde antifungal duyarlılık testlerinin önemi artmıştır. Bütün bunlar antifungal tedavi seçiminde in vitro duyarlılığı ölçen testlerin geliştirilmesine yönelik çalışmaları yoğunlaştırmıştır. Antifungal ilaçlar, Cilt ve mukozaların lokal mantar infeksiyonlarının ve çeşitli sistemik mantar infeksiyonlarının tedavisinde kullanılırlar. (Göller, 1λλλ-Topçu ve ark., 2002) Yaptığımız bu çalışmada hastanemizde tedavi gören hastalardan alınmış olan steril vücut sıvısı örneklerinden izole edilen Kandida türlerinin dağılımının ve antifungal direnç profillerinin belirlenmesi amaçlanmıştır. 2. MATERYAL VE METOD 2.1 Test Mikroorganizmaları Çalışmamızda Ocak β015 - Şubat β018 tarihleri arasında Afyon Kocatepe Üniversite hastanesine başvuran hastalardan alınarak Tıbbi Mikrobiyoloji laboratuvarına gönderilen kan kültürü, beyin omurilik sıvısı, periton, plevra, perikard kültürü örneklerine ait sonuçlar çalışmaya dahil edilmiştir. Toplam 1γ1γ7 adet steril vücut sıvısı örneğine ait kültür ve antifungal duyarlılık sonuçları taranmıştır. Bu amaçla, 11.8γ5 kan kültür örneği, 4γ5 periton örneği, 40γ plevral mayi örneği, geriye kalan 464 beyin omurilik sıvısı ve perikard örneklerine ait sonuçlar taranmıştır. 2.2 Primer İzolasyon Kan kültürü inkübasyonu için BACTEK FX tam otomatize kan kültür sistemi kullanılmıştır. Pozitif üreme sinyali veren örneklerin %5 koyun kanlı ve Eozin-Metilen Blue (EMB) agara pasajı alınmıştır. Rutin laboratuvara mantar kültürü amacıyla gönderilen diğer vücut sıvı örnekleri %5 koyun kanlı, EMB, Çikolata ve Subaroud Dekstroz (SDA) agara ekilerek β5ºC ve γ7ºC de 48 saat inkübe edilmiştir. Üremeler günlük olarak kontrol edilerek ve 7β saat sonunda, maya üremesi olmayan örnekler çalışma dışı bırakılmıştır. Maya üremesinden şüphe edilen örneklerden gram boyama alınmıştır. SDA’da genellikle β-γ günde üreyen, hamur kıvamında, 0,5-1 mm çapında, beyaz veya krem renkli, genellikle düzgün sınırlı ve kendine özgü maya kokusu olan kolonilerden gram boyama yapılmıştır. Gram boyamada, gram pozitif, oval veya uzamış tomurcuklu maya hücreleriyle, tek tek, bazen ikili, üçlü blastospor kümeleri ve pseudohif oluşturan maya hücreleri Candida spp. olarak tanımlanmıştır. Saf olduğu saptanan kültürlerden, identifikasyonun ileri aşamasında tür tayininde ve antifungal duyarlılık testinde kullanılmak üzere SDA besiyerine pasaj yapılmıştır. (Yücel ve Kantarcıoğlu, 1999 -Kuştimur, 1λλλ) İdentifikasyon ve antifungal duyarlılık testleri için VITEK β Tam Otomatize İdentifikasyon sistemi kullanılmıştır. Bu sistemle identifiye edilmeyenler için germ tüp deneyi kullanılmıştır. Bunun için , test edilecek koloniden öze ile bir miktar alınıp tüp içindeki 1 ml insan serumu içinde süspansiyon haline getirilmiştir. γ7ºC’de β,5-γ saat inkübe edildikten sonra süspansiyondan bir damla alınıp lam-lamel arası preparat hazırlanarak mikroskopta x40 büyütmede incelenmiştir. İncelemede ana hücreden orjin alan ve başlangıç noktasında boğumlanma yapmaksızın ve uzunluğu boyunca belirgin kabarıklık olmayan, flament şeklinde uzantılar gösteren yapılar germ tüp olarak değerlendirilip ve incelenen suşun C. albicans olduğuna karar verilmiştir. Mikroskobik incelemede germ tüpe benzeyen ancak ana hücreden boğumlanarak dışa doğru uzama gösteren hifal yapıların duvarlarının birbirine paralellik göstermediği yalancı germ tüp oluşumları da gözlenmiştir. İleri identifikasyonda bu oluşumların C. tropicalis’e ait oldukları saptanmıştır. Antifungal duyarlılık değerlerinin belirlenmesi sırasında, VITEK β sistemi ile elde edilen antifungal duyarlılık sonuçlarında dirençli olarak belirlenen antifungal ajanlar için E-test yöntemi ile doğrulamaya gidilmiştir. (Göller, 1λλλ Topçu ve ark., β00β) 3.BULGULAR Toplam 1γ1γ7 adet steril vücut sıvısı örneği sonuçları taranmıştır. 11.8γ5 kan kültür örneğinden 114, 4γ5 periton kültüründen dokuz ve 40γ plevral mayi örneğinden bir Kandida türü üremesi olmuştur. Çalışmaya dahil edilen beyin omurilik sıvısı ve perikard örneklerinde Kandida türleri izole edilmemiştir. Çalışmamızda elde ORAL PRESENTATION 41 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org edilen sonuçlara göre, 1β4 steril vücut sıvısı örneğinde Kandida üremesi olmuştur. Bunlardan, (67)%54’ünde C.albicans, (β0)%16.1’inde C.parapsilosis, (17)%1γ.7’sinde C.glabrata, (4)%γ.β’sinde C.tropicalis, (γ)%β.4’ünde C.famata, (β)%1.6’sında C.ciferrii, (β)%1.6’sında C.kefyr , (1)%0.8’inde C.lusitaniae, (1)%0.8’inde C.dubliniensis, (1)%0.8’inde C.krusei, (6)%4.8’inde Candida spp. türleri üremiştir. Bununla birlikte, Kan kültürü, periton ve plevra sıvısı örneklerinden izole edilen Kandida türlerinin Flukanazol, Amfoterisin B, Mikafungin, Vorikonazol, Flusitozin ve Kaspofungin’e karşı antifungal duyarlılık oranları belirlenmiş ve bu verilere göre Flusitozin’e karşı hiçbir kandida suşunda direnç’e rastlanmazken, genel olarak kandida türleri Flukanozole karşı en yüksek direnci göstermiştir. Flukanozole en yüksek direnci %41.1 oranında C.glabrata gösterirken, bunu %β.λ oranıyla C.albicans takip etmektedir. Bu sonuçlar, Tablo 1’de ayrıntılı olarak verilmiştir. Tablo 1. Kandida türleri ve antifungal direnç oranları Kandida Türleri Suşlar Sa yı (n/ %) 67/%54 C.albicans 20/%16.1 C.parapsilosis 17/%13.7 C.glabrata 4/%3.2 C.tropicalis 3/%2.4 C.famata 2/%1.6 C.ciferrii 2/%1.6 C.kefyr F Antifungal ilaçlar (n/%) M V C O L A MP B 2/%2.9 1/%1.4 1/%1.4 F C C S 4/%5.9 0/%0 4/%5.9 0/%0 1/%5 1/%5 0/%0 0/%0 0/%0 7/%41.1 0/%0 0/%0 1/%5.8 0/%0 2/%11.7 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 1/%33.3 0/%0 0/%0 2/%66.6 0/%0 0/%0 1/%50 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 1/%0.8 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 C.lusitaniae 1/%0.8 0/%0 0/%0 0/%0 0/%0 0/%0 0/%0 C.dubliniensis 1/%0.8 1/%100 0/%0 0/%0 0/%0 0/%0 0/%0 C.krusei 6/%4.8 1/%16.6 1/%16.6 0/%0 0/%0 0/%0 0/%0 Candida spp. 124/%100 13/%10.4 3/%2.4 2/%1.6 7%5.6 0/%0 6/%4.8 TOPLAM FL: Flukanazol, AMP B: Amfoterisin B, MC: Mikafungin, VO: Vorikonazol, FC: Flusitozin, CS: Kaspofungin 4.TARTIŞMA Mantar infeksiyonlarında görülen artış ve tür çeşitliliği tedavi başarısı açısından kaygı uyandırmaktadır. Özellikle Kandida kaynaklı infeksiyonlar son yıllarda önemli derecede artış göstermektedir. Nozokomiyal fungal infeksiyonlarda ilk sırayı C.albicans almakla birlikte antifungal tedaviye daha zor yanıt verdiği bilinen C.tropicalis, C.lusitaniae, C. krusei, C.glabrata, C.parapsilosis gibi nonalbicans türlerle karşılaşma oranı da giderek artmaktadır. Bu nedenle türlerin identifikasyonu ve direnç profillerinin belirlenmesi de oldukça önem taşımaktadır. Böylece, antifungal tedavi direnç gelişimi sorununu da beraberinde getirmektedir. (Ener, 1λλ6 Hospenthal ve ark.,2004) Kandida türleri, normalde insan deri ve mukoza florasında bulunan mikroorganizmalardır. Normal bireylerin % 30-50’sinin ağız ve gastrointestinal sisteminde bulunurlar. Mayaların normal flora elemanı olmaları nedeniyle infeksiyon etkeni olup olmadığı konusunda tanıda zorluklar yaşanabilir ve zaman zaman tanı konmakta geç kalınmış olabilir. Bu nedenle etkenlerinin doğru tespiti, türlerin ayrımı ve antifungal duyarlılık testlerinin yapılması gün geçtikçe zorunluluk haline gelmektedir. Ancak tedavide seçilen antifungallerin in vitro duyarlılığı her zaman in vivo koşullardaki duyarlılık ile uyumlu olmayabilir. (Koç, β00β – Sütçü ve ark., β017) Çeşitli çalışmalar incelendiğinde, sepsis etkenleri içerisinde kandida türlerinin üçüncü sırada yer aldığı belirlenmiştir. Ayrıca, kan kültürlerinden izole edilen mikroorganizmaların % 6 ile% 15 arasında değişen oranlarda kandida türlerinin oluşturduğu bildirilmiştir. Son yıllarda dünyada non albicans kandida türlerinin sıklığındaki artışa paralel olarak, çalışmamızda izole edilen kandida suşları arasında non albicans türlerin sıklığı da tedavi zorluğu açısından önemli bir veridir. (İnan ve Çakmakçı, 1λλ7 – Tekerekoğlu ve ark., 1λλ7 Singh,2017) ORAL PRESENTATION 42 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Amerika kıtasında bir çok merkezde yapılan bir çalışmada, kandida türlerinin, % 5γ.γ’ünü C.albicans, diğerlerini sırasıyla C. parapsilosis, C.glabrata, C.tropicalis, C.krusei, C.guillermondii ve diğer türler olarak belirlemişlerdir. ABD’de nonalbicans türler % 4γ.8 oranında, Kanada’da % 47.5 oranında, Güney Amerika’da ise % 5λ.5 oranında yer aldığı bildirilmiştir. (Pfaller ve ark, 1λλ8 - Pfaller ve ark, 2002) Yine yapılan bir diğer çalışmaya göre, kan kültürlerinden izole edilen 88 kandida suşundan γ0’unun (%34.1) C. albicans, β6’sının (%βλ.5) C. tropicalis, 15’inin (%17.1) C. parapsilosis, 8’inin (%λ.1) C. glabrata, 5’inin (%5.7) C. kefyr, 4’ünün (%4.5) C. krusei olduğu görülmüştür. (Karakoç ve ark., β007) Pfaller ve ark. yine yaptıkları bir çalışmada kan kültürlerinden izole ettikleri β047 kandida suşunun % 54’ünü C. albicans, % 16’sını C. glabrata, % 15’ini C. parapsilosis, % 10’unu C. tropicalis, diğerlerini sırasıyla C. krusei, C. guillermondii, C. lusitaniae ve diğer suşlar olarak saptamışlardır. (Pfaller ve ark, 1λλ8 - Pfaller ve ark, 2002) Çalışmamızda ise, 1β4 steril sıvı örneğinden, (67)%54’ünde C.albicans, (β0)%16.1’inde C.parapsilosis, (17)%1γ.7’sinde C.glabrata, (4)%γ.β’sinde C.tropicalis, (γ)%β.4’ünde C. famata, (β)%1.6’sında C.ciferrii, (β)%1.6’sında C.kefyr , (1)%0.8’inde C. lusitaniae, (1)%0.8’inde C.dubliniensis, (1)%0.8’inde C.krusei, (6)%4.8’inde Candida spp. türleri ürediği belirlenmiştir. Çalışmamızda elde edilen bu verilere göre sonuçların dünyada yapılan diğer çalışmalar ile uyumlu olduğu belirlenmiştir. Ülkemizde yapılan çalışmalardan birinde ise, kan kültürlerinden izole ettikleri 50 kandida suşunun % 60’ını C.albicans, % 18’ini C.parapsilosis, % 10’unu C.tropicalis ve C.krusei, C.kefyr, C.lusitaniae, C.famata ve C.glabrata olarak bildirilmiştir. (Kurt ve ark., β00β) Çalışmamıza göre sonuçlar, ülkemizde yapılan diğer çalışmalar ile de uyumlu bulunmuştur. Nawrot ve ark. yaptıkları çalışmada hematolojik rahatsızlığı bulunan çocuk ve erişkin hastaların steril vücut sıvıları ve kan örneklerinden izole ettikleri kandida suşlarının antifungal duyarlılıklarını araştırmış Flukonazol için en düşük direnç %4 ile C. albicans’ta, en yüksek direnç ise %44 oranı ile C. krusei’de saptanmıştır. Aynı çalışmada C. krusei’lerin hiçbirinde flukonazol duyarlılığı saptanmamış, suşların %56 sında ise orta derecede duyarlılık saptanmıştır. (Nawrot ve ark., β005) Antunes ve ark. Brezilya’da yaptıkları bir çalışmada kan kültürlerinden izole edilen Kandida suşlarının hiçbirinde flukonazole direnç saptamamışlardır. (Antunes ve ark., β004) Buna karşın çalışmamızda Nawrot ve arkadaşlarından farklı olarak Flukonazole karşı en yüksek direnç oranı C.glabrata’ da saptanırken C.albicans için direnç oranları benzerlik göstermektedir. Antunes ve arkadaşlarının gerçekleştirmiş oldukları çalışmada Flukonazole karşı direnç saptanmazken bizim çalışmamızda en yüksek direnç oranına sahip olan antifungal ajan Flukonazol olarak belirlenmiştir. Çalışmamızda elde edilen sonuçlara göre, steril sıvı örneklerinden izole edilen non-albicans kandida türleri oldukça geniş bir yelpazede yer almaktadır. Bu da, kandida enfeksiyonlarının tedavisinde zorlukların artması anlamına gelmektedir. Bununla birlikte, flukonazole dirençli suşlarla oluşan infeksiyonların tedavisinde alternatif ilaç olarak sırasıyla, Flusitozin, Mikafungin, Amfoterisin B, Kaspofungin ve Vorikonazol kullanılabileceği sonucuna varılmıştır. KAYNAKLAR Antunes AGV, Pasqualotto AC, Diaz MC, d’Azevedo PA, Severo LC β004. Candidemia in a Brazilian tertiary care hospital: species distribution and antifungal susceptibility patterns. Rev Inst Med Trop Sao Paulo, 46: 239- 41. Ener B 1λλ6.İnvitro antifungal duyarlılık testleriμ standardizasyon ve klinik önemi. Mikrobiyoloji Bülteni, 30:419-425. Göller S lλλλ.Klinik örneklerden izole edilen kandidaların tiplendirilmesi ve antifungal ajanlara duyarlılıkları. Izmir Dokuz Eylül Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı. Uzmanlık tezi. Hospenthal DR, Murray CK, Rinaldi GM 2004. The role of antifungal susseptibility in the therapy of candidiasis.Diag Microbiol Infect Dis, 48:153-160. İnan M, Çakmakçı M 1λλ7. Cerrahi yoğun bakım infeksiyonları. Hastane Infeksiyonları Derg, 1μ λ1-96. ORAL PRESENTATION 43 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Karakoç E , Yazgı H, Aktaş AE , Uyanık MH β007. Çeşitli Candida Türlerinin İki Farklı Triazole Duyarlılıklarının Mikrodilüsyon Yöntemi İle Araştırılması.The Eurasian Journal of Medicine,17γ-177. Koç AN β00β. Tıbbi bakımdan önemi olan candida türlerinin mikolojik özellikleri. Candida Mikrobiyolojisi ve Infeksiyonları Simpozyumu, Eskişehir, Kongre Kitabı, γ7-50. Kurt Ö, Kurt H, Bayar B, Memikoğlu KO, Azap A, Tekelli E β00β. Typing and antifungal susceptibility testing of Candida strains isolated from the blood cultures of candidemia patiens. Clinical Microbiology and infection, 8: 559. Kuştimur S 1λλλ. Antifungal duyarlılık testleri. Usataçelebi Ş, eds. Temel ve Klinik Mikrobiyoloji. Öncü Basımevi. Güneş Kitabevi. 115λ-1165 pp. Nawrot U, Nowicka J, Juszczak K, Gusin B 2007. Susceptibility to antifungal agents of Candida species isolated from paediatric and adult patients with haematological diseases. Mycoses, 48: 385-90. Pfaller MA, Jones RN, Doern GV, Sader HS, Hollis RJ, Messer SA 1998. International survelliance of bloodstream infections due to Candida species: 107 frequency of occurrence and antifungal susceptibilities of isolates collected in 1997 in the United States, Canada, and South America for the sentry program. J Clin Microbiol, 36(7): 1886-1889. Pfaller MA, Diekema DJ, Jones RN, Messer SA, Hollis RJ 2002. Trends in antifungal susceptibility of Candida spp. isolated from pediatric and adult patients with bloodstream infections: SENTRY antimicrobial surveillance program, 1997 to 2000. J Clin Microbiol, 40: 852-856. Singh M, Chakraborty A. 2017. Antifungal Drug Resistance among Candida albicans and Non-albicans Candida Species Isolates from a Tertiary Care Centre at Allahabad. J Antimicrob Agents, 3(4): 150. Sütçü M, Acar M, Erköse Genç G, Kökçü İ, Aktürk H, Atay G, Hançerli Törun S, Salman N, Erturan Z, Somer A 2017. Evaluation of Candida species and antifungal susceptibilities among children with invasive candidiasis. Turk Pediatri Ars, 52: 145-53. Tekerekoğlu MS, Durmaz B, Taştekin N, Otlu B1λλλ. Otomatize kan kültür sistemi ile üç yıllık dönemde alınan sonuçların değerlendirilmesi. λ. Türk Klinik Mikrobiyoloji ve Infeksiyon Hastalıkları Kongresi, Antalya, Kongre Kitabı. Topçu Willke A, Söyletir G, Doğanay M. Infeksiyon Hastalıkları ve Mikrobiyolojisi. İstanbulμNobel Tıp Kitabevleri, 296 pp. Yücel A, Kantarcıoğlu S β001. Hastane kaynaklı mantar infeksiyonlarının epidemiyolojisi. Cerrahpaşa J Med, 32: 259-6980. ORAL PRESENTATION 44 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org In vitro Cytotoxic Effecct of Metformin on Triple Negative Breast Cancer Cell Line MDA-MB-231 İdil Çetin Istanbul University, Faculty of Science, Department of Biology, Istanbul, Turkey Corresponding author e-mail: idil.cetin@istanbul.edu.tr Abstract Breast cancer, which is the most common type of cancer in women, is a heterogeneous disease. Triple negative breast cancer (TNBC), characterized by absence of estrogen receptor, progesterone receptor and HER2 gene expression, is known as the most aggressive type. The lack of a specific therapeutic target, as in other breast cancer types, makes the treatment process of this disease difficult. Oral hypoglycemic agent Metformin, has drawn attention with its safe use, antiproliferative effect in many types of cancer, and prolongation of patient survival. In this study, the in vitro cytotoxic effect of Metformin was evaluated on triple negative breast cancer cell line MDA-MB-231. For this purpose cell viability, cell index values obtained from xCELLigence RTCA (Real-Time Cell Analysis) DP instrument, mitotic index (MI) and labelling index (LI) analysis among cell kinetic parameters were used. Three different concentrations γ0 ηM, 65 ηM and 1γ0 ηM of Metformin were used to determine the IC 50 value. γ0 ηM concentration was determined as IC50 value. Significant decrease for all parameters was observed. Metformin offers a promising treatment modality in different breast cancer subtypes especially in TNBC subtype. Keywords: Metformin, Breast cancer, MDA-MB-231, In vitro. 1. INTRODUCTION Metformin is the most commonly prescribed oral hypoglycemic agent for patients with type 2 diabetes mellitus (Nathan et al., 2009). Metformin is a glucose-lowering agent that improves insulin sensitivity and lowers the circulating insulin level in patients with type II diabetes mellitus (Steals, 2006). It (N, N-dimethylbiguanide) belongs to the biguanide class of antidiabetic drugs (containing two linked guanidine rings) originally derived from galegine (isoamylene guanidine), a guanidine derivative found in the French lilac Galega officinalis. Among the three biguanides developed for diabetes therapy, metformin has a superior safety profile, and it is well tolerated (Viollet et al., 2012). Numerous in vitro and in vivo animal studies have demonstrated growth-inhibiting effects of metformin in breast, endometrial, lung, liver, gastric, and medullary thyroid cancer cell lines (Rizos and Elisaf). Antiproliferative effects have also been demonstrated in several hemopoietic cancer cells, including acute myeloid and promyelocytic leukemia cells. These effects are thought to stem from growth inhibition via cell cycle arrest and from increased cytotoxicity via the induction of apoptosis (Morales and Morris, 2015). Metformin has been shown to increase the cytotoxicity of many chemotherapeutic agents, including cisplatin, carboplatin, doxorubicin, and paclitaxel, and enhance tumor-free remission in vivo (Iliopoulos et al., 2011). The ability of metformin to prolong tumor remission is believed to be due to the ability of this drug to selectively kill cancer stem cells (CSCs, also known as tumor initiating cells) that are chemo-resistant and may lead to future cancer reoccurrence (Hirsch et al., 2009; Ning et al., 2013). Breast cancer is a heterogeneous disease. Prognosis of this disease is related mainly to stage and biological characterization, which defines a variety of conditions ranging from a low risk of relapse and indolent clinical course to a high relapse risk and rapid clinical progression, despite aggressive therapies (Voduc et al., 2010). ORAL PRESENTATION 45 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Triple negative breast cancer (TNBC) is a particular immunopathological subtype of breast cancer that lacks expression of estrogen and progesterone receptors (ER/PR) and amplification of the human epidermal growth factor receptor 2 (HER2) gene (Mendes et al., 2015). In this study, we investigated the antiproliferative effects of Metformin on MDA-MB-231 cell line which belongs to triple negative subtype of breast cancer. 2. MATERIALS AND METHODS Cell line The MDA-MB-231 cell line used in this study was obtained from European Cell Culture Collection (CCL). Cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (high glucose) (Gibco Lab) containing 10% fetal bovine serum (FBS, Gibco Lab), 100 ηg/ml streptomycin (Streptomycin sulphate, I. E. Ulugay), 100 IU/ml penicilin (Pronapen, Pfizer), amphotericin B (Sigma, USA) and 2 mM glutamine at 37 oC in humidified atmosphere of 5% CO2. The pH of the medium was adjusted to 7.4 with NaHCO 3. Drug Concentrations Metformin concentrations that were used in the present study were determined based on previous in vitro and clinical studies. Stock solution was prepared with methanol. Three different concentrations were prepared by dilution of stock solution. These concentrations were γ0 ηM, 65 ηM and 1γ0 ηM. Cell viability analysis Cell viability was examined using the MTT (Thiazolyl Blue Tetrazolium Bromide, Sigma, Missouri, USA) colorimetric assay. Briefly, MDA-MB-231 cells were plated in 96-well plates at a density of 3x104 cells per well and each plate was incubated for 24 hrs. After incubation, drug doses were added to each well. At the end of the experimental period, the medium in each well was removed and 40 ηl fresh MTT solution (5 mg/ml in PBS) were added into each well and cells were incubated at 37 oC for 4 hrs. Then, DMSO (Dimethyl Sulfoxide, Sigma, France) was added into each well and cells were shaked thoroughly for 1 hr on a shaker. Then, the absorbance of the samples was measured against a background control as a blank using an Elisa reader (ηQuant, Bio-Tek Instruments Inc Vermont, USA) at 450-690 nm. Real Time Cell Analyzer (RTCA): Cell Index Continuous monitoring of cell viability and dynamic changes in cell properties is crucial for cell culture studies. For this purpose real time cell analyzer (RTCA, xCELLigence, Roche) can be used for label-free and real-time monitoring of cell properties. This system is impedance-based technology and uses specially designed microtiter plates containing interdigitated gold microelectrodes to noninvasively monitor the viability of cultured cells using electrical impedance as the readout In experimental process 100 ηL of cell culture medium was added to each well for the impedance background measurement. After adding 5000 cells for per wells, the final volume was β00 ηL. The E-Plates (16 E-Plate) were incubated at γ7°C with 5% CO 2 and monitored on the RTCA system at 15-minute time intervals for up to 24 hours without treatment and following 72 hours with treatment. Mitotic index (MI) MI was determined with the Feulgen method and then stained with 10% Giemsa stain solution (pH 6.8) for a period of 3 min and washed twice in phosphate buffer. Finally, MI was evaluated by counting cells in different phases of mitosis for each tested inhibitor concentration and control, and 3000 cells were examined from each slide for MI at the minimum. 3 H-thymidine labelling index analysis For 3H-thymidine labeling index analysis, 3H-thymidine was applied at 1 ηCi/mL concentration on control and test group cells for 20 min. ORAL PRESENTATION 46 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Autoradiography After labelling, the cells were fixed with Carnoy’s fixative and the remaining radioactive material was washed twice with β% perchloric acid at 4°C for a period of γ0 min. Coverslips were coated with K.β gel emulsion (Ilford, Cheshire, UK). After exposure time autoradiograms were bathed with D-19 b developer (Kodak, New York, USA) and Fixaj B (Kodak, New York, USA). Labelled cells on each coverslip were counted. 3,000 cells were examined from each coverslip at the minimum. Statistics Statistical analysis of AI, LI, MIν Student’s t-test was used to test significance. Two-tailed p values<0.01 were considered statistically significant. Values obtained from all experimental groups were analyzed using one-way ANOVA with Dunnett’s multiple comparison test to test significance. 3. RESULTS After administration of γ0 ηM, 65 ηM and 1γ0 ηM Metformin concentrations for 24 hrs, the cell proliferation values of MDA-MB-231 cells decreased significantly. The differences between the control and all experimental groups were significant (p<0.01). As seen in Figure 1, cell proliferation values decreased from 650,570 x 10-3 to 320,928 x 10-3; 218,725 x10-3 and 209,112 x10-3 at 24 hrs respectively for γ0 ηM, 65 ηM and 1γ0 ηM. Figure 1. Absorbance values of mitochondrial dehydrogenase activity (450-690 nm) of MDA-MB-231 cells treated with γ0 µM, 65 µM and 1γ0 µM concentrations of Metformin for 24 hrs (p<0.01). As seen in Figure β, cell viability values 4λ,γγ %, γγ,6β % and γβ,14 % at β4 h respectively for γ0 ηM, 65 ηM and 1γ0 ηM according to control group which was taken as 100%. According to these data γ0 ηM concentrations of Metformin is IC50 concentration. ORAL PRESENTATION 47 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 2. Percent viability values of MDA-MB-βγ1 cells treated with γ0 µM, 65 µM and 1γ0 µM concentrations of Metformin for 24 hrs (p<0.01). Cell index values obtained from the real-time cell analysis system were examined as a result of application of Metformin to MDA-MB-βγ1 cells. γ0 µM, 65 µM and 1γ0 µM concentrations were used. When the cell index values were compared with the standard curve (Figure 3), all concentrations have cytoskeletal effect on triple negative breast cancer cell line (Figure 4). Figure 3. Standard curve of xCelligence Real-Time Cell Analysis (RTCA) system ORAL PRESENTATION 48 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 4. Cell index values of MDA-MB-231 cells treated with γ0 µM, 65 µM and 1γ0 µM concentrations of Metformin obtained from xCelligence Real-Time Cell Analysis (RTCA) system (---Control, --- γ0 µM, --- 65 µM, --- 130). After administration of 1γ0 ηM Metformin concentration for 0-72 hrs, the mitotic index values of MDA-MB-231 cells decreased significantly. The differences between the control and all experimental groups were significant (p<0.01). As seen in Figure 4, mitotic index values decreased from 5,7 to 2,97 at 24 hrs; from 6,8 to 2,18 at 48 hrs and from 7,1 to 1,16 at 72 hrs for γ0 ηM. Figure 5. Mitotic index values of MDA-MB-βγ1 cells treated with γ0 µM concentration of Metformin for 0-72 hrs (p<0.01). As seen in Figure 4, labelling index values of MDA-MB-231 cells decreased significantly. After administration of 130 ηM Metformin concentration labelling index values decreased from 6,21 to 4,18 at 24 hrs; from 7,28 to 3,21 at 48 hrs and from 7,33 to 2,18 at 72 hrs. ORAL PRESENTATION 49 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 6. Labelling index values of MDA-MB-231 cells treated with γ0 µM concentration of Metformin for 072 hrs (p<0.01). When all the evaluated parameters are examined, metformin causes statistically significant antiproliferative effects on MDA-MB-231 cells. 4. DISCUSSION Metformin is involved in many cancer researches with easy accessibility and safe use. There is substantial preclinical evidence suggesting that metformin has anti-cancer properties. In vitro and in vivo analysis of metformin has exhibited anti-proliferative activity by inhibiting intracellular pathways (Chae et al., 2016). Both AMPK-dependent and independent pathways have been proposed to mediate the anticancer effects of metformin treatment (Pulito et al., 2013). Remarkably, metformin was reported to reduce cancer incidence (Evans et al., 2005). Metformin also improved the prognosis of cancers, such as liver cancer, ovarian cancer, colorectal cancer, pancreatic cancer and breast cancer. Breast cancer patients who were treated with metformin had significantly higher survival rates than patients who did not receive metformin (Morales DR, Morris, 2015). Metformin selectively targets breast cancer stem cells, significantly reduces breast tumor growth and prolongs remission when combined with chemotherapy (Hirsch et al., 2009). TNBC cell lines are more sensitive to metformin than non-TNBC cell lines (Liu et al., 2009). In a study by Topcul and Cetin, 130 µM concentration of Metformin reduced cell viability from 100% to 52% in 24 hours (Topcul and Cetin, 2015). Our current findings suggest that metformin can be used as a therapeutic agent for triple negative breast cancer. 5. CONCLUSION This study focused on antiproliferative effects of Metformin used in the treatment of type 2 diabetes on MDAMB-231 cells originating from the triple negative subtype of the most aggressive type breast cancer. When the results were evaluated, it has been shown that the drug has a significant antiproliferative effect on these cells. This study and other in vitro and clinical studies supporting this study have shown that this drug may be effective in the treatment of cancer. However, it is important to investigate combination of Metformin with various chemotherapeutic drugs currently used or various inhibitors or extracts currently being investigated. ORAL PRESENTATION 50 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org REFERENCES Chae YK1,, Arya A, Malecek MK, Shin DS, Carneiro B, Chandra S, Kaplan J, Kalyan A, Altman JK, Platanias L, Giles F 2016. Repurposing metformin for cancer treatment: current clinical studies. Oncotarget 7 (26):40767-40780. Evans JM, Donnelly LA, Emslie-Smith AM, Alessi DR, Morris AD 2005. Metformin and reduced risk of cancer in diabetic patients. BMJ 330: 1304-1305. Hirsch HA, Iliopoulos D, Tsichlis PN, Struhl K 2009. Metformin selectively targets cancer stem cells, and acts together with chemotherapy to block tumor growth and prolong remission. Cancer Res 69: 7507-7511. Iliopoulos D, Hirsch HA, Struhl K 2011. Metformin decreases the dose of chemotherapy for prolonging tumor remission in mouse xenografts involving multiple cancer cell types. Cancer Res 71: 3196-3201. Liu B, Fan Z, Edgerton SM, Deng XS, Alimova IN, Lind SE, Thor AD 2009.Metformin induces unique biological and molecular responses in triple negative breast cancer cells. Cell Cycle 8: 2031-2040. Mendes TFS, Kluskens LD, Rodrigues LR 2015. Triple negative breast cancer: Nanosolutions for a big challenge. Advances Science 2 (11): 1-14. Morales DR, Morris AD 2015. Metformin in cancer treatment and prevention. Annu Rev Med 66: 17-29. Nathan DM, Buse JB, Davidson MB, Ferrannini E, Holman RR, Sherwin R, Zinman B 2009. Medical management of hyperglycemia in type 2 diabetes: a consensus algorithm for the initiation and adjustment of therapy: a consensus statement of the American Diabetes Association and the European Association for the Study of Diabetes. Diabetes Care 32:193-203. Ning X, Shu J, Du Y, Ben Q, Li Z 2013. Therapeutic strategies targeting cancer stem cells. Cancer Biol Ther 14: 295-303. Pulito C, Sanli T, Rana P, Muti P, Blandino G, Strano S 2013. Metformin: On ongoing journey across diabetes, cancer therapy and prevention. Metabolites 3: 1051-1075. Rizos CV, Elisaf MS 2013. Metformin and cancer. Eur J Pharmacol 705: 96-108. Staels B 2006. Metformin and pioglitazone: Effectively treating insulin resistance. Curr Med Res Opin 22 (2): S27-37. Topcul M, Cetin I 2015. Effects of metformin on cell kinetic parameters of MCF-7 breast cancer cells in vitro. Asian Pacific Journal of Cancer Prevention 16 (6): 2351-2354. Viollet B, Guigas B, Sanz Garcia N, Leclerc J, Foretz M, Andreelli F 2012. Cellular and molecular mechanisms of metformin: an overview. Clin Sci 122: 253-270. Voduc KD, Cheang MC, Tyldesley S, Gelmon K, Nielsen TO, Kennecke H 2010. Breast Cancer Subtypes and the Risck of Local and Regional Relapse. Journal of Clinical Oncology 28 (10): 1684-1691. ORAL PRESENTATION 51 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Investigation of Different Potassium Dihydrogen Phosphate(KH2PO4) Quantities on Growth and Lipid Production of Microalgae Chlorella variabilis Necla Altın1, Togayhan Kutluk1,2*,Başar Uyar1,2 Nurcan Kapucu 1,2 1 Department of Chemical Engineering, Kocaeli University, 41380 Kocaeli, Turkey 2 Alternative Fuels R&D Center, Kocaeli University, 41040 Kocaeli, Turkey Corresponding author e-mail:togay71@gmail.com Abstract Algae are living organisms that utilize solar energy most effectively, and for this reason, interest in microalgae production technology is increasingly being explored for the discovery of new components in different microalgae species. In recent years, oil and fatty acid products obtained from single-celled algae have attracted considerable attention. In this study, the effects of different potassium dihydrogen phosphate (KH2PO4) (0.005-0.020-0.080-0.160)g/L concentrations in BG11 medium on microalgeChlorella variabilis growth and lipid content (%) for biodiesel production were examined. According to the experimental results, it has been determined that growth in microorganisms in the nutrient medium prepared with low concentration is better. In the nutrient sample prepared with 0.005 g/L KH2PO4 with the maximum cell concentration Xmax = 1.810 g/L and maximum specific growth rate ηmax = 0.202 hr-1 was found. The highest amount of oil was reached (12.3%) at the same KH2PO4 concentration. Doubling times of cells were between 34 - 52 hours. Keywords: biodiesel, Chlorella, microalgae oil, phosphate stress 1. INTRODUCTION Microalgae are able to produce oil using carbon dioxide and sunlight, so that they can multiply in hours and be produced throughout the year organisms with higher crop productivity than black plants. These photosynthetic organisms give oxygen to the photosynthetic outcome center. Immortal they can make changes in their metabolism against environmental conditions; Selena andHaddadi(2017). Chlorella and Neochloris species belonging to the class Chlorophyceae have nutritional deficiencies cultures in the medium and 60% of the dry cell weight oil hey were removed Algae also require elements such as carbon source, nitrogen, phosphorus, sulfur, potassium, phosphate, magnesium to sustain their growth and development. Limitations of nutrient elements are important factors affecting the growth of microalgae species Siaut et al. (2007). There are limeted number of studies with Chlorella variabilis in literature with the aim of raising the fat content. Balcı et al.(β006) observed that the Scenedesmusobliquus species grow and protein production to different nitrate (8, 12, 16 and 20 mM) and phosphate (0.1, 0.3, 0.5 and 0.7 mM) concentrations. At different pHs (pH: 7 and pH: 8) and cultures were taken at β0 ± βºC. At both pHs, nitrate and phosphate concentrations significantly affect cell number and protein production respectively. To the highest cell number (15.5x106) and protein concentration (8.08 mg/L) pH: 7 12 mM nitrate and 0.γ mM phosphate concentration were determined. Sönmez et al.(β016) obtained the highest lipid productivity with nitrogen and phosphate under limiting conditions and Micrakinium sp. 85.4 ± β mg L-1d-1 in P-depleted It was. They also found that the amount of oleic acid increased 8-fold during Pdepletion. This paper clarifies that effects of different KH2PO4 concentrations on Chlorella variabilis microalgae growth and oil content. 2. MATERIALS AND METHODS 1.1 Materials Chlorella variabilis is a member of the Chlorellaceae family. Chlorella variabilis was taken from İstanbul Medeniyet University Department Molecular biology and Genetics. Synthetic growth media (BG11) was used ORAL PRESENTATION 52 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org in experimantal study. The chemical composition of BG11 medium (g/L); NaNO3, 1.5; KH2PO4, 0.04; MgSO4.7H2O, 0.075; CaCl2.2H2O, 0.036; H3BO3 0.003; Na2CO3, 0.02; Fe(III)citrate, 0.006; citric acid 0.006. Chemicals were analytical gradeand were purchased from Merck. 2.2. Microalgae growth Illumination of the cultures was provided continuously (24 hours) with OSRAM brand LED lambs with a value of 7W β400K to provide γ.80 klx surface light intensity. the temperature is kept constant at β5 ± β ° C. All cultures were inoculated with algae up to γ% of their volume. All glassware used was kept at 1β1 ºC for β hours before sterilization. Microalgae were cultured in 125 mL open flasks. Samples were run in an orbital shaker incubator running at 145 rpm with natural ventilation. Different potassium dihydrogen phosphate (KH2PO4) (0.005-0.020-0.080-0.160) g/L concentrations in BG11 medium were added. 2.3. Optic density (OD) and pH measurements The absorbances of the samples in quartz cuvettes were read with spectrophotometer (Jenway 6800 UV-VIS spectrophotometer) at a wavelength of 600 nm. pH measurements were done using aMettler Toledo Easy S-20K pH meter. 2.4. Harvesting of microalgae Microalgae were centrifuged at 6000 rpm for 10 minutes and dried in oven 60 °C overnight. 2.5. Lipid content analysis Lipid analysis was performed according to the method of Bligh and Dyer (1959). 0.2 grams of homogenized algae samples were stored at 105 ºC for β hours in the oven. After these samples were added a mixture of 1β0 mL methanol/chloroform (1/2). 0.4% CaCl2 solution was tadded into a samples. These samples were stirred for 3 hours at 200 rpm on a mechanical stirrer, then filtered through a filter paper. Samples were kept in dark overnight. The next day the upper layer consisting of the methanol-water mixture was separated. Chloroform was removed from the media by rotary evaporator. The residual lipid was cooled to room temperature and weighed. 3. RESULTS The time-dependent growth and pH changes of Chlorella variabilis in photobioreactorson different KH2PO4concentrations are shown in Fig. 1 and Fig. 2, respectively. Figure 1 clearly shows that the microorganism with a concentration of 0.020 g / L KH2PO4showed a steady-state growth up to 237 hours, then continued to grow rapidly until 718 hours. In the presence of 0.005 g/L KH2PO4 concentration sample, a smooth growth curve was observed up to 718 hours. At all concentrations, the death phase started after 718 hours. The maximum cell concentration (Xmax = 1.810 g / L) and the specific growth rate (ηmax = 0.β0βh-1) were reached in the nutrient medium prepared at low KH2PO4 concentration. The highest fat content produced in the microorganism is 12.3% at 0.005 g / L KH2PO4concentration. Doubling times of the cells are determined to be 34, 41, 52 and 48 hours, respectively. According to the Figure 2 at the beginning of cultures, pH values were measured between 6.00 and 6.50 then increased up to 309 hours and decreased in the following hours. Approximately after the 500 hours the pH remained constant at 8.50-9.0. The effect of KH2PO4 stress conditions on microorganism growth rate and lipid content at different concentrations is given in Table 1. ORAL PRESENTATION 53 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Biomass(gdw/L) 2,0000 1,5000 0.05 g/L 1,0000 0.020 g/L 0.080 g/L 0,5000 0.160 g/L 0,0000 0 100 200 300 400 500 600 Time (h) Figure 1. Effects of different KH2PO4 concentrations on microalgae growth 10,5 10 9,5 pH 9 8,5 0.005 g/L 8 0.020 g/L 7,5 0.080 g/L 7 0.160 g/L 6,5 6 0 200 400 600 800 1000 Time (h) Figure 2. pH changes of microalgae growth at different KH2PO4 concentrations Table 1. Effect of KH2PO4 stress conditions on microorganism growth rate and lipid content KH2PO4stress (g/L) Xmax (g/L) µmax -1 (h ) Lipid content (%) Doubling time Lipid productivity (h) (mg/Ld-1) 0.005 1.81 0.020 12.3 34 0.72 0.020 1.61 0.017 11.4 41 0.52 0.080 0.56 0.013 9.6 52 0.40 0.160 0.67 0.014 6.8 48 0.28 ORAL PRESENTATION 54 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 5. CONCLUSION Forthe first time in literature this study expresses the effect of different KH2PO4 stress conditions on microalgae growth and lipid accumulation of Chlorella variabilis. The findings show that the microalgae can be considered as a raw material for biodiesel production applications in the future. Low KH2PO4 concentrations must be applied for maximum microorganism groth rate and lipid accumulation. According to the literature, nitrogen stress is more effecite compared to the KH 2PO4 stress on the microorganism lipid accumulation. ACKNOWLEDGEMENTS The authors thank Dr. Turgay Çakmak from Istanbul Medeniyet University Department of Moleculer Biology and Genetics for donating microalgae species Chlorella variabilis. REFERENCES Siaut, M., Heijde, M., Mangogna, M., Montsant, A., Coesel, S., Allen, A., Bowler 2007. C. Molecular toolbox for studying diatom biology in Phaeodactylumtricornutum. Gene,406(1), 23-35. Balcı M., Çelekli A., Deveci A., Eyüboglu F β006. ScenedesmusobliquusTürününGelisimine, Klorofil-a ve Protein ÜretimKapasitesine pH, NitratveFosfatKonsantrasyonlarınınEtkisi, Türkiye λ. GıdaKongresiν β4β6 Mayıs. Sonmez, C., Elcin, E., Akın, D., Oktem, H. A., &Yucel, M 2016. Evaluation of novel thermo-resistant Micractinium and Scenedesmus sp. for efficient biomass and lipit production under different temperature and nutrient regimes. Bioresource technology, 211, 422-428. Bligh, E. G., & Dyer, W. J 1959. A rapid method of total lipit extraction and purification. Canadian journal of biochemistry and physiology, 37(8), 911-917. HaddaniMH, Aiyelabega HT, Negahdari B 2017. Advanced biotechnology in biorefinery: a new insight into municipal waste management to the production of high-value products International Journal Environmental Science Technology. Doi:10.1007/s1376. Selena D, Miranda M, Daniel F, Arsalon AH, Serdar O, Faisal S,Debalina S, Mahmoud MEH 2017.A review of biodiesel production from microalgae, Clean Technology Environmental 19:637–668. ORAL PRESENTATION 55 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Sulu Çözeltilerden Anhidrotetrasiklinin Giderimi İçin Lemna gibba L.’nın Kullanımının Araştırılması Murat Topal1*, Erdal Öbek2, Gülşad Uslu Şenel3, E. Işıl Arslan Topal3 *1 Munzur Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Tunceli, Türkiye 2 Fırat Üniversitesi, Mühendislik Fakültesi, Biyomühendislik Bölümü, Elazığ, Türkiye 3 Fırat Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Elazığ, Türkiye Sorumlu yazar e-mail: murattopal@munzur.edu.tr Özet Bu çalışmada, sucul bitkilerden Lemna gibba L. bitkisi kullanılarak farklı konsantrasyonlarda hazırlanan sulu çözeltilerden anhidrotetrasiklin (ATC) giderimi araştırıldı. Bu amaçla, belirli miktarda Lemna gibba L. bitkileri cam reaktörlere yerleştirildi. Her bir reaktöre 50, 100 ve γ00 ηg/L içeren anhidrotetrasiklin çözeltileri eklendi. Farklı hidrolik bekletme sürelerine göre Lemna gibba L. tarafından ATC giderim verimleri belirlendi. Lemna gibba L. bulunan reaktörler bitkili reaktörler olarak, bulunmayan reaktörler kontrol reaktörleri olarak kullanıldı. 50 ηg/L ATC içeren bitkili reaktörde en düşük giderim verimi %40,8±β,0, en yüksek giderim verimi %87,56±4,γ olarak gerçekleşti. 100 ηg/L ATC içeren bitkili reaktörde en düşük ATC giderim verimi %50,2±β,5 olarak, en yüksek ATC giderim verimi ise %λγ,74±4,7 olarak gerçekleşti. γ00 ηg/L ATC içeren bitkili reaktörde en düşük ATC giderim verimi %4γ±β,1 olarak, en yüksek ATC giderim verimi ise %λ7,λ±4,8 olarak gerçekleşti. ATC konsantrasyonunun artışıyla Lemna gibba L. tarafından giderilen ATC giderim verimi de arttı. Anahtar Kelimeler: Giderim, antibiyotik, su mercimeği, fitoremediasyon 1. GİRİŞ Modern tıbbi teknolojinin hızla gelişmesi ile antibiyotikler insanların ve hayvanların hastalıklarını tedavi etmek veya önlemek ve hayvancılık verimliliğini arttırmak için yaygın olarak kullanılmaktadır (Ren ve ark., 2018). Tetrasiklinler, insan tıbbında ve veteriner hekimlikte kullanılan en eski ve en önemli geniş spektrumlu bir antibiyotiktir (Xiong ve ark., β018). Bu bileşiklerin çözelti içinde oldukça kararsız olduğu bilinmektedir. Tetrasiklinlerin tanımlanmış ana bozunum ürünleri arasında bazıları, toksik veya farmakolojik olarak inaktiftir. Tetrasiklinin parçalanma ürünleri epitetrasiklin, epianhidrotetrasiklin ve anhidrotetrasiklindir. Anhidrotetrasiklin (ATC), asit ortamında tetrasiklinin en büyük toksik bozunma ürünlerinden biridir. ATC, şiddetli yan etkileri nedeniyle tedavi edici olarak etkili değildir (Fernández ve Dassie, β008). ATC’in toksikolojik önemi Klimova ve Ermolova (1λ76) tarafından bildirilmiştir. Klimova ve Ermolova (1λ76) yaptıkları çalışmada tetrasiklinin anhidro türevlerinin büyüyen piliç embriyoları ve aşılanmış farelerin dalak hücreleri üzerindeki toksik etkisini araştırmışlardır. Dalak hücreleri üzerindeki tetrasiklin ve ATC etkisinin karşılaştırmalı incelemesi sonucu, ATC’in tetrasiklinden 40 ila 100 kat daha düşük dozlarda kullanıldığında antikor üreten hücrelerin sayısında tetrasiklin ile aynı miktar düşüşe neden olduğu görülmüştür. Bu sonuç, ATC’in yüksek toksisitesini ortaya çıkarmıştır. dos Santos ve ark. (1λλ8), ATC' in toksik etkilerini dimetilamino grubunun (C4 üzerindeki) relatif konumuna bağlamışlardır. Son zamanlarda, göl, nehir, toprak ve hatta içme suyu da dahil olmak üzere çevrede antibiyotik kalıntıları giderek artmaktadır. Tetrasiklin kalıntılarıν genetik değişim, bakterilerde ilaçlara karşı direnç ve sonrasında insan sağlığına tehdit oluşturabilir (Ren ve ark., β018). Adsorpsiyon, mikrobiyal bozunma ve membran ayırma gibi arıtmalar tetrasiklin için etkili değildir. Sulu ortamdan tetrasiklin kalıntılarını uzaklaştırmak için çevre dostu, düşük maliyetli ve etkili bir yöntem bulmaya ihtiyaç vardır (Ren ve ark., β018). Fitoremediasyon, bitkilerin atıksudan kirletici maddeleri doğal olarak absorplama kabiliyetini kullanan düşük maliyetli ve çevre dostu iyileştirme tekniği olarak bilinir (Li ve ark., β007ν Yavari ve ark., β017). Makrofitler, doğal karakteristikleri nedeniyle, atıksuyu arıtmada kullanım potansiyeline sahiptir. Su mercimekleri, hızlı büyüyen bitkilerdir ve sudaki nutrientleri ve ağır metalleri uzaklaştırmada etkilidirler (Ng ve Chan, β017). Su mercimeği Lemna gibba L. küçük, monokotiledonlu bir su bitkisidir. Ana frondların torbalarından yavru frondlar (yaprak benzeri yapılar) ORAL PRESENTATION 56 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org geliştirerek vejetatif ve exponansiyel olarak büyür. Lemna gibba L. tarafından besin maddelerinin emilimi, bitkinin geniş frond yüzeyi nedeniyle artmaktadır (Majewski ve ark., β017). Bu nedenle, çalışmamızda sucul bitkilerden Lemna gibba L. bitkisi kullanılmıştır. Bu çalışmada, Lemna gibba L. (su mercimeği) bitkisi kullanılarak, laboratuvar şartları altında, farklı konsantrasyonlarda ATC içeren sulu çözeltilerden ATC giderimi araştırıldı. 2. MATERYAL VE METOD Çalışmamızda materyal olarak anhidrotetrasiklin ve Lemna gibba L. bitkileri kullanıldı. Anhidrotetrasiklin antibiyotik standardı %λ7 saflıkta olup Agros Organics (New Jersey, USA) firmasından temin edildi. Lemna gibba L. bitkileri ise Elazığ yöresinden doğal ortamından toplandı. Çalışmamız, laboratuvar şartları altında 600 mL ölçekli cam reaktörlerde kesikli sistem prensibine göre gerçekleştirildi. Her bir reaktöre farklı konsantrasyonlarda hazırlanan (50, 100 ve γ00 µg/L) ATC çözeltilerinden 400 mL eklendi. Sonra reaktörlere 5g olacak şekilde Lemna gibba L. bitkileri yerleştirildi. Farklı hidrolik bekletme sürelerine (HBS) göre Lemna gibba L. bitkisi tarafından ATC giderim verimi araştırıldı. Sulu çözeltilerde ATC konsantrasyonları Jia ve ark., β00λ tarafından verilen metot modifiye edilerek gerçekleştirildi. Öncelikle her bir reaktörden alınan su örnekleri Katı Faz Ekstraksiyonu (SPE) işleminden geçirildi. SPE işleminde Oasis HLB ve Oasis MAX kartuşları kullanıldı. Söz konusu kartuşlar ön şartlandırma, yükleme, yıkama ve elute işlemlerinden geçirildi. Elde edilen eluteler β mL’lik viallere alındı ve LC/MS-MS cihazı kullanılarak ATC konsantrasyonları tespit edildi. 3. BULGULAR ve TARTIŞMA Bu çalışmada, Lemna gibba L.’nın ATC giderimindeki etkinliği belirlenmiş ve elde edilen bulgular aşağıda tartışılmıştır. Oda sıcaklığında ve farklı HBS’nde ATC konsantrasyonunun Lemna gibba L.’nın giderim verimi üzerine etkisi 50, 100 ve γ00 µg/L konsantrasyonlarında araştırıldı. 50 µg/L ATC içeren bitkili ve kontrol reaktörlerde elde edilen giderim verimleri Şekil 1’de verilmiştir. Giderim verimi (%) 120 100 80 60 Lemna gibba L.'lı reaktör 40 Kontrol reaktör 20 2s 4s 8s 12s 1.gün β.gün γ.gün 4.gün 5.gün 6.gün 7.gün 8.gün λ.gün 10.gün 0 Zaman Şekil 1. ATC giderim veriminin değişimi (C o= 50 µg/L ATC) Şekil 1’e göre, Lemna gibba L.’lı reaktörün en düşük ve en yüksek ATC giderim verimleri sırasıyla, %40,8±β,0 ve %87,56±4,γ olarak gerçekleşmiştir. ATC50 için %81,γ4±4,01 oranında bir giderim 1β. saat sonunda tespit edilmiştir. Bu nedenle ATC50 konsantrasyonunda Lemna gibba L. için en uygun hasatlama süresi 1β saat olarak belirlenmiştir. Kontrol reaktöründe ise ATC50 için en düşük ve en yüksek azalma sırasıyla, %6,6±0,γ1 ve %87,4±4,γ olarak gerçekleşmiştir. 100 µg/L ATC içeren Lemna gibba L.’lı ve kontrol reaktörlerinde farklı HBS’ne karşı elde edilen giderim verimleri Şekil β’de verilmiştir. ORAL PRESENTATION 57 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Giderim verimi (%) 120 100 80 60 Lemna gibba L.'lı reaktör 40 Kontrol reaktör 20 2s 4s 8s 12s 1.gün β.gün γ.gün 4.gün 5.gün 6.gün 7.gün 8.gün λ.gün 10.gün 0 Zaman Şekil β. ATC giderim veriminin değişimi (C o= 100 µg/L ATC) Şekil β’den de görüldüğü gibi, Lemna gibba L.’lı reaktörde en düşük ATC giderim verimi %50,β±β,5 olarak, en yüksek ATC giderim verimi ise %λγ,74±4,7 olarak gerçekleşmiştir. 1β. saatten 10. güne kadar ATC giderim veriminde çok fazla değişiklik meydana gelmemiştir (%5,γ4±0,βγ). Bu nedenle ATC100 konsantrasyonunda Lemna gibba L. için en uygun hasatlama süresi 1β saat olarak belirlenmiştir. Kontrol reaktöründe ise ATC100 için en düşük azalma %40,λ±β,1 olarak, en yüksek azalma %λγ,51±4,6 olarak gerçekleşmiştir. ATC100 için hem Lemna gibba L.’lı hem de kontrol reaktörlerde giderim verimleri γ. günden sonra hemen hemen aynı olmuştur. Bu durum bize ilk γ günde Lemna gibba L.’ nın ortamda bulunan ATC’yi aktif olarak giderdiğini γ. günden sonra ise makroorganizmanın aktivitesini kaybettiğini göstermektedir. γ00 µg/L ATC içeren Lemna gibba L.’lı ve kontrol reaktörlerinde farklı HBS’ne karşı elde edilen giderim verimleri Şekil γ’de verilmiştir. Şekil γ’e göre, Lemna gibba L.’lı reaktörde en düşük ATC giderim verimi %4γ±β,1 olarak, en yüksek ATC giderim verimi ise %λ7,λ±4,8 olarak gerçekleşmiştir. ATCγ00 konsantrasyonunda Lemna gibba L. için en uygun hasatlama süresi 1β saat olarak belirlenmiştir. Kontrol reaktöründe ise ATCγ00 için en düşük azalma %β,γ+0,1 olarak, en yüksek azalma %λ7,λ+4,7 olarak gerçekleşmiştir. Giderim verimi (%) 120 100 80 60 Lemna gibba L.'lı reaktör 40 Kontrol reaktör 20 0 Zaman Şekil γ. ATC giderim veriminin değişimi (C o= γ00 µg/L ATC) ORAL PRESENTATION 58 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4. SONUÇ Bitkili reaktörlerde ATC50, ATC100 ve ATCγ00 için en yüksek giderim verimleri sırasıyla, %87,56±4,3; %93,74±4,7 ve %97,9±4,8 olarak, kontrol reaktörlerinde ise en yüksek azalma sırasıyla, %87,4±4,3; %93,51±4,6 ve %97,9±4,7 olarak tespit edilmiştir. ATC50, ATC100 ve ATCγ00 konsantrasyonlarında Lemna gibba L. için hasatlama süreleri 1β saat olarak belirlenmiştir. Sonuç olarak, sucul bir bitki olan Lemna gibba L. bitkisi kullanılarak sucul çözeltilerden ATC’nin gideriminde kullanılabileceği belirlenmiştir. TEŞEKKÜR Bu çalışma, Türkiye Bilimsel ve Teknolojik Araştırma Kurumu (TÜBİTAK Proje No. 11γY0γ5) ve Fırat Üniversitesi Bilimsel Araştırma Projeleri Yönetimi Birimi (FUBAP Proje No. MF 1βγ6) tarafından desteklenmiştir. KAYNAKLAR dos Santos HF, de Almeida WB, Zerner MC 1998. Conformational Analysis of the Anhydrotetracycline Molecule: A Toxic Decomposition Product of Tetracycline, Journal of Pharmaceutical Sciences, 87:190– 195. Fernández RA, Dassie SA 2008. Electroanalytical procedure to resolve a sample solution containing tetracycline and its toxic degraded product:Anhydrotetracycline, Journal of Electroanalytical Chemistry, 624(1–2): 121-128. Jia A, Xiaoa, Y, Hua J, Asamib M, Kunikaneb S 2009. Simultaneous determination of tetracyclines and their degradation products in environmental waters by liquid chromatography–electrospray tandem mass spectrometry. J. Chromatogr. A, 1216: 4655–4662. Klimova NE, Ermolova OB 1976. Embryotoxicity and the immunodepressive action of tetracycline and its epiand anhydro- derivatives, Antibiotiki, 21(11): 1018-1022. Li M, Wu YJ, Yu ZL, Sheng GP, Yu HQ 2007. Nitrogen removal from eutrophic water by floating-bed-grown water spinach (Ipomoea aquatic Forsk.) with ion implantation, Water Research, 41:3152-3158. Majewsky V, Scherr C, Schneider C, Arlt SP, Baumgartner S 2017. Reproducibility of the effects of homeopathically potentised Argentum nitricum on the growth of Lemna gibba L. in a randomised and blinded bioassay, Homeopathy, 106(3): 145-154. Ng YS, Chan DJC 2017. Wastewater phytoremediation by Salvinia molesta, Journal of Water Process Engineering, 15: 107-115. Ren YN, Xu W, Zhou LX, Zheng YQ 2018. Two new uranyl complexes as visible light driven photocatalysts for degradation of tetracycline, Polyhedron, 139: 63-72. Xiong W, Wang M, Dai J, Sun Y, Zeng Z 2018. Application of manure containing tetracyclines slowed down the dissipation of tet resistance genes and caused changes in the composition of soil bacteria, Ecotoxicology and Environmental Safety, 147: 455-460. Yavari S, Malakahmad A, Sapari NB, Yavari S, Khan E 2017. Nutrient balancing for phytoremediation enhancement of urea manufacturing raw wastewater, Journal of Environmental Management, 202(1): 225231. ORAL PRESENTATION 59 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Color Removal from Dyeing Wastewater with Chemical Coagulation Ezgi Oktav Akdemir*, Ahmet Çağrı Aytuna Dokuz Eylul University, Engineering Faculty, Environmental Engineering Department, İzmir, Turkey Corresponding author e-mail:ezgi.oktav@deu.edu.tr Abstract Nowadays, color removal from wastewaters containing dye is important and the color has been taken into the regulations as a parameter to be removed. In this study, color removal after chemical treatment of Reactive Red 3B textile dye with ferric trichloride (FeCl3) was investigated. In experimental studies, jar test experiments were carried out with different concentrations of dye and FeCl 3 with rapid mixing, slow mixing and settling processes. The efficiency of chemical treatment on color removal efficieny was determined by the Box–Wilson statistical experiment design. This method was used to investigate the effects of the three independent variables (dye concentration, FeCl3 concentration and settling time) on the response function (color removal efficiency) and to determine the optimal conditions maximizing the percent color removals. Dye concentration was changed between 50-250 mg/l, FeCl3 concentration varied between 50-400 mg/l and settling time was changed between 30-60 minutes during experimental studies. The Statistica 5.0 computer program was employed and the correlation coefficient (R2) between the observed and predicted color removals was 0.934. This result indicated excellent agreement between the observed and predicted values. The optimum conditions at which the highest color removal efficiency obtained were the dye concentration of 250 mg/l, the FeCl3 concentration of 200 mg/l and the settling time of 60 minutes. Color removal efficiency obtained in these conditions was 99%. Keywords: Box-Wilson experimental design, Decolorization, Dye, FeCl3 . 1. INTRODUCTION Industries that use dyes in their manufacturing processes discharge high concentrations of dyes in their wastewater effluents. Textile industry is one of the entities where 10–15% of the dye used is washed out into the wastewater effluent. Dye-contaminated wastewater released to the environment causes numerous problems such as high chemical oxygen demand (COD), increase in toxicity and a decrease in biodegradability and the growth of biota. Industries are therefore compelled by environmental legislation to remove dye from their effluents before they are released into the watercourse (Mohammed et.al., 2014; Karthik et. al., 2014). In general, dyes are difficult to remove because they are stable to light and oxidizing agents, and with low biodegradability (Buscio et.al., 2016). The most used technologies to treat wastewater containing dyes are based on physical–chemical or/and biological processes. Coagulation and sedimentation processes are known to be effective in eliminating the colors of insoluble dyes such as disperse ones. The well-known conventional coagulants such as alum, polyaluminum chloride, iron (II) sulfate and lime were widely used in the textile wastewater treatment (Robinson et.al., 2001). There are very limited numbers of works available on water treatment with direct use of FeCl 3. Papic et al. (2000) used the coagulation–flocculation process for the treatment of reactive dye wastewaters,with ferric chloride hexahydrate employed as the coagulant. They found this process very effective with a more than 99.5% colour removal. Tian and Wang (2013) used FeCl3 as a coagulant for three different sun-proof dye such as green, yellow and scarlet. They found the optimum dosages of FeCl3 as 9.6 and 8 ml when the concentration of FeCl3 was 2 g/l. Under theese conditions, the removal rates of turbidity were 86.2%, 83.6%, 93.4% and the removal rates of color were 82.7%, 61.4%, 79.0% for sun-proof green, yellow and scarlet, respectively. Kim et al. (2004) examined the decolorization of some of the most commonly used disperse and reactive dyestuffs by combination of chemical coagulation with FeCl3 and Fenton oxidation. They reported that Fenton oxidation in combination with Fe3+ coagulation was very effective for COD and dye removal. About 90% of COD and 99% of dye removals were obtained at the optimum conditions in their study. Debnath et al. (2015) used a systematic study ORAL PRESENTATION 60 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org of the interaction of FeCl3 with Congo Red (CR) performed with UV-Vis-NIR spectrophotometer. They obtained an exceptionally high removal rate of 2670 mg/g at 100 mg/L initial CR concentration and they found enhanced removal rate with increasing initial CR concentration. In the content of this study FeCl3 was used as a coagulant for the decolorization of Reactive Red HE3B. Box– Wilson statistical experiment design approach was used by considering the dye concentration, FeCl3 concentration and settling time as independent variables while were the objective functions to be optimized. The optimal conditions maximizing color removal efficiency were also determined in this study. 2. MATERIALS AND METHODS 2.1. Coagulation-Flocculation Experiments Experiments on dye coagulation and flocculation were performed using Jar-test equipment (VelpScientifica Flocculation Test Unit) given in Figure 1. Desired concentration of dye stuff (50-250 mg/L) and FeCl3 (50-400 mg/L) were added to beaker each containing 500 ml volume. The mixture was then stirred at high velocity (200 rpm) for 3 min after which the velocity was decreased to 40 rpm and this slow stirring was maintained for 45 min. Subsequently, the stirring was stopped and different settling time (30-60 min) was applied. Following the settling time, samples were collected from clear supernatant using a syringe. The collected samples were analyzed by the spectrophotometer of HACH Lange DR 6000 at 456 nm. . Figure 1. Jar Test Equipment 2.2. Design of Experiments The Box–Wilson design is a response surface methodology, which is an empirical modeling technique, devoted to the evaluation of the relationship of a set of controlled experimental factors and observed results. Basically this optimization process involves three major steps: performing the statistically designed experiments, estimating the coefficients in a mathematical model, and predicting the response and checking the adequacy of the model (Akdemir and Özer, β011). Three important operating parameters; dye concentration, FeCl3 concentration and settling time were chosen as the independent variables and designated as X1, X2 and X3, respectively. Dye concentration was changed between 50-250 mg/l, FeCl3 concentration varied between 50-400 mg/l and settling time was changed between 30-60 minutes during experimental studies. Color removal efficiency was chosen as system responses. The experiments consisted of six axial (A), eight factorial (F) and center points (C) totaling 17 experiments. Experimental conditions determined by the Box–Wilson statistical design are presented in Table 1. ORAL PRESENTATION 61 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 1. Experimental Conditions According to a Box–Wilson Statistical Design Dye concentration FeCl3 concentration Settling time (mg/L) (mg/L) (min) Axial point 250 225 45 A1 A2 50 225 45 A3 150 400 45 A4 150 50 45 A5 150 225 60 A6 150 225 30 Factorial points F1 92 326 54 208 326 54 F2 F3 208 326 36 F4 208 124 36 F5 92 124 54 F6 92 326 36 F7 208 326 54 F8 92 124 36 Center point 150 225 45 C The predicted color removal efficiency was correlated with the other independent parameters dye concentration (X1), FeCl3 concentration (X2) and settling time (X3) using Eq. (1). Y=b0+b1X1+b2X2+b3X3+b12X1X2+b13X1X3+b23X2X3+b11X12+b22X22+b33X32 (1) where Y is predicted yield; bo is constant; b1, b2 and b3 are linear coefficients; b12, b13, b23 are cross product coefficients; and b11, b22, b33 are quadratic coefficients. 3. RESULTS AND DISCUSSIONS 3.1. Box–Wilson Experimental Design Method Results Experimental results found in this study were used to determine the coefficients of the response function (Eq. (1)) using a statistical regression analysis program “Statistica”. The calculated coefficients are listed in Table 2 and they were used to calculate the predicted values of color removal efficiency. Table 2 . Coefficients of the Response Function Coefficients b0 b1 b2 b3 b12 b13 b23 b11 b22 b33 ORAL PRESENTATION Color removal 0,7519125 -0,0003364 0,0036528 -0,0201068 -0,0000068 0,0000468 -0,0000264 -0,0000011 -0,0000015 0,0002508 62 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The coefficients given in Table 2 were used in calculating predicted values of color removal efficiencies. All efficiencies obtained from experiments and calculated by the Statistica are given in Table 3. The correlation coefficient (R2) between the observed and predicted values was 0.934 indicating a good agreement between the observed and predicted values of color removal efficiencies. Table 3. Observed and Predicted Color Removal Efficiencies Observed color removal (%) Predicted color removal (%) 83.02 84.46 93.99 66.56 95.76 85.10 95.63 88.65 85.24 72.57 76.63 98.93 91.72 70.34 84.78 80.44 84.47 91.49 66.54 94.75 83.36 98.81 91.87 89.84 71.30 73.94 97.61 91.22 78.75 84.92 A1 A2 A3 A4 A5 A6 F1 F2 F3 F4 F5 F6 F7 F8 C 3.2. Color Removal The effects of dye concentration, FeCl3 concentration and settling time on the color removal efficiencies have been investigated in this study. First of all, the variation of the FeCl3 and dye concentrations on the color removal efficiency at constant settling time was investigated and the results are given in Figure 2. For all the dye concentrations examined, the increase in FeCl3 concentration up to 250 mg/l also increases the color removal efficiency. At FeCl3 concentrations above 250 mg/l, the color removal efficiency decreases with increasing FeCl3 concentration for high dye concentrations At high dye concentrations such as 200 mg/l, 93%, 99% and 91% color removal efficiencies were obtained for 50 mg/l, 250 mg/l, and 400 mg/l FeCl3 concentration, respectively. At low dye concentration such as 50 mg/l and for the same FeCl3 concentrations the efficiencies obtained were 65%, 91% and 99%, respectively. Color removal efficiency (%) 100 90 80 70 60 0 100 200 300 400 FeCl3 concentration (mg/l) Figure 2. Variation of Color Removal Efficiency with FeCl3 Concentration. Settling Time: 60 min. Dye Concentration: (♦) 50 mg/l, (▲)100 mg/l, ()150 mg/l, (■) 200 mg/l: ORAL PRESENTATION 63 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org In the second part of experiments, variation of color removal efficiency with dye concentration at different settling time was investigated. FeCl3 concentration was kept constant at 100 mg/l. Results are given in Figure 3. The increase in dye concentration also increases the color removal efficiency. 71% color removal efficiency was obtained at a dye concentration of 50 mg/l for 60 minute settling time, while the efficiency reached 99% when the dye concentration was increased to 250 mg/l. Color removal efficiency was not changed much during 30 minutes and 40 minutes settling time. However, when the settling time went up to 60 minutes, 99% color removal efficiency was reached. In the last part of experiments, variation of color removal efficiency with settling time as a function of FeCl3 concentration was investifated and results are given in Figure 4. As it can be seen from figure, color removal efficiency at low settling times is not effective. When the settling time reaches 60 minutes, the efficiency for all the concentrations of FeCl3 investigated. The highest color removal efficiency was achieved as 99% at the concentration of 250 mg/l FeCl3 and 60 minutes settling time. Color removal efficiency (%) 100 90 80 70 60 50 0 100 200 300 Dye concentration (mg/l) Figure 3. Variation of Color Removal Efficiency with Dye Concentration. FeCl3 Concentration: 100 mg/l, Settling Time () 60 min, (▲) 50 min, (■) 40 min, (♦) 30 min. Color removal efficiency (%) 100 90 80 70 60 50 20 30 40 50 60 70 Precipitation time (minute) Figure 4. Variation of Color Removal Efficiency with Settling Time. Dye Concentration: 100 mg/l, FeCl3 Concentration: () 250 mg/L, (x) 200 mg/L,( ▲) 150 mg/L, (■) 100 mg/L, (♦) 50 mg/L 5. CONCLUSION In this study, color removal by chemical treatment method using FeCl3 from wastewater containing dye was investigated. The experiments were carried out according to Box-Wilson experimental design method. The ORAL PRESENTATION 64 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org parameters of dye concentration (X1), FeCl3concentration (X2) and settling time (X3) were used to determine color removal efficiency in wastewater containing dye in jar test experiments. When the Box-Wilson experimental design method was applied for the color removal, the correlation coefficient (R2) between the color values measured in the experiments and the color values calculated by the Statistica program was found to be 0.934. This demonstrates a good agreement between the measured and calculated values and proves the applicability of the method. The optimum conditions at which the highest color removal efficiency is obtained at the end of the experimental runs are the dye concentration of 250 mg/l, FeCl3 concentration of 200 mg/l and the settling time of 60 minutes. The obtained color removal efficiecy in these conditions is 99%. REFERENCES Akdemir EO, Ozer A 2011. Efficiency of filtration process in the pretreatment of olive oil mill wastewaters (OMWW). Fresenius Environmental Bulletin, (20): 597-602. Buscio V, Crespi M, Gutierrez-Bouzan C 2016. Application of PVDF ultrafiltration membranes to treat and reuse textile wastewater. Desalination and Water Treatment, (57): 8090–8096. Debnath A, Thapa R, Chattopadhyay KK, Saha B 2015. Spectroscopic studies on ınteraction of congo red with ferric chloride in aqueous medium for wastewater treatment. Separation Science and Technology, 501(11): 1684-1688. Karthik V, Saravanan K, Bharathi P, Dharanya V, Meiaraj C 2014. An overview of treatments for the removal of textile dyes. Journal of Chemical and Pharmaceutical Sciences, 7(4): 1215–1220. Kim T H, Park C, Yang J, Kim S 2004. Comparison of disperse and reactive dye removals by chemical coagulation and Fenton oxidation. Journal of Hazardous Material, 112: 95-102. Mohammed MA, Shitu A, Ibrahim A 2014. Removal of methylene blue using low cost adsorbent: A review. Research Journal of Chemical Sciences, 4 (1): 91– 102. Papic S, Koprivanac N, Bozic AL 2000. Removal of reactive dyes from wastewater using Fe (III) coagulant. Coloration Technology, 116: 352-360. Robinson T, McMullan G, Marchant R, Nigam P 2001. Remediation of dyes in textile effluent: A critical review on current treatment technologies with a proposed alternative. Bioresource Technology, (77): 247–255. Tian Y P, Wang B 2013. Experimental study of optimal coagulation effect on three kinds of direct sun-proof dyes by FeCl3. Advenced Material Research, 690: 1504-1510. ORAL PRESENTATION 65 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The Detailed Chromosome Measurements and B-Chromosomes in Salvia virgata Hülya Doğan1*, Halil Erhan Eroğlu2, Belgin Coşge Şenkal3, Cüneyt Cesur3, Tansu Uskutoğlu3, Uğur Özkan4, Derya Altay5 *1 Bozok University,Technical Sciences Vocational School, Deparment of Seed Science, Yozgat, Turkey 2 Bozok University, Faculty of Science and Art, Deparment of Biology, Yozgat, Turkey 3 Bozok University, Agriculture Faculty, Deparment of Field Crops, Yozgat, Turkey 4 Ankara University, Agriculture Faculty, Deparment of Field Crops, Ankara, Turkey 5 Ankara University, Graduate School of Natural and Applied Sciences, Deparment of Biology, Ankara, Turkey Corresponding author e-mail: hulya.dogan@bozok.edu.tr Abstract Salvia virgata Jacq., popularly known as erysipelas, is used as wound healing and spreads naturally in Anatolia. The purpose of this study is to determine the diploid chromosome number, detailed chromosome measurements, B chromosomes and karyotype asymmetry of S. virgata. The results showed that the diploid chromosome number is 2n = 32 + 0-2B in S. virgata. The karyotype formula is 2n = 4x = 32 = 24m + 6sm + 2st. The length of chromosomes varied from 0.56 to 1.65µm. Total haploid length and mean haploid length are 18.10 and 1.1γ ηm, respectively. The centromeric index values varied from 1λ.54 to 48.57. The intrachromosomal asymmetry value (MCA) and interchromosomal asymmetry value (CV CL) are 20.28 and 28.68, respectively. The karyotype of S. virgata close to symmetric type. As a result, detailed chromosome measurements and 0-2B chromosomes of S. virgata were showed for the first time. The species has small chromosomes shaped median, submedian and subterminal. Keywords: Asymmetry index, B chromosome, Karyotype, Lamiaceae, Salvia virgata. 1. INTRODUCTION The genus Salvia L. (sage) belongs to the subfamily Nepetoideae of the family Lamiaceae. It is the largest genus of Lamiaceae with approximately 1000 species. The species which are herbaceous, shrubby or woody and annual, biennial or perennial, spread mainly in temperature and tropical areas of Eastern Asia, Western Asia, Central America and South America. The distribution centers of the species are Mediterranean region, Central Asia, Mediterranean region, Andean mountains of South America and highlands of Mexico (Alberto et al., 2003; Martin et al., 2011; Gedik et al., 2016). The Salvia species are used in traditional folk medicine as herbal tea and food in perfumery, cosmetics and pharmaceutical industry due to antibacterial, antitumoral, antidiabetic, antiseptic and antioxidant activities (Alberto et al., 2003; Martin et al., 2011; Gedik et al., 2016; Ben Khedher et al., 2017). S. virgata Jacq., popularly known as erysipelas, is used as wound healing and spreads naturally in Anatolia. This species is used against the skin diseases and blood cancer (Bayram et al., 2016). It grows at altitudes from 1 to 2400 m. in all regions of Turkey (Martin et al., 2011). Karyological studies may contain valuable information for phylogenetic and morphological studies in organisms. It was reported that genus Salvia had diverse chromosome numbers ranging from 2n = 12 to 2n = 88 (Patudin et al., 1λ75ν Markova and Ivanova, 1λ8βν Nakipoğlu, 1λλγν Alberto et al., β00γν Martin et al., β011ν Gedik et al., 2016). Some species of Salvia have 0-γ B chromosome (Nakipoğlu, 1λλγν Alberto et al., β00γν Martin et al., 2011). B chromosomes are supernumerary or accessory chromosomes, which do not follow Mendelian rules of inheritance. The purpose of this study is to determine the diploid chromosome number, detailed chromosome measurements, B chromosomes and karyotype asymmetry of S. virgata. ORAL PRESENTATION 66 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS AND METHODS The seeds of S. virgata were collected from in Yozgat (Turkey). The information regarding the collection is given below. Salvia virgata – TURKEY. Yozgat: Yozgat-Ankara way, γλ° 48' γ46'' Nν γ4° 46' 408'' E, 1216 m, 05-VII-2017. The seeds were germinated at room temperature in petri dishes. The root tips were fixed in a fixative solution (3 part glacial acetic acid – 1 part ethanol at β4 h. The roots were stored at 4ºC in ethanol (70%). The samples were hydrolysed for 10 min at 60ºC in HCl (1N). The samples were stained in aceto-orcein for 2 h and squashed in acetic acid (45%) (Eroğlu et al., β01γν Martin et al., β015ν Şahin et al., β016ν Altay et al., 2017). Karyotypes were determined using KaryoType software on a personal computer (Altınordu et al., β016). The long arm length (L), short arm length (S), total chromosome length (TCL = L + S), arm ratio (L/S), centromeric index (CI = S/[L + S] × 100) were measured. The karyotype formula was determined using the nomenclature of Levan et al. (1964). For analysis of karyotype asymmetry, two known methods were used. Peruzzi and Eroğlu (β01γ) reported the MCA parameter for intrachromosomal asymmetry index, as shown in Eqs. (1) - (2) below. A= �−� �+� � MCA = A × 100 (2) Paszko (2006) reported that the CVCL parameters for interchromosomal asymmetry index, as shown in Eqs. (3) (4) below. A = � �� � ������ ℎ � � � ��ℎ CVCL = Aβ × 100 (4) 3. RESULTS The metaphase chromosomes, monoploid ideogram and chromosomal measurement data are given in Figure 1AB, Figure 2 and Table 1, respectively. Karyotype formula, ploidy level, MCA and CVCL are given in Table 2. The measurement reports showed that the diploid chromosome number is 2n = 32 + 0-2B in S. virgata. The karyotype formula is 2n = 4x = 32 = 24m + 6sm + 2st. All chromosomes are almost median type outside submedian chromosomes 12, 15, 16 and subtelocentric chromosome 13. In the chromosomes, no satellite was observed. The length of chromosomes varied from 0.56 to 1.65µm. Total haploid length and mean haploid length are 18.10 and 1.1γ ηm, respectively. The centromeric index values varied from 1λ.54 to 48.57. A centromere with median zone has low centromeric index, unlike a centromere with telocentric zone has high centromeric index. The intrachromosomal asymmetry value (M CA) and interchromosomal asymmetry value (CVCL) are 20.28 and 28.68, respectively. The values of MCA and CVCL increase up to 100 with centromeric shift. This value refers to the most asymmetrical karyotype. Unlike the values of M CA and CVCL can be at least zero. This value refers to the most symmetrical karyotype. The karyotype of S. virgata close to symmetric type. ORAL PRESENTATION 67 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure1. Metaphase chromosomes of Salvia virgata: (A) 2n = 32 + 2B (arrowhead) (B) 2n = 32 Figure 2. Monoploid ideogram of Salvia virgata 4. DISCUSSION The results showed that the chromosome number is 2n = 32 and basic chromosome number is x = 8 in S. virgata. The Salvia species have the different levels of ploidy as x = 7, 8, 9, 10, 11, 13 (Alberto et al., 2003; Martin et al., 2011). It was reported that the diploid chromosome numbers are 2n = 16 (Markova and Ivanova, 1982; Nakipoğlu, 1λλγ) and βn = 32 (Patudin et al., 1975; Martin et al., 2011) in S. virgata. In this study, the detailed chromosome measurements of S. virgata were given for the first time. B chromosomes, which are also known as supernumerary chromosomes, are a major source of intraspecific variation in nuclear DNA. In natural plant populations, B chromosomes support large genomes and cause DNA polymorphisms (Jones et al., 2008). The B chromosomes have been observed in Salvia species (Nakipoğlu, 1993; Alberto et al., 2003; Martin et al., 2011). In this study, we observed B chromosomes in S. virgata (Figure 1A), which is the first report of S. virgata. Karyotype asymmetry was determined by using MCA (intrachromosomal) and CVCL (interchromosomal) methods. Acoording to the MCA and CVCL values, the karyotype of S. virgata close to symmetric type. ORAL PRESENTATION 68 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 1. The measurement data of chromosomes of Salvia virgata Chromosome L/S CI TCL L S Chromosome Pair (μm) (μm) (μm) Type 1 1.65 1.04 0.61 1.70 m 36.97 2 1.60 0.88 0.72 1.22 m 45.00 3 1.40 0.72 0.68 1.06 m 48.57 4 1.37 0.80 0.57 1.40 m 41.61 5 1.35 0.78 0.57 1.37 m 42.22 6 1.30 0.69 0.61 1.13 m 46.92 7 1.18 0.66 0.52 1.27 m 44.07 8 1.17 0.62 0.55 1.13 m 47.01 9 1.12 0.63 0.49 1.29 m 43.75 10 1.10 0.62 0.48 1.29 m 43.64 11 1.08 0.57 0.51 1.12 m 47.22 12 1.05 0.68 0.37 1.84 sm 35.24 13 0.87 0.70 0.17 4.12 st 19.54 14 0.73 0.43 0.30 1.43 m 41.10 15 0.57 0.42 0.15 2.80 sm 26.32 16 0.56 0.40 0.16 2.50 sm 28.57 Abbreviations: total chromosome length (TCL), long arm length (L), short arm length (S), arm ratio (L/S), centromeric index (CI), median (m), submedian (sm), subterminal (st) Table 2. The karyotype formula, ploidy level and asymmetry values of Salvia virgata Karyotype formula Ploidy level MCA CVCL 2n = 32 + 0-2B 24m + 6sm + 2st 4x 20.28 28.68 5. CONCLUSION As a result, detailed chromosome measurements and 0-2B chromosomes of S. virgata were showed for the first time. The species has small chromosomes between 0.56-1.65 µm shaped median, submedian and subterminal. The chromosomal can support morphological characters. The genus Salvia has many taxa unknown detailed chromosomal data. More chromosomal data are needed to contribute to the cytotaxonomy of Salvia. ACKNOWLEDGEMENTS This work was financially supported by Scientific Research Projects Fund of Bozok University (Project No: 6602A-ZF/17-75). REFERENCES Alberto CM, Sanso AM, Xifreda CC 2003. Chromosomal studies in species of Salvia (Lamiaceae) from Argentina. Botanical Journal of the Linnean Society, 141: 483-490. Altay D, Eroğlu HE, Hamzaoğlu E, Koç M β017. Karyotype analysis of some taxa of Dianthus section Verruculosi (Caryophyllaceae, Sileneae). Turkish Journal of Botany, 41: 367-374. Altınordu F, Peruzzi L, Yu Y, He XJ β016. A tool for the analysis of chromosomesμ KaryoType. Taxon, 65μ 586592. ORAL PRESENTATION 69 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Bayram M, Yılar M, Özgöz E, Kadıoğlu İ β016. Ada Çayı (Salvia virgata Jacg.) tohumlarının bazı fiziksel özelliklerinin belirlenmesi. Nevşehir Bilim ve Teknoloji Dergisi, 5: 325-331. Ben Khedher MR, Ben Khedher S, Chaieb I, Tounsi S, Hammami M 2017. Chemical composition and biological activities of Salvia officinalis essential oil from Tunisia. EXCLI Journal,16: 160-173. Eroğlu HE, Şimşek N, Koç M, Hamzaoğlu E β01γ. Karyotype analysis of some Minuartia L. (Caryophyllaceae) taxa. Plant Systematics and Evolution, 299: 67-73. Gedik O, Kıran Y, Emre İ, Kürşat M β016. Karyological notes for seven Salvia L. taxa grown in Turkey. Cytologia, 81: 395-402. Jones RN, Viegas W, Houben A 2008. A century of B chromosomes in plants: so what? Annals of Botany, 101: 767-775. Levan AK, Fredga K, Sandberg AA 1964. Nomenclature for centromeric position on chromosomes. Hereditas, 52: 201-220. Markova ML, Ivanova PS 1982. Karyological study of the genus Salvia L. in Bulgaria. Filologija (Sofia), 20: 319. Martin E, Çetin Ö, Kahraman A, Celep F, Doğan M β011. A cytomorphological study in some taxa of the genus Salvia L. (Lamiaceae). Caryologia,64: 272-287. Martin E, Karaman SE, Aytaç Z β015. Karyological studies on Oxytropis (Fabaceae) from Turkey. Caryologia, 68: 357-362. Nakipoğlu M 1λλγ. Türkiye'nin Salvia L. türleri üzerinde karyolojik araştırmalar II. S. viridis L., S. glutinosa L., S. virgata Jacq., S. verbenaca L., S. argentea L. Türk Botanik Dergisi, 17μ 157-161. Patudin AV, Yurtsev VN, Pakaln DA 1975. Chromosome number in some species of Salvia L. (Lamiaceae). Botaničeskii Žhurnal (Moscow & Leningrad), 60μ 5βλ-534. Paszko B 2006. A critical review and a new proposal of karyotype asymmetry indices. Plant Systematics and Evolution, 258: 39-48. Peruzzi L, Eroğlu HE β01γ. Karyotype asymmetryμ again, how to measure and what to measure? Comparative Cytogenetics, 7: 1-9. Şahin E, Eroğlu HE, Hamzaoğlu E, Koç M β016. Karyotype analysis of four species of Dianthus section Fimbriati (Caryophyllaceae, Sileneae). Caryologia, 69: 267-272. ORAL PRESENTATION 70 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Kentsel Çevrelerdeki Biyoçeşitlilik Çalışmaları Meryem Bingül Türk*, Salih Doğan Erzincan Üniversitesi, Fen Edebiyat Fakültesi, Biyoloji Bölümü, Erzincan, Türkiye Sorumlu yazar e-mail: mbingul@erzincan.edu.tr Özet Yaşam alanları olarak kentler birer insan ekosistemleridir. Kentler, insanların toplu ve sosyal yaşam isteğine bağlı olarak oluşan bir yaşam biçimi ve mekânı olarak kabul edilmektedir. Kentlerin yaşanabilir olmasında göz ardı edilemeyen unsurdan birisi de biyoçeşitliliktir. Kent içerisinde yer alan bitki ve hayvan türlerinin sayıca zenginliği ve bolluğu, o kentin biyolojik çeşitliliği olarak değerlendirilir. Günümüzde, sürdürülebilir nitelikte kent ekosistemlerinin geliştirilmesi ve koruma bilincinin oluşturulması için kentlerin biyolojik çeşitliliğinin belirlenmesi gerekmektedir. Bu çalışmada, kentsel biyoçeşitliliğe dayalı araştırmalar irdelenmiştir. Yapılan literatür taraması sonucunda kentsel çevrelerdeki biyoçeşitlilik çalışmalarının belli organizma grupları ile sınırlı kaldığı ve bu çalışmaların az sayıda olduğu ortaya konmuştur. Kentsel ekosistem özelliği taşıyan çevrelerdeki biyolojik çeşitliliğinin ortaya çıkarılarak, yerel biyolojik zenginliği desteklemek ve sürdürülebilir yaşam alanları oluşturmak amacıyla bu konudaki çalışmalara hız verilmesi gerektiği düşünülmektedir. Kentsel çevreler nesli tehlike altında olan çok sayıda türü içlerinde barındırabilmektedir. Günümüzde dünya nüfusunun yarıdan fazlası şehirlerde yaşamaktadır ve gelecekte bu oranın daha da artacağı düşünüldüğünde kentsel yaşam alanlarının önemi daha da artacaktır. Anahtar Kelimeler: Biyoçeşitlilik, Çeşitlilik Kaybı, Kent, Yaşam Alanı. 1. GİRİŞ Kentler yaşam alanı olarak, doğal ve kültürel birçok ögenin etkileşim içinde olduğu insan ekosistemleridir (Karadağ, β00λ). Uygarlık tarihinin başlangıcı olarak kabul edilen kentsel mekânlar, insanların toplu veya sosyal yaşam isteğini ortaya koyan bir yaşam şekli ve mekânı olarak değerlendirilmektedir (Gül ve Küçük, β001). Kentsel yeşil alanlar, kente estetik kazandırıp değer katan, doğru kullanıldığı zaman kente kimlik kazandırıp karakterini ve yaşanabilirliğini etkileyen önemli yerlerdir. Kentsel çevreler, yarı doğal habitatlardan, açık alanlara, parklara ve insanlardan yoğun şekilde etkilenen çevrelere kadar değişen birçok doğal alanı barındır (Atabeyoğlu ve Bulut, β01βν Bingül ve ark., 2016). Bir kentin genel karakterini, mimari yapıları, açık-yeşil alanları, bunların etkileşimi ve bütünlüğü belirler. İnsan ve doğa arasındaki bozulan ilişkileri dengelemede ve kentsel yaşam şartlarının iyileştirilmesinde açık-yeşil alanların önemli bir yeri vardır (Gül ve Küçük, β001). Biyoçeşitlilik, kentlerin yaşanabilir olmasında görmezden gelinmesi mümkün olmayan unsurlardan birisidir. Kent içerisinde yer alan bitki ve hayvan çeşitliliği ve bolluğu, o kentin biyolojik çeşitliliği hakkında bilgi vermektedir. Günümüzde, etkin yeşil alan ve tabiattan yoksun olan kentlerdeki sınırlı sayı ve çeşitteki bitki ve hayvan varlığı, hızlı nüfus artışı, kirlilik ve kentleşmenin neden olduğu diğer çevre sorunları nedeniyle olumsuz etkilenmektedir (Uslu ve Shakouri, 2013). Biyoçeşitlilik, genetik olarak farklı olan ve değişik işlevlere sahip canlı türlerinden oluşan, çeşitli ekosistemlere dağılmış, sayı ve tür bakımından zengin canlı topluluklarının oluşturduğu yaşam dünyalarıdır. Çevremizde var olan çeşitlilik bir değişimin sonucudur ve bu değişim γ,β milyar yıldan beri devam etmektedir (Doğan ve ark., 2010). Bu ekolojik miras üzerinde insanoğlunun çok fazla olumsuz etkisi vardır. Öyle kiν son β00 yıl içerisinde yok olan tür sayısı, 65 milyon yıl öncekine kıyasla çok daha fazla olmuştur. Kentsel yeşil alanlarda biyoçeşitliliğin desteklenmesi kentlerin ekolojik kalitelerinin gelişmesini sağlamaktadır (Uslu ve Shakouri, 2013). Kentsel alanlar hızlı nüfus artışına bağlı olarak hızla genişlemektedir. Bu kentsel genişleme, doğal kaynakları büyük oranda etkilemekte ve başlıca tarım arazilerini tüketmekte, dolayısıyla ekosistemleri ve biyoçeşitliliği olumsuz yönde etkilemektedir (Pouya ve Pouya, 2017). Kentsel gelişimim biyoçeşitlilik üzerindeki en büyük ORAL PRESENTATION 71 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org etkisi, yaşam ortamları üzerinedir. Kentleşme nedeniyle doğal vejetasyonun yok olması, egzotik türlerin yaygınlaşması, doğal mekânların kaybı veya parçalanması ya da izole edilmesi, birçok canlının yaşam ortamlarına olan zararlardır (Uslu ve Shakouri, β01γ). Kentleşmenin en büyük sorunlarından birisi habitat parçalanmasıdır. Habitat parçalanması, genellikle habitat kaybı ve habitatın başka bir yere ayrılmasını kapsayan geniş arazi ölçeğindeki oluşum olarak tanımlanmaktadır. Bugüne kadar yapılan çalışmalar habitat kaybının biyolojik çeşitlilik üzerinde sürekli olarak olumsuz etki yaptığını ortaya konmuştur (Karakaş, β017). Kentsel Biyoçeşitlilik İle İlgili Çalışmalar Günümüzde küresel iklim değişikliği, çevre kirliliği, doğal habitatların hızla bozulması ve yok olması, ekonomik yönü olan türlerin aşırı kullanımı ve istenmeyenlerin yok edilmesi gibi nedenlerle canlılık dünyası ciddi tehdit altında bulunmaktadır. Bazı doğaseverler insanoğlunun geçmişte gerçekleşen yok oluşlara eşit düzeyde kitlesel yok oluşa neden olduğunu söylemektedir. Diğer bazıları, bu süreci tersine çevirmek için bir şeyler yapılmazsa insanoğlu ile beraber diğer tüm canlıların yok olacağını, dünyada yaşamın sonunun geldiği öngörüsünde bulunmakta tereddüt etmezler (Lévêque ve Mounolou, β008). Bu nedenle, biyoçeşitliliğin belirlenmesi, izlenmesi ve koruma altına alınarak gelecek nesillere bir miras olarak bırakılması önem taşımaktadır (Bingül ve ark., 2016). Ülkeler için doğal ortam özelliklerinin ve bu doğal ortamların barındırdıkları biyolojik zenginliklerin belirlenmesi ve bunlar ile insanlar arasındaki etkileşimin açıklanması son derece önem arz etmektedir. Dolayısıyla biyolojik zenginliklerin tespiti öncelikli konular arasında yer almaktadır. Zenginlik, aslında hangi boyutlarda sahip olunduğunun farkına varılarak, sürdürülebilir kılınmasına bağlıdır. Bu nedenle, her ülke kendi biyolojik zenginliğini belirlemek ve korumak zorundadır (Bingül ve ark., 2016). Aşağıda yurt içi ve dışında yapılmış kentsel biyoçeşitlilik çalışmaları kronolojik sırayla sunulmuştur. Savard vd. (2000), çalışmalarını kuşlarla sınırlı tutarak biyoçeşitlilik ve kentsel ekosistemler üzerinde durmuştur. Mckinney (2002), kentsel gelişmenin yerel ekosistemlere nasıl zarar verdiğini değerlendirmiş ve bunu iki şekilde açıklamıştır. Birincisi, doğal habitat alanlarının korunması gerektiğiν ikincisi ise ekolojik olarak toplum bilincini geliştirmeye yönelik hizmetler verilmesi gerektiğini savunmuştur. Mckinney (β008), kentleşmenin bitki ve hayvanlar üzerindeki etkilerini araştırmış ve sonuçta tür zenginliğinin aşırı şehirleşmeye sahip alanlarda yani kent merkezlerinde düşük olduğunu ancak kırsal çevrelerde anlamlı farklılıklar gösterdiğini belirlemiştir. Goddard vd. (2009), kentsel biyolojik çeşitliliği artırmak için yeşil alanların yönetiminden ve arazi kullanımlarından bahsetmiş ve uygun ölçekte bahçe ve yönetimlerinin nasıl olması gerektiğini açıklamıştır. Strohbach vd. (β00λ), Almanya’daki kuş çeşitliliğini nüfus yoğunluğu, hane halkı geliri, işsizlik ve kentsel yeşil alanlar gibi çeşitli açılardan açıklamaya çalışmış ve yüksek statüye sahip semtlerde, orman kalıntıları, parklar ve nehir boyunca daha yoğun olduklarını ortaya çıkarmışlar ve bu türlerin geleceği açısından zengin yeşil alanların korunması gerektiğini savunmuşlardır. Kowarik (β011), biyoçeşitliliğin kentleşme üzerindeki etkisi ve farklı koruma yaklaşımları üzerinde durmuş ve kentsel ekosistemlerin tüm farklılıklarını dikkate alarak incelemiştir. Barrico vd. (β01β) tarafından yapılan çalışmada, Portekiz’in Coimbra kentindeki vasküler bitki ve makromiset çeşitliliği araştırılmış ve sonuçta bitkilerden β87, makromisetlerden λ6 takson kaydedilmiştir. Bennett ve Lovell (β014) tarafından hem çim hem de çayırlık alana sahip altı Şikago parkında yararlı eklembacaklı türleri (avcı hayvanlar ve arılar) ve avcılık faaliyetleri karşılaştırılmıştır. Çalışmada arıların bolluğunun, Ağustos ayına kadar çimene kıyasla çayırda önemli ölçüde daha yüksek ve yaz boyunca avcılığının daha yüksek olduğu tespit edilmiştir. Yırtıcılık hizmetlerinin Haziran ayında çim ve çayır arasında belirgin bir farklılık göstermezken, yaz mevsiminde çayırda sürekli artarak Ağustos ayına kadar belirgin olduğu belirtilmiştir. Kentlerdeki çim sahası ve çayırlık alanların eklembacaklı bolluğunu ve ekosistem hizmetlerini desteklediği tespit edilmiştir. Doğan vd. (β015), Amsterdam şehir merkezindeki Flevopark’tan topladıkları oribatid akar türlerini değerlendirmiş ve 1β akar türü kaydetmiştir. ORAL PRESENTATION 72 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Carrus vd. (2015), Bari, Floransa, Roma ve Padua’da kent içi ve çevresindeki yeşil alanların biyolojik çeşitliliğe etkilerini araştırmış ve insanların refahı için böyle alanların daha fazla korunması gerektiği sonucuna varmışlardır. Akimov ve Nebogatkin (β016), kentsel peyzaj alanlarındaki sert keneler ile ilgili çalışmaların tarihini gözden geçirerek bir derleme yapmışlar ve sonuçta 68 ülke ve 7λγ şehirdeki kenelerle ilgili çalışmaları bibiliyografik olarak sunmuşlardır. Gunnarsson vd. (β017) biyoçeşitlilik ve çevreyle ilgili tutumların kentsel yeşil alanın görsel ve işitsel algılamalara etkilerini araştırmıştır. Çalışmayı kapsamında araştırmacılar İsveç’in Göteborg kentinde yüksek, orta ve düşük olmak üzere üç biyoçeşitlilik kategorisi oluşturmuş ve çalışmayı altı alanda yürütmüşlerdir. Hane halklarına kentsel yeşil alanın estetik algısı, ses algısı ve kuş türlerinin algılanmasında ağaçların ve bitkilerin önemi üzerine anket yapmış ve çevreyle ilgili tutumların yeşil alan algılamalarını etkilediği sonucuna varmışlardır. Borysiak vd. (β017) Polonya'nın Poznań kentindeki bahçelerinin doğal vasküler florasını değerlendirerek tür çeşitliliğini belirlemeye çalışmıştır. Çalışmada hisseli bahçelerin kentsel yeşil altyapı içindeki özel konumu ortaya çıkarılarak kullanıcıların yerel biyoçeşitliliği şekillendirmedeki rolü araştırılmıştır. Çalışma kapsamında 11 tahsisli bahçe mülkünden 358 doğal bitki türü kaydetmiştir. Gallo vd. (β017) kentsel yeşil alanların, yaban hayatı yaşam alanı olarak nasıl işlev gördüğünü değerlendirmek için ABD’nin Illinois eyaletine bağlı Şikago bölgesi boyunca şehir parkları, mezarlıklar, golf sahaları ve doğal alanlardaki memelilerin çeşitliliği ve kommunite dinamiklerini tahmin etmeye çalışmıştır. Sonucunda kentsel yeşil alanların, şehirlerde biyolojik çeşitliliğin korunması ve sürdürülebilirliği için farklı katkılar sağladığını ve kolektif etkili önemli habitatlar oluşturduğunu belirtmiştir. Xu vd. (β018) Çin Şanghay'daki Yeni Jiangwan yerleşim yerinde, β00β yılından β01γ yılına kadar olan arazi örtüsü verileri ve kuş kayıtlarını toplamış ve analiz etmiştir. Kentsel gelişim nedeniyle çalılık ve sulak alanların β01γ sonuna kadar sırasıyla % 87,γ ve % 8β,4 oranında düştüğünü ortaya koymuş ve sonuç olarak habitat kaybı ve parçalanmasının kuşların çeşitlilik üzerindeki etkilerinin değişik kuş popülasyonlarında farklılık gösterdiğini saptamışlardır. Ülkemizdeki kentsel biyoçeşitlilik çalışmalara bakıldığındaν Alaoğlu (1λ84) Erzurum ve Erzincan’daki meyve ağaçları ve asmalar başta olmak üzere diğer ağaç ve çalılardan eriophyoid akarları belirlemiş ve sonucunda Eriophyidae familyasından 17 tür, Rhncaphytoptidae familyasından ise 1 tür tespit etmiştir. Zengin (2001), Erzincan ilinin açık ve yeşil alanlarını incelemiş, bu alanların erişilebilirlikleri, niteliksel ve niceliksel özelliklerini irdelemiş ve sonucunda kent için uygun açık ve yeşil alan sistemi önermiştir. Ortaçeşme vd. (β005) tarafından Antalya ilinde, Büyükşehir Belediyesi ve alt belediyeler olan Muratpaşa, Kepez ve Konyaaltı belediyeleri düzeyinde aktif yeşil alanların mevcut durumu araştırılmış ve kent genelinde γλγ aktif yeşil alanın varlığı saptanmıştır. Doygun ve Ok (β006) ve Kahramanmaraş kentinin açık-yeşil alanlarının ağaçlandırma çalışmalarını değerlendirmiş ve bu konuda öneriler sunmuştur. Yine Sandal ve Karademir (β01γ) Kahramanmaraş’ta yeşil alanların yeterliliği ile halkın beklentilerinin ve bilinç düzeylerinin belirlenmesine yönelik çalışmalar yürütmüştür. Acar vd. (β007) Trabzon’un peyzaj alanlarındaki bitki türlerinin dağılımına bakıp bunlara ilişkin sayısal verileri kaydetmişlerdir. Avcı (β008) ve (2014) İstanbul’u doğal bitki örtüsü ve faunistik özellikleri bakımından değerlendirmiş ve İstanbul’un doğal alanlarını tehdit eden en önemli unsurun beşerь faktörler olduğunu ortaya koymuştur. Uslu ve Shakouri (β01γ), kentsel alanlarda biyolojik çeşitliliği destekleyen, kent ekolojisini zenginleştiren peyzaj tasarım araçlarını açıklamış ve bu maksatla yapılan projeleri, uygulamaları ve yöntemleri irdelemiştir. Yeşilayer ve Çobanoğlu (β01γ), İstanbul’da park ve süs bitkilerinden toplanan rafignathoid akarları değerlendirmiş ve iki familyaya ait 7 tür tespit etmişlerdir. ORAL PRESENTATION 73 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Selim vd. (2015) kentsel alanlardaki biyoçeşitliliği destekleyici olanakları tartışmış, koruma ve kullanma dengesini sağlamaya yönelik öneriler sunmuştur. Çalışmada, kentlerde biyoçeşitliliğin devamlılığı için öncelikle nadir ve endemik türlere yönelik koruma yaklaşımlarının uygulanması, kentsel arazi kullanımlarının belirlenmesinde ekolojik odaklı yaklaşımların geliştirilmesi, yeşil altyapı sistemlerinin tasarlanması gibi uygulamaların gerekliliği üzerinde durulmuştur. Bursalı ve Keskin (β016) tarafından yapılan çalışmada Erzincan il genelinde 16 kene türünün varlığı rapor edilmiştir. Bingül vd. (β016) ve Doğan vd. (β016) Erzincan il merkezinde kent yaşamına uyum sağlamış olan bazı akar türlerini CBS ile analiz etmiş, konuma dayalı analiz tekniklerini kullanarak kent merkezindeki familya ve tür seviyesindeki dağılışlarını dijital haritalar üzerinde göstermiş ve farklı habitatların barındırdığı akar çeşitliliğini ortaya çıkarmıştır. Bingül vd. (β017) kent yenileme faaliyetlerinin arttığı Erzincan şehir merkezinden akarlar için uygun yaşam alanlarından toprak, döküntü ve yosun numuneleri almış ve Oribatida içerisinde yer alan β0 familyaya ait toplam β5 akar türünü belirlemiştir. Bunlardan iki oribatid türünü Türkiye akar faunası için yeni kayıt olarak belirlemiş ve mevcut çalışmada bu türlerin kısa tanımlarını yapıp, dünyadaki dağılımlarına yer vermiştir. Çalışkan vd. (β017) Mersin ili park ve peyzaj alanlarında bulunan süs bitkilerindeki unlubit (Hemipteraμ Pseudococcidae) türlerini saptamayı amaçlamış ve çalışma sonucunda toplanan 108 örnekten β cinse ait 4 tür tespit etmiştir. Ayalp (β017), birinci derecede arkeolojik sit kategorisine giren Küçükyalı Arkeopark’ın (İstanbul) doğal florasını incelemiş, 4λ familyaya ait 14β cins içinde β08 damarlı bitki ile 16 kültür/egzotik türü olmak üzere toplam ββ4 takson tespit etmiştir. Sever Mutlu vd. (2017), Antalya ilinin bazı ana yol güzergâhlarındaki ağaç çeşitliliğini belirleyerek, yürütülen ağaçlandırma faaliyetlerini değerlendirmişler ve bu faaliyetlerden sorumlu kent ormancıları ve belediye çalışanlarına önerilerde bulunmuşlardır. Yücekaya ve Kocatürk (β017) Kilis ili imar planı üzerinde kentsel yeşil alanların büyüklüklerini hesaplayarak, imar mevzuatında öngörülen standartlara göre niceliksel yeterlilikleri incelemiş, sonraki aşamada, Kilis’te bulunan 51 parktan belirli bir büyüklüğün üzerinde olan 16 parkı niteliksel ölçütler doğrultusunda incelemiş ve bu parklar arasından seçilen γ parkta anket uygulaması yapmışlardır. Bu doğrultuda, niceliksel değerlendirmelerde, Kilis’te kişi başına yeşil alan miktarının γ,71 m2 düştüğünü, bu değerin imar mevzuatında belirtilen kişi başına düşen 10 m2 yeşil alan standardının çok altında kaldığını belirtmişlerdir. Niteliksel değerlendirmelerde ise Kilis kentinde parklar ve yeşil alanların, kent makroformu içerisinde dengeli bir dağılım göstermediğini saptamışlardır. Elde edilen veriler ve yapılan değerlendirmeler birbirleriyle karşılaştırıp, sentezlenerek Kilis kenti yeşil alanlarının dengeli dağılımı, yapılaşmış çevrelerle bir bütünlük oluşturabilmesi ve kentin yaşam kalitesini yükseltmesi açısından niteliksel ölçütleri odak noktasına alarak çeşitli öneriler sunmuşlardır. Yücesu vd. (β017) Kırklareli kent merkezine ait açık ve yeşil alanları mevcut ve plandaki durumlarıyla analiz etmişlerdir. Araştırma sonucundaν Kırklareli kent merkezi genelinde kişi başına 1,6 m 2 yeşil alan düştüğü saptanmış ve bu değerin yürürlükte olan imar mevzuatında öngörülen standardın çok altında olduğunu belirtmişlerdir. Diğer taraftan, kentsel alanda bulunan 1β mahallenin yeşil alan miktarlarında önemli değişiklikler saptanmış ve yeşil alanların kentsel alanın tamamında mekânsal dağılımının düzenli olmadığını belirtmişlerdir. Araştırma ile kentin mevcut açık ve yeşil alan varlığının korunmasına ve iyileştirilmesine dikkat çekerek kent ve yakın çevresindeki açık ve yeşil alanlarını peyzaj planlama ilkeleri çerçevesinde ele alarak bir sistem önerisi getirmişlerdir. Zencirkıran ve Seyidoğlu Akdeniz (β017), Bursa’da dört kent parkın odunsu taksonlarını ekolojik tölerans kriterlerini dikkate alarak değerlendirmiştir. Araştırmacılar Bursa kent parkları tasarımında kullanılan odunsu taksonların 5γ familya içerisinde yer aldıklarını tespit etmiş, Reşat Oyal Kültür Parkında 54, Soğanlı Botanik Parkta 182, Merinos Kent Parkında 4λ, Hüdavendigar Kent Parkında ise 76 odunsu taksonun kullanıldığını belirtmişlerdir. Çalışmada odunsu bitki taksonları su tüketimleri, ışık istekleri ve ekolojik toleransları yönünden analiz edilmiş ve sonuçta Reşat Oyal Kültür parkının en eski park olmasına rağmen tüm faktörler bakımından ORAL PRESENTATION 74 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org uygun tasarım bitkilerinin kullanıldığı, su tüketimleri düşük ve ekolojik töleransı yüksek bitki taksonları dikkate alınarak tasarlandığı ortaya konmuştur. Son yıllarda, insanın doğaya olan özlemini gidermek ve kentsel yaşam kalitesini yükseltmek için kentlerde kişi başına düşen yeşil alan miktarını artırma çabaları kent için önemli bir konu haline gelmiştir. Bu amaçla kentlerde yeşil alan oluşturmak üzere binaların çatılarını ve duvarları yeşillendirme çalışmaları artmıştır. Yaşayan çatılar veya ekolojik çatılar olarak da tanımlanan bitkilendirilmiş çatılarν mikroorganizmalar, eklembacaklılar ve kuşlar için uygun kentsel yaşama alanları oluşturmaktadır. Özellikle Avrupa’da son yıllarda yaygınlaşan yeşil çatıların biyolojik çeşitliliği üzerine sınırlı sayıda çalışma yapılmıştır. Bu çalışmalarda, yeşil çatıların toprağa göre düşük olsa da örümcek, akar ve böcek gibi eklembacaklı çeşitliliği barındırdığı ve bu eklembacaklı türlerinin çoğunun kuraklığa dayanıklı sıçrarkuyruklu ve kserofilik akarlardan oluştuğu bildirilmiştir (Doğan, β00λ). Schrader ve Böning (β006), Almanya’daki eski ve yeni çatılardan numune alıp, kollembol bolluğu ve türlerini belirlemeye çalışmış, sonuçta eski çatılarda kollembol yoğunluğunun yeni çatılara oranla daha fazla olduğunu ortaya koymuştur. Rumble ve Gange (β01γ), Londra’da 14 ay boyunca yeşil çatılardaki mikro eklembacaklı topluluklarını takip etmiş ve sonuçta kuraklığa toleranslı kollembol ve kserofillik akarların olduğunu ve toprak biyoçeşitliliğini desteklemek ve sürdürülebilir yaşam alanları oluşturmak amacıyla, çatılara ve peyzaj çalışmalarına daha dikkat edilmesi gerektiği sonucuna varmıştır. 2. SONUÇ Kent çevrelerindeki yaşam koşulları genel olarak nispeten istikrarlıdır ve bu ortamlarda çok sayıda canlı türü yaşamını sürdürmektedir. Kentsel çevrelerdeki canlı yaşam alanları (habitat)ν ‘domestik, peridomestik ve doğal alanlar’ olmak üzere üçe ayırılır. Domestik yaşam alanları meskenlerin ve mekânların içi ve kapalı alanlardır. Yapıların dışı ve çevresi peridomestik yaşam alanlarını kapsar. Kentlerdeki doğal yaşam alanları ise ormanlar ve nehirler gibi kalıntılardır. Peridomestik habitatlar insan yapımı barınakların ve yapıların çevresi ve civarıdır. Bu alanlar binaların dış yüzeylerini, çatıları, bahçeleri, çevredeki süs bitkileri ve ağaçlarını, parkları ve insan yapımı tüm yeşil alanları kapsar. Kentsel biyoçeşitlilik aslında peridomestik ve doğal alanlarda yaşamlarını sürdüren canlı varlığı ile kent çevrelerindeki farklılıkları ifade etmektedir. Birçok tür kent koşullarına uyum sağlamış olup, bu yaşam alanlarının fauna bileşenleri arasında kuşlar, kemirgenler, böcekler, örümcekler, akarlar ve çokayaklılar sayılabilir (Doğan ve ark., β016). Biyoçeşitliliğin ve kentsel ekosistemlerin sağlığı, doğal, kültürel ve sosyal çevrenin uyum içinde gelişmesiyle sağlanabilir. Bu sebeple biyolojik unsurlara dair çalışmalar özellikle kentsel çevrelerde önem kazanmaktadır. Yeşil alanlar estetik açıdan kente katkıda bulundukları gibi birçok canlı için de yaşama alanı olarak hizmet eder. Günümüzde, kentsel yaşam kalitesini artırmaya yönelik kentsel alanlarda yapılan fiziksel planlama çalışmaları doğal kaynakları olumsuz etkilemektedir. Doğal ve kültürel süreçlerin sürdürülebilirliği için insanoğlunun yaşadığı ekosistemler ile uyumlu ve dengeli bir ilişki geliştirmesi gerekmektedir. Biyoçeşitliliğin önem derecesi ve ağırlığı kişiden kişiye değişse de, özellikle kent merkezinde yaşayan insanların ruhsal ve duygusal gereksinimlerini karşılamada ve bu gereksinimlerinin sürekliliğinin sağlanmasında önemli bir unsurdur (Demir, 2009). Günümüzde, sürdürülebilir nitelikte kent ekosistemlerini geliştirme ve koruma bilincinin oluşması, kentlerin biyolojik çeşitliliğinin belirlenmesini ve korunmasını zorunlu kılmaktadır. Yapılan literatür taraması sonucunda kentsel çevrelerdeki biyoçeşitlilik çalışmalarının belli organizma grupları ile sınırlı kaldığı ve bu çalışmaların az sayıda olduğu ortaya konmuştur. Ülkemizde gerçekleştirilen belli sayıdaki çalışmalar genellikle kentlerdeki açık-yeşil alanların belirlenmesi, ağaçlandırma çalışmaları ve peyzaj tasarım faaliyetleri üzerinedir. Kentlerdeki hayvan varlığı ve fauna bileşenlerinin tespitine yönelik ise sınırlı sayıda çalışma bulunmaktadır. Kentsel ekosistem özelliği taşıyan çevrelerdeki biyolojik çeşitliliğinin ortaya çıkarılarak, yerel biyolojik zenginliği desteklemek ve sürdürülebilir yaşam alanları oluşturmak amacıyla bu konudaki çalışmalara hız verilmesi gerekmektedir. Kentler, doğal özelliklerini giderek kaybeden çevreler haline gelmektedir. Günümüzde dünya nüfusunun yarıdan fazlası, ülkemizde ise neredeyse %80’e yakını şehirlerde yaşamaktadır ve gelecekte bu oranın daha da artacağı düşünüldüğünde kentsel yaşam alanlarının önemi daha da artacaktır. ORAL PRESENTATION 75 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org KAYNAKLAR Acar C, Acar H, Eroğlu E β007. Evaluation of ornamental plant resources to urban biodiversity and cultural changing: A case study of residential landscapes in Trabzon city (Turkey). Building and Environment, 42: 218-229. Akimov IA, Nebogatkin IV 2016. Ixodid ticks (Acari: Ixodidae) in urban landscapes (history of research, Countrıes). Ukrainska Entomofaunistyka, 7 (2): 1-34. Alaoğlu Ö 1λ84. Erzurum ve Erzincan yörelerindeki bazı bitkilerde bulunan Eriophyoidea (Acarinaμ Actinedida) akarların sistematiği ve zarar şekli üzerinde çalışmalar. Atatürk Üniversitesi Ziraat Fakültesi Dergisi, 15 (γ4): 1-16. Atabeyoğlu Ö, Bulut Y β01β. Ordu kenti mevcut yeşil alanlarının değerlendirilmesi. Akademik Ziraat Dergisi, 1 (2): 67-76. Avcı M β008. Kentsel biyoçeşitlilik açısından bir değerlendirmeμ İstanbul örneği. Urban Ecology and Livable Cities Syposium, 81-105. Avcı M β014. Kentsel Biyolojik Çeşitlilik Açısından İstanbul. İstanbul Ormanlarının Sorunları ve Çözüm Önerileri, Türkiye Ormancılar Derneği Yayınıμ 87-124. Ayalp Ş β017. Küçükyalı Arkeopark’ta floristik incelemeler. Anadolu Orman Araştırmaları Dergisi, γ (2) 139166. Barrico L, Azul AM, Morais MC, Coutinho AP, Freitas H, Castro P 2012. Biodiversity in urban ecosystems: Plants and Macromycetes as indicators for conservation planning in the city of Coimbra (Portugal). Landscape and Urban Planning, 106: 88-102. Bennett AB, Lovell ST 2014. A comparison of arthropod abundance and arthropod mediated predation services in urban green spaces. Insect Conservation and Diversity, 7 (5): 405-412. Bingül M, Doğan S, Ayyıldız N 2017. Two newly recorded species of oribatid mites (Acari, Oribatida) for the Turkish fauna from the Erzincan urban center. Ecology 2017 International Symposium, Kayseri, 380. Bingül M, Doğan S, Dilkaraoğlu S, Kesik OA 2016. Kent akarlarının (Acari) belirlenmesi ve Coğrafi Bilgi Sistemi (CBS) kullanılarak haritalandırılmasıμ Erzincan Örneği. Uluslararası Erzincan Sempozyumu, 28 Eylül-01 Ekim, Erzincan, 3: 943-954. Borysiak J, Mizgajski A, Speak A 2017. Floral biodiversity of allotment gardens and its contribution to urban green infrastructure. Urban Ecosystems, 20 (2): 323-335. Bursalı A, Keskin A β016. Erzincan ili biyolojik çeşitliliğiμ Kene türleri üzerine bir envanter çalışması. Uluslararası Erzincan Sempozyumu, Erzincan, kabul edilmiş bildiri. Çalışkan AF, Ulaşlı B, Ulusoy MR β017. Mersin ili park ve peyzaj alanlarında tespit edilen unlubit (Hemipteraμ Coccomorphaμ Pseudococcidae) türleri. Türkiye Entomoloji Bülteni, 7 (1): 75-80. Carrus G, Scopelliti M, Lafortezza R, Colangelo G, Ferrini F, Salbitanoe F, Agrimi M, Portoghesi L, Semenzato P, Sanesi G 2015. Go greener, feel better? The positive effects of biodiversity on the well-being of individuals visiting urban and peri-urban green areas. Landscape and Urban Planning, 134: 221-228. Demir A β00λ. Ekonomik açıdan biyolojik çeşitliliğin önemi. İstanbul Ticaret Üniversitesi Fen Bilimleri Dergisi, 8 (15): 55-68. Doğan S β00λ. Akaroloji Ders notları. Atatürk Üniversitesi, Kazım Karabekir Eğitim Fakültesi, Erzurum. Doğan S, Ayyildiz N, Faraji F, Dilkaraoğlu S, Zeytun E, Ersin F β015. Oribatid mites in the Flevopark in Amsterdam (Acari: Oribatida). Nederlandse Faunistische Mededelingen, 45: 91-96. Doğan S, Bingül M, Ayyıldız N, Kesik OA β016. An evaluation in terms of urban mite (Acari) diversity: some mites in peridomestic habitats of Erzincan city (Turkey). 8th Symposium of the European Association of Acarologists (EURAAC-2016), 11–15 July, Valencia, Spain, 40-41. Doğan S, Özçelik S, Dolu Ö, Erman O β010. Küresel ısınma ve biyolojik çeşitlilik. İklim Değişikliği ve Çevre, 3: 63-88. Doygun H, Ok T β006. Kahramanmaraş kenti açık-yeşil alanlarında ağaçlandırma çalışmalarının değerlendirilmesi ve öneriler. Kahramanmaraş Sütçü İmam Üniversitesi Fen ve Mühendislik Dergisi, λ (β)μ 94-103. ORAL PRESENTATION 76 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Gallo T, Fidino M, Lehrer EW, Magle SB 2017. Mammal diversity and metacommunity dynamics in urban green spaces: implications for urban wildlife conservation. Ecological Applications. 27 (8): 2330-2341. Goddard MA, Dougill AJ, Benton TG 2009. Scaling up from gardens: biodiversity conservation in urban environments. Trends in Ecology and Evolution, 25 (2): 90-98. Gül A, Küçük V β001. Kentsel açık-yeşil alanlar ve Isparta kenti örneğinde irdelenmesi. Süleyman Demirel Üniversitesi Orman Fakültesi Dergisi, Seriμ A, ISSNμ 1γ0β-7085, 2: 27-48. Gunnarsson B, Knez I, Hedblom M, Ode Sang A 2017. Effects of biodiversity and environment-related attitude on perception of urban green space. Urban Ecosystems, 20: 37-49. Karadağ A β00λ. Kentsel ekolojiμ kentsel çevre analizlerinde coğrafi yaklaşım. Ege Coğrafya Dergisi, 18 (1-2): 31-47. Karakaş T β017. Hızlı kentsel değişimin doğala yakın habitatlara etkisinin değerlendirilmesiμ Ankara ili Bağlıca ve Yapracık mahallesi örneği. Ormancılık Araştırma Dergisi, 4 (1)μ 77-89. Kowarik I 2011. Novel urban ecosystems, biodiversity, and Conservation. Environmental Pollution, 159: 19741983. Mckinney ML 2002. Urbanization, biodiversity, and conservation. BioScience, 52 (10): 883-890. Mckinney ML 2008. Effects of urbanization on species richness: a review of plants and animals. Urban Ecosyst, 11: 161-176. Ortaçeşme V, Yıldırım E, Manavoğlu E β005. Kentsel yeşil alan fonksiyonları düzleminde Antalya kenti yeşil alanlarına bir bakış. Akdeniz Üniversitesi, Ziraat Fakültesi Peyzaj Mimarlığı Bölümü, Antalya. Pouya S, Pouya S β017. Biyolojik çeşitliliğe ve ekosistem hizmetlerine katkı sağlayan kentsel projeler. Kent Akademisi. Kent Kültürü ve Yönetimi Hakemli Elektronik Dergi, 10 (3): 306- 322. Rumble H, Gange AC 2013. Soil microarthropod community dynamics in extensive green roofs. Ecological Engineering, 57: 197-204. Sandal EK, Karademir N β01γ. Kahramanmaraş’ta yeşil alanların yeterliliği ile halkın beklentilerinin ve bilinç düzeyinin belirlenmesi. Doğu Coğrafya Dergisi, 18 (βλ)μ 155-176. Savard J.-PL, Clergeau P, Mennechez G 2000. Biodiversity concepts and urban ecosystems. Landscape and Urban Planning, 48: 131-142. Schrader S, Böning M β006. Soil formation on green roofs and its contribution to urban biodiversity with emphasis on Collembolans, Pedobiologia, 50: 347-356. Selim C, Sever Mutlu S, Selim S, β015. Kentsel alanlarda biyolojik çeşitliliğin sürdürülebilirliği ve koruma yaklaşımları. Türk Bilimsel Derlemeler Dergisi, 8 (1): 38-45. Sever Mutlu S, Selim C, Ün G β017. Plant biodiversity of urban roadside trees in Antalya, Turkey. Kastamonu University, Journal of Forestry Faculty, 17 (1): 80-87. Strohbach MW, Haase D, Kabisch N 2009. Birds and the City: Urban Biodiversity, Land Use, and Socioeconomics. Ecology and Society, 14 (2): 31. Uslu A, Shakouri N β01γ. Kentsel peyzajda yeşil altyapı ve biyolojik çeşitliliği destekleyecek olanaklar. Türk Bilimsel Derlemeler Dergisi, 6 (1): 46-50. Xu X, Xie Y, Qi K, Luo Z, Wang X 2018. Detecting the response of bird communities and biodiversity to habitat loss and fragmentation due to urbanization. Science of the Total Environment, 624: 1561-1576. Yeşilayer A, Çobanoğlu S β01γ. Determination of Raphignathoid mites (Acari: Prostigmata: Raphignathoidea) ornamental plants of Istanbul (Turkey). Turkish Journal of Entomology, 37 (1): 93-103. Yücekaya M, Kocatürk F β017. Kilis’te açık yeşil alanlar ve park nitelikler. İnönü Üniversitesi Sanat ve Tasarım Dergisi, 7 (16): 80-94. Yücesu Ö, Korkut A, Kiper T β017. Kırklareli kent merkezinin açık ve yeşil alanların analizi ve bir sistem önerisi. Artium, 5 (β)μ ββ-37. Zencirkıran M, Seyidoğlu Akdeniz N β017. Bursa kent parkları odunsu bitki taksonlarının ekolojik tölerans kriterleri açısından değerlendirilmesi. Bartın Orman Fakültesi Dergisi, 1λ (β)μ 11-19. Zengin M β001. Yeniden yapılanma süreci içerisinde Erzincan kentinin açık-yeşil alanları. Yüksek Lisans Tezi, Atatürk Üniversitesi, Fen Bilimleri Enstitüsü, 1-140. ORAL PRESENTATION 77 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Atıksu Arıtma Tesisi Çıkış Sularında Bulunan Kalayın Su Mercimekleri Tarafından Akümülasyon Kapasitelerinin Araştırılması Murat Topal1, Erdal Öbek2*, Şule Tatar1, E. Işıl Arslan Topal3 1 Munzur Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Tunceli, Türkiye 2 Fırat Üniversitesi, Mühendislik Fakültesi, Biyomühendislik Bölümü, Elazığ, Türkiye 3 Fırat Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Elazığ, Türkiye Sorumlu yazar e-mail:eobek@firat.edu.tr Özet Bu çalışmada, Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan su mercimeklerinde (Lemna minor L. ve Lemna gibba L.) kalayın akümülasyonu araştırıldı. Su mercimeklerinden Lemna minor L. ve Lemna gibba L. İstanbul Üniversitesi Botanik Bahçesinden temin edildi. Temin edilen sucul bitkiler 4 adet reaktöre (üst çapı 50 cm, alt çapı 40 cm, su yüksekliği 1β cm) yerleştirildi. Reaktörlerin ikisine Lemna minor L., diğer ikisine Lemna gibba L. bitkileri 200 gr olacak şekilde eklendi. Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış suları reaktörlere yaklaşık 0,0β L/dk olacak şekilde verildi. Bitkili reaktörler 7 gün boyunca işletildi. Su mercimekleri her gün olmak üzere hasatlandı ve hasatlanan bitkiler ICP- MS (PerkinElmer ELAN 9000) ile analizlendi. Çalışma sonucunda elde edilen verilere göre, Lemna minor L. bitkilerinde en yüksek kalay konsantrasyonu 6. gün 1,β8±0,06 ppm olarak, en düşük kalay konsantrasyonu 1. gün 0,57±0,0β ppm olarak tespit edildi. Lemna gibba L. bitkilerinde ise en yüksek kalay konsantrasyonu 2. gün β,λ8±0,14 ppm olarak, en düşük kalay konsantrasyonu 5. gün 1,04±0,05 ppm olarak tespit edildi. Sonuç olarak, Lemna minor L. ve Lemna gibba L. sucul bitkilerinin atıksu arıtma tesisi çıkış sularında bulunan kalayı akümüle etme kapasitesine sahip olduğu belirlendi. Anahtar Kelimeler: Akümülasyon, kalay, Lemna minor L., Lemna gibba L. su mercimeği 1. GİRİŞ Kalay yumuşak, beyaz, gümüşsü bir metal olup suda çözünmez. Kalay, yiyecek, içecek kutuları ve bunun gibi malzemelerde kullanılır. Kalay çeşitli bileşikler oluşturmak için diğer kimyasallarla birleşebilen bir metaldir. Kalay, klor, kükürt veya oksijen ile birleştiğinde inorganik kalay bileşiği olarak adlandırılır. İnorganik kalay bileşikleri, yerkabuğunda az miktarda bulunurlar. Ayrıca diş macunu, parfüm, sabun, renklendirme maddeleri, gıda katkı maddeleri ve boyalarda bulunurlar. Kalay, organik kalay bileşiklerini oluşturmak için karbon ile birleşebilir. Bu bileşikler plastikler, gıda paketleri, plastik borular, zirai ilaçlar, boyalar, odun koruyucuları ve kemirgen kovucu maddelerin yapımında kullanılır (USHH, β005). Kalay metali yerkabuğunda (kayaçlar, maden ocakları vb. gibi) bulunmaktadır. Bu nedenle, kalay metali yağışlar ve madencilik faaliyetleri sonucunda yeraltı ve yerüstü sularına ulaşabilir. Söz konusu su kaynaklarının kullanılması sonucu (içme, sulama ve kullanma suyu olarak) kalay metali besin zinciri yoluyla canlıların bünyesine taşınır. Yiyeceklerle veya solunum yoluyla kalayı vücuda almak göz ve cilt tahrişleri, baş ağrısı, mide ağrısı, hastalık ve baş dönmesi, şiddetli terleme, nefes darlığı ve idrar problemleri gibi akut etkilere neden olabilir. Ayrıca, kalay metali depresyonlar, karaciğer hasarı, bağışıklık sistemlerinin bozulması, kromozomal hasar, alyuvarların yetersizliği, kızgınlığa neden olan beyin hasarı, uyku bozuklukları, unutkanlık ve baş ağrısı gibi uzun süreli etkilere de neden olabilir (Niknezhadi ve Nezamzadeh-Ejhieh, 2017). Farklı endüstrilerde metallerin işlenmesi sonucu açığa çıkan kalay metali ya doğrudan alıcı ortamlara verilmekte yada kanalizasyon sistemleri vasıtasıyla arıtma tesislerine ulaşmaktadır. Özellikle, kentsel atıksu arıtma tesislerinde metaller yeterli düzeyde arıtılamadığından çıkış sularında farklı konsantrasyonlarda bulunabilir. Bu durum, arıtma tesisi çıkış sularında bulunan metallerin ileri arıtma yöntemi kullanılarak arıtımını gerektirir. Metallerin gideriminde doğal arıtma, adsorpsiyon, iyon değiştirme, membran vb. gibi arıtma yöntemleri kullanılmaktadır. Doğal arıtma yöntemlerinden biri olan fitoremediasyon teknolojisi, fiziksel ve kimyasal arıtma yöntemlerine alternatif olarak düşük maliyetli bir yöntem sunar ve çok çeşitli organik ve inorganik kirleticiler için uygundur (Jiang ve ark., 2015). Fitoremediasyonda değişik sucul bitkiler kullanılabilir. Bu çalışmada, sucul bitkilerden su mercimekleri (Lemna minor L. ve Lemna gibba L.) ORAL PRESENTATION 78 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org kullanılmıştır. Su mercimekleri, doğal sularda yaygın olarak bulunan ve ağır metallerin, nutrientlerin, mikrokirleticlerin gideriminde kullanılan yüzen sucul bitkilerdir. Bu çerçevede, çalışmamızda Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan su mercimeklerinde kalayın akümülasyonu araştırılmıştır. 2. MATERYAL VE METOD Çalışmamızda materyal olarak kullanılan su mercimeklerinden Lemna minor L. ve Lemna gibba L. İstanbul Üniversitesi Botanik Bahçesinden temin edildi. Temin edilen sucul bitkiler 4 adet reaktöre (üst çapı 50 cm, alt çapı 40 cm, su yüksekliği 1β cm) yerleştirildi (Şekil 1). Reaktörlerin ikisine Lemna minor L., diğer ikisine Lemna gibba L. bitkileri 200 gr olacak şekilde eklendi. Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış suları reaktörlere yaklaşık 0,0β L/dk olacak şekilde verildi. Bitkili reaktörler 7 gün boyunca işletildi. Su mercimekleri her gün olmak üzere hasatlandı ve hasatlanan bitkilerde kalay konsantrasyonları ICP- MS (Perkin-Elmer ELAN 9000) ile tespit edildi. Şekil 1. Çalışmada kullanılan reaktörler 3. BULGULAR ve TARTIŞMA Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan Lemna minor L.’de tespit edilen kalay konsantrasyonları Şekil β’de verilmiştir. Konsantrasyon (ppm) Lemna minor L. 1,6 1,4 1,2 1 0,8 0,6 0,4 0,2 0 0 1 2 3 4 5 6 7 Zaman (gün) Şekil β. Lemna minor L.’de tespit edilen kalay konsantrasyonu Şekil β’ye göre, çalışmanın başlangıcında Lemna minor L.’de tespit edilen kalay konsantrasyonu 0,β±0,01 ppm düzeyindeydi (0. gün). Lemna minor L.’de en yüksek kalay konsantrasyonu 6. gün 1,β8±0,06 ppm olarak, en düşük kalay konsantasyonu ise 1. gün 0,57±0,0β ppm olarak tespit edildi. Lemna minor L.’de başlangıç konsantrasyonu göz önüne alındığında Lemna minor L. tarafından kalayın alımı 1. günden 6. güne kadar arttı ve 6. günden sonra azalmaya başladı. Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan Lemna gibba L.’da tespit edilen kalay konsantrasyonları Şekil γ’de verilmiştir. ORAL PRESENTATION 79 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Konsantrasyon (ppm) Lemna gibba L. 3,5 3 2,5 2 1,5 1 0,5 0 0 1 2 3 4 5 6 7 Zaman (gün) Şekil γ. Lemna gibba L.’da tespit edilen kalay konsantrasyonu Şekil γ değerlendirildiğinde, Lemna gibba L.’da 0. gün kalay konsantrasyonu 0.4±0,0β ppm olarak tespit edildi. Lemna gibba L.’da en yüksek kalay konsantrasyonu β. gün β,λ8±0,14 ppm olarak, en düşük kalay konsantasyonu ise 5. gün 1,04±0,05 ppm olarak tespit edildi. Lemna gibba L.’da başlangıç konsantrasyonu göz önüne alındığında Lemna gibba L. tarafından kalayın alımı 1. günden β. güne kadar arttı, β. günden 5. güne kadar azaldı ve 6. ve 7. günlerde hemen hemen aynı değerler aldı (1,7γ±0,08 ve 1,8β±0,0λ ppm). Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan Lemna minor L. ve Lemna gibba L.’da tespit edilen kalay konsantrasyonlarının karşılaştırılması Şekil 4’de verilmiştir. Lemna minor L. Lemna gibba L. Sn Alım Düzeyi (%) 1000 800 600 400 200 0 1 2 3 4 5 6 7 Zaman (gün) Şekil 4. Sucul bitkilerde kalay alım düzeylerinin karşılaştırılması Şekil 4’e göre, Lemna minor L.’de tespit edilen kalay konsantrasyonları 4, 5 ve 6. günlerde Lemna gibba L.’den daha fazla konsantrasyonlardaydı. 1, β, γ ve 7. günlerde ise Lemna gibba L.’da tespit edilen kalay konsantrasyonları Lemna minor L.’den daha yüksekti. 4. SONUÇ Atıksu arıtma tesisi çıkış sularına maruz bırakılan sucul bitkilerden Lemna minor L. ve Lemna gibba L. bitkileri farklı hidrolik bekletme sürelerine göre farklı konsantrasyonlarda kalayı akümüle ettiği tespit edilmiştir. Bu nedenle, söz konusu sucul bitkilerin atıksu arıtma tesisi çıkış sularının arıtılmasında ileri bir arıtıma yöntemi olarak kullanılabileceği belirlendi. ORAL PRESENTATION 80 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org KAYNAKLAR USHH 2005. Toxicological Profıle for Tin and Tin Compounds. US. Department of Health and Human Servıces Public Health Service Agency for Toxic Substances and Disease Registry, Atlanta, Georgia, p.426. Niknezhadi A, Nezamzadeh-Ejhieh A 2017. A novel and sensitive carbon paste electrode with clinoptilolite nano-particles containing hexadecyltrimethyl ammonium surfactant and dithizone for the voltammetric determination of Sn(II), Journal of Colloid and Interface Science, 501: 321-329. Jiang Y, Lei M, Duan L, Longhurst P 2015. Integrating phytoremediation with biomass valorisation and critical element recovery: A UK contaminated land perspective Biomass and Bioenergy, 83: 328-339. ORAL PRESENTATION 81 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Koroner Arter Hastalığı, Yaşam Tarzı ve Genetik Faktörler Songül Budak Diler Niğde Ömer Halisdemir Üniversitesi, Fen Edebiyat Fakültesi, Biyoteknoloji Bölümü, Niğde, Türkiye Sorumlu yazar e-mail:budakdiler@gmail.com Özet Koroner Arter Hastalığı (KAH), kalp adalesini besleyen ve koroner arterler olarak adlandırılan, atar damarların daralma veya tıkanması ile kan akımının kısmi ya da tam kesilmesine bağlı olarak ortaya çıkan bir kalp hastalığıdır. KAH, tüm dünyada ve Türkiye'de ölüm nedenleri arasında ilk sırada yer alması ve bireylerin sosyal gelişimlerini negatif yönde etkilemesinden dolayı, kompleks bir hastalık olarak genetik araştırmaların ilgi odağını oluşturmaktadır. Bu hastalığa yol açan risk faktörlerinin başında genetik yatkınlık ve yaşam tarzı gelmektedir. Birinci derece yakınlarında KAH olan kişilerin bu hastalığa yakalanma riskinin, diğer bireylere göre daha fazla olduğu ve bu risk üzerine olumsuz yaşam tarzı da eklendiğinde, hastalığın kaçınılmaz hale geldiği belirlenmiştir. Bir ailede KAH oluşumunda genetik risk taşıyor olmak için o ailede bir erkek bireyin 55 yaşından önce ya da kadın bireyin 65 yaşından önce kalp krizi geçirmiş olması gerektiği bildirilmektedir. Ayrıca sigara, beslenme alışkanlığı, tansiyon, şeker hastalığı ve hareketsiz bir yaşam tarzının da hastalığın oluşumunda genetik yapı ile birlikte etkili olduğu gösterilmiştir. Dolayısıyla bu tip aile gruplarında, genetik KAH hastalığı olanları tespit edip, çocuklarına veya birinci derce yakınlarına uyarıda bulunmak ve bireylerin genetik test yaptırmalarını sağlamak önemlidir. Son yıllarda KAH’a sebep olan genleri ve bu genlerde meydana gelen mutasyonları tespit etmek mümkün olmakla birlikte, bunlara yönelik tedavi edici teknoloji henüz gelişme aşamasındadır. Günümüzde, hastalığa sebep olan genleri engelleme teknolojisi olmasa da, bu genler erken teşhis edilerek, bireylerin yaşama şansı ve kalitesi artırılmaya çalışılmaktadır. Koroner arter hastalığı en önemli ölüm nedenleri arasında bulunmakla birlikte, genetik çalışmaları diğer hastalıkların gerisinde kalmaktadır. Bu derleme çalışması ile son zamanlarda kaydedilen genetik faktörlerdeki gelişmelerin gözden geçirilmesi hedeflenmiştir. Anahtar Kelimeler: Koroner Arter Hastalığı (KAH), genetik faktörler, mutasyonlar. 1. GİRİŞ Koroner Arter Hastalığı (KAH), gelişmiş ülkelerde önde gelen ölüm nedenleri arasında ilk sırada yer almaktadır. Ayrıca KAH risk faktörlerine maruziyetin artması nedeniyle gelişmekte olan ülkelerde de KAH prevalansının hızla arttığı bildirilmiştir. KAH, birden fazla genetik faktörün, çevresel faktörlerin ve bu faktörler arasındaki etkileşimlerin neden olduğu düşünülen, en yaygın kalp hastalığıdır (Weng ve ark., 2005). Bu genetik ve çevresel faktörlerin (özellikle yaşam tarzının) tanımlanması KAH'ın önlenmesi ve kontrolü için değerli bilgiler sağlayacaktır (Wang, β005a). Genetik çalışmalar, KAH’ın patogenezinde yeni fikirler ortaya koymaktadır. Gelecekteki çalışmalar, hastalık yapan yeni genlerin ve duyarlılık genlerinin tanımlanması, KAH’a neden olan mutasyonların moleküler mekanizmaların araştırılması ve hastalar için gen spesifik tedavilere odaklanacaktı (Wang, 2005b). KAH’ın, kalp adalesini besleyen ve koroner arterler olarak adlandırılan, atar damarların daralma veya tıkanması ile kan akımının kısmi ya da tam kesilmesine bağlı olarak ortaya çıktığı ve nedeni de halk arasında damar sertliği olarak bilinen "ateroskleroz" olduğu bilinmektedir. Koroner aterosklerozun, iskemik kalp hastalığına yol açabileceği ve arteryal lezyonlara trombus eklendiğinde, iskemik kalp hastalığının en ağır formu olan miyokard enfarktüsü (ME) gelişebileceği rapor edilmiştir (Ercan ve ark., β00β). Bu çalışmada, sanayileşmiş toplumlarda ölümlerin bir numaralı nedeni olan KAH’ın, bu güne kadar araştırılmış genetik alt yapısının derlenmesi hedeflenmiştir. ORAL PRESENTATION 82 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 1.1 KAH Kimlerde Görülür? KAH çeşitli etkenlere bağlı olarak özellikle aile hikayesi olan bireylerde genç yaşlarda başlar ve bu hastalığa ait bulgular genellikle 40 yaş sonrasında görülür. Türkiye’de yılda, γ7 yaş ve üzeri yetişkin bireylerden yaklaşık γ40 bin kişinin KAH sebebiyle hayatını kaybettiği ve 400–4β0 bin kişiye ise yeni KAH tanısı konduğu tespit edilmiştir (Onat ve ark., 2014; Kasapoğlu ve Enç, 2017). KAH’ın erkeklerde, kadınlara göre yaklaşık dört kat daha fazla görülmesi, kadınlardaki östrojen hormonunun bu hastalık açısından koruyucu olduğu yönündedir. Bu nedenle kadınlarda görülme sıklığının östrojen hormonunun azaldığı menopoz sonrası dönemde arttığı tespit edilmiştir. KAH tanısı sıklıkla erkeklerde 50-60 yaşları arasında, kadınlarda ise 60-70 yaşları arasında konulmaktadır (Cassar ve ark., 2009). Ani kalp ölümlerinin % 80'inden fazlasının aterosklerotik KAH’dan, kalan vakaların % 20'sinin ise kardiyomiyopati, sol ventrikül hipertrofisi, aort kapak hastalığı ve diğer kardiyak bozukluklardan kaynaklandığı belirlenmiştir (Wang β005b). 1.2 KAH İçin Risk Faktörleri Risk faktörlerinin tanımlanması ve bunların tedavi edilmesi, belirlenmiş hastalığı olan bireylerde tekrarlayan olayların önlenmesi önemlidir. Klinik ve popülasyon temelli çalışmalar, genetik faktörlerin KAH ve ME’de önemli roller oynadığını göstermiştir. 1λγ0'ların başında, KAH'ın bir genetik bileşeni ve bunun kolesterol ile olan ilişkisi hakkında erken ipuçları sağladığı rapor edilmiş ve aile kümelenme olgusu da, 1950'lerde ve 1λ60'larda araştırılmıştır. Daha sonra, KAH ve ME'nin aile kümelenmesi iyi tanımlanmış ve belgelenmiştir. İkizlerle yapılan çalışmalarda KAH’ın kalıtsallığının, yaklaşık olarak %50-%60 arasında olduğu hesaplamıştır (Dai ve ark., 2016). Günümüzde, KAH’ın belli bir genetik altyapı ve bu yapıdan kaynaklanan riske sahip kişilerde, çevresel risk faktörlerinin etkisiyle ortaya çıktığı gösterilmiştir. Ulusal Kolesterol Eğitim Programı’nın (NCEP) β002’de yayınlanan III. yetişkin tedavi panelinde (ATP III), KAH için risk faktörleri şu şekilde sınıflandırılmıştır. (NCEP ATP ΙΙΙ, 2002) 1. Lipid risk faktörleri a. LDL, b. Trigliseridler, c. Non-HDL Kolesterol, d. HDL düşüklüğü, e. Aterojenik dislipidemi β. Nonlipid risk faktörleri A. Modifiye edilebilen risk faktörleri a. Hipertansiyon b. Sigara içiyor olmak c. Diyabetes Mellitus d. Fazla kiloluluk/Obezite e. Fiziksel inaktivite f. Aterojenik diyet g. Trombojenik/ hemostatik durum B. Modifiye edilemeyen risk faktörleri a. Yaş b. Erkek cinsiyeti c. Ailede erken koroner kalp hastalığı öyküsü (Genetik Yatkınlık) Ayrıca KAH İçin bağımsız risk faktörleri de belirlenmiş ve aşağıdaki gibi gösterilmiştirν 1. Yaş (erkeklerde ≥45, kadınlarda ≥55 ) 2. Ailede erken KAH öyküsü yani genetik yatkınlık (birinci derece akrabalardan erkekte 55, kadında 65 yaşından önce KAH bulunması) ORAL PRESENTATION 83 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3. Sigara içiyor olmak 4. Hipertansiyon ( Kan basıncı ≥140/λ0 mmHg veya antihipertansif ilaç kullanımı ) 5. Düşük HDL kolesterol ( HDL <40 mg/dl ) 6. Yüksek LDL kolseterol ( LDL ≥1γ0 mg/dl ) (NCEP ATP ΙΙΙ, β00β) 1.3 KAH ve Genetik Faktörler Dünyada, β0. yy’ın başlarında kardiyovasküler hastalıklardan ölümler %10’dan daha az iken, β1. yüzyılın başlangıcında, gelişmiş ülkelerde ölümlerin yaklaşık yarısına ve gelişmekte olan ülkelerde ise %β5’ine bu hastalıkların neden olduğu rapor edilmiştir (Durusoy ve ark., β010). Mortalitenin en büyük sebeplerinden biri olan KAH, kompleks bir hastalık olarak genetik araştırmaların ilgi odağını oluşturmaktadır. Kalp hastalıklarına yol açan risk faktörleri arasında yer alan genetik yatkınlığın önemli olduğu ve birinci derece yakınlarında kalp ve damar hastalığı olan kişilerin bu hastalıklara yakalanma riskinin, diğer bireylere göre 1β kat daha fazla olduğu belirlenmiştir (McPherson R ve Tybjaerg-Hansen 2016). KAH için en güçlü aile hikayesi, birinci derece bir yakında erken yaşta koroner arter hastalığı öyküsü olmasıdır. Baba veya diğer birinci derece erkek akrabalarda 55 yaşından önce, anne veya diğer birinci derece kadın akrabalarda 65 yaşından önce erken KAH gelişimi, KAH riskini iki katına çıkarttığı, ancak bildirilen göreceli riskin 1.3-11.γ arasında değiştiği saptanmıştır (Myers ve ark.,1990; Yusuf ve ark., 2004; Kaikkonen ve ark., 2006). Erken yaşta KAH’a sahip yakın sayısı arttıkça veya ailede KAH’a yakalanma yaşı azaldıkça, aile öyküsünün önemli olduğu rapor edilmektedir (Dai ve ark., 2016). KAH’ın önlenmesi, β1. yüzyıl için uygun bir hedeftir. Bununla birlikte, KAH’a yatkınlığın % 40-60'ını oluşturduğu tahmin edilen genetik risk, yakın zamana kadar bilinmiyordu. β1. yüzyıl teknolojisi, ilk genetik risk varyantını β007 yılında saptamış ve bu varyant λpβ1’dir (McPherson ve ark., 2007). Daha sonraki çalışmalarda KAH için 60’a yakın genetik risk faktörü keşfedilmiştir. Şaşırtıcı bir keşif, bu faktörlerin üçte ikisinin bilinen risk faktörleri veya mekanizmaları yoluyla davranmadığı yönündedir. Genom-wide (Genome-wide association studies, GWAS) çalışmaları, KAH kalıtımının % 6'sını açıklayan yaklaşık 40 lokus tanımlamıştır (Roberts, 2014). Bu genetik risk faktörlerinin nüfusta beklenenden daha sık görüldüğü ve bunların yarısından fazlasının nüfusun % 50'sinde, daha azının (10) ise nüfusun % 75'inde ortaya çıktığı belirlenmiştir (Dai ve ark., 2016). KAH gibi yaygın, karmaşık hastalıkların genetik belirleyicilerinin belirlenmesinde çeşitli zorluklar mevcuttur. Bu zorluklar arasında, fenotipik ve genetik heterojenlik, gen-gen ve gen çevre etkileşimleridir. Ayrıca diğer önemli bir faktör de, etiyolojik spektrumun, küçük etkilere sahip yaygın genetik varyantlardan, geniş etkilere sahip nadir görülen genetik varyantlara kadar değişebileceği gerçeğidir (Wang 2005b). İkiz ve aile çalışmaları, KAH'nın ailelerde kümelendiğini ortaya çıkartmıştır. Kanıtlar, aile öyküsünün bilinen risk faktörlerinden bağımsız olarak, KAH riskinde artışa katkıda bulunduğunu da göstermektedir (Marenberg ve ark., 1994). KAH ile ilişkili mutasyonlar aşağıda belirtildiği gibi üç ana başlık altında toplamış (Ercan ve ark., 2002) ve günümüzde bu mutasyonların mekanizmaları ile ilgili ileri moleküler çalışmalar farklı araştırmacılar tarafından yapılmıştır (Ercan ve ark., 2002; Wang ve ark., 2003; McPherson ve ark., 2007; Stein ve ark., 2012). Silva ve ark., (2010) tarafından KAH’lı olgularda HFE mutasyonları araştırılmış ve bu mutasyonların, kadınlarda KAH riski artış ile anlamlı derecede ilişkili olduğu bulunmuştur. 1.Koagülasyon ile ilişkili mutasyonlar - Glikoprotein IIb/IIIa - PIA2 mutasyonu - Faktör V leiden - Protrombin G20210A - Metilentetrehidrofolat redüktaz (MTHFR). β. Lipoproteinler ile ilişkili Mutasyonlar -Apo AI ORAL PRESENTATION 84 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org -Apo AIV -CETP (Kolesterol ester transfer protein) -LPL (Lipoprotein lipaz) -Apo B-100 -Apo CII, Apo E, LDLR (low density lipoprotein reseptör) γ. Kanbasıncının regülasyonu ile ilişkili mutasyonlar - Angiotensin converting enzim (ACE) - Angiotensin II tip I reseptör (AT1R) - Endotelyal nitrik oksit sentaz (eNOS) (Ercan ve ark., 2002). KAH, birden fazla genetik faktörün, çevresel faktörlerin ve bu faktörler arasındaki etkileşimlerin neden olduğu düşünülen en yaygın kalp hastalığıdır. Bu genetik ve çevresel faktörlerin tanımlanması KAH'ın önlenmesi ve kontrolü için değerli bilgiler sağlayacaktır (Wang 2005b). Son yıllarda KAH, miyokard enfarktüsü (ME) ve iskemik inmeye yatkınlık genlerinin tanımlanmasında önemli ilerlemeler gerçekleştirilmiştir. Mevcut araştırmalardaki en büyük zorluklar, hangi genlerin ve hangi genetik varyantların genel olarak kompleks hastalıklara ve özellikle de KAH neden olduğunu tanımlamaktır. Bu hastalıktan sorumlu genin saptanmasına yönelik yaklaşımlardan en yaygın olarak kullanılanları, DNA markırlarının hastalıkla ilişkisini test eden bağlantı (linkage studies) ve ilişkilendirme çalışmalardır (association studies) (Wang 2005b; Roberts, 2014). Bağlantı analizi ile aynı kromozom üzerinde birbirine yakın iki genetik lokusun anne-babadan çocuğa aktarılırken bir arada geçiş olasılığı hesaplanmaktadır (Örenay Boyacıoğlu S and Dündar M β01β). KAH genlerinin kromozomal yerlerini haritalamak için iki farklı bağlantı analizi kullanılmıştır (Wang Q 2005a). Bunlardan ilki model tabanlı bağlantı analizi olup, parametrik metot olarak da bilinen bu analizde, lokalizasyonu belirlenecek genin, herhangi bir kromozomda bulunma olasılığının, o kromozomda bulunmama olasılığına oranının logaritması (Logarithm of Odds ratio, LOD Score) alınarak hesaplanır. Bu analizinde başarı sağlanabilmesi için, hastalığın kalıtımının kesin olarak bilinmesi, markır alleli ile hastalık allelinin, bir arada kalıtılıp kalıtılmadığının yeterince gözlenebileceği büyük aileler (üç ve daha fazla kuşaklı) kullanılmaktadır (Örenay Boyacıoğlu S and Dündar M β01β). Bu analiz ile KAH’lı olgularda, ALOX5AP (koroner ve serebrovasküler hastalık), MEFβA (KAH ile ilişkili varyantların tanımlanması ve varyasyonu) ve PCSKλ (kolestrol metabolizmasıyla alakalı bir gen) mutasyonlarının tanımlanmasında kayda değer bir başarı sağlanmıştır (Wang 2005a). Model tabanlı bağlantı analizi özellikle Mendelyan kalıtım gösteren birçok hastalık geninin tanımlanmasında başarılı olmuştur. Ancak bu analizin KAH gibi kompleks hastalıklarla ilişkili genlerin tanımlanmasında daha az başarılı olduğu saptanmıştır (Wang 2005a; Dai ve ark., 2016). Bu nedenle de KAH gibi Mendelyan kurallarının uygulanamadığı kompleks hastalıklarda daha çok İkinci analiz olan modelsiz (Parametrik olmayan) bağlantı analizi kullanılmakta ve bu analiz genel olarak ilişkilendirme analizleri olarak da bilinmektedir. İlişkilendirme çalışmalarında hastalıktan etkilenmemiş bireylerin dikkate alınmadığı, fakat etkilenen bireylerde tespit edilen aynı kromozom segmentinin diğer bireylerde de araştırılması gerektiği tespit edilmiştir. Bu metotta, markır ve örnek sayısı çok olmalı ve kontrol bireyleri iyi belirlenmelidir. Ayrıca modelsiz bağlantı analizi ile yapılan çalışmalarda, araştırılan hastalıktan en az iki etkilenmiş kardeşi olan yüzlerce küçük aile kullanılmaktadır. Gerek ilişkilendirme gerekse bağlantı analizi sonucu elde edilen bilgi, bir hastalığın belli bir kromozomun hangi bölgesinde olduğunun olasılığını verecek değerdir (Örenay Boyacıoğlu S and Dündar M 2012; McPherson R ve Tybjaerg-Hansen 2016). Son yıllarda, genom boyu ilişkilendirme çalışmaları (genome wide association studies-GWAS) ile yeni genetik belirteçlerin bulunması ve kişiye özgü tedavinin oluşturulması amaçlanmaktadır. Burada amaç, tek bir hastanın belirli bir hastalığa yatkınlığının derecesini belirlemekten çok, bireyin yüksek risk taşıdığı durumları belirlemektir. KAH ve ME ile ilişkili bulunan 9p21 lokusu, gen bakımından zengin olmasa da transkripsiyon aktivasyonunu arttırıcılar açısından zengin bir bölgedir. Bu bölgeden bağımsız olarak KAH ile ilgili 1γ SNP tespit edilmiş ve bu riskli allel taşıyıcıları %β0’sinin hastalığı geçirme olasılığının 1.7 kat arttığı rapor edilmiştir. KAH’a yönelik GWA çalışmalarının kardiyovasküler çalışmalara getirisi, hastalık fenotipinin bağlı olduğu patogenezde rol oynayan yeni lokuslar ve yeni yolakları belirlemektir. Ancak GWA çalışmalarının epigenetik ilişkileri saptamada yetersiz kalması, vaka-kontrol çalışmalarında kontrol grubunun seçiminin problemli olması ve genetik-çevresel etkenlerin her hasta için değişen ağırlıkta etki göstermesi, genotipik ve fenotipik ORAL PRESENTATION 85 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org heterojenite, etnik gruplar arası farklar gibi etkenlerden dolayı, KAH çalışmalarında genetik açıdan hızlı ilerleme sağlanamamaktadır (Wang, 2005b; Roberts, 2014, Dai ve ark., 2016) 2. SONUÇ Sonuç olarak, çevresel faktörlerden yaşam tarzının da rol oynadığı kompleks hastalıklarda, genetik yatkınlığın teknoloji ve tıp alanındaki gelişmelerle belirlenebileceği, fakat tek gen hastalıklarında belirleyici rol oynayan mutasyonların bakıldığı genetik testlerin, yakın geçmişteki başarısına rağmen, KAH gibi kompleks hastalıklarda aynı başarıyı sağlayamadığı yapılan araştırmalarla gösterilmiştir. Dolayısıyla, genetik bulguları, biyolojik süreçler ve genler arasındaki işlevsel etkileşimler bağlamında yorumlayarak, KAH’ın genetik mimarisine dair yeni anlayışlar elde edilmelidir. Bu anlamda KAH genetiği alanında yapılacak araştırmalarla; 1) Bu hastalığa neden olan yeni genlerin ve duyarlılık genlerinin tanımlanmasıν β) Yeni tanımlanan KAH genlerinin moleküler karakterizasyonu ile bu hastalığın patogenezindeki moleküler mekanizmaların saptanması; 3) Genotip-fenotip korelasyon çalışmaları ve KAH hastaları için gene spesifik tedaviler de dahil olmak üzere temel bulguların klinik uygulamalara aktarılması hedeflenmelidir. KAYNAKLAR Cassar A, Holmes DR, Rihal CS, and Gersh BJ 2009. Chronic Coronary Artery Disease: Diagnosis and Management. Mayo Clin Proc., 84(12):1130-1146. Dai X, Wiernek S, Evans JP, Runge MS 2016. Genetics of coronary artery disease and myocardial infarction. World J Cardiol, 26; 8(1): 1-23. Durusoy E, Yıldırım, Altun A β010. Koroner Arter Hastalığı Poliklinik Takibi. Trakya Univ Tıp Fak Derg, β7 (1):13-18. Ercan B, Tamer L, Atik U β00β. Koroner arter hastalığı ile ilişkili genetik risk faktörleri. MEÜ Tıp Fak. Dergisi, 2:213-219. Kasapoğlu ES, Enç N β017. A Guide for Coronary Artery Patients. Journal of Cardiovascular Nursing, 8(15)μ17. Kaikkonen KS, Kortelainen ML, Linna E, Huikuri HV 2006. Family history and the risk of sudden cardiac death as a manifestation of an acute coronary event. Circulation, 114: 1462-1467. Marenberg ME, Risch N, Berkman LF, Floderus B, de Faire U 1994. Genetic susceptibility to death from coronary heart disease in a study of twins. N Engl J Med, 330:1041–1046. McPherson R, Pertsemlidis A, Kavaslar N, Stewart A, Roberts R, Cox DR, Hinds DA, Pennacchio LA, Tybjaerg-Hansen A, Folsom AR, Boerwinkle E, Hobbs HH, Cohen JC. 2007. A common allele on chromosome 9 associated with coronary heart disease. Science, 316:1488–1491. McPherson R and Tybjaerg-Hansen A 2016. Genetics of Coronary Artery Disease. Circ Res. 118:564-578. Myers RH, Kiely DK, Cupples LA, Kannel WB 1990. Parental history is an independent risk factor for coronary artery disease: the Framingham Study. Am Heart J, 120: 963-969. NCEP ATP ΙΙΙ, β00β. Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) Final Report. National Cholesterol Education Program National Heart, Lung, and Blood Institute. National Institutes of Health, September 2002, NIH Publication No. 02- 5215. Onat A, Karakoyun S, Akbaş T, Özpamuk Karadeniz F, Karadeniz Y, Çakır H, Şimşek B, Can G β015. TEKHARF 2014 taraması ve Türkiye’de coğrafi bölgelere göre ölüm oranı ile koroner hastalık insidansı. Türk Kardiyol Dern Arş., 4γ(4)μγβ6–332. Örenay Boyacıoğlu S and Dündar M β01β. Gene Mapping Strategies. Journal of Health Sciences, β1(1)μ50-60. Roberts R 2014. Genetics of Coronary Artery Disease. Circ Res., 114:1890-1903. Silva MCP, Njajou OT, Alizadeh BZ, Hofman A, Witteman JCM, van Duijn CM, Janssens ACJW 2010. HFE gene mutations increase the risk of coronary heart disease in women. Eur J Epidemiol, 25:643–649. ORAL PRESENTATION 86 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Stein EA, Mellis S, Yancopoulos GD, Stahl N, Logan D, Smith WB, Lisbon E, Gutierrez M, Webb C, Wu R, Du Y, Kranz T, Gasparino E, Swergold GD 2012. Effect of a monoclonal antibody to PCSK9 on LDL cholesterol. N Engl J Med, 366:1108–1118. Wang Q 2005a. Advances in the Genetic Basis of Coronary Artery Disease. Curr Atheroscler Rep, 7(3): 235– 241. Wang Q 2005b. Molecular genetics of coronary artery disease. Curr Opin Cardiol, 20(3): 182–188. Wang L, Fan C, Topol SE, Topol EJ, Wang Q 2003. Mutation of MEF2A in an inherited disorder with features of coronary artery disease. Science, 302:1578–1581. Weng L, Kavaslar N, Ustaszewska A, Doelle H, Schackwitz W, Hébert S, Cohen JC, McPherson R, and Pennacchio1 LA 2005. Lack of MEF2A mutations in coronary artery disease. J. Clin. Invest., 115:1016– 1020. Yusuf S, Hawken S, Ounpuu S, Dans T, Avezum A, Lanas F, McQueen M, Budaj A, Pais P, Varigos J, Lisheng L 2004. Effect of potentially modifiable risk factors associated with myocardial infarction in 52 countries (the INTERHEART study): case-control study. Lancet, 364: 937-952. ORAL PRESENTATION 87 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Thyroid Pathology in Rats Induced by Bisphenol-A: Protective Effects of Taurine and Curcumin Fatma Gökçe Apaydin1*, Suna Kalender2 , Yusuf Kalender1 *1 2 Gazi University, Faculty of Science, Department of Biology, Ankara, Turkey Gazi University, Faculty of Gazi Education, Department of Science, Ankara, Turkey Corresponding author e-mail: fguzun@gmail.com Abstract Bisphenol A (BPA)is a chemical that has endocrine-disrupting properties. The present study aimed to examine the possible protective roles of curcumin and taurine against BPA-induced toxicity on thyroid tissue in rats. For this purpose, forty-two adult albino male rats were divided seven equal groups: control, olive oil, curcumin (100 mg kg-1 daily), taurine (100 mg kg-1 daily), BPA (130 mg kg-1 daily), BPA plus curcumin, BPA plus taurine. After four weeks on treatment thyroid glands were examined for histopathological examinations. BPA caused seriously toxicity such as follicular cell hyperplasia on thyroid tissues, but curcumin and taurine did not have completely protective effects of this damage. Keywords: Thyroid, Bisphenol A, Taurine, Curcumin, Rat, Histopathology 1. INTRODUCTION The thyroid is an essential endocrine gland of animal bodies, and its secretions are metabolically pertinent. It is known that environmental chemicals can disrupt endocrine systems. Thyroid gland is also very effected by these chemicals. Many environmental chemicals have a high degree of structural similarity to the THs thyroxine (T4) and triiodothyronine (T3), and therefore interfere with binding of THs to receptors or transport proteins (Boats et al., 2006). Bisphenol A (BPA, 4,40-isopropylidenediphenol) is widely used in plastic products such as plastic bottles, water dispenser, electronic products, epoxy resins (Ortiz-Villanueva et al., 2017; Tarapore et al., 2017). BPA exposure may induce several toxic effects like obesity, diabetes, organ dysfunctions (Tarapore et al., 2017). It has been reported that BPA induces reproductive toxicity, nephrotoxicity, hepatotoxicity and also neurotoxicity in experimental animals (Mahmoudi et al., 2015; Tarapore et al., 2017; Zhou et al., 2017). Curcumin is a phenolic compound which a member of the ginger family (Zingiberaceae) (Anamika, 2012). It has therapeutic effects on many toxic changes on different organs. It has anti-arthritic, anti-rheumatic, analgesic and gastro-protective effects (Kaur et al., 2017). Taurine has also antioxidant properties like anti-inflammation, Ca2+ modulation, cell membrane stabilization and neuromodulator effect (Feng et al., 2017). Therefore, the purpose of our study is to investigate the possible toxic effects of BPA and related mechanisms of taurine and curcumin on the thyroid tissues in rats. 2. MATERIALS AND METHODS 2.1. Chemicals and Experimental Design Taurine (≥λλ% purity) and Curcumin (from Curcuma longa (Turmeric)) were purchased from Sigma. Bisphenol A (≥ λλ% purity) was provided by Aldrich. Adult male albino rats (weighing 250-300g) were obtained from GUDAM and were housed in cages, at room temperature β0±β oC, relative humidity 40%, and 12h light/dark cycle. Food (pellet rat chow) and water available ad libitum. Experimental studies were confirmed by University of Gazi Animal Ethics Committee (G.U.ET–14.075). After acclimatization, animals were divided seven groups (n=6) categorized as follows: ORAL PRESENTATION 88 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Group 1 (control group): received distilled water (1.0 ml kg-1 bw daily). Group 2 (olive oil group): received olive oil (1.0 ml kg-1 bw daily). Group 3 (curcumin group): received curcumin (100 mg kg-1 bw daily in olive oil). Group 4 (taurine group): received taurine (100 mg kg-1 bw daily in distilled water). Group 5 (BPA group): received bisphenol A (130 mg kg-1 bw daily in olive oil). Group 6 (BPA + curcumin group): received curcumin and bisphenol A (100 mg kg-1 bw daily + 130 mg kg-1 bw daily, respectively). Group 7 (BPA + taurine group): received taurine + bisphenol A (100 mg kg-1 bw daily + 130 mg kg-1 bw daily, respectively). Both solutions were administrated via gavage during 28 days. BPA and other solutions were freshly prepared. After the treatment period, animals were sacrificed under the anesthesia and thyroid glands removed quickly. 2.2. Histopathological Examination For light microscopy, thyroid glands were dissected free of connective tissues and then fixed in 10% neutral formalin and processed for paraffin sections of 5-7η thickness. Sections were stained with hematoxylin and eosin (H&E) for routine histological investigations. Then the tissues were evaluated under a light microscope (Olympus BX51, Tokyo, Japan) and photographed with a camera (Olympus E-330, Olympus Optical Co., Ltd., Japan). Ten slides were prepared from each tissues. 3. RESULTS In our study histopathological examination of rat thyroids were investigated using light microscope. Histological examinations of thyroid glands of the control, olive oil, taurine and curcumin-treated rats indicated normal arrangement with no histological alterations of the four groups. Thyroid follicles in control rats were lined by a single uniform layer of short cuboidal epithelial cells and contained abundant thyroglobulin colloid within the lumen (Figure 1). In contrast, BPA treated groups we showed that follicular cell hyperplasia () in adjacent follicles is characterized by masses of follicular epithelial cells filling the lumens, microscopic images also revealed desquamated irregularly shaped follicles with reduced colloidal space () and follicular degenerations (), (Figure 2-4). In BPA plus curcumin treated groups showed that () follicular cell hyperplasia (Figure 5). In BPA plus taurine treated groups we showed that () degenerations of follicle and () follicular cell hyperplasia (Figure 6). Figure 1. Photomicrographs of thyroids of the control group (group 1) at low magnification, showing normal, evenly spaced follicles. H&E, x200. ORAL PRESENTATION 89 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 2. Thyroid sections of BPA treated rats, : follicular cell hyperplasia, : degenerations of follicles, : showing desquamated follicles. H&E, x400. Figure 3. Thyroid sections of BPA treated rats, : follicular cell hyperplasia, : degenerations of follicles, : showing desquamated follicles. H&E, x400. Figure 4. Thyroid sections of BPA treated rats, : follicular cell hyperplasia, : degenerations of follicles, : showing desquamated follicles. H&E, x400. ORAL PRESENTATION 90 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 5. Thyroid sections of BPA plus curcumin treated rats, : follicular cell hyperplasia. H&E, x200. Figure 6. Thyroid sections of BPA plus taurine treated rats, : degenerations of follicles, : follicular cell hyperplasia. H&E, x200. 4. DISCUSSION BPA exposure may cause several pathological changes because of its estrogenic-like effects. It is very important for role of BPA toxicity. Humans be exposed to BPA with different ways (El-Tabaa et al., 2017). BPA has been founded in maternal serum, amniotic fluid, fetal cord blood, and breast milk (Vandenberg et al., 2007). Galyon et al., reported that in their study, maternal bisphenol A exposure should be limited during pregnancy and lactation (Galyon et al., 2017). Guignard et al., reported that Bisphenol A alters the maternal thyroid status in pregnant ewe (Guignard et al., 2017). Many researches have focused on reproductive functions based on the estrogen mimetic properties of BPA. However, accumulated evidence suggests that BPA might have toxic effects on other endocrine systems including thyroid function (Guignard et al., 2017). The thyroid system is a primarily target of the endocrine disrupting chemicals (Tebourbi et al., 2010). In addition, previous investigators have reported that BPA cause alterations in antioxidant enzyme activities in several rat tissues (Eid et al. 2015). Various xenobiotic have also been caused to cellular damage in tissues related to inhibition of antioxidant mechanism (Apaydın et al. β015; Santamaria et al. 2015). In the present study, we examined that the effects of BPA exposure on thyroid tissues histological structure. The oral LD50 of BPA for male rats is 3250 mg/kg body weight (Michalowicz, 2014). In the present study, BPA was given at 1/25 of oral LD50 and none of the rats died during the experimental period. We determined that serious ORAL PRESENTATION 91 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org histopathological changes in BPA-treated rats such as follicular cell hyperplasia, desquamated irregularly shaped follicles with reduced colloidal space and follicular degenerations. Curcumin and taurine protects several tissues against environmental toxicants and these preventive effects possibly are due to their antioxidant properties (Kaur et al., 2017; Feng et al., 2017). In conclusion, previous studies BPA caused histopathological effects on thyroid glands. It may be due to its xenoestrogen properties and/or increased reactive oxygen species production which caused oxidative stress. It has been shown that protective effects of taurine and curcumin because of their antioxidant properties. However, in this study we haven’t show protection on thyroid glands. This results may be related to their doses that used in this study. They may be lower or higher doses against of BPA. However, we show fever histopathological changes in antioxidant supplementation groups than only BPA treated group. REFERENCES Anamika, B., 2012. Extraction of curcumin. Journal of Environmental Science Toxicology and Food Technology. 1: 1–16. Apaydin FG, Kalender S, Bas H, Demir F, Kalender Y, 2015. Lead nitrate induced testicular toxicity in diabetic and non-diabetic rats: protective role of sodium selenite. Brazilian Archives of Biology and Technology. 58: 68-74. Boas M, Feldt-Rasmussen U, Skakkebæk NE, Main KM, 2006. Environmental chemicals and thyroid function. European Journal of Endocrinology. 154: 599–611. Eid JI, Eissa SM, El-Ghor AA, 2015. Bisphenol A induces oxidative stress and DNA damage in hepatic tissue of female rat offspring. The Journal of Basic and Applied Zoology. 71: 10–19. El Tabaa MM, Sokkar SS, Ramadan ES, Abd El Salam IZ, Zaid A, 2017. Neuroprotective role of Ginkgo biloba against cognitive deficits associated with Bisphenol A exposure: An animal model study. Neurochemistry International. 108:199-212. Feng Y, Sun F, Gao Y, Yang J, Wu G, Lin S, Hu J, 2017. Taurine decreased uric acid levels in hyperuricemic rats and alleviated kidney injury. Biochemical and Biophysical Research Communications. 489: 312-318. Galyon KD, Farshidi F, Han, G, Ross MG, Desai M, Jellyman JK, 2017. Maternal bisphenol A exposure alters rat offspring hepatic and skeletal muscle insulin signaling protein abundance. American Journal of Obstetrics & Gynecology. 216:290-299. Guignard D, Gayrard, V, Lacroix MZ, Puel S, Picard-Hagen N, Viguie C, 2017. Evidence for bisphenol Ainduced disruption of maternal thyroid homeostasis in the pregnant ewe at low level representative of human exposure. Chemosphere. 182: 458-467. Kaur M, Singh A, Kumar B, Singh SK, Bhatia A, Gulati M, Prakash T, Bawa P, Malik AH, 2017. Protective effect of co-administration of curcumin and sildenafil in alcohol induced neuropathy in rats. European Journal of Pharmacology. 805: 58–66. Mahmoudi A, Ghorbel H, Bouallegui Z, Marrekchi R, Isoda H, Sayadi S, 2015. Oleuropein and hydroxytyrosol protect from bisphenol A effects in livers and kidneys of lactating mother rats and their pups. Experimental and Toxicologic Pathology, 67: 413-425. Michalowicz J, 2014. Bisphenol A-Sources, toxicity and biotransformation. Environmental Toxicology and Pharmacology. 27: 738-758. Ortiz-Villanueva E, Navarro-Martín L, Jaumot J, Benavente F, Sanz-Nebot V, Pina, B, Tauler R, 2017. Metabolic disruption of zebrafish (Danio rerio) embryos by bisphenol A. An integrated metabolomic and transcriptomic approach. Environmental Pollution. 231: 22-36. Santamaria C, Durando M, de Toro MM, Luque EH, Rodriguez HA, 2015. Ovarian dysfunction in adult female rat offspring born to mothers perinatally exposed to low doses of bisphenol A. The Journal of Steroid Biochemistry and Molecular Biology. 158:220-230. Tarapore P, Hennesy M, Song D, Ying J, Outang B, Govindarajah V, Leung Y, Ho S, 2017. High butter-fat diet and bisphenol A additively impair male ratspermatogenesis. Reproductive Toxicology. 68: 191–199. ORAL PRESENTATION 92 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tebourbi O, Hallègue D, Yacoubi MT, Sakly M, Rhouma KB, 2010. Subacute toxicity of p,p-DDT on rat thyroid: Hormonal and histopathological changes. Environmental Toxicology and Pharmacology. 29: 271–279. Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV, 2007. Human exposure to bisphenol A (BPA). Reproductive Toxicology. 24: 139-77. Zhou Y, Wang Z, Xia M, Zhuang S, Gong X, Pan J, Li C, Fan R, Pang Q, Lu S, 2017. Neurotoxicity of low bisphenol A (BPA) exposure for young male mice: Implications for children exposed to environmental levels of BPA. Environmental Pollution. 229: 40-48. ORAL PRESENTATION 93 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Comparative Study the Production of Silver Nanoparticles with the Cultural Supernatant and Biomass of Yeast Candida guillermondii bdu-217 Khudaverdi Ganbarov., Mirmusa Jafarov., Khadija Bozkurt., Sanam Huseynova., Aygun Israyilova., Gulshan Suleymanova., Zokhrab Agamaliyev., Goncha Eyvazova Baku State University, Faculty of Biology/Department of Microbiology Baku AZ 1148, Azerbaijan cafarov.67@mail.ru Abstract The presented article is devoted to the comparative study of the production of silver nanoparticles with the cultural supernatant and biomass of yeast Candida guillermondii BDU - 217. It has been determined that the cultural supernatant and biomass of this strain has the Ѕapability to form silver nanoparticles. Its ability to produce silver nanoparticles was initially detected by the coloring of the reaction mixture into dark color. The colloidal silver nanoparticles solutions were monitored by ultraviolet – visible (UV) spectroscopy, and the obtained nanoparticles were characterized by Scanning Electron Microscopy (SEM) and Energy Despersive spectroscopy (EDAX). UV – vis spectrophotometric analysis nanoparticles produced with culture supernatant showed an absorbance peak at 390 nm and with biomass – at 410 nm wavelength. In the SEM it was clearly seen that these nanoparticles have spherical form. Moreover, nanoparticles, produced with culture supernatant were 20,0 – 35,5 nm and that, produced with biomass, were 34,2 – 37,5 nm. EDAX confirmed the presence of elemental silver by the sharp signals. Keywords: yeast, silver nanoparticles, Candida guillermondii BDU – 217, cultural supernatant, biomass. 1. INTRODUCTION Production of nanoparticles by physical and chemical methods is considered ecologically unfavorable. The application of the mentioned methods requires chemical reagents, that can cause environmental pollution [3]. Therefore, greater attention is paid to the synthesis of nanoparticles with biological objects. In the biological synthesis process, yeasts and mold fungi, bacteria and plant extracts are used as producers [1, 5 - 7, 11-14]. Usage of the yeast fungi created favorable conditions to obtain metal nanoparticles such as silver, gold, zinc, selenium, titanium and platinum [6]. Metal nanoparticles are characterized by various properties. For example, silver nanoparticles have their own characteristic features compared to other metal nanoparticles; the greater surface area, the more unique physical, chemical and biological features. The possibility of obtaining silver nanoparticles using yeast genus Candida is shown [8,10, 15]. The previous research was devoted to the study of the production of silver nanoparticles by Candida macedoniensis BDU - MY44. In addition, the dependence of the nanoparticles formation on the quantity of biomass, was also researched [2, 3, 9]. The main purpose of the investigation was the comparative analysis the formation of silver nanoparticles in the cultural supernatant and biomass of Candida guilliermondii BDU – 217 yeast fungus. 2. MATERIALS AND METHODS Candida guilliermondii BDU - 217 strain taken from the culture collection of the Microbiology Department of Baku State University was used as a research object. For the acquisition of biomass, Candida guilliermondii BDU - 217 were planted in a liquid medium with the following ingredients: yeast extract - 10 g, sucrose - 20 g, pepton - 20 g, distilled water - 1 liter. The fungus was cultivated at 300C for 5 days. Biomass and cultural supernatant were used separately for the production of silver nanoparticles. ORAL PRESENTATION 94 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The obtained yeast fungus biomass was separated from the cultural medium by centrifugation (5000 rpm / min. 20 min). 10 ml of 10-3 M AgNO3 solution was added to 90 ml of cultural supernatant and the mixture was incubated in the thermostat at 300C for 7 days. During the inkubation, color change was observed. The biomass was washed 3 times with 100 ml of sterile distilled water. 20 grams of biomass was introduced into sterile distilled water, 10 ml of 10-3 molar AgNO3 solution was added and the mixture volume was increased up to 100 ml. The obtained mixture was incubated in thermostat for 7 days at 30 0C. At the end of the experiment, both the cultural supernatant and biomass were filtered. Afterwards, presence of silver nanoparticles in the filtrate was analyzed. The existence of nanoparticles was determined primarily by the color of the reaction mixture. Silver nanoparticles were analyzed in spectrophotometer "UV - VIS specord 250 plus". The shape and size of silver nanoparticles were determined in the scanning electron microscope (SEM, JEOL 7600F, Japan). Energy – dispersive X – ray (EDAX) spectroscopy analysis for the confermation of elemental silver was carried out for the detection of elemental silver. 3. RESULTS AND DISCUSSIONS As a result of studies, it was found that the color of the reaction mixture was dark when the Candida guilliermondii BDU - 217 cultural supernatant (Fig. 1) and biomass (Fig. 2) were incubated for 7 days at 300C with silver nitrate solution. No color change has been observed in the tubes without silver nitrate solution. The color black – out of the reaction mixture is regarded as one of the indications of the formation of silver nanoparticles. Figure 1. Visible observation of silver nanoparticles biosynthesis with cultural supernatant of Candida guilliermondii BDU - 217: a - control; b –experiment Figure 2. Visible observation of silver nanoparticles biosynthesis with biomass of Candida guilliermondii BDU - 217: a - control; b – experiment ORAL PRESENTATION 95 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The colloidal solution obtained by filtration of black – out reaction mixture was analyzed in UV spectrophotometer. As a result, it was detected that it has a 390 nm wavelength absorption which is characteristic of silver nanoparticles (Fig. 3). Figure 3. UV – visible absorption spectra of produced silver nanoparticles in 390 nm wavelength using cultural supernatant (1) and in 410 nm wavelength using biomass (2) of Candida guilliermondii BDU – 217 The analysis of the samples taken from the cultural supernatant in the scanning electron microscope showed that silver nanoparticles have a spherical form and a size of 20,0 to 35,5 nm (Fig. 4). Figure 4. The SEM micrograph of silver nanoparticles produced with the cultural supernatant of Candida guilliermondii BDU – 217 The analysis of nanoparticles by the EDAX spectrum has shown that silver particles possess the specific (Ag La1) peak (Fig. 5). ORAL PRESENTATION 96 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 5. EDAX spectrum of silver nanoparticles produced by the cultural supernatant of Candida guilliermondii BDU – 217 The colloidal solution, obtained by filtration of black – out reaction mixture with biomass was analyzed by UV spectrophotometer. This analysis has resulted in a fact that the solution has a 410 nm wavelength absorption, which is characteristic of silver nanoparticles (Fig. 3). The analysis of the sample in scaning electron microscope showed that silver nanoparticles have a spherical form and a size of 34,2 – 37,5 nm (Fig. 6). Figure 6. The SFM micrograph of silver nanoparticles produced with the biomass of Candida guilliermondii BDU – 217 Analysis of nanoparticles by EDAX spectrum shows that silver particles have the specific (Ag La1) peak (Fig.7). ORAL PRESENTATION 97 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 7. EDAX spectrum of silver nanoparticles produced by the biomass of Candida guilliermondii BDU – 217 Thus, it has been determined that Candida guilliermondii BDU - 217 has the ability to produce silver nanoparticles in both cultural supernatant and biomass. Its ability to produce silver nanoparticles was initially determined by color change of the reaction mixture and absorbing wavelengths of 390 and 410 nm in the UV spectrophotometer. Silver nanoparticles, produced both with the biomass and cultural supernatant , have a spherical shape. Nanoparticles, produced with cultural supernatant are at the range of 20,0 – 35,5 nm, and with the biomass - of 34,2 – 37,5 nm. ACKNOWLEDGEMENTS The authors wish to thank the head of Nanoreseach laboratory prof. M.A.Ramazanov for providing the possibility of UV and SEM analysis of samples. BIBLIOGRAPHY 1. QənbərovX.Q., Musayev E.M. Nanohissəciklər əmələ gətirən mikroorqanizmlər // AMEA – nın Mikrobiologiya İnstitutunun elmi əsərləri, 2012, c. 10, s. 78 – 84. 2. Qənbərov X.Q., Cəfərov M.M., Haciyeva F.T., Bozkurt H.C., Ramazanov M.A., Eyvazova Q. M., Ağamaliyev Z.Ə., Əhmədov İ.S., Abdülhəmidova S.M. Candida macedoniensis BDU-Mİ 44 maya göbələyi ştamının gümüş nanohissəcikləri əmələ gətirmə xassələrinin öyrənilməsi. // Journal of Qafqaz University Chemıstry and Biology, β015, s.1γλ – 142 3. Qənbərov X.Q., Cəfərov M.M., Haciyeva F.T., Bozkurt H.C., Ramazanov M.A., Eyvazova Q. M. Candida macedoniensis BDU-Mİ 44 maya göbələklərində gümüş nanohissəciklərin əmələ gəlməsinin biokütlənin miqdarından aslılığı.// Konfrans Ümummilli lider H. Əliyevin anadan olmasının 93 – ci ildönümünə həsir olunub. Müasir kimya və biologiyanın aktual problemləri Beynəlxalq elmi konfrans Gəncə, β016, s. 161 – 165 4. .ϕϴЄϴЁЂ϶ϴ Е.Ϟ., ϠЇϿВϾϼЁ ϔ.ϟ. ϞЂϻϿЂ϶ϴ ϔ.ϡ., ϤϹ϶ϼЁϴ ϔ.ϔ., ϱϿА-ϤϹϷϼЅІϴЁ ϗ.И. ϖϻϴϼЀЂϸϹϽЅІ϶ϼϹ ϼЂЁЂ϶ ϼ ϾϿϴЅІϹЄЂ϶ ЅϹЄϹϵЄϴ ϶ ϶ЂϸЁЏЉ ϼ ϶ЂϸЁЂ-ЂЄϷϴЁϼЋϹЅϾϼЉ ЄϴЅІ϶ЂЄϴЉ Ѕ ϾϿϹІϾϴЀϼ Candida utilis ϼ Saccharomyces cerevisiae // ϡϴЇϾЂϹЀϾϼϹ ІϹЉЁЂϿЂϷϼϼ. β005, Ϧ.6, № 5, c.33 – 37 5. ϤϹ϶ϼЁϴ ϔ.ϔ., ϕϴЄϴЁЂ϶ϴ Е.Ϟ., ϠЇϿВϾϼЁ ϔ.ϟ., ϥЂЄЂϾϼЁ ϖ.ϖ. "ϡϹϾЂІЂЄЏϹ ЂЅЂϵϹЁЁЂЅІϼ ϶ЂϻϸϹϽЅІ϶ϼГ ϾϿϴЅІϹЄЁЂϷЂ ЅϹЄϹϵЄϴ Ёϴ ϸЄЂϺϺϹ϶ЏϹ ϾϿϹІϾϼ Candida utilis" // ϱϿϹϾІЄЂЁЁЏϽ ϺЇЄЁϴϿ "ИЅЅϿϹϸЂ϶ϴЁЂ ϶ ϤЂЅЅϼϼ", β005, І.1γλ, Ѕ. 140γ – 1409 6. ϞЄЇІГϾЂ϶ ϲ.ϟ. ϥϼЁІϹϻ ϼ Ѕ϶ЂϽЅІ϶ϴ ЁϴЁЂЊϴЅІϼЊ ЅϹЄϹϵЄϴμ ϸЂЅІϼϺϹЁϼГ ϼ ЃϹЄЅЃϹϾІϼ϶Џ // ϧЅЃϹЉϼ ЉϼЀϼϼ, β008, І.77, Ѕ. β4β – 269 7. Anal K. Jha, K.Prasad and A.R.Kulkarni. Yeast Mediated Synthesis of Silver Nanoparticles // International Journal of Nanoscience and Nanotechnology, v.4, No.1, 2008, p.17 – 21. ORAL PRESENTATION 98 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 8. Bharde A., Rautaray D., Bansal V., Ahmad A., Sarkar I., Mohammad Yusuf S., Sanyal M., Sastry M. Extracellular Biosynthesis of Magnetite using Fungi // Biosynthesis of nanoparticles, 2006, v.2, №1, p.135 9. Ganbarov Kh.G., Jafarov M.M., Hajiyeva F.T., Huseynova S.I., Bozkurt Kh. J., Ramazanov M.A., Agamaliyev Z.A., Eyvazova G.M., Akhmedov I.S. Mycogenic Formation of Silver Nanoparticles by the Azerbaijanese environmental isolate Candida macedoniensis BDU-MI44.// International Journal of Research Studies in Biosciences Volume 4, İssue 5, May β016, p. 1 – 5 10. E. M. Radwan, Hassan, A. A. and Refai, M. K. Correlation between virulence factors and pathogenesis of Candida albicans // Egypt. Vet. Med. Assoc, 2003, 65(5) p. 239 – 247 11. Meenal Kowshik, Shriwas Ashtaputre, Sharmin Kharrazi, W. Vogel, J.Urban, S.K. Kulkarni and K.M. Paknikar. Extracellular synthesis of silver nanoparticles by a silver-tolerant yeast strain MKY3 // Nanotechnology, β00β, v.14, №1, p.λ5 – 100 12. Muthupandian Saravanan, Tsehaye Amelash, Letemichael Negash, Araya Gebreyesus, Arokiyaraj Selvaraj, VinothRayar and Karthik Dheekonda. Extracellular biosynthesis and biomedical application of silver nanoparticles synthesized from baker’s yeast // International Journal of Research in Pharmaceutical and Biomedical Sciences, β01γ, v.4, № γ, p. 8ββ – 828 13. Sastry M, Ahmad A, Khan MI and Kumar: Biosynthesis and application of silver and gold nanoparticles. Current Sci 2003, v.85, p.162-70 14. Sadowski Z. Synthesis of silver nanoparticles using microorganisms // Materials Science Poland, 2008, v.26, p.420 – 424 15. Xiangqian Li, HuizhongXu, Zhe-Sheng Chen and Guofang Chen. Biosynthesis of Nanoparticles by Microorganisms and Their Applications // Journal of nanomaterials, β011, v.β011, № 8, p. 1 – 17 ORAL PRESENTATION 99 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Comparison of Different Treatment Methods For Cr (III) Adsorption Onto Borax Sludge Emek Moroydor Derun1*, Meral Yildirim1, Nevin Karamahmut Mermer1, Fatma Tugce Senberber1,2 *1 Yildiz Technical University, Faculty of Chemical and Metallurgical Engineering, Department of Chemical Engineering, Turkey 2 Atasehir Adiguzel Vocational School of Higher Education, Programme of Occupational Health and Safety, Turkey Corresponding author e-mail:moroydor@yildiz.edu.tr Abstract Heavy metal pollution, which causes adverse health effects besides environmental problems, has been of great concern and should be eliminated. In the present study, borax production sludge was used to remove trivalent chromium (Cr (III)) by different stirring methods of magnetic and ultrasonic mixing. The adsorption of Cr (III) in aqueous solution was investigated for various experimental parameters. The adsorption temperature were kept constant as 40°C. The residual Cr (III) concentration in aqueous solution was determined by Inductively Coupled Plasma- Optical Emission Spectrometry (ICP-OES). The experimental data were fitted to the many isotherm and kinetic models. According to results, it was clearly determined that ultrasonic mixing accelerated the removal of Cr (III). Keywords: Borax sludge, Cr (III), Adsorption isotherm, Adsorption kinetic 1. INTRODUCTION Heavy metal pollution can occur in water, air, and soil due to the industrial wastes, radioactive and microbiological contamination (Holdgate, 1979). Especially in recent years, the pollution in environment has been increasing with industrial developments (Yilmaz et al., 2015). Metal processes, mining operations, tanneries, electroplating industry, textile, wood preservatives, paint and pigments, petroleum, are some industrial sources of heavy metal pollution (Yilmaz et al., 2015; Bailey et. Al., 1999; Gode and Pehlivan, 2004; Inglezakis et al., 2002). According to the information obtained from World Health Organization (WHO), the most toxic metals are identified as aluminium, chromium, magnesium, iron, cobalt, nickel, copper, zinc, cadmium, mercury and lead. Since the late 1950s, studies about the removal of heavy metals from aqueous solutions have received significant attention by researchers and health committees due to their harmful effects on living beings and environment (World Health Organization, 1988). After the discovery of chromium by Vauquelin in 1797 chromium compounds such as catalysts, fungicides, corrosion inhibitors extensively used. The increase of chromium usage in many application areas due to the industrial development led to give a priority to the element and in later times the effects on health were being discovered (Baruthi, 1992). The intake modes of chromium can be ingestion, dermal contact and inhalation which can cause acute (14 days or less), intermediate (15 to 364 days), and chronic (365 days or more) effects. Although Cr (III) is an essential element in humans (daily intake of 50 to β00 µg/d for adults), exposure of chromium compounds can cause immunological, neurological and geneotoxic problems and also can induce cancer in livings (Guertin, 2004; Assem and Zhu, 2007). Several methods are utilized for the removal of Cr (III) from the industrial waste water such as filtration, ion exchange, solvent extraction co-precipitation, membrane filtration, and biosorption (Pehlivan et al., 2009). These treatment methods are not preferred, because they cause the formation of secondary toxic sludge which also has toxic effects. Adsorption, as a separation process has been widely used due to the low cost, efficiency, ease of operation (Pehlivan et al., 2009, Albadarina et al., 2012). In adsorption process the using of cheap and easily available adsorbents are particularly preferred. In recent years, the adsorbents such as activated carbon, soya cake, neem leaves, Turkish brown coals and bentonite were used to remove of hexavalent and trivalent ORAL PRESENTATION 100 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org chromium ions from waste water (Gode and Pehlivan, 2005;Utrilla and Polo, 2003; Daneshvar et al., 2002; Babu et al., 2008; Tahir et al., 2007). Boron compounds have wide usage areas including glass, detergent, textile, pesticide, ceramic industries which causes the consumption of huge amount of boron compounds. Turkey possesses 47.2% of total world boron production. In Turkey, annually 400 000 tons of process waste (borax sludge) form in the production of sodium borates from tincal (Özdemir and Kıpçak, β010). In terms of economics and environment, the evaluation of the occurred borax sludge in different application is significant. In this study, borax sludge was aimed to evaluate for Cr (III) removal from the wastewater by different stirring methods. Besides classical magnetic stirring method, ultrasonic stirring was used to observe effects of changed adsorption conditions on the treatment of Cr (III) containing wastewater. Ultrasonic mixing increases the interaction of materials by producing shock waves, thus, ensure a more effective adsorption process. In the current study, the influence of adsorption time, initial Cr (III) concentration and stirring methods on Cr (III) adsorption onto borax sludge were investigated and the experimental data were applied to various adsorption isotherm and kinetic models. 2. MATERIALS AND METHODS 2.1. Experimental Procedure Borax sludge used in this study was obtained from Eti Mine Bandirma Boron Works (Balikesir, Turkey). Prior to experimental usage, dolomite was subjected to a preparation process and characterized as a mixture of dolomite (pdf. no: 00-005-0622; CaMg(CO3)2) and tincalconite (pdf. no: 00-008-0049; Na2B4O7·5H2O) phases according to X-ray diffractometer (XRD) analysis. The BET surface area of borax sludge was determined as 5.54 m 2/g (Senberber et al., 2017). The aqueous Cr (III) solutions used in the experiments were prepared from standard Cr (III) solution (Merck KGaA, Darmstadt, Germany). The experiments were performed by classical stirring method and ultrasound treatment to compare their effects on the adsorption performance of borax sludge. For classical stirring method, the agitation time was varied as 15, 30, 60, 90, 120 and 180 minutes when the stirring speed were set to 200 rpm. The experiments conducted by ultrasonic probe (Bandelin Sonopuls HD 2070) were carried out for 5, 15, 30, 45 and 60 minutes of contact time. For each experimental set, 0.02 g of the borax sludge was mixed with 20 ml of the aqueous solutions of Cr (III) and temperature was set to 40 °C. Also, to obtain adsorption equilibrium isotherms, the initial Cr (III) concentration was changed between 10-30 mg/L. At the end of the adsorption period, the mixture was filtered (using Whatman filter paper, blue ribbon) and Cr (III) concentration in the supernatant solution was analysed by using Inductively Coupled Plasma- Optical Emission Spectrometry (ICP-OES). 2.2. Theoretical Background Basically, adsorption can be called with the interaction between adsorbent and adsorbate (1). Adsorption Adsorbate( A)  Adsorbent ( B)   AB (1) The change in the adsorption capacity of adsorbent according to varied adsorption parameters was calculated through Eq. (2): q Ci  C f m xV (2) where q is the removal capacity of adsorbent at equilibrium (mg/g), V is the volume (mL), m is the weight of adsorbents (g), Ci and Cf are initial and final concentration of Cr (III) (mg/L), respectively. ORAL PRESENTATION 101 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The isotherm methods of Langmuir, Freundlich, Temkin and Harkin-Jura were used to explain the adsorption process and reaction mechanism between Cr (III) and borax sludge. Langmuir isotherm assumes that the adsorption occurs in a mono layer and homogeneous surface. The adsorption of this kind of surface continues until the equilibrium point. Hence, the maximum amount of adsorption is reached at the moment of equilibrium. Langmuir equation is expressed by Eq. (3): qe  q max K L C e xV 1  K L Ce (3) where qe (mg/g) is amount of adsorbate adsorbed per unit mass of adsorbent, q max maximum adsorption capacity of adsorbent (mg/g), Ce is concentration of adsorbate in suspension at equilibrium (mg/L) and K L is Langmuir constant related to the affinity of the binding sites. The values of KL and qmax can be obtained from slope and intercept of 1/qe versus 1/Ce plot. In Langmuir isotherms, separation factor of R L is used to indicate the essential features of the isotherm. When R L is between 0 and 1, it expresses that the adsorption is favorable Eq. (4). RL  1 1  K LCi (4) Temkin isotherm assumes that the indirect adsorbate / adsorbate interactions on the adsorption process are effective and the heat of adsorption (Δ�ads) of all molecules in the layer decreases linearly with the increasing surface coverage. The equations for Temkin isotherm method are given in Eq. 5 and 6: qe  BT ln AT  BT ln Ce (5) BT  (6) RT bt where BT is the Temkin constant related to the heat of adsorption (kJ/mol), AT is the equilibrium binding constant, R is the gas constant (8.314 J/mol K), T is the temperature (K). The values for A T, BT and bt are calculated from the plot of qe versus lnCe (Senberber et al., 2017). Harkin-Jura isotherm assumes the possibility of multilayer adsorption on the surface of adsorbents having heterogeneous pore distribution (Nimibofa et al., 2017). The equation for Harkin-Jura isotherm method is given in Eq. 7: qe  AH BH  log C e (7) The adsorption constants of AH and BH are calculated from the plot of 1/qe2 versus logCe. The Lagergren pseudo-first order kinetic method, pseudo-second order kinetic method and intraparticle diffusion method were fitted to experimental data for investigation of the kinetic parameters and adsorption mechanism. The Lagergren pseudo-first and second order kinetic methods can be expressed by Eq. 8 and 9, respectively: dqt  k1 (q e  qt ) dt (8) dqt  k1 (qe  qt ) 2 dt (9) where k1 and k2 are the rate constants for the pseudo-first and second order methods (min-1), qt and qe are amounts of adsorbed Cr (III) per unit mass of adsorbent at time t and equilibrium time (mg/g), respectively. ORAL PRESENTATION 102 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The intraparticle diffusion kinetic model which gives information about the adsorption mechanism is formulated as Eq. (10). dqt  kid t 0.5  A (10) In Eq. (10), qt is amount of adsorbed Cr (III) per unit mass of adsorbent at time t (mg/g), t is contact time (min), kid is the intraparticle diffusion rate constant (mg/g.min1/2) and A is a constant. 3. RESULTS The effects of contact time on the Cr (III) removal from aqueous medium are shown in Figure 1. As seen in Figure 1, the treatment method significantly changed the equilibrium time for Cr (III) adsorption. Figure 1. The effects of different treatment methods on Cr (III) adsorption depend on the contact time The calculated isotherm constants and correlation coefficients (R2) of Langmuir, Temkin and Harkins-Jura models are given in Table 1. The fitting equilibrium data to adsorption isotherms is important to explain the interaction between adsorbates and adsorbents. For all applied isotherm models, high R2 values were obtained. Table 1. The adsorption isotherm constants for adsorption of Cr (III) by borax sludge Isotherm Plot Langmuir 1/qe vs 1/Ce Temkin qe vs lnCe Harkins-Jura 1/qe2 vs logCe ORAL PRESENTATION Parameter Ultrasonic stirring Magnetic stirring qmax KL RL R2 BT AT bt R2 AH BH R2 19.418 46.8182 0.0021 - 0.0007 0.9253 3.1962 765.629 0.8142 0.9288 0.0082 2.407 0.984 5.192 87.55 0.0011 - 0.0004 0.9998 16.023 251.764 0.1624 0.9415 3.5474 2.084 0.9823 103 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The experimental results were employed to find out the kinetic parameters using the three different models and the calculated kinetic parameters are listed in Table 2. The highest R2 was found for pseudo-second order kinetic model as 1 for both stirring methods and initial Cr (III) concentrations. Table 2. The calculated kinetic parameters for Cr (III) adsorption onto borax sludge Kinetic model Parameter Pseudo-first order Pseudo-second order Intraparticle diffusion qe K R2 qe K R2 Kid A R2 Ultrasonic stirring Initial Cr (III) concentration (mg/L) Magnetic stirring Initial Cr (III) concentration (mg/L) 10 20 30 10 20 30 0.6223 0.0806 0.9694 3.998 19.5469 1 0.0009 3.9906 0.967 0.0715 0.0953 0.9609 8.000 3.3967 1 0.0064 7.9499 0.9272 0.0055 0.0276 0.9655 12.019 0.3328 1 0.0643 11.513 0.9618 0.0098 0.015 0.8428 4 4.3104 1 0.0008 3.9877 0.9519 0.0849 0.023 0.9191 8.006 0.7091 1 0.0079 7.9039 0.7312 0.1165 0.0299 0.9647 12.005 0.6672 1 0.007 11.913 0.9139 4. DISCUSSION In adsorption process, the initial uptake of Cr (III) was rapid for both stirring method and in the following periods the adsorption took place slowly. Due to the higher interaction during the ultrasonic stirring, the adsorption system reached the equilibrium faster than magnetic treatment. In isothermal studies, RL values obtained from Langmuir isotherms for both of methods were in the range of 0 – 1. RL values indicate the adsorption to be unfavourable when R L>1, linear when RL=1, favourable when 0< RL<1, and irreversible when RL=0 (Nimibofa et al., 2017). Adsorption mechanism was favourable for both of methods, however ultrasound effects promoted Cr (III) adsorption on borax waste. Also, the calculated q max values for ultrasonic stirring was approximately four times bigger than qmax values of magnetic stirring method. On the other hand, the qmax value showed a decrease when compared with previous study in which the adsorption temperature was selected as β0°C (Senberber et al., β017). The higher R 2 values of Temkin isotherm explained that the heat of the adsorption of all Cr (III) molecules in a layer increase with the surface coverage of the adsorbate-sorbate interaction. The higher R2 values obtained in Harkins-Jura method showed the existence of heterogeneous pore distribution (Melvin et al., 2015). The highest correlations factors were determined for Pseudo-second order kinetic model. This indicated that the adsorption of Cr (III) adsorption on borax sludge was a chemisorption process. K constants were found in the range of 19.5469 – 0.3328 and 4.3104 – 0.6672 for ultrasonic stirring and magnetic stirring, respectively. 5. CONCLUSION Borax waste was used as an adsorbent for removal of Cr (III) from aqueous solutions. The adsorption was influenced by such parameters initial Cr (III) concentration and treatment method. The Cr (III) removal efficiency was increased with an increase in the initial Cr (III) concentrations. The experiments indicated that borax waste was suitable for Cr (III) adsorption and ultrasonic stirring contributed the maximum adsorption capacity of adsorbent. All the attempted isotherm models showed satisfactory correlation with experimental data. The kinetic calculations for Cr (III) removal were obtained and fitted to various kinetics models. According to the calculations, the adsorption mechanism of Cr (III) onto the borax waste was explained by the pseudo-second order kinetic model (R2=1) which showed the chemisorption controlled process. ORAL PRESENTATION 104 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org References Albadarina AB, Mangwandi C, Al-Muhtasebb AH, Walker GM, Allena SJ, Ahmad MNM 2011. Kinetic and thermodynamics of chromium ions adsorption onto low-cost dolomite adsorbent, Chemical Engineering Journal, 179: 193-202. Assem L, Zhu H 2007. Chromium, Toxicological Overview, Zhu Institute of Environment and Health Cranfield University. Ayawei N, Ebelegi AN, Wankasi D 2017. Modelling and interpretation of adsorption isotherm, 2017: Article ID 3039817, doi: 10.1155/2017/3039817. Babu BV, Gupta S 2008. Adsorption of Cr(VI) using activated neem leaves: kinetic studies, Adsorption, 14: 85– 92. Bailey SE, Olin TJ, Brick RM, Adrian DD 1999. A review of potentially low-cost sorbents for heavy metals, Water Research, 33: 2469-2479. Baruthi F 1992. Toxic effects of chromium and its compounds, Biological Trace Element Research, 32: 145-153. Daneshvar N, Salari D, Aber S 2002. Chromium adsorption and Cr(VI) reduction to trivalent chromium in aqueous solutions by soya cake, Journal of Hazardous Materials. B94: 49–61. Gode F, Pehlivan E 2005. Adsorption of Cr(III) ions by Turkish brown coals, Fuel Processing Technology, 86: 875– 884. Guertin J 2004. Toxicity and Health Effects of Chromium (All Oxidation States). In: Guertin J, Jacobs JA, Avakian CP (eds), Chromium (VI) Handbook. Florida: CRC Press, pp. 215-235. Holdgate MW 1979. A perspective of environmental pollution. Cambrige: Cambridge University Press. Inglezakis VJ, Loizidou MD, Grigoropoulou HP 2002. Equilibrium and kinetic ion exchange studies of Pb 2+, Cr3+, Fe3+ and Cu2+ on natural clinoptilolite, Water Research, 36: 2784–2792. Melvin Samuel S, Evy Alice Abigail M, Chidambaram R 2015. Isotherm Modelling, Kinetic Study and Optimization of Batch Parameters Using Response Surface Methodology for Effective Removal of Cr(VI) Using Fungal Biomass. PLoS ONE, 10(3): e0116884, doi:10.1371/journal.pone.0116884. Özdemir M, Kıpçak I β010. Recovery of boron from borax sludge of boron industry, Minerals Engineering βγμ 685–690. Pehlivan E, Özkan AM, Dinc S, Parlayi S β00λ. Adsorption of Cu2+ and Pb2+ ion on dolomite powder, Journal of Hazardous Materials, 167: 1044–1049. Sari Yilmaz M, Dere Özdemir O, Kasap S, Piskin S β015. The kinetics and thermodynamics of nickel adsorption from galvanic sludge leachate on nanometer titania powders, Research on Chemical Intermediates, 41: 1499–1515. Senberber FT, Yildirim M, Karamahmut Mermer N, Moroydor Derun E 2017. Adsorption of Cr(III) from aqueous solution using borax sludge, Acta Chimica Slovenica, 64: 654–660. Tahir SS, Naseem R 2007, Removal of Cr(III) from tannery wastewater by adsorption onto bentonite clay, Separation and Purification Technology, 53: 312–321. Utrilla JR, Polo MS β00γ. Adsorption of Cr(III) on ozonised activated carbon. Importance of Cπ—cation interactions, Water Research. 37: 3335–3340. World Health Organization, 1988. IPCS International Programme on Chemical Safety, Environmental Health Criteria. ORAL PRESENTATION 105 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Evaluation of Mg Wastes in Hydrothermal Synthesis of Magnesium Phosphate Fatma Tugce Senberber1* And Emek Moroydor Derun2 *1 Atasehir Adiguzel Vocational School, Program of Occupational Health and Safety, Istanbul, Turkey. 2 Yıldız Technical University, Department of Chemical Engineering, Istanbul, Turkey. Corresponding author e-mail: tugcesenberber@adiguzel.edu.tr Abstract The aim of the experiments is the evaluation of magnesium (Mg) wastes in magnesium phosphate synthesis. Mg wastes are reacted with phosphoric acid (H3PO4) at different mole ratios at the constant reaction temperature and time. For the identification and characterization, X-Ray Diffraction (XRD) and Fourier Transform Infrared Spectroscopy (FT-IR) are applied to synthesized minerals. The samples are identified as the mixtures of MgHPO4·γH2O and Mg3PO4·ββH2O phases. According to the Scherrer equation, the crystal sizes of synthesized compounds were in the range of 58.6 – 70.5 nm. Through FT-IR spectroscopy, the characteristic phosphate bands were observed. The characteristic band values between P and O atoms were good agreement with literature. Keywords: Mg wastes, magnesium phosphate, hydrothermal synthesis, characterization 1. INTRODUCTION The increase in the waste formation that require storage and disposal with developing technology is a problem for the whole world. Some kinds of waste would be hazardous for both people and environment. One of the dangerous wastes is metal wastes and scraps. Distribution of waste per person in the United States and Turkey are 8.9% and 7% of metal waste, respectively (T.R. Ministry of Education, 2009). Because of the increase in waste amount, the waste hierarchy was developed. It includes the steps of prevent, re-use, recycling, recovery and disposal (Nilsen, 2017). Metal wastes are 9.7% of solid wastes and the recycling of metal waste is aimed to increase to 60% by 2023. Stages of metal waste recycling process are a separate collection, magnetic extraction, smelting factory, recycled metal, comprises the steps of the new metal products (T.R. Ministry of Environment and Civilization, 2016). Magnesium wastes and scraps are produced by many industrial activities, all over the world. Most of the magnesium wastes and scraps occurs from the die casting part of vehicles or molds. Several types of magnesium waste have identified according to the content of metal and impurity such as high grade clean scrap, chip and fines etc. Magnesium wastes are combustible and oxidizing materials, therefore it should be careful in usage (Brown, 2000; Kramer 2002). Metal phosphates are the useful compounds that have unique applications in industry according to the metal ion in phosphate structure. Magnesium phosphates especially preferred as catalysts in the process of organic transformations, and bonding materials in refractors or mortars. Also they can be used in pharmacy, agricultural, textile or construction industry. Magnesium phosphates can be prepared in hydrates or non-hydrous forms. They have hydrate types such as MgHPO4·γH2O, Mg2PO4OH·4H2O, Mg3PO4·5H2O, Mg3PO4·8H2O and Mg3PO4·ββH2O or anhydrous types such as Mg3(PO4)2 and Mg2P2O7 (Aramendia et al., 1999a; Aramendia et al., 1999b; Kongshaug et al., 2001; Golubev et al., 2001; Sadiq et al., 2008; Boonchom, 2009; Britvin et al., 2002; Liu et al., 2012; Metres and Ginebra, 2011). The chemical and physical properties of these compounds depend on the synthesis procedure. Formation of a compound affected from many factors such as the synthesis method, raw material selection, mole ratio of raw materials, precipitation agent, pH, reaction temperature and time. In these experiments, the magnesium wastes were evaluated in the magnesium phosphate synthesis in hydrothermal conditions without using precipitation agent or additives. The effects of mole ratio on the characterization of synthesized structure was studied. ORAL PRESENTATION 106 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS AND METHODS 2.1. Materials and Characterization Metallic Mg wastes are obtained from local gold factory in Turkey. These wastes are formed at the instance of plastic molding in the manufacturing processes and they are to be stored in the factory. Element content of Mg wastes were identified with the X-Ray Fluorescence analysis by Philips PANanalytical brand Minipal Model 4 with silicon drift detector (Kipcak, 2012). Phosphoric acid (H3PO4) is supplied from Merck. Raw materials are used without any pre-treatment. 2.2. Synthesis and Sample Characterization Synthesis procedure can be explained with the reaction of Mg waste with H 3PO4 at the certain mole ratios in liquid medium. In these experiments, mole ratios of Mg/H 3PO4 were determined as 1:2, 1:1, 3:2, 2:1. The magnesium and Samples were synthesized at room temperature without using precipitation agent. The reaction time of 1 hour was used. After the reaction time ended, the slurry was filtered and dried at 40°C for β4 hours. The experimental flowchart is shown schematically in Figure 1. Figure 1. The experimental setup The possible synthesis reaction is given in Eqs. (1): 3Mg  2H 3 PO4  3H 2 O  Mg 3 ( PO4 ) 2  3H 2 O  3H 2( g ) (1) Samples were identified with the X-Ray Diffraction (XRD) analysis with Philips PANanalytical brand where in this equipment X-rays are produced from Cu-Kα tube at the parameters of 45kV and 40mA. The particle size of samples can be calculated from the highest peak in XRD pattern by using Scherrer equation which can be given in Eqs. (2):  K  t  cos( ) (2) where ί is the line broadening at half the maximum intensity (FWHM), K is a dimensionless shape factor (0.8λ), ζ is the X-ray wavelength, t is the average particle size of sample and θ is the Bragg angle (Özbay and Gülce, 2014). The characteristic band values of samples were detected by a Perkin Elmer FT-IR supplied with a universal attenuation total reflectance (ATR) sampling accessory accommodated with a diamond/ZnSe crystal. The measurement range was 4000 cm-1 - 400 cm-1. 3. RESULTS 3.1. XRF Results of Magnesium Waste Element content of magnesium wastes was given in XRF results, in Table 1. According to XRF analysis results; the major element in the waste composition is magnesium (93.36%) and the minor element is aluminium (3.67%). ORAL PRESENTATION 107 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 1. XRF results of the magnesium waste (Kipcak, 2012) Elements Content (%) Mg 93.36 Al 3.67 Fe 0.93 Mn 0.90 Zn 0.88 Cu 0.14 S 0.08 Cr 0.03 Ca 0.01 3.2. XRD Results As a result of the experiments, no solid precipitate was observed at 1: 2 mole ratio. XRD patterns of samples synthesized at the mole ratios of 1:1, 3:2, 2:1 were presented in Figure 2. Figure 2. XRD patterns of samples According to the XRD results, synthesized samples were identified as the “Newberyite” mineral with the chemical formula of MgHPO4·γH2O and powder diffraction file number of 01-075-1714. According to the XRD analyses, waste of Mg could be used in newberyite (MgHPO4·γH2O) synthesis. The characteristic peaks [h k l (dspacing)] of newberyite are seen at the βθ positions of 14.λβ ° [1 1 1 (5.λ4Å)], 16.6β° [0 β 0 (5.γ4 Å)], 17.γ8° [β 0 0 (5.10 Å)], 18.8γ° [0 β 1 (4.71 Å)], 1λ.77° [1 0 β (4.4λ Å)], β1.45° [1 1 β (4.14 Å)], β4.λ0° [β 0 β (γ.57 Å)], β5.74° [β β 1 (γ.46 Å)], β8.01° [1 γ 1 (γ.1λ Å)], β8.λ6° [γ 1 1 (γ.08 Å)], γ0.10° [β β β (β.λ7 Å)], γβ.λβ° [γ 1 β (β.7β Å)], γ4.78° [0 4 1 (β.58 Å)], and γ5.60° [1 4 1 (β.50 Å)] (Sivakumar, β000). ORAL PRESENTATION 108 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3.3. FT-IR Results FT-IR spectra of synthesized magnesium phosphates are shown in Figure 3. The characteristic band values over the 3200 cm-1 can be explained with the OH-1 vibration in the hydrate structure. Vibrational band of θ(PO 2(OH)) is observed in the region of 3100–2800 cm-1. The band values between 1700 and 1600 cm -1 are assigned to the H-O-H vibration. The symmetrical stretching of PO3- and PO4-3 are seen in the ranges of 1200 – 1100 cm-1 and 1100 – 1000 cm-1, respectively. The bending of PO2(OH) is generally seen at 885 cm-1. The band values lower than 700 cm-1 can be explained with the out of plane of phosphate ions. (Aramendia et al., 1999a; Boonchom, 2009). Figure 3. FT-IR spectra of samples 4. DISCUSSION Reuse of Mg waste is possible according to its purity (Kramer, 2002). In XRF analysis result, its high magnesium content indicates that the waste is suitable for use as a magnesium source. The absence of a white precipitate at a molar ratio of 1:1 indicated that the production could occur at higher waste rates. The final pH values of solution at the end of the reaction can be seen in Table 2. According to the Table 2, pH value of reaction medium increases with the increasing Mg amount in solution. Therefore, it can be said that ratio of 1:2 is not suitable for the synthesis procedure. Table 2. The final pH values of reaction medium after the reaction Mole Ratio (Mg/H3PO4) pH 1:2 3 1:1 5 3:2 5.2 2:1 5.5 ORAL PRESENTATION 109 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The Scherrer equation is applied on a sharp peak with a narrow width at 100% density. The particle sizes were calculated for the peak at around β5.74° for each sample. The minor changes were obtained with changing mole ratios. The average particle size of samples were found as 63.02 nm, 58.61 nm and 70.47 nm for mole ratios of 1:1, 3:2 and 2:1, respectively. Characteristic stretching of phosphate ions generally seen in the range of 2100 – 700 cm-1. These vibrations are the symmetrical and asymmetrical stretching of PO3- and PO4-3 anions. Obtain band values from FT-IR are in good agreement with the literature (Aramendia et al., 1999a; Boonchom, 2009). 5. CONCLUSION Reuse of waste is a step which is favourable for both the waste hierarchy and environmental health. These experiments showed that higher mole ratios than 1:1 of Mg/H 3PO4 could be suitable for Magnesium phosphate preparation without using any pH adjustment or precipitation agent. Prepared phase was identified as the “Newberyite” mineral with the chemical formula of MgHPO4·γH2O and powder diffraction file number of 01075-1714. Characteristic band values between the P and O atoms were compatible with the literature. REFERENCES Aramendia MA, Borau V, Jimenez C, Marinas JM, Romero FJ 1999. Synthesis and Characterization of Magnesium Phosphates and Their Catalytic Properties in the Conversion of 2-Hexanol. Journal of Colloid and Interface Science, 217: 288–298. Aramendia MA, Borau V, Jimenez C, Marinas JM, Romero FJ 1999. Synthesis, Characterization, and Catalytic Uses of Mg3(PO4)2/MgO Systems. Journal of Colloid and Interface Science, 217: 201–209. Boonchom B 2009. Kinetic and thermodynamic studies of MgHPO 43H2O by non-isothermal decomposition data. Journal of Thermal Analysis and Calorimetry, 98:863–871. Britvin SN, Ferraris G, Ivaldi G, Bogdanova AN, Chukanov NV 2002. Cattiite,Mg 3(PO4)2 · ββH2O, a new mineral from Zhelezny Mine (Kovdor Massif, Kola Peninsula, Russia). Neues Jahrbuch für Mineralogie, pp. 160-168. Brown RE 2000. Magnesium Recycling Yesterday, Today, Tomorrow, Fourth International Symposium on Recycling of Metals and Engineered Materials, pp. 1317–1329. http://library.nmlindia.org/FullText/RMEM20007.pdf Golubev SV, Pokrovsky OS, Savenko VS 2001. Homogeneous precipitation of magnesium phosphates from seawater solutions. Journal of Crystal Growth, 223:550–556. Kipcak AS, Senberber FT, Moroydor Derun E, Piskin S 2012. Evaluation of the magnesium wastes with boron oxide in magnesium borate synthesis. World Academy of Science, Engineering and Technology, 67(1):887-891. Kongshaug KO, Fjellvag H, Lillerud KP 2001. The synthesis and crystal structure of a hydrated magnesium phosphate Mg3(PO4)2·4H2O. Solid State Sciences, 3:353–360. Kramer D. 2002, Magnesium Recycling in the United States in 1998, Flow Studies For Recycling Metal Commodities In The United States, Available at: https://pubs.usgs.gov/of/2001/of01-166/of01-166.pdf [Erişim 17.0β.β018] Liu YH, Kumar S, Kwag, JH, Ra CS 2012. Magnesium ammonium phosphate formation, recovery and its application as valuable resources: a review. Journal of Chemical Technology & Biotechnology, 88: 181– 189. Metres G, Ginebra MP 2011. Novel magnesium phosphate cements with high early strength and antibacterial properties. Acta Biomaterialia 7:1853–1861. ORAL PRESENTATION 110 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Nilsen H 2017. The Hierarchy of Resource Use in a Sustainable Circular Economy, University of Oslo Faculty of Law Research Paper, Available at http://dx.doi.org/10.2139/ssrn.2981673 [Erişim 17.0β.β018] Özbay E, Gülce H β014. Çinko Oksit Nanopartikülleri Sentezi ve Karakterizasyonu, Selcuk University of Journal of Engineering Science and Technology, 2(4):1-5. Sadiq M, Bensitel M, Lamonier C, Leglise J 2008. Influence of the nature of precipitating basic agent on the synthesis of catalytic magnesium phosphate materials. Solid State Sciences, 10:434-437. Sivakumar GR 2000. Investigations on The Crystallization and Characterization Of Bio-minerals: Calcium and Magnesium Phosphate, PHD Thesis, Crystal Growth Centre Anna University, Chennai – India. Available at: http://hdl.handle.net/10603/76888 [Erişim 17.0β.β018] T.R. Ministry of Education 2009. Environmental protection, solid waste collection, Ankara. T.R. Ministry of Environment and Civilization 2016. National Waste Management and Action Plan 2023, Ankara. ORAL PRESENTATION 111 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Advanced Oxidation of Phenol Derivatives with Fenton and Photo-Fenton Treatment Processes: Effect of the Surface Water Matrix on Removal Rates, Degradation Products and Acute Toxcity of 2,4-DCP Idil Arslan-Alaton1*, Tugba Olmez-Hanci1, Miray Bekbolet2 *1 Istanbul Technical University, School of Civil Engineering, Department of Environmental Engineering, Istanbul, Turkey 2 Bogazici University, Institute of Environmental Sciences, Department of Environmental Chemistry, Istanbul, Turkey Corresponding author e-mail: arslanid@itu.edu.tr Abstract In this study the effect of Fenton and Photo-Fenton treatment on the degradation intermediates and acute toxicity of 2,4-dichlorophenol (0.46 mM), a model phenol derivate and industrial pollutant, was investigated in pure and simulated surface water. Fenton and Photo-Fenton (optimized treatment conditions: 10 mM H 2O2; 0.2 mM Fe2+, pH=3, t=120 min) processes ensured complete removal of 2,4-dichlorophenol in both pure water and simulated surface water. Hydroquinone, maleic and formic acids were identified as the common degradation products of the examined chemical/photochemical treatment processes. The Photo-Fenton process resulted in faster target pollutant and toxicity removal rates than Fenton treatment. The inorganic constituents (chloride, sulfate, phosphate, etc.) present in the simulated surface water did not inhibit 2,4-dichlorophenol degradation under the studied experimental conditions. Keywords: Phenol derivatives, advanced oxidation processes, Fenton and Photo-Fenton treatment, degradation products, acute toxicity, synthetic surface water. 1. INTRODUCTION Phenol derivatives are a diverse group of industrially important chemicals with high production and consumption rates. At the same time, effluent discharge containing chlorinated compounds is difficult to treat by conventional methods and in some cases very biotoxic (Sharma et al., 2013; Zazo et al., 2007). Hence, it is expected that chlorinated pollutants found in water and wastewater have detrimental effects on aquatic and terrestrial environments (Pimentel et al., 2008). For example, chlorophenols such as 2,4-dichlorophenol (2,4-DCP) are listed as “priority toxic substances” by the US EPA in the Clean Water Act (USEPA, β016). Considering these issues, the treatment and control of phenol derivatives in water and wastewater is a major, challenging task and a vast variety of biological, physical and chemical treatability studies have been reported in the scientific literature so far (Zazo et al., 2010). Among these, advanced oxidation process (AOPs) deserve special attention, since they rely on the formation and intermediacy of free radicals (mainly HO ●, HO2●) that strongly and almost nonselectively attack organic and inorganic pollutants found in water and wastewater (Gogate and Pandit, 2004). Among these, in particular iron-based AOPs have received special attention due to their high performance and hence superiority in terms of reaction kinetics and removal rates (Neyens and Baeyens, 2003). By UV, near-UV and even visible light irradiation, it is possible to enhance the Fenton’s reagent and thus accelerate free radical production. The aqueous ligand-to-metal charge transfer (LMCT) processes in which Fe3+ is reduced and HO is formed are shown below (Legrini et al., 1993); Fe(OH)2+* + h → Fe2+ + HO● photoreduction at 200 <  < 450 nm (1) *the dominant complex at pH = 2.8. The intermediacy of Fe3+ complexes is important in the dark (thermal) as well as photo-induced Fenton reactions (Detomaso, 2003); ORAL PRESENTATION 112 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Fe2+ + H2O2 → Fe3+ + HO● + OHFe3+ + H2O2 → Fe2+ + HO2● + H+ Fenton’s reagent, Fenton-like process, k=63 M-1 s-1 k=2.0  10-3 M-1 s-1 (2) (3) UV-C photolysis of H2O2 also contributes to HO● formation (Legrini et al., 1993); H2O2 → βHO● (at  < 300 nm) (4) Due to the fact that iron-based AOPs are very fast and difficult-to-control reactions, it is important to follow degradation products and aquatic toxicity during their application by employing product analysis and conducting bioassays. Besides, the presence of different anions (carbonate, bicarbonate, chloride, sulfate, nitrate, etc.) typically found in real waters, may inhibit AOPs due to competitive/scavenging reactions between these ions and reactive oxygen species (HO●, HO2●, etc.). Considering the above mentioned facts, in the present study it was aimed at investigating the degradation of 2,4DCP, which was selected as the model chlorophenol derivate and industrial pollutant, with the Fenton and Photo-Fenton treatment processes under previously optimized reaction conditions. Experiments were conducted in pure and simulated (synthetically prepared) surface water to mimic real water / wastewater treatment conditions. In order to examine the ecotoxicological effect of Fenton and Photo-Fenton treatments on 2,4-DCP, bioassays were also conducted employing the marine photobacteria Vibrio fischeri (V. fischeri) which is routinely used standardized procedure to determine and evaluate the acute toxicity of pollutants and their degradation products. 2. MATERIALS AND METHODS All chemicals required for the analytical and experimental procedures were at least of analytical grade and purchased from Merck (Germany) or Riedel-de Haën (Germany). Aqueous β,4-DCP solutions were prepared with distilled water, whereas for mobile phases, stock and standard solutions doubly distilled water with a conductivity of 0.055 ηS cm-1 was used (Arium 611UV, Sartorius AG, Germany). Fenton and Photo-Fenton experiments were performed in pure (distilled) water (PW) and synthetic surface water (SSW) that was prepared in accordance with Standard Methods (APHA/AWWA/WPCF, 2005) and composed of a mixture of inorganic salts at typical concentrations encountered in moderately hard freshwaters. The SSW simulates the potential inhibitory/scavenging effects being expected from common inorganic components of surface waters. In the Fenton and Photo-Fenton experiments, SSW was spiked with 2,4-DCP prepared from a stock solution of 4 g L-1 (6 mM) under constant agitation. 2.1 Fenton and Photo-Fenton Experiments Fenton and Photo-Fenton experiments were conducted in a 3250 mL capacity, cylindrical stainless steel photoreactor (length: 84.5 cm; diameter: 8.0 cm). The UV-C light source was a 40 W low pressure mercury vapor lamp being located in a quartz sleeve in the center of the photoreactor. The batch-operated photoreactor was mixed by means of a peristaltic pump at a flow rate of 25 mL min -1. The incident photon flux at 253.7 nm was determined as 0.066 ηeinstein cm -2 s-1 by H2O2 actinometry (Nicole et al., 1990). Fenton and Photo-Fenton experiments were carried out under previously optimized reaction conditions (Karci et al., 2012). At the beginning of these experiments, the initial pH of the aqueous 2,4-DCP solutions (0.46 mM) was adjusted to 3.0 using 2 to 6 N H2SO4. The pH was not controlled throughout the experiments. 10 mM H2O2 was introduced from a 35% w/w stock solution to the pH-adjusted, aqueous 2,4-DCP solution. Thereafter, the photoreactor was filled with the reaction solution by means of a peristaltic pump. FeSO 4·7H2O from a 10%, w/v (0.36 M) stock solution was also added as the Fe2+ source at a concentration of 0.2 mM as soon as the photoreactor was completely filled with the reaction solution. Sample aliquots were periodically withdrawn from the photoreactor and the reactions were immediately quenched upon addition 10 N NaOH solution and filtered through 0.45 ηm PVDF syringes (Millipore Corp., USA). In this way, iron catalyst was removed from the solution in the form of Fe(OH)3. ORAL PRESENTATION 113 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2.2 Analytical and Instrumental Procedures 2,4-DCP, its aromatic (hydroquinone; HQ) and aliphatic (maleic and formic acids) oxidation products were monitored by HPLC (Agilent 1100 Series, Agilent Technologies, USA) equipped with a diode array detector (DAD). Operating conditions of the HPLC for the quantification of the selected target compound and its degradation intermediates have been described elsewhere in more detail (Karci et al., 2012). Changes in acute toxicity during the application of Fenton and Photo-Fenton treatment processes were measured by using a commercial assay kit (BioTox™ν Finland) in accordance with an ISO test protocol (ISO, β008). The reagent was a lyophilised preparation of the marine photobacterium V. fischeri (NRRL B-11177). The assay is based on the decrease in light emission of V. fischeri resulting from its exposure to the toxicant. Prior to the assay the pH of all samples was adjusted to 7.0 ± 0.2 with NaOH or H2SO4 solutions. NaCl was added to obtain a final chloride concentration of 2% (w/v) in the samples. In order to eliminate its positive effect on the toxicity test results, any unreacted H2O2 remaining in the samples was catalytically decomposed with catalase made from Micrococcus lysodeikticus (200181 AU mL-1, Fluka, Sweden). The percent relative luminescence inhibition was measured after 15 min contact time at 15°C and expressed as the percent relative inhibition. 3. RESULTS and DISCUSSION 3.1 2,4-DCP Removals Figure 1 (a) and (b) presents percent 2,4-DCP removals in PW (a) and SSW (b) being compared for the Fenton and Photo-Fenton treatment processes, respectively. From Figure 1 it is evident that the photochemically enhanced Fenton (Photo-Fenton) process is superior in terms of 2,4-DCP removal which was complete in 20 min. In the case of Fenton treatment on the other hand, 2,4-DCP removal was slower and hence achieved at the later stages of the reaction. 2,4-DCP removal was complete after 40 and 70 min in SSW and PW, respectively. Surprisingly, in SSW, 2,4-DCP degradation occurred appreciably faster and the difference in 2,4-DCP abatement rates was particularly evident at the 20-40th min of treatment, where 2,4-DCP removals were obtained in the range of 40-60% in PW and 80-99% in SSW. Speculatively, secondary radicals such as chloride (Cl●) might form from the reaction between Cl - and HO● and continue the oxidation of 2,4-DCP and its degradation products in a more selective and thus less competitive way (Munoz et al., 2012). That depending on the nature and concentration of the organic/inorganic water components, no negative effect or even an enhancement can be expected during treatment of micropollutants with AOPs, has already been evidence in former related work (Parvez et al., 2006). Apparently, there was no difference between 2,4-DCP removal rates in PW and SSW during Photo-Fenton treatment, indicating that water constituents were not affecting the target pollutant removal rates. Hence, the effect of inorganics such as chloride, sulfate or phosphate could be tolerated when 2,4-DCP was exposed to Photo-Fenton or Fenton treatments. It should also be emphasized here that due to the carbonic acid-bicarbonatecarbonate equilibrium, not significant effect was expected from bicarbonate at pH3. 3.2 Hydroquinone Formation HQ was one of the common aromatic oxidation intermediates that were identified during Fenton and PhotoFenton treatments of 2,4-DCP. Figure 2 depicts HQ evolutions during Fenton and Photo-Fenton treatment of 2,4-DCP in PW and SSW. As is apparent in Figure 2, HQ evolution started a bit earlier during Photo-Fenton treatments (at the 6th min of treatment), probably due to the fact that 2,4-DCP removal was faster during the photochemically enhanced Fenton process. The highest HQ evolution was observed as 0.75 mg/L at the 20 th min of Fenton treatment in PW. For all studied iron-based AOPs, HQ formed and disappeared within 4 min and 1420 min during Photo-Fenton and Fenton processes, respectively. Obviously, HQ formation and abatement is closely linked to the water matrix and the studied treatment process. ORAL PRESENTATION 114 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 100 2,4-DCP Removal, % 80 60 40 PW (a) 20 0 0 10 20 30 40 50 60 Time, min Photo-Fenton Fenton 2,4-DCP Removal, % 100 80 60 40 SSW (b) 20 0 0 10 20 30 Time, min Photo-Fenton 40 50 60 Fenton Figure 4. Percent 2,4-DCP removals obtained during Fenton and Photo-Fenton treatments in pure water (a) and synthetic surface water (PW, SSW). Experimental, initial treatment conditions: 0.46 mM 2,4-DCP; 10 mM H2O2; 0.2 mM Fe2+, pH=3, t=120 min. ORAL PRESENTATION 115 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 0.9 Fenton-PW Fenton-SSW Photo-Fenton-PW Photo-Fenton-SSW 0.8 0.7 HQ, mg/L 0.6 0.5 0.4 0.3 0.2 0.1 0.0 0 10 20 30 Time, min 40 50 60 Figure 2. Hydroquinone (HQ) formation during Fenton and Photo-Fenton treatment of 2,4-DCP in pure and synthetic surface water (PW, SSW) samples. Experimental conditions are as in Figure 1. 3.3 Maleic and Formic Formation Maleic and formic acids were the only common aliphatic oxidation intermediates being quantified during Fenton and Photo-Fenton treatments of 2,4-DCP. Figures 3 and 4 display maleic and formic acid evolution profiles for 2,4-DCP treatment in PW and SSW for the iron-based AOPs, respectively. Generally speaking, maleic acid evolution occurred faster (within the first 20 min of treatment) during Photo-Fenton treatment, whereas maleic acid formation and abatement was slightly delayed and continued for as long as 80 min (between 10th and 90th min of oxidative treatment) during the Fenton process. In the case of formic acid evolution, similar profiles and trends were obtained as for maleic acid; formic acid formation and subsequent abatement was complete in a few min (between 1-10th min of treatment) during Photo-Fenton treatment, but occurred later (after 10 min treatment) and took 80 min for the Fenton process. Former researchers have already demonstrated that Fenton and Photo-Fenton processes kinetically and mechanistically differ appreciably from each other thus affecting degradation intermediate evolution profiles (Pérez-Moya et al., 2007) as was also the case in the present study. 3.4 Acute Toxicity Changes Figure 5 shows changes in percent relative photoluminescence inhibition rates being observed during Fenton and Photo-Fenton treatment of 2,4-DCP in PW and SSW. From Figure 5 it is clear that the original (t=0 min) acute toxicity of the sample changed with water matrix and SSW was more toxic to V. fischeri than PW (80% for PW and 100% for SSW). Acute toxicity results were also in parallel to 2,4-DCP removals since detoxification could be achieved during Fenton treatment of 2,4-DCP in SSW, but not in PW, where 2,4-DCP removals were also slower in PW than in SSW. Photo-Fenton treatment generally speaking resulted in quite promising results since practically complete detoxification could be reached which were quite in line with the 2,4-DCP removal profiles. Fenton treatment in PW resulted in a relatively poor detoxification rate where relative inhibition decreased from 80% to 55% after 90 min oxidation. ORAL PRESENTATION 116 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Fenton-PW Photo-Fenton-PW 3.5 Fenton-SSW Photo-Fenton-SSW Maleic Acid, mg/L 3.0 2.5 2.0 1.5 1.0 0.5 0.0 0 20 40 60 80 100 Time, min Figure 3. Maleic acid formation during Fenton and Photo-Fenton treatment of 2,4-DCP in pure and synthetic surface water (PW, SSW) samples. Experimental conditions are as in Figure 1. Fenton-PW Photo-Fenton-PW Fenton-SSW Photo-Fenton-SSW Formic Acid, mg/L 8.0 6.0 4.0 2.0 0.0 0 20 40 60 80 100 Time, min Figure 4. Formic acid formation during Fenton and Photo-Fenton treatment of 2,4-DCP in pure and synthetic surface water samples. Experimental conditions are as in Figure 1. ORAL PRESENTATION 117 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 100 Inhibition, % 80 60 40 20 0 0 10 20 30 Fenton-PW Photo-Fenton-PW 40 50 Time, min 60 70 80 90 Fenton-SSW Photo-Fenton-SSW Figure 5. Changes in per cent relative V. fischeri inhibition during Fenton and Photo-Fenton treatment of 2,4DCP in pure and synthetic surface water samples. Experimental conditions are as in Figure 1. 4. CONCLUSION AND RECOMMENDATIONS In the present study, the effect of water matrix being prepared to simulate surface water, was investigated for the treatment of 2,4-DCP, an industrially important and representative phenol derivative, by two iron-based advanced oxidation processes, namely the Fenton and Photo-Fenton processes. Results were comparatively assessed in terms of 2,4-DCP abatement, evolution of hydroquinone (selected as the commonly quantified aromatic oxidation intermediate), maleic and formic acids (selected as the commonly quantified aliphatic oxidation intermediates) as well as acute toxicity towards the marine photobacteria V. fischeri. Obtained experimental findings revealed that Photo-Fenton treatment was superior to the Fenton’s process in terms of β,4DCP removal rates and efficiencies and the simulated surface water sample did not exhibit any negative/inhibitory affect the treatment performance of the selected chemical and photochemical oxidation processes. However, the original (initial) acute toxicity increased for the synthetic surface water. Conclusively, Photo-Fenton but also dark Fenton treatment appeared to be promising and high performance treatment and detoxification options for the industrial pollutant and phenol derivative 2,4-DCP even in real water samples. ACKNOWLEDGEMENTS The authors thank Dr. Akin Karci for his contribution to the experimental work as well as the Scientific and Technological Research Council of Turkey for their financial support under Project Nr. 111Y145. REFERENCES American Public Health Association/American Water Works Association/Water Environment Federation 2005. Standard methods for the examination of water and wastewater. 21 st Edn., APHA/AWWA/WPCF, Washington, DC. Detomaso A, Lopez A, Lovecchio G, Mascolo G, Curci R 2003. Practical applications of the Fenton reaction to the removal of chlorinated aromatic pollutants. Environmental Science and Pollution Research, 10:379384. ORAL PRESENTATION 118 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Gogate PR, Pandit AB 2004. A review of imperative technologies for wastewater treatment I: oxidation technologies at ambient conditions. Advances in Environmental Research, 8:501-551. International Organisation for Standardization 2008. Water quality: Determination of the inhibitory effect of water samples on the light emission of Vibrio fischeri (luminescent bacteria test) Part 3: Method using freeze-dried bacteria, ISO 11348-2, Geneva. Karci A, Arslan-Alaton I, Olmez-Hanci T, Bekbölet M β01β. Transformation of 2,4-dichlorophenol by H2O2/UV-C, Fenton and photo-Fenton processes: oxidation products and toxicity evolution. Journal of Photochemistry and Photobiology A: Chemistry, 230: 65-73. Legrini O, Oliveros E, Braun AM 1993. Photochemical processes for water treatment. Chemistry Reviews, 93:671-698. Munoz M, de Pedro ZM, Pliego G, Casas JA, Rodriguez JJ 2012. Chlorinated byproducts from the Fenton-like oxidation of polychlorinated phenols, Industrial Engineering Chemistry Research, 51:13092-13099. Neyens E, Baeyens J 2003, A review of classic Fenton’s peroxidation as an advanced oxidation technique, Journal of Hazardous Materials, B98:33-50. Nicole I, de Laat J, Dore M, Duguet JP, Bonnel C 1990. Use of UV-radiation in water treatment-measurement of photonic flux by hydrogen-peroxide actinometry. Water Research, 24:157-168. Parvez S, Venkataraman C, Mukherji S 2006. A review on advantages of implementing luminescence inhibition test (Vibrio fischeri) for acute toxicity prediction of chemicals. Environment International, 32:265-268. Pérez-Moya M, Graells M, del Valle LJ, Centelles E, Mansilla HD 2007. Fenton and photo-Fenton degradation of 2-chlorophenol: multivariate analysis and toxicity monitoring. Catalysis Today, 124:163-171. Pimentel M, Oturan N, Dezotti M, Oturan MA 2008. Phenol degradation by advanced electrochemical oxidation process electro-Fenton using a carbon felt cathode. Applied Catalysis B: Environmental, 83:140-149. Poulopoulos SG, Nikolaki M, Karampetsos D, Philippopoulos CJ 2008. Photochemical treatment of 2chlorophenol aqueous solutions using ultraviolet radiation, hydrogen peroxide and photo-Fenton reaction. Journal of Hazardous Materials, 153:582-587. Sharma S, Mukhopadhyay M, Murthy ZVP 2013. Treatment of chlorophenols from wastewaters by advanced oxidation processes. Separation and Purification Reviews, 42:263-295. Stalter D, Magdeburg A, Weil M, Knacker T, Oehlmann J 2010. Toxication or detoxication? In vivo toxicity assessment of ozonation as advanced wastewater treatment with the rainbow trout. Water Research, 44:439-448. Zazo ZA, Casas JA, Molina CB, Quintanilla A, Rodriguez JJ 2007. Evolution of ecotoxicity upon Fenton’s oxidation of phenol in water. Environmental Science and Technology, 41:7164-7170. United States Environmental Protection Agency 2016. Effluent Guidelines-Toxic and Priority Pollutant under the Clean Water Act. Available at: https://www.epa.gov/eg/toxic-and-priority-pollutants-under-cleanwater-act [Erişim 14.0β.β018] ORAL PRESENTATION 119 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Extraction and Purification of Extracellular Glucosyltransferase (GTFs) from Streptococcus mutans Serotype C Isolate (H5) 1 Essam F. A. Al-Jumaily *, Hashim M. Z. AL-Seubehawy2 and Faris A. Al-Toraihy2 * Biotechnology Dept. Genetic Engineering and Biotechnology Institute for post graduate studies, Baghdad University- Baghdad-Iraq 2 Veterinary Medicine Research Center-Industry and Mineral Ministry, Baghdad-Iraq Corresponding author e-mail:Samgen992003@Yahoo.com Abstract The Streptococcus mutans isolates were tested for production of extracellular Glucosyltransferase (GTF) through determination of their enzyme specific activity. All isolates were able to produce the enzyme; Streptococci isolate (H5) which identified as Streptococcus mutans serotype C was selected as the best producible isolate for GTF with a specific activity of 2.6 U/mg. It was found that GTF of the chosen isolate (H5) was produced during the middle stationary phase (18-35 hr.) and its maximal productivity was reached at 22 hr. Purification of S. mutans serotype (C) H5 GTF were done by ammonium sulfate, ion-exchange chromatography (DEAE-Sephacel column), and gel-filtration chromatography using Sepharose 6B column. The best percent saturation use for precipitating GTF by ammonium sulfate was 20-40% with specific activity 2.4 U/ml. Two purified GTF enzymes (GTF-I and GTF-II) were detected with specific activity 35.5 U/mg, 8.3 U/mg after 96.1, 22.6 fold of purification respectively with yield 17.2%. Determination of purified GTF (GTF-I, GTF-II) molecular weight was done by using gel-filtration chromatography (Sepharose 6B) column with presence of standards proteins. It was found that the molecular weight of GTF-I, GTF-II was 125819, 112201 dalton, respectively. Keywords: Glucosyltransferase, DEAE-Sephacel column, molecular weight, Sepharose 6B. 1.Introduction S. mutans synthesis exocellular polysaccharide (EPS) i.e. glucan, from the glucosyl residuse of sucrose by secretion glucosyltransferase (GTFs). It is well known that S.mutans has at least three GTFs (GTF-B, C, and D) (Nishimura, et al., 2012). GT-B and D mainly synthesize water-insoluble α-(1-3) - and water soluble α-(1-6)glucan. GTF-C associates with insoluble and soluble glucan synthesis, which is controlled by the genes gtfB, gtfC, and gtfD (Koo et al., 2010). The gtfB and gtfC genes are tandomly arranged on S. mutans chromosomal DNA. (Ueda and Kuramitsu, 1988). The nucleotide sequences of gtf genes from different oral streptococci comply with the same basic pattern. The GTFs are very large proteins of approximately 1300- 1700 amino acids long (Devulapalle et al., 1997). Streptococcal GTFs have two common functional domains. The amino-terminal portion, the catalytic domain, is responsible for the cleavage of sucrose, and the carboxyl-terminal portion, the glucan binding domain, is responsible for glucan binding (Colby and Russell, 1997). In addition the two genes share extensive nucleotide sequence homology. The primary amino acid sequences of the streptococcal GTF enzymes are highly homologous. The synthesis of extracellular water-insoluble glucans from sucrose is necessary for the formation of dental plaque by S. mutans (Hamada and Slade, 1980). It is generally understood that this polymerization is catalyzed by two types of extracellular glucosyltransferase one synthesizing a watersoluble product from sucrose (GTF-S) and another synthesizing water-insoluble product from sucrose (GTF-I). These two types of GTF, when combined, synthesize a complex, highly branched, adherent, water-insoluble glucan (Walker, 1978). The development of dental caries has been an important topic in oral microbiology research for several decades. In both experimental animals and man, this role is mediated by the ability of these microorganisms to produce extraellular and cell-associated glucosyltransferase (GTF;EC 2.4.1.5) enzymes, which in turn, synthesize water-soluble and insoluble glucan from sucrose (Kuramitsu, 1975). The insoluble glucans that are involved in the adherence of S. mutans to the surface of the teeth. The attachment of S.mutans to smooth surfaces is primarily a consequence of the ability of these organisms to synthesize insoluble glucan products from sucrose therefore, the enzymes involved in this conversion glucosyltransferase GTF, play a key role in the initiation of dental plaque formation and subsequent caries development (Kurmatsu and Ingersoli 1976). Therefore recent studies to develop new strategies these are using specific drug vaccine. S.mutans possesses various cell-surface substances, which it is including serotype specific polysaccharide antigens, lipoteichoic acid, glucosyltransferase, glucan- binding protein, antigen D,A,C. These cell-surface molecules are thought to play important roles in interaction between the organism and its host and have been given much ORAL PRESENTATION 120 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org attention as vaccine candidates agent dental caries (Kruger, 2004). Glucosyltransferase and fragment of the molecules have been used as immunogenic agent (Culshaw et al.,2007). The aim of the study was to Purification and description of two kinds of glucosyltransferase enzyme from the local isolate Streptococcus mutans (serotype C) for the purpose of preamble as immunogens. 2.MATERIALS AND METHODS Extraction GTF of Streptococcus mutans It was prepared by modification the method was described by Hamada et al. (1989) and as followed: Bacterial isolates was grown on the brain heart infusion agar medium and incubated anaerobically at γ7 ᵒC for 48 hrs. A stock culture suspension was prepared by a separated loopful colony in 10 ml brain heart infusion broth and incubated anaerobically at γ7 ᵒC to reach the optical density of spectrophotometer to 0.75. A 1ml % of this stock culture was inoculated in to 180 ml Todd-Hewitt broth, supplemented with 1.8 % glucose and incubated anaerobically for β4 hrs. at γ7ᵒC, after this period broth culture was cooling centrifuge at 1000 xg for β0 minutes at 4ᵒC. The culture supernatant was precipitated with Ammonium sulfate at 40% saturation and kept overnight at 5Cᵒ. The sediment obtained by centrifugation was dissolved in β5 ml of distilled water and dialyzed in one liters of 0.05 M phosphate buffer pH 6.8 overnight. Total protein had measured by the Bradford (1976). Then the GTF activity estimated. GTF Activity Assay GTF activity had estimated according to the modification method described by Al-Hebshi et al (2005): The -fold dilutions of the crud bacterial enzyme (final concentration 1–0.01% w/v). The mixture was incubated at γ7ᵒCfor 2 hrs. Water-insoluble glucans were precipitated by centrifugation at 10,000g for 5 min. The supernatant was then transferred to another tube and water-soluble glucans precipitated by adding 1 ml 100% ethanol followed by n and centrifugation as above. The glucan pellet was hydrolyzed by boiling in 300– then neutralized by addition of an equal amount of 1 M NaOH. Finally, glucans were quantified using the phenol-sulphuric acid method. Purification of GTFs by Ion Exchange Chromatography The exchanger DEAE sephacel was prepared and packed into a column according to the recommendation of the manufacturing company (Sigma-Germany) as follows: DEAE sephacel is supplied pre-swollen in 24% ethanol. Prepare a slurry by decanting the 24% ethanol solution and replaced it with starting buffer in a ratio of 75% settled medium to 25% 20 mM tris-bis buffer pH 8.2 after this step degassing the medium and pour the slurry in to the column 7.5x3.5 cm, then the column equilibrated with the same buffer overnight. Partially purified concentration GTF 15ml were separately passed after loaded onto the column carefully. Then 100 ml of 20 mM Tris-bis buffer pH 8.2 was added. Flow rate estimated as 50 ml / hr. proteins were eluted by using 200 ml of a gradient from 0.5-1 M sodium chloride. Fractions of 5ml were collected and absorbency was monitored at 280 nm. The GTFs were estimated from each fraction of the major peaks as in (3.2.10) then protein concentration and specific activities were determined for the collected active fraction. Purification of GTFs by Gel Filtration Chromatography Sepharose 6B column 75 x 1.5cm was prepared and packed according to the instruction of the manufacturing company (Fluka) the column was equilibrated with 50mM phosphate buffer PH 7.5 at a flow rate of 50 ml / hr. A 10 ml sample of each concentrated partially purified GTFs was added to the column. Elutions of proteins were done with the application of 150 ml of 50 mM phosphate buffer PH 7.5. A 5 ml fraction was collected for each GTF then protein concentration was estimated by measuring the absorbency at 280 nm. GTF activity was determined for each fraction of the major peaks. Protein concentration and specific activities were also determined. Determination of Molecular Weight of GTFs by Gel Filtration Chromatography: 1.Determination of the Void Volume of the Column It was prepared by using Sepharose - 6B column 70 × 1.5 cm and peaked according to the recommended of the manufacturing company. The column was equilibrated with 50 mM phosphate buffer pH 7.5and with a flow rate of 48 ml / hr. blue dextran 2000 solution, was passed through the column then 200 ml of 50 mM phosphate buffer pH 7.5 was added to the column. Fractions of 5 ml were collected. The absorbency at 280 nm for each ORAL PRESENTATION 121 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org fraction was measured. The void volume (V o) was determined by the estimation of total volume of fraction as characterized with start point movement of the blue dextran to that of climax of absorbency of the blue dextran. 2.Determination of GTFs Elution Volumes (Ve) A 5 ml of partial purified GTFs samples were passed separately through Sepharose- 6B column 70 × 1.5 cm, and 200 ml of 50 mM phosphate buffer pH 7.5 with a flow rate 48 ml / hr. were passed through the column. Fractions of 5 ml were collected. The elution volumes (V e ) were estimated separately for each separated and dissolved fractions of purified GTFs by following the absorbency at 280 nm. 3.Mesurment of Standard Proteins Elution Volumes (V e) It was prepared by using several standard proteins ( Inulin with MW 5000 Dalton, Casein with 32500 Dalton, Bovine serum albumin with MW 67000Dalton and Catalase with 232000 Dalton )were passed through Sepharose 6B column, and then eluted with (50 mM) phosphate buffer (pH 7.5) with a flow rate of (48 ml / hr.). The elution volume was calculated for each standard protein by following the absorbency for the separated fraction at wave length 280 nm then the ratio of (V e / Vo) was calculated for each standard protein and for the dissolved and separated fractions of partial purified GTFs , then standardization was done, by plotting the elution volume of each standard protein to the void volume of the blue dextran 2000 versus the log of each standard protein molecular weight (Stellwagen, 1990) and thus the molecular weight of GTFs were accordingly calculated. 3.RESULTS The production of the enzyme from the streptococcus species of the isolates has done. From seventeenth isolates only twelve isolates is selected which depending on their productivity. It’s appeared from the results show in table (2) that all selected isolates are capable of producing an extracellular GTF enzyme and cell-associated GTF enzyme. Protein concentration and activity of GTF for isolates are made, and it’s found that specific activity of GTF are ranged between (0.54 - 2.6 U/mg protein). The specific activities of GTF of isolates (H1, H2, H3, H5, H6, H16, H21, and H28) are very approached to each other thus the conformation is made according to the choose the highest GTF producible bacteria among them. Table (2) GTF Production from Different Mutants Streptococci Isolate Enzyme Protein No Symbols Serotype Activity Conc. (U/ml) Specific Activity (U/mg) 1 H1 Other 32.8 20 1.64 2 H2 Other 27.8 22.3 1.24 3 H3 C 55.6 22.2 2.5 4 H5 C 65.7 25 2.6 5 H6 C 45.6 33.2 1.37 6 H9 Other 42.6 44.8 0.95 7 H10 Other 22.9 35.8 0.63 8 H16 Other 32.9 19.3 1.7 9 H17 C 19.4 23.5 0.82 10 H21 C 36.2 31.9 1.13 11 H24 C 26.9 33.9 0.79 12 H28 Other 44.2 39.8 1.11 ORAL PRESENTATION 122 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Specific activity (Unit / mg ) The extraction of GTF from these isolates is repeated for them in 10 ml BHI broth medium and again determined protein concentration, specific activity. Result has shown in figure (1) indicate that all isolates are capable to produce an extracellular GTF enzyme and the specific activities of GTF for all isolates are ranged between (0.54-2.6 U/mg protein) and the isolate (H5 )serotype C has the highest GTF specific activity (2.6 U/ mg protein), wherefore it is chosen H5 for large scale production and other characterization of GTF enzyme. 3 2 1 0 1 H1 2 H5 3 4 5 H76 H6 7H15 8 9 10 H21 H16 H28 ISOLATES Figure (1): The Abilities of the Mutans Streptococci Bacterial Isolates to Express GTF Production Phase of GTF 2 1,8 1,6 1,4 1,2 1 0,8 0,6 0,4 0,2 0 3 Absorbance 2,5 2 1,5 1 0,5 Enzyme Activity U/ml Absorbance at 600 nm In order to determine production phase for the isolate H 5 growth curve. Figure (2) appeares that no change in Absorbance through the first 6 hrs. This happenes ordinary because the lag phase of bacterium need to normalized the nutrition of medium. After this period absorbance began to rise in term 9 hrs. This period represented the log phase still the bacteria no produced the enzyme target, in the middle of stationary phase it is shown the first GTF activity exactly in the 18 hrs. The figure (2) has shown that the maximum production of GTF activity is in the hour (22). 0 0 10 20 30 Incubation Time (hrs) 40 50 Figure (2): Production Phase and GTF Activity of Streptococcus mutans (H5) Serotype C. Purification of GTF by Ammonium Sulfate The result has shown in table ( 3 ) indicated that best percent saturation used for precipitate GTF enzyme by ammonium sulfate was 20-40 % , it is estimated specific activity 2.4 U/ml while 60% saturation gave 0.6 U/ml and 20% saturation no activity is shown. Purification of GTF by Ion-Exchange Chromatography Purification of GTF enzyme by using ion- exchange chromatography DEAE-Sephacel. The concentrated sample from previous step (crud) 15 ml is passed separately through the DEAE Sephacel column. Two peaks are shown which represented by fraction peak I 39-42 and fraction peak II 45-47. Each fraction obtained from all fraction of enzyme sample which represented the peaks after washing and elution processes are tested for GTF ORAL PRESENTATION 123 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org activity and thus its clearly that only fraction peak I 39-42 and fraction peak II 45-47 are able to appeared GTF activity 4.2 and 7.2 U/ml respectively. (Figure 3) These two peak fraction of enzyme sample are collected each separately and named GTF-I and GTF-II respectively. Protein concentration, GTF activity and specific activity are estimated for each one of them. Result has shown in table (3) indicated that the amount of 85.7 U/ml, 54.7 with a Protein concentration of 19.5 mg/ml, 7.5 mg/ml and specific activity of 4.3 U/mg, 7.8 U/mg with purification fold of 6.1, 11.1 and yield of 10.4, 6.6 are obtained respectively for GTF- I (peak I) and GTF-II (peak II). According to these result two GTF enzymes (GTF-I, GTF-II) are obtained after purification with ion-exchange chromatography. Elution Washing 0,125 0.25 M 0,1 8 7 6 5 4 3 2 1 0 1M 0. 5 M 0,075 0,05 0,025 0 0 5 10 15 20 25 30 35 40 45 50 55 Enzyme Activity U/ml) Absorbancu at 280 nm Absorbance Fraction No. Figure (3): Purification of GTF Enzyme by Ion-Exchange Chromatography DEAE- Sephacel Column 12 x 3 cm. The Column Was Washed by Using 50mM Phosphate Buffer pH 7.5 and then Eluted by Using a Gradient of 0.25 M to 1 M NaCl . Purification of GTF by Gel-Filtration Chromatography Purification of GTF enzyme by gel-filtration chromatography Sepharose- 6B column. A 10 ml of concentrated partially purified GTF-I and GTF-II has taken from the purification previous step both is added separately to the column, the elution of proteins is done by 200 ml of 50mM phosphate buffer pH 7.5. Results have shown in figure ( 4 , 5 ) indicate clearly two peaks (one for GTF-I and one for GTF-II) represented by fraction 23-27, 25-29 respectively. It is determined GTF activity for two peaks which indicate that two fraction are able to produced GTF enzyme. Two fractions are pooled separately for each enzyme then GTF activity; protein concentration and specific activity are estimated. Result has shown in table ( 3 ) indicate that GTF-I and GTF-II are able to reflect GTF activity, protein concentration and specific activity of 27.2 U/ml, 97.8 U/ml; 3.25 mg/ml, 2.75 mg/ml, 8.3 U/mg, 35.5 U/mg after 11.8, 50.7 fold of purification and yield of 1.6%, 5.9% of GTF respectively. ORAL PRESENTATION 124 Absorbanc at 280 nm 0,35 9 8 7 6 5 4 3 2 1 0 protein con. Enzyme activity 0,3 0,25 0,2 0,15 0,1 0 10 20 30 40 Fraction No. Enzyme activity (U/ml International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 50 Figure (4): Purification of GTF-I by Gel Filtration Chromatography Sepharose 6B. 40 35 protein con. 1 30 Activity 0,8 25 0,6 20 15 0,4 10 0,2 5 0 Enzyme Activity U/mg Absorbanc at 280 nm 1,2 0 0 10 20 Fraction No. 30 40 Figure (5): Purification of GTF-II by Gel-Filtration Chromatography Sepharose- 6B. Table (3): Purification Scheme and Yield of GTF Enzyme from Streptococcus mutans (Serotype C) Volume (ml) Enzyme Activity (U/ml) Total Activity (U) Protein con. mg/ml Specific activity (U/mg) Yield (%) Fold 500 21.6 10800 57.3 0.37 100 1 40 165 6600 48.2 3.4 61.1 9.25 Peak I 20 108.5 2170 26.4 4.1 20.09 11.08 Peak II 20 54.7 1094 7.5 7.2 10.1 19.7 Peak I 15 27.2 408 3.25 8.3 3.7 22.6 Peak II 15 97.8 1467 2.75 35.5 13.5 96.1 Step Crude Enzyme GTF Culture Supernatant Ammonium Sulfate 20-40 % DEAE-Sephacel Column Chromatography Gel- Filtration Sepharose 6B ORAL PRESENTATION 125 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Estimation of Molecular Weight of Glucosyltransferase The purified two GTFs GTF-I, GTF-II are obtained from applied Sepharose- 6B. The void volume (Vo) of the column is estimating by determined the void volume of blue dextran 2000 and the elution volume (Ve) for each standard protein and then for the separated fraction of GTF-I, GTF-II and CA-GTF each separately. It is calculated the ratio of Ve of each standard protein and separated fraction of each partial purified GTF-I, GTF-II to the void volume of the blue dextran 2000. GTF-II are about 1.60, 1.73 and 1.82 respectively. GTF-I and GTF-II have approached Ve / Vo ratio which located between bovine serum albumin 67000 Dalton and catalase 232000 Dalton and thus it is appeared that the molecular weight of purified GTF-I and GTF-II is determined as 125891 Dalton and 112201 Dalton figure (6 ). Streptococcus mutans H5 (serotype C) is able to produce two glucosyltransferase enzymes GTF-I and GTF-II and has different molecular weight and it is supposed that the lower-molecular-weight fraction synthesized water soluble glucan, whereas the higher molecular weight fractions synthesized water-insoluble glucans. protein standard 5,5 ▲ GTF-I MW 112201 Dalton▲ Log Molecular wight 5 ● GTF-II MW 125891 Dalton 4,5 Catalase MW 232000 Dalton ■ Bovine serum albumin Casein MW 23500 Dalton 4 Inulin MW 5000 Dalton 3,5 3 0 1 2 3 4 5 Ve / Vo ratio Figure (6 ): Standardization of GTF Enzymes Accordance to The Ratio of Void and Elution volume (Ve / Vo) Ratio . 4. DISCUSSION According to the table (3) all isolates bacteria of mutans streptococci and serotype belonged this bacteria are capable to secret GTF, this result applied with numerous reports that confirmed mutans streptococci serotypes (A,B,C,D,F and G), S. salivarias and S. sanguis are capable to express several GTF types (Hamada et al., 1989). Form the Figure (1) AL-Jumaily et al (2009) indicated also that all isolates (mutans streptococci) are capable to produce an extracellular GTF enzyme but the specific activities of GTF for all isolates are ranged between 0.083-0.51U/mg protein as well as they indicated that all serotypes of mutans streptococci bacteria are capable to express GTF. Al- Mudallal, (2008) found that GTF activity extracted from S. sobrinus is noticed after 20 hrs and reached its maximum production during late stationary phase 24 hrs. The GTF activity continues until the 35 hrs. Then no activity is noticed. The expression and activity of the GTF enzymes can be influenced by several environmental conditions, including pH, ion concentration, availability of acceptor molecules and oxidation reduction potential (Narisawa, 2010). In the batch culture case as in this experiment the carbohydrate sources present in the ORAL PRESENTATION 126 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org medium beian to degradation, when the growth curve reaches to the late stationary phase, converting to the lactic acid during the Embeden Myerhove Pathway (EMP), therefore the pH of medium is decreased and reached to (3-4), this pH value is inconvenient for the GTF production then the production of GTF is detracted because the optimum condition to produce this enzyme approximately about pH 6-7. There are numerous reports and studies have been suggested that different strains of MS produced at least two kinds of extracellular GTF enzymes as Streptococcus mutans and it has been described on the basis of the formation of glucosyl linkages catalyzed by them (Fukui et al., 1983). Yamashita et al , (1988) obtained three major GTF fraction from the supernatant fluid of culture of strain S.mutans (serotype g), also AL-Mudallal et al. (2010) described three type of glucosyltransferase obtained after purification with ion exchange chromatography.When comparative with result of ALHayali, (β00β) who’s conclude that Streptococcus sobrinus has the ability to produce three types of GTF after the purification step by using Sepharose C1-6B and his evaluate of purification of this step for the third GTF reflected that GTF activity, protein concentration and specific activity of 0.20 U/ml, 0.09 mg/ml and 2.3 U/ml after 153.3 fold of purification with yield of 20.8% respectively. ALMudallal, (2006) described three kind of GTF of S. sobrinus (serotype g) and she determined molecular weight by using Sephacryl S-200, two of them are isozyme (same molecular weight) 128882 Dalton and the third has186208 Dalton. 5. CONCLUSION We can conclude from this study that the S.mutans (serotype C) is the most isolated bacterial species of mutans streptococci from the human dental plaque, and also other serotypes of mutans streptococci bacteria are able of producing two types of glucosyltransferase, extracellular GTF and cellassociated. REFERENCES Al-Hayali AM 2002. Isolation and purification of glucosyltransferase from mutans streptococci and the relation to dental caries, dental plaque and parameters of saliva. Ph.D. Thesis, College of Dentistry, University of Baghdad. AL-Hebshi NN, Nielsen Q, Skaug N 2005. In vitro effects of crude khat extracts on the growth, colonization, and glucosyltransferases of Streptococcus mutans. Acta Odontologica Scandinavica,; 63: 136–142. AL-Jumaily EF, AL-Mudallal NH, AL-Muhimen NA, AL-Shaibany AW 2009. Evaluation of mutans streptococci local strains for production of glucosyltransferase enzyme. J. Duhok Univ. V.12, (1): 227-232. Al-Mudallal, Nada Hisham Abd Al-Lateef (2006). Characterization of glucosyltransferase of mutans Streptococcus sobrinus (serotype G):Functional and immunological assessment. Thesis, college of Science, Al-Nahrain University. AL-Mudallal, N. H., AL-Jumaily, E. F., Abdul-Muhymen, N. and AL-Shaibany, A. W. (2010). Isolation and purification of glucosyltransferase from mutans streptococcus Sobrinus (serotype g) local isolate. Iraq J. of Medical Science V. 8 ( 4): 10-18 Barrientos S, Rodriguez A 2011. Production of glucosyltransferase B and glucans by Streptococcus mutans strains isolated from caries-free individuals.Acta Odontal. V. 24 (3): 258-264. Bradford MM 1976. A rapid and sensitive method for the quantitation of microorganism's protein utilizing the principleof protein-dye binding. Analytical Bioch. V. 72: 248-254. Colby SM, Russell RRB 1997. Sugar metabolism by mutans streptococci. J. Appl. Microbiol. V.83: 80-85. Culshaw S, Larosa K, Tolani H,Han X, Eastcott JW, Smith DJ, Taubman MA 2007.Immunogenic and protective potential of mutans streptococcul glucosyltransferase peptide constructs selected by major histocompatibility complex class II allele binding . Infect.Immun.V.75:915-923. ORAL PRESENTATION 127 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Devulapalle KS, Goodman SD, Ann Hemsley Q, Mooser G 1997. Knowledge-based model of a glucosyltransferase from the oral bacterial group of mutans streptococci. J.protein science V. 6: 2489-2493. Fujiwara T, Tero Y, Hoshino T, Kawabata S, Ooshima T, Sobue S, K[mura S, Hamada S 1989. Molecular analysis of glugosyltransferase genes among strain of streptococcus mutans. FEMS Microbiol. Lett. V.161: 331-336. Fukui K, Kokeguchi S, Kato K, Miyake Y, Nogami R, Moriyama T 1983. Immunochemical properties of glucosyltransferase from Streptococcus mutans. Infection and Immunity, V. 39: 762-766. Hamada S,Slade HD 1980.Biology.Immunology, and cariogenicity of Sreptococcus mutans.Microbiological Reviews. V.44:331-384. Hanada N, Takehara T, Saeki E 1987. Purification and characterization of third glucosyltransferase from Streptococcus mutans serotype g . J. of General Microbiology. V. 133: 1351-1358. Islam B, Khan SN, Khan AU 2007. Dental caries: From infection to prevention. Med. Sci. Monit. V.13(11): 196-203. Koo H, Duarte S, Murata R, Scott-Anne K, Gregori S,Watson G, Singh A, Vorsa N 2010. influence of the carenberry proanthocyanidins on formation of biofilm by Streptococcus mutans on salivacoated apatitic surface and on dental caries development in vivo. Caries Res. V. 44:116-126. Kruger C,Pearson SK, Kodama Y, Vacca-Smith A, Bowen WH 2004. The effects of egg derived antibodies to glucosyltransferases on dental caries in rats. Caries Res. V.38: 9-14. Kuramitsu HK 1975. Characterization of extracellular glucosyltransferase activity of streptococcus mutans. Infect. Immun. V.12: 738-749. Kuramitsu H, Ingersoli L 1976 .Immunological relationships between glucosyltransferase from streptococcus mutans serotyps .Infection and Immunity, 636-644. McCabe MM 1985. Purification and characterization of a primer-independent glucosyltransferase from Streptococcus mutans 6715-13 mutant 27. Infection and Immunity, V.50 (3): 771-777. Monchois V, Willemot RM, Manson P 1999. Glucan-sucrases: mechanism of action and structurefunction relationships. FEMS Microbiology review, V. 23: 131-151. Nishimura J, Saito T, Yoneyama H, Bai LL, Okumura K, Isogai E 2012. Biofilm formation by streptococcus mutans and related bacteria. Advanced in Microbiology. V2 :208-215. Narisaw N 2010. Development characterization and ecological implication of a smooth colony variant forming cariogenic streptococcus mutans . J.Oral Biosei. V.52(3) 245-251. Stellwagen K 1λλ0. Gel filtration. Inμ “Methods in Enzymology” (Dentscher) M.P. (edt.) Academic Press, New York V. 182:327-328.. Takada K, Fukushima K 1986. Effect of certain salts on glucosyltransferase synthesis by streptococcus mutans strain PS-14. J. Dent. Res.No. V.3: 452-455. Ueda S, Kuramitsu HK..1988. Molecular basis for the spontaneous generation of colonization – defective mutans of streptococcus mutans. Mol. Microbiol.V. 2: 135-140. Walker GJ 1978. Dxtrans. Int. Rev, Biochem. V.16: 75-126. Yamashita Y, Shigeoka T, Hanada N, Takehara T 1988. Immunological properties of the primerindependent glucosyltransferase of Streptococcus mutans serotype d and g. J. of General Microbiology, V. 134, 1232-1227. ORAL PRESENTATION 128 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Sediment Yapısının Tubifex tubifex’in Biyokimyasal Kompozisyonu Üzerine Etkisi Pınar ÇELİK* Çanakkale Onsekiz Mart Üniversitesi, Deniz Bilimleri ve Teknolojisi Fakültesi, Çanakkale, Türkiye. * Sorumlu yazar e-mail: pinarcelik@comu.edu.tr Özet Tubifex tubifex oligochaeta alt sınıfına dahil olan bir tatlısu solucanı türüdür. Aynı zamanda, T. tubifex tatlısu akvaryum balıklarının beslenmesinde yaygın olarak kullanılan bir canlı yem türüdür. Balıkların büyümesinde ve üremesinde oldukça etkili ve verimli bir protein kaynağıdır. Günümüzde tüketiciye sunulan T. tubifex’in neredeyse tamamı doğadan toplanmaktadır. Bu türün kontrollü şartlarda yoğun bir şekilde kültüre alınması ile ilgili deneysel çalışmalar devam etmektedir. Bu çalışmada, kültür şartları hakkında pek fazla bilgi bulunmayan T. tubifex solucanları farklı sediment ortamlarında tutulmuşlar ve besin kompozisyonlarındaki değişimler gözlenmiştir. Bunun için, volkanik toprak, zeolit, 0.5-1mm kuartz kum, 1-3mm kuartz kum, 35mm kuartz kum, normal deniz kumu ve yumurta kartonu gibi yedi farklı materyal sediment olarak kullanılmıştır. Kapalı devre çalışan akvaryumlarda yapılan deneme 60 gün sürmüştür. 60 günün sonunda grupların biyokimyasal kompozisyonları, amino asit ve yağ asit seviyeleri ölçülmüş ve gruplar arasında karşılaştırma yapılmıştır. Denemelerin sonunda en yüksek protein (%5β,57±0,67) ve en yüksek yağ (11,67±0,γ1) içeriğinin, sediment olarak γ-5mm kuartz kumun kullanıldığı grupta olduğu tespit edilmiştir. Doymamış yağ asit seviyelerinin bütün gruplarda benzer ve sabit değerlerde olduğu görülmüştür. Toplam amino asit seviyelerine göre ise en yüksek değerlerin γ-5mm kuartz kumun kullanıldığı grupta olduğu belirlenmiştir (22,07 g/100g). Anahtar Kelimeler: Tubifex tubifex, biyokimyasal kompozisyon, akvaryum balıkları, canlı yem. 1. GİRİŞ Balık beslemede özellikle de süs balıkları beslemede yaygın olarak kullanılan Tubifex tubifex, ekonomik olduğu kadar balık büyüme ve üremesine doğrudan etkili bir canlı yem türüdür. İçermiş olduğu ω-γ ve ω-6 serisi yağ asitleri, esansiyel aminoasit ve karotenoid pigmentleri dolayısıyla, özellikle tatlı su akvaryum balıklarının beslenmelerinde ihtiyaç duydukları besin maddeleri bakımından zengin bir besin kaynağıdır. Yapılan denemelerden elde edilen sonuçlarla, profesyonel üreticilerin istediği miktarlarda ve hastalık yapıcı etmenlerden arındırılmış, besin değeri optimum seviyelerde T. tubifex üretimi yapılabildiği takdirdeν işletmelerin balık üretim performansı artacağı gibi T. tubifex ticaretinde üretici-toptancı-perakendeci-tüketici döngüsü yeniden çalışmaya başlayabilir ve sadece kurt (T. tubifex) yetiştiriciliği yapan, yeni işletmelerin ortaya çıkması söz konusu olabilir. Bu sebeple, yoğun T. tubifex kültürü için farklı ortam şartlarının denenmesi ve bu ortamlardan elde edilen kurtların besin kompozisyonlarının belirlenmesininν sosyal, ekonomik ve hatta bilimsel alanda birçok pozitif çıktı elde edilmesine neden olacağı düşünülmektedir. Bu amaçla yaptığımız çalışmalarda yedi farklı sediment ortamının T. tubifex kurtlarının besin kompozisyonuna etkisine bakılmıştır. Çıkan sonuçlara göre, T. tubifex ana yaşam alanlarını oluşturan sedimentin yapısı besin büyüme, üreme ve biyo kimyasal kompozisyonları ile ilişkili olduğunu söylenebilir. Bundan dolayı da kültür ortamları için en uygun materyalin bulunması için bu çalışmada sunulan bulgular önem arz edebilir. 2. MATERYAL VE METOD Bu çalışma da uygulanan araştırma yöntemine daha önce başka bir bilimsel kaynakta rastlanmamış olup, tamamen bu çalışmaya özgü yöntemler kullanılmıştır. 2.1 Canlı Materyal Temini ve Deneyin Kurulumu T. tubifex pek çok ülkede olduğu gibi ülkemizde de hala doğal kaynaklardan toplanarak tüketiciye sunulmaya devam edilmektedir. Bundan dolayı da, ilk olarak geleneksel toplama yöntemini kullanan bir toplayıcıdan canlı deneme materyal temin edilmiştir. Deneme üniteleri kurulmuştur. T. tubifex’ler deneme ünitesine getirildikten sonra β hafta süre karantinada tutulmuş, akabinde β hafta süre ile deneme ortamına adapte edilmeleri sağlanmıştır. Bu süre zarfında 18°C sıcaklık ve 1β/1β fotoperiyot koşulları altında ticari balık yemi ile canlı ORAL PRESENTATION 129 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org ağırlığın %5’i oranında yemleme yapılmıştır. Denemede 1 adet β50 L filtre tankı ve 4 adet 100 L hacimli akvaryumlardan oluşan UV filtre düzeneği ilaveli kapalı devre sistemler kullanılmıştır. Filtre tanklarında azot türevi bileşiklerin ortamdan uzaklaştırılması için biyolojik filtrasyon yapılmış ve su daimi olarak hava motoru yardımı ile havalandırılmıştır. Su sıcaklıkları, filtre tanklarına yerleştirilen merkezi bir ısıtıcı/soğutucu yardımı ile ayarlanmış, günlük ¼ oranında su değişimi yapılmıştır. Denemede şebeke suyu kullanılmıştır. Doğal aydınlanma koşullarına uygun olarak tüm gruplara ait gerçekleştirilen uygulamalar, γ’er tekerrürlü olarak yürütülmüştür. 2.2 Sediment Materyali Bu aşamada, T. tubifex solucanlarının farklı sediment ortamlarındaki büyüme ve üreme performnasları gözlenmiş, besin kompozisyonlarındaki değişimler tespit edilmeye çalışılmıştır. Bunun için, volkanik toprak, zeolit, 0.5-1mm kuartz kum, 1-3mm kuartz kum, 3-5mm kuartz kum, normal deniz kumu ve yumurta kartonu gibi yedi farklı materyal sediment olarak kullanılmıştır. Kapalı devre çalışan akvaryumlarda yapılan deneme 60 gün sürmüştür. 60 günün sonunda grupların biyokimyasal kompozisyonları, amino asit ve yağ asit seviyeleri ölçülmüş ve gruplar arasında karşılaştırma yapılmıştır. Denemelerin sonunda elde edilen değerler hem deneme başı değerlerle hem de birbirleriyle karşılaştırılmıştır. Tercih edilen zeminler, ticari formda olup her daim temin edilebilecek özelliktedirler. Kapalı devre akıntılı sisteme tartılarak yerleştirilen zeminlerden sonra su sıcaklığı sabitlenmiştir. Geçmiş yıllarda T. tubifex ile yapılan bilimsel çalışmalara bakıldığında pek çoğunda su sıcaklığı β1ºC olarak kullanılmıştır. Bu sıcaklığın uygun sıcaklık olduğuna dair gözlemler bildirilmiştir. Bunlara istinaden bu deneme de su sıcaklığının β0ºC olmasına karar verilmiştir. 60 gün süren deneme boyunca su sıcaklığı β0ºC’ de sabit tutulmaya çalışılmıştır. Ancak oda sıcaklığındaki değişimlerden dolayı su sıcaklığı β0±1ºC olarak kaydedilmiştir. Canlı ağırlık miktarlarındaki değişimi görebilmek için deneme başında ve deneme sonunda yaş canlı ağırlık tartımları yapılmıştır. Deneme başında her bir tekerrür tankına ortalama 50’şer gr T. tubifex stoklanmıştır. 2.2 Analiz ve Ölçümler Besin kompozisyonunun belirlenmesi aşamasında, farklı sediment ortamlarında tutulan kurtların besin kompozisyonlarına bakılarak en iyi sonucun hangisinde alındığı ortaya konulmaya çalışılmıştır. Bu amaçla T. tubifex’in toplam yağ, kül, ham protein analizleri yapılmıştır. Yağ asitleri kompozisyonu ve toplam aminoasit tayini gerçekleştirilmiştir. Örneklerde toplam yağ analizi Erickson (1λλγ)’e göre metanol/kloroform ile ektrakte edilmiştir. Ektrakte edilen örneklerden rotary evaporator ile çözücüler uzaklaştırılmış ve elde edilen tartım sonuçları ile toplam yağ miktarı belirlenmiştir. Kül miktarı AOAC (β000)’e göre yapılmıştır. Belirli miktarda tartımı alınmış örnekler, kül fırınında 5β5 oC’de 1β saat yakılıp sabit tartıma getirilerek kül miktarı belirlenmiştir. Protein analizi Kjeldahl metoduna göre yapılmıştır (AOAC, β000). Örnekler 6,β5 faktörü ile çarpılarak toplam protein miktarı belirlenmiştir. Yağ asitleri kompozisyonu, gaz kromotografisi ile belirlenmiştir. Toplam yağ miktarından elde edilen örneklerin, öncelikle metal ester türevleri hazırlanmıştır. Bunun için örneklerden elde edilen ham yağlar, 0.5 N metanolik NaOH çözeltisi ve BFγ/MeOH ile esterleştirilmiştir. Esterleştirme işleminden sonra yağ asitleri sıvısıvı ekstraksiyon ile hekzan fazına alınarak gaz kromotografisi için hazır hale getirilmiştir. Elde edilen esterleştirilmiş yağ örneklerinin içerikleri gaz kromotografisi ile belirlenmiştir. Toplam amino asit için hidroliz işlemi yapılırken, öncelikle protein içerikleri belirlenmiş, her örnek içinde % γ0 düzeyinde protein olacak şekilde tartım yapılmıştır. Etüv 1101 C’ye ayarlanmış, sıcağa dayanıklı cam şişelere konulan örnekler üzerlerine β0 ml 6 N HCl ilave edilip azot gazından geçirilerek etüve konulmuştur. β4 saat sonra alınarak 0.β0 µm PTFE şırınga filtrelerinden süzülmüştür. Örnekler rotary evaporatörün balonuna koyularak su banyosu 65C’ye ayarlanarak hidroklorik asit uçurulmuştur. Uçurma sonrası balonda kalan örnekler sitrat–sodyum sitrat tamponu (0.1 M, pH β.β) ile seyreltme çözeltisine alınarak amino asit analizine hazır hale getirilmiştir (Srivastava ve diğ., 2006; Chi ve diğ.., 2008). Serbest amino asitlerin belirlenmesinde, kuru örneklerden belirli miktarda tartım yapılarak metafosforik asit çözeltisi ile 4 saat manyetik karıştırıcı ile ekstraksiyon işlemi yapılmıştır. Daha sonra elde edilen çözelti gaz kromotografisi ile tayin edilmiştir. ORAL PRESENTATION 130 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3. SONUÇ Deneme başında her bir tekerrürüne 50’şer gr T.tubifex stoklanan gruplarda 60 gün sonunda, en fazla canlı ağırlığın yumurta kolisi (Koli) grubunda olduğu tespit edilmiştir. Bütün gruplarda başlangıç ağırlığına göre canlı ağırlık bakımından bir azalma gözlenirken, sadece yumurta kolisi grubunda az da olsa bir artış olmuştur. Diğer gruplarda ise birbirlerine benzer sonuçlar elde edilmiştir. Besin kompozisyonu değerlerine bakıldığında, deneme sonunda 7 grupta da toplam protein değerleri ilk gelen canlıların toplam protein değerinin altında kalmıştır. Deneme sonunda en yüksek toplam protein değerine sahip iki grubun 3 – 5 mm kuartz kum grubu (%5β,57) ile koli grubu (%54,55) olduğu tespit edilmiştir (Tablo 1). Kül oranlarının ilk örneğe göre fazla çıkmasını ayıklama esnasında T. tubifex’leri zemin maddesinin tamamen ayırt edilememesine bağlanabilir. Nem oranlarında istatistiksel olarak farklılığa rastlanmamıştır (Tablo 1). Tablo 1. Toplayıcıdan Gelen İlk Örnek ile Farklı Sediment Denemesi Sonunda Elde Edilen Bireylerin Besin Kompozisyonu Değerleri (%Protein, %Yağ, %Kül ve %Nem). Protein Yağ Kül Nem 65,55±5,0γ 13,32 4,58±0,γ5 80,0γ±0,γλ İlk Örnek 41,70±0,18 10,16 γ1,70±0,γ1 81,λ5±1,8γ Volkan Top. 40,β8±0,λβ 8,92 γ1,14±0,γ0 8β,86±1,γ1 Zeolit 0,5-1mm 46,57±1,γ5 9,91 β5,λ6±4,γ5 80,λ7±1,5λ Kuartz Kum 1-3mm 46,64±γ,8λ 10,82 β0,56±1,05 81,65±1,βγ Kuartz Kum 3-5 Kuartz 5β,57±0,67 11,67 16,86±0,06 84,β6±1,0γ Kum γ6,76±1,γ4 10,5 γ6,γ1±0,5γ 78,61±γ,41 Normal Kum 54,55±0,β5 9,07 5,07±0,0λ 88,60±0,λλ Koli (Karton) Doğadan toplanan ilk örnekte toplam yağ yüzdesi 1γ,γβ olarak bulunmuştur. Deneme sonunda dört grupta (volkan toprağı (VOL), 1 – 3mm kuartz kum, 3 – 5mm kuartz kum ve normal kum) toplam yağ yüzdesi 10’un üzerinde tespit edilmiştir (Tablo 1). Tablo 2. Toplayıcıdan Gelen İlk Örnek ile Farklı Sediment Denemesi Sonunda Elde Edilen Bireylerin Yağ Asidi Kompozisyonları. İlk Vol Zeolit 0,5-1mm 1-3mm 3-5mm Kum Koli Örnek C4:0 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 C6:0 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 C8:0 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 C10:0 0,34 0,00 0,09 0,00 0,00 0,11 0,13 1,09 C11:0 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 C12:0 2,40 0,40 0,62 0,33 0,42 0,53 0,54 9,17 C13:0 0,54 0,17 0,22 0,13 0,13 0,15 0,16 0,64 C14:0 6,86 4,07 4,72 4,01 3,82 4,15 3,93 6,83 C14:1 1,70 0,45 0,53 0,37 0,36 0,61 0,36 0,94 C15:0 0,60 0,41 0,44 0,39 0,45 0,39 0,39 0,65 C15:1 0,17 0,11 0,10 0,00 0,11 0,00 0,09 0,08 C16:0 5,36 4,05 4,39 2,88 3,39 3,82 2,40 5,26 C16:1 7,18 4,04 4,26 2,73 3,51 3,80 2,39 5,04 C17:0 1,03 0,82 0,85 0,80 0,80 0,70 0,75 1,27 C17:1 0,23 0,09 0,10 0,14 0,13 0,18 0,14 0,08 C18:0 5,64 6,99 6,39 6,15 6,23 6,74 5,49 5,18 C18:1n9C+T 13,09 8,85 9,63 9,45 9,13 9,45 8,94 11,14 ORAL PRESENTATION 131 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org C18:2n6c C18:2n6t C18:3n6 C18:3n3 C20:0 C20:1n9 C20:2 C20:3n6 C21:0 C20:3n3 C20:4n6 C20:5n3 C22:0 C22:1n9 C22:2 C23:0 C22:6n3 C24:1n9 Doymamışlık (UNSAT) Doymuşluk (SAT) UNSAT/SAT Σ Sat Σ MUFA Σ PUFA ALA EPA DHA DHA/EPA 10,93 0,00 0,49 1,86 9,69 0,62 6,24 1,96 0,00 7,18 0,11 11,31 1,61 0,21 0,38 1,32 0,96 0,00 10,75 0,00 0,83 2,12 12,61 0,28 7,55 1,00 0,00 10,51 0,32 13,29 1,95 0,50 0,72 1,63 5,19 0,32 11,16 0,00 0,91 2,30 12,57 0,11 7,48 1,02 0,00 9,73 0,32 13,22 1,77 0,22 0,70 1,56 4,58 0,00 12,43 0,00 0,96 2,19 13,47 0,29 7,88 1,18 0,00 10,54 0,32 13,78 1,80 0,17 0,77 1,76 5,09 0,00 12,03 0,00 0,92 2,18 13,70 0,28 7,72 1,09 0,00 10,72 0,33 13,60 1,96 0,21 0,78 1,71 4,26 0,00 11,44 0,00 0,73 2,15 12,77 0,21 6,97 1,01 0,00 10,28 0,28 13,81 1,83 0,72 0,58 1,60 4,86 0,13 11,91 0,00 0,86 2,18 13,04 0,32 7,70 1,08 0,00 12,21 0,29 14,86 1,74 0,19 0,83 1,89 5,16 0,00 8,63 0,00 0,33 1,49 10,40 0,19 4,93 1,24 0,00 7,83 0,18 13,05 1,29 0,22 0,25 1,32 1,26 0,00 64,61 66,90 66,37 68,28 67,39 67,21 69,52 56,90 35,39 33,10 33,63 31,72 32,61 32,79 30,48 43,10 1,83 35,39 23,19 41,42 1,86 11,31 0,96 0,09 2,02 33,10 14,64 52,27 2,12 13,29 5,19 0,39 1,97 33,63 14,95 51,42 2,30 13,22 4,58 0,35 2,15 31,72 13,15 55,14 2,19 13,78 5,09 0,37 2,07 32,61 13,73 53,65 2,18 13,60 4,26 0,31 2,05 32,79 15,10 52,11 2,15 13,81 4,86 0,35 2,28 30,48 12,43 57,09 2,18 14,86 5,16 0,35 1,32 43,10 17,69 39,21 1,49 13,05 1,26 0,10 Sediment denemesi sonunda elde edilen yağ asitleri değerleri Tablo β’da verilmiştir. Doymamış yağ asitleri oranı deneme sonunda değişmese de DHA oranında bariz bir artma gözlemlenmiştir (Tablo β). Koli grubu hariç diğer bütün gruplarda, deneme sonu DHA oranı 4-5 kat seviyesinde artmıştır. EPA oranları bakımından hem gruplar arasında hem de ilk ölçüm seviyesine göre önemli derecede bir değişiklik olmadığı görülmektedir. Tablo 3. Toplayıcıdan Gelen İlk Örnek ile Farklı Sediment Denemesi Sonunda Elde Edilen Bireylerin Esansiyel Amino Asit(EAA) ve Esansiyel Olmayan Amino Asit (NEAA) Değerleri (g/100g). Esansiyel Amino Asitler İlk 0,5-1 1-3 3-5 Vol. Zeolit Kum Koli (EAA) Örnek mm mm mm Histidin (HIS) 1,00 1,06 1,09 1,14 1,07 1,34 0,83 1,09 Isolösin (ILE) 4,21 2,65 3,24 3,41 3,46 4,05 2,76 4,96 Lösin (LEU) 0,70 0,38 0,00 0,00 0,00 0,00 0,00 0,00 Lizin (LYS) 1,40 2,25 0,70 0,63 0,64 0,67 0,21 0,46 Metionin (MET) 3,51 2,22 2,71 3,02 2,88 2,99 2,46 4,40 Fenilalanin (PHE) 3,82 2,07 2,82 2,50 2,76 3,44 2,38 3,90 Treonin (THR) 6,34 4,27 5,12 5,41 5,02 6,13 3,96 6,96 Valin (VAL) 4,86 2,68 0,00 3,40 3,56 3,45 2,85 0,00 25,84 17,58 15,67 19,50 19,39 22,07 15,43 21,78 Toplam Esansiyel Olmayan İlk 0,5-1 1-3 3-5 Vol Zeolit Kum Koli Amino Asitler (NEAA) Örnek mm mm mm ORAL PRESENTATION 132 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Alanin (ALA) Aspartik Asid (ASP) Glutamik Asid (GLU) Glisin (GLY) Serin (SER) Tyrosin (TYR) Cystine (C-C) Hydroxylysine (HLY) Toplam EAA/NEAA 1,18 5,56 7,26 1,21 2,60 6,99 3,04 0,18 28,00 0,92 0,77 1,36 3,73 4,36 4,95 5,50 1,19 0,78 2,07 2,20 5,26 5,44 3,28 2,88 0,12 0,25 21,37 22,79 0,82 0,69 1,57 4,52 5,86 0,84 2,37 6,72 3,23 0,31 25,42 0,77 1,34 4,27 5,46 0,83 2,14 5,99 3,04 0,28 23,35 0,83 1,33 5,81 6,91 0,93 2,84 7,17 3,38 0,32 28,69 0,77 1,19 3,57 4,49 0,50 1,79 4,70 2,83 0,16 19,23 0,80 1,39 5,96 7,27 0,97 2,81 7,44 2,95 0,21 29,01 0,75 Doğadan toplanıp laboratuvara getirilen ilk örneklerde esansiyel amino asitlerden en fazla değere sahip olanların treonin (6,γ4), ısolösin (4,β1) ve valin (4,86) olduğu tespit edilmiş, deneme sonunda da durum değişmemiştir (Tablo 3). Toplam esansiyel aminoasit değerlerinde ise deneme sonunda en yüksek değer γ – 5mm kuartz grubunda ββ,07 g/100g olarak tespit edilmiştir (Tablo 3). T. tubifex‘lerin 7 farklı zeminde gösterdikleri büyüme ve hayatta kalma performansının gözlendiği bu denemede, bu kurtların zemin tercihlerinin nasıl oluğuna yönelik ilk veriler elde edilmiştir. Bu ilk verilere göre en azından burada kullanılan zeminlerin T. tubifex yetiştiriciliğinde işe yaramayacağını söylemek mümkündür. Bu deneme sonunda “T. tubifex yetiştiriciliği için en uygun zemin hangisidir?” Sorusuna net bir yanıt verilememiştir. Ancak kullanılacak zeminin yumuşak, sık gözenekli ve organik yük oranı fazla olması gerektiği bulgularına ulaşılmıştır. Ulaşılan en önemli bulgu iseν ortamdaki sediment yapısının üreme, büyüme ve besin kompozisyonundaki değişim ile doğrudan ilişkisi vardır. Uygun sediment materyalinin seçiminde bu canlıların doğadaki kaynaklarda olduğu gibi çamurumsu balçık gibi bir sediment taklit edilerek, daha da başka materyallerin denenmesi gerekmektedir. Diğer yandan bu çalışmadaki gruplarda canlı sayısının beklendiği oranlarda artmamasının en önemli nedeninin, doğrudan zemin kaynaklı olmadığı, verilen besinin yeterli olmamasının daha önemli bir etken olduğunu söylemek mümkündür. Ortamda yeteri kadar besin olmaması canlı biomasını doğrudan etkilemiştir. 4. TARTIŞMA Denemeler için Ekim ve Aralık aylarında toplayıcıdan T. tubifex alınmıştır. Ekim (%50,λγ±0,7β) ve Aralık (%65,55±5,0γ) aylarında gelen numuneler arasındaki protein değeri farklarının mevsimsel ve substrat özelliklerinden kaynaklandığı düşünülmektedir. Ekim ayında gelen T. tubifex’lerin kuru maddedeki protein değeri %50,λγ±0,7β ölçülmüştür. Yanar ve diğ. (β00γ) (%58,68) ile Bouguenec (1992) (%65)’e göre düşük, Bernard ve diğ. (1λλ7) (%46,1)’e göre daha yüksek bulunmuştur. Ekim ayında gelen canlılarla başlatılan sıcaklık denemesi sonucunda en yüksek üç grup β0°C (%55,18±1,4β), β8°C (%46,71± 0,7β) ve 16°C (%45,01±0,γγ) bulunmuştur. Aralık ayında gelen T. tubifex’lerin kuru maddedeki protein değeri %65,55±5,0γ bulunmuştur. Bu değer daha önceki yapılan çalışmalarla karşılaştırıldığında Bouguenec (1992)’nin bildirimine (%65) yakın değerlerde, Yanar ve diğ. (β00γ)’ün bildirimine göre (%58,68) daha yüksek değerde bulunmuştur. Aralık ayında gelen T. tubifex’ler ile yapılan sediment denemesi sonuncunda 7 grupta da (volkan toprağı, zeolit, 0,5-1mm kuartz kum, 1-3mm kuartz kum, 3-5mm kuartz kum, normal deniz kumu ve yumurta kolisi (karton)) kuru maddedeki protein değeri ilk örneğe göre düşük tespit edilmiştir. Bunun nedeni olarak ta denemede kullanılan yemin kuru maddedeki protein değerinin %45,51±0,45 olması neden gösterilebilir. Sediment denemesinde kuru maddedeki lipit değerleri 4 grupta (γ-5mm, 1-γmm, kum ve volkan toprağı) Yanar ve diğ. (β00γ)’ünde tespit ettiği gibi %10’un üzerinde çıkmıştır (sırasıylaν %11,67, 10,8β, 10,5 ve 10,16). Farklı sediment denemesi bulgularında EPA ve DHA omega-γ yağ asitleri ilk örneklerden daha yüksek bulunmuştur. Yanar ve diğ. (β00γ)’te yaptıkları çalışmada T. tubifex’lerde DHA’ya rastlamadıklarını ve zooplanktonik ve bentik organizmalarda yok denecek kadar az bulunduklarını rapor etmişlerdir. Amino asit değerlerine bakıldığında Yanar ve diğ. (β00γ)’te yaptığı çalışma ile bu deneme sonuçları arasında neredeyse tüm kalemlerde bariz farklılıklar tespit edilmiş olup yukarıdaki tablolarda sunulmuştur. Sonuç olarak, farklı sediment maddelerinde kültüre alınan Tubifex tubifex’in kuru maddedeki % protein değerlerinde azalma olmasına rağmen et verimi, yumurta kalitesi, büyüme gibi yaşamsal faaliyetlerde olmazsa olmaz yağ asitlerinde bariz artışlar gözlemlenmiştir. Özellikle de DHA yağ asidinin miktarı deneme sonunda en az 4 katına çıkmıştır. Sediment materyalinin yapısı T. tubifex yetiştiricilik performansını doğrudan etkileyebilecek bir unsurdur. Kullanılan sedimentin kurtların kendilerini rahatlıkla gömebilecekleri, zemin ORAL PRESENTATION 133 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org içerisinde kolay hareket etmelerine olanak sağlayan bir yapıda olması gerektiği bulgusuna ulaşılmıştır. Diğer yandan kullanılan sediment bu canlıların besin kompozisyonu da etki edebilmektedir. TEŞEKKÜR Bu çalışma, Çanakkale Onsekiz Mart Üniversitesi Bilimsel Araştırma Projeler Koordinasyon Birimi tarafından desteklenmiştir “Proje Numarası: FBA-2014-403.” KAYNAKLAR AOAC 2000. Official Methods of Analysis of AOAC International (17th ed.). AOAC International Suite 500, 481 North Frederick Avenue Gaithersburg, Maryland 20877-2417 USA Bernard, J.B., Allen, M.E. and Ullrey, D.E., 1997. Feeding captive insectivorous animals: Nutritional aspects of insects as food. Nutrition Advisory Group Handbook. Fact Sheet 003, August: 1-7. Bouguenec V. 1992. Oligochaetes (Tubificidae and Enchytraeidae) as Food in Fish Rearing: a Review and Preliminary Tests. Aquaculture. Volume 102, Issue 3, Pages 201-217. https://doi.org/10.1016/00448486(92)90149-F Chi Z, Yan K, Gao L, Li J, Wang X and Wang L 2008. Diversity of marine yeasts with high protein content and evaluation of their nutritive compositions. Journal of the Marine Biological Association of the United Kingdom,88(7): 1347-1352. Erickson M. C.1993. Lipid Extraction From Channel Catfish Muscle: Comparison of Solvent Systems Journal Of Food Science Volume 58, Issue Pages 84–89 Doi:10.1111/J.1365-2621.1993.Tb03217.X Srivastava A, Hamre K, Stoss J, Chakrabarti R and Tonheim SK (2006). Protein content and amino acid composition of the live feed rotifer (Brachionusplicatilis): With emphasis on the water soluble fraction. Aquaculture 254: 534-543. Yanar, M., Yanar, Y. & Genç, M. A. (2003). Tubifex tubifex Müller, 1774 (Annelidae)’in Besin Kompozisyonu, E.Ü. Su Ürünleri Dergisi, β0, 1-2, 103-110. ORAL PRESENTATION 134 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org EST-SSR Marker Identification in Cirsium arvense L. EST Databases Ebru Derelli Tufekci1*, Behcet İnal2, Ali Riza Tufekci3 *1 Cankiri Karatekin University, Yapraklı Vocational High School, Department of Field Crops, Cankiri, Turkey 2 Siirt University, Faculty of Agriculture, Department of Agricultural Biotechnology, Siirt, Turkey 3 Cankiri Karatekin University, Faculty of Sciences, Department of Chemistry, Cankiri, Turkey Corresponding author e-mail: ebru.derelli@gmail.com Abstract Cirsium species known as thistle and these species are rich as biological activities phenolic compounds. Cirsium arvense extracts and isolated compounds have antimicrobial, antidiabetic, antioxidant, hepatoprotective, antiinflammatory, vasorelaxant, cytotoxic activity toward cancer cells, anticancer activities. EST-SSRs or genic SSRs have been used usually in analyses of functional diversity, genetic mapping and/or marker-assisted selection in plants. In present study, 46,807 expressed sequence tags (ESTs) of Cirsium arvense L. were vused to search for simple sequence repeats (SSRs). A total of 5,062 EST-SSRs, which accounted for 10.9 % of all the ESTs, were identified. The most abundant EST-SSR types were trimeric repeats (2,147, 42%) followed by dimeric (1,130, 22%), tetrameric (1,716, 13%), hexameric (963, 19%), monomeric (597, 12%), pentameric (131, 3%) and tetrameric repeats (94, 2%). For SSR motifs, the most prevalent motifs ACC/GGT (509, 23.14%), followed by A/T (496, 22.55%), AAG/CTT (477, 21.69%), AAC/GTT (149, 6.77%) and AAT/ATT (132, 6.01%). We suppose that the EST-SSR markers provided here can be species-specific markers for taxonomic identification of C. arvense from other Cirsium species. Thus, the set of EST-SSRs developed in the present study is a promising resource for the related studies of Cirsium species . Keywords: Cirsium arvense, EST-SSR, microsatellite, sequence repeats. 1. INTRODUCTION Around the world, Cirsium species known as thistle. There are about 300 Cirsium species and 71 of them grows naturally in Turkey, also perennial plant belonging to family Compositae (Ozer et al., 2001). Cirsium species are believed to be harmful in agricultural areas as they can reproduce and grow uncontrollably. But the stem and roots of Cirsium genus have been used as food source and food additives in rural areas in Turkey for years (Demirtas et al., 2017). These species are rich as biological activities phenolic compounds (Noh et al., 2013) such as silibinin and silymarine. The compounds that are two of the most famously known examples of flavonoids from Cirsium species have hepatoprotective effects (Yildiz et al., 2013). The genus have also been used for the treatment of hemorrhaging (Meng et al., 2011), kidney inflammation and variety of abdominal and intestinal disorders (Guarrera 2005). Additionally, some recent research studies showed that Cirsium arvense L. extracts and isolated compounds have antimicrobial (Nazaruk and Jakoniuk, 2005), antidiabetic (Perez et al., 2001), antioxidant (Jeong et al., β008), hepatoprotective (D’Andrea et al., β005), anti-inflammatory (Lim et al., 2008), vasorelaxant (Kim et al., 2008), cytotoxic activity toward cancer cells (Lee et al., 2002), anticancer activities such as liver cancer, uterine cancer, leukaemia (Liu et al., 2007). Than, it can be a source of fiber, vitamins and minerals (Hossain et al., 2017). Microsatellites, or simple sequence repeats (SSRs), tandemly repeated nucleotide sequences (1-6 bases in lenght) and widely distributed across prokaryotic and eukaryotic genomes. SSRs have become the best choice among markers used in plant breeding programs, as they are practical, convenient, easy to use and inexpensive. Among all available molecular markers, SSRs are easy to score and have wide genomic distribution, codominant inheritance and a multiallelic nature (Chen et al., 2015; Han et al., 2016). ORAL PRESENTATION 135 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Expressed sequence tags (ESTs) are sequenced portions of complementary DNA copies of mRNA, and represent part of the transcribed region of the genome. they mainly correspond to relatively conserved sequences. Many applications, ESTderived markers (EST-SSR) can be used to cross-reference genes between species for enhancing the resolution in comparative genomics studies and identifying conserved genomic regions among species and genus (Poncet et al., 2006, Cheng et al., 2016). EST-SSRs offer the following advantages, for example: they should detect variation in the expressed portion of the genome, so that gene tagging should give ‘‘perfect’’ marker-trait associations, they can be developed at no cost from the EST databases [genomic SSRs (gSSRs) are expensive to develop] and once developed, these markers, unlike genomic SSRs, may be used across a number of related species (Gupta et al., 2003). Cirsium arvense L. species of EST sequences was defined within the ‘‘Compositae Genome Project CGP’’ (http://compgenomics.ucdavis.edu) by next generation sequencing platforms. In current study, we have mined Cirsium arvense L. transcriptome and characterised genome-wide EST-SSR markers for this species and developed EST-SSRs serve as a potential marker to allow a clear differentiation of Cirsium arvense L. taxa from other morphologically similar Compositae and other family plants. 2. MATERIALS AND METHODS 2.1 Data Retrieval and Analysis Illumina RNA-Seq data for Cirsium arvense L. was obtained from NCBI Short Read Achieve (SRA) database (https://www.ncbi.nlm.nih.gov/sra) under accession number SRX093410. The sequenced read length for forward and reverse sequences of paired-end data is 100 bp in length. All readings were obtained in raw sequence data as “.sra” format and converted to “fastq” format for Illimuna by the NCBI (National Center for Biotechnology Information) SRA Toolkit. After cutting the low-quality readings (Phred quality (Q) score <20) and trimming adapters with FASTX toolkit, all clean readings were exposed to FastQC analysis to control reading qualities in terms of per-base sequence qualities. All transcript sequences were subject to identify potential microsatellite or SSR motifs using a perl script called MIcroSAtellite tool (MISA, version 1.0). The parameters for identifying simple repeat motifs were as follows: (i) the SSR motifs are expected to contain mono-, di-, tri-, tetra-, penta-, and hexa-nucleotides with minimum repeat numbers of 10, 6, 5, 5, 4 and 3, respectively, (ii) a compound SSR motif was defined if the number of bases between two adjacent SSR motifs was ≤100. 3.RESULTS A total of 46,807 expressed sequence tags (ESTs) of Cirsium arvense L. were vused to search for simple sequence repeats (SSRs). A total of 5,062 EST-SSRs, which accounted for 10.9 % of all the ESTs, were identified. The EST-SSR contents of C. arvense indicated that the most abundant EST-SSR types were trimeric repeats (2,147, 42%) followed by dimeric (1,130, 22%), hexameric (963, 19%), monomeric (597, 12%), pentameric (131, 3%) and tetrameric repeats (94, 2%) (Figure 1). Among these EST-SSRs, the most dominant motifs were found to be ACC/GGT (509, 23.14%), followed by A/T (496, 22.55%), AAG/CTT (477, 21.69%), AAC/GTT (149, 6.77%) and AAT/ATT (132, 6.01%). These top five motifs accounted nearly for 80.17% of total motifs whereas the remaining thirteen motifs accounted for 19.83% (Figure 2). ORAL PRESENTATION 136 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 1. The frequency and distribution of EST-SSR types 600 500 400 300 200 100 0 Figure 2. Basic characteristics and number of top 18 dominant EST-SSR motifs in Cirsium arvense L. 4.DISCUSSION EST-SSRs composition and frequency of Cirsium arvense L., which used for phylogenetic studies, genuslevel taxonomy and population genetics, remain poorly defined. A total of 5,062 SSRs were identifed from 46,807 EST databases. These results clearly demonstrated that this species ESTs are a valuable resource for mining SSR markers. The densities of SSRs in the coding region were shown to be generally higher than those in the noncoding regions of the genome (Morgante et al., 2002).Thus there is considerable variation not only in the densities of EST-SSRs in different plant systems, but also between the densities of SSRs in coding and noncoding regions. Since the sample sizes used in different studies differed widely, only future investigations will resolve the significance of the variation in densities of SSRs in different regions of a genome in the same species and also among the whole genomes of different plant systems (Gupta et al., 2003). In the present study, trinucleotide repeats were found to be most abundant, which is in agreement with previous reports on several crop plants (Cardle et al., 2000; Scott et al., 2000; Varshney et al., 2002). Trinucleotide repeats are generally the most common motif found in both monocots and dicots (Eujayl et al. 2004; Varshney et al., 2005). However, they suggested that their result might have been due to the over- ORAL PRESENTATION 137 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org representation of untranslated regions (UTRs) compared with open reading frames (ORFs). Indeed, because of the absence of frameshift mutations when there are length variations in tri- and hexanucleotide repeats, these motifs are found in excess in both coding and noncoding sequences, but other repeat types are much less frequent in coding regions than in UTRs (Metzgar et al., 2000). As most microsatellite libraries used for marker development are generally enriched in mono-, di-, tri- and tetra-nucleotide repeats, computational mining of EST databases mainly involves these types of motifs (Morgante et al., 2002; Eujayl et al., 2004). The ACC/GGT motif was the most abundant trinucleotide motif (23.14%) in Cirsium arvense L. ESTs. These motifs were also the most frequently observed SSRs in plants (Scott et al., 2000; Gao et al., 2003; Thiel et al., 2003; Saha et al., 2004). The most abundant mono-nucleotide repeat motif detected in the present study was A/T (22.5%), closely followed by AAG/CTT (21.69%). These results are in agreement with other reports on dicot species (Scott et al., 2000; Eujayl et al., 2004; Kumpatla and Mukhopadhyay, 2005). Finally, EST databases provide a valuable resource for the development of SSR-markers, which are associated with transcribed genes. The EST-SSR identification, development and characterization in the Cirsium arvense L. very scarce, mainly due to the limited number of transcriptomic and genomic studies. We suppose that the EST-SSR markers provided here can be species-specific markers for taxonomic identification of C. arvense from other Cirsium species. The EST-SSR data can also be used for this genus specific markers. However, EST-SSRs are the preferred method at genome-wide level because of their multi-allelic and codominant nature as well as quite high level of transferability across species/genus. 5.CONCLUSION EST-derived SSRs, which can easily be extracted from EST databases, can be used successfully and EST databases provide a valuable resource for the development of SSR-markers, which are associated with transcribed genes. In addition to mapping ESTs via microsatellite loci for locating the genes of putative functions, the EST-derived SSRs developed are a useful tool to study the genetic diversity within plants, although the potential limitations imposed by homoplasy and allele likeness require further attention. In the present study we comprehensively mined and characterised the publicly available transcriptome data from C.arvense to identify EST-SSR markers at EST databases. Thus, the set of EST-SSRs developed in the present study is a promising resource for the related studies of Cirsium species. KAYNAKLAR Cardle L, Ramsay L, Milbourne D, Macaulay M, Marshall D, Waugh R 2000. Computational and experimental characterization of physically clustered simple sequence repeats in plants. Genetics, 156(2): 847-854. Chen H, Wang L, Wang S, Liu C, Wohlgemuth Blair M, Cheng X 2015. Transcriptome Sequencing of Mung Bean (Vigna radiate L.) Genes and the Identification of EST-SSR Markers. PLoS ONE, 10(4): e0120273. Cheng J, Zhao Z, Li B, Qin C, Wu Z, Trejo-Saavedra DL, Luo X, Cui J, Rivera-Bustamante RF, Li S, Hu K 2016. A comprehensive characterization of simple sequence repeats in pepper genomes provides valuable resources for marker development in Capsicum. Scientific Reports, 6, 18919. Demirtas İ, Tufekci Ali Riza, Yaglıoglu Sahin Ayse, Elmastas M β017. Studies On The Antioxidant And Antiproliferative Potentials Of Cirsium Arvense Subsp. Vestitum. Journal of Food Biochemistry, 41(1): e12299. Eujayl I, Sledge MK, Wang L, May GD, Chekhovskiy K, Zwonitzer JC, Mian MA 2004. Medicago truncatula EST-SSRs reveal cross-species genetic markers for Medicago spp. Theor Appl Genet 108(3): 414-422. Gao LF, Tang JF, Li HW, Jia JZ 2003. Analysis of microsatellites in major crops assessed by computational and experimental approaches. Mol Breed, 12(3): 245-261. Guarrera PM 2005. Traditional phytotherapy in Central Italy (Marche, Abruzzo, and Latium). Fitoterapia, 76(1): 1-25. Gupta PK, Rustgi S, Sharma S, Singh R, Kumar N, Balyan HS 2003. Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol Gen Genomics, 270: 315-323. ORAL PRESENTATION 138 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Han B, Wang C, Tang Z, Ren Y, Li Y, Zhang D, Dong Y, Zhao X 2016. Genome-Wide Analysis of Microsatellite Markers Based on Sequenced Database in Chinese Spring Wheat (Triticum aestivum L.). PLoS ONE, 10(11): e0141540. Hossain L Md, Monjur-Al-Hossain ASM, Saha S, Sadhu SK 2017. Assessment of Biological Activity on Cirsium arvense L. Algerian Journal of Natural Products, 5(1): 417-426. Jeong DM, Jung HA, Choi JS 2008. Comparative antioxidant activity and HPLC profiles of some selected Korean thistles. Archives of Pharmacal Research, 31, 28-33. Kumpatla SP, Mukhopadhyay S 2005. Mining and survey of simple sequence repeats in expressed sequence tags of dicotyledonous species. Genome, 48(6): 985-998. Lee WB, Kwon HC, Cho OR, Lee KC, Choi SU, Baek NI, Lee KR 2002. Phytochemical constituens of Cirsium setidens Nakai and their cytotoxicity against human cancer cell lines. Archives Pharmacal Research, 25(5): 628-635. Morgante M, Hanafey M, Powell W 2002. Microsatellites are preferentially associated with non-repetitive DNA in plant genomes. Nature Genet, 30: 194-200. Meng Y, Wang Q, Yang L 2011. Pharmacological effects of Cirsium setosum in Hei Long Jiang. Inf. Tradit. Chin. Med, 28, 17-18. Metzgar D, Bytof J, Wills C 2000. Selection against frameshift mutations limits microsatellite expansion in coding DNA. Genome Res, 10: 72-80. Noh H, Lee H, Kim E, Mu L, Rhee YK, Cho CW, Chung J 2013. Inhibitory effect of a Cirsium setidens extract on hepatic fat accumulation in mice fed a high-fat diet via the induction of fatty acid boxidation. Bioscience, Biotechnology and Biochemistry, 77: 1424-1429. Ozer Z, Tursun N, Onen H β001. Yabancı otlarla sağlıklı yaşamμ (Gıda ve Tedavi). p. 50, 4 Renk Yayınları ve Tanıtım Matbaacılık, Ankara. Perez G, Ramirez L, Vargas S 2001. Effect of Cirsium pascuarense on blood glucose levels of normoglycaemic and alloxan-diabetic mice. Phytotherapy Research, 15(6): 552-554. Poncet V, Rondeau M, Tranchant C, Cayrel A, Hamon S, Kochko A, Hamon P 2006. SSR mining in coffee tree EST databases: potential use of EST–SSRs as markers for the Coffea genus. Mol Gen Genomics, 276: 436449. Saha MC, Mian MA, Eujayl I, Zwonitzer JC, Wang L, May GD 2004. Tall fescue EST-SSR markers with transferability across several grass species. Theor Appl Genet, 109(4): 783-791. Scott KD, Eggler P, Seaton G, Rossetto M, Ablett EM, Lee LS, Henry RJ 2000. Analysis of SSRs derived from grape ESTs. Theor Appl Genet, 100(5):723-726. Thiel T, Michalek W, Varshney RK, Graner A 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet, 106(3): 411-422. Varshney RK, Thiel T, Stein N, Langridge P, Graner A 2002. In silico analysis on frequency and distribution of microsatellite in ESTs of some cereal species. Cell Mol Biol Lett, 7(2002): 537-546. Varshney RK, Graner A, Sorrells ME 2005. Genic microsatellite markers in plants: features and applications. Trends Biotechnol, 23(1): 48-55. Yıldız O, Can Z, Saral O., Yulug E, Ozturk F, Alıyazıoglu R, Canpolat S, Kolaylı S β01γ. Hepatoprotective potential of chestnut Bee pollen on carbon tetrachloride-induced hepatic damages in rats. Evidence-Based Complementary and Alternative Medicine, 2013(2013): 9 pp. ORAL PRESENTATION 139 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Electromagnetic Micromanipulator Designs for Biological Species Mustafa Böyük, Kutay İçöz, Günyaz Ablay Abdullah Gül University, Department of Electrical-Electronics Engineering, Kayseri, Turkey Corresponding author e-mail: gunyaz.ablay@agu.edu.tr Abstract Micromanipulation of biological species is significant for biological separation, medical treatment, and biosensors. While many different actuating techniques have been studied in recent years, the most promising micromanipulation method is related to magnetic actuators. In this work, design and analysis of quadrupole magnetic actuators for two dimensional manipulation of biological particles are studied. Finite element method based numerical methods are used for analysis and magnetic force calculations. Several different quadrupole electromagnetic actuating systems are designed and analyzed, and an optimal design is obtained. Keywords: micromanipulation, magnetic actuators, magnetic tweezers, separation. 1. INTRODUCTION In recent years, the micromanipulation systems have become an important research area due to their effective application potentials in many fields. It is expected that the micromanipulators will have a crucial role in many fields including biotechnology, medicine, electronics, appliances etc. Various actuating mechanisms can be used for micromanipulation. Electrostatic force can be generated to actuate a micro-electro-mechanical system (Donald et al. 2006). Dielectrophoresis can be used to trap or manipulate micro particles (Gauthier et al. 2006). Piezoelectric materials can be used to generate traveling waves in elastic tails as a propulsion method while the required high voltage currently cannot be developed in micron-level due to technological limitations (Kosa et al. 2007). Thermal actuators (e.g., silicon carbon-nitride) can also be considered for micromanipulation, but they are not suitable for biological environments (Liew et al. 2002; Cahill et al. 2003). It is also possible to use Bacterial manipulation through magnetotactic bacteria which can be used to push special microstructures (e.g., microbeads) (Martel et al. 2006, 2009). Optical tweezers are able to trap and manipulate micro particles (Onda and Arai 2012). The optical manipulation is suitable for quasi-static force measurement and dynamic force sensing (Huang et al. 2011). The optical tweezers are inherently stable, but heating and photo-damage are very critical problems (Peterman et al. 2003). The most effective results have been obtained when magnetic force is utilized in different ways such as swimming microrobots and magnetic resonance based micromanipulation (Qiu et al. 2015; Abbott et al. 2009; Belharet et al. 2010). Magnetic field as a principal force and magnetostrictive principle as a secondary oscillating mode are used for untethered manipulation of magnetic micro-structures (Jing et al. 2011). Permanent magnet and electromagnet based magnetic tweezers have been recently developed for manipulation and quantification of biological species. One significant application of the magnetic actuation is the magnetic tweezers. They are composed of permanent magnets or electromagnets to apply controlled forces and torques to biological molecules. There exist different configurations of magnetic tweezers including various permanent magnet configurations, electromagnet needle, multi-pole electromagnets. Magnetic tweezer is a single molecule-technique such that in its typical implementation external magnetic field controlled superparamagnetic bead is used to manipulate bio-molecules. It is designed and employed to offer an insight into the function and dynamics of bio-molecules, for instance, extracting properties of DNA, RNA and polymerases (Lipfert et al. 2009; Kriegel et al. 2017). The main advantages of magnetic tweezers include exerting and measuring from fN level to mN level forces, safe operations in biological environments, measurements of multiple molecules, and possibility of various robust designs for different needs and applications (Vlaminck and Dekker 2012). Permanent magnets offer simple designs without any control action or motorized designs for spatial manipulations. The selection of permanent magnets are usually based on empirical studies rather than ORAL PRESENTATION 140 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org quantitative analyses and predictions (Neuman and Nagy 2008). This type of magnetic tweezers can be used for developing biosensors (İçöz and Mzava β016) and for analyzing the topology of DNA molecules (Strick et al. 1998), and to study topoisomerases (Charvin et al. 2005). Electromagnets, on the other hand, utilize coils, pole pieces and open-loop control or feedback control mechanisms for complex spatial manipulations. The experience on manipulation small pieces and maglev trains with electromagnets (Eroğlu and Ablay β016ν Han and Kim 2016) have been modified recently for micromanipulation applications. In the literature, the designed magnetic tweezers are mostly simple force appliers with open-loop control, namely, the required magnetic forces are applied to the magnetic particles and the motions are measured (Levi et al. 2005; Zhang et al. 2010). The main advantage of the electromagnetic tweezers is to control a magnetic particle in three dimensional space with suitable control mechanisms. While most of the studies have been reported that electromagnetic tweezers produce lower magnetic forces (or field strengths and gradient forces) compared with permanent magnets, electromagnetic tweezers can be more powerful with suitable designs and control mechanisms (Hosu et al. 2003; Neuman and Nagy 2008; Vlaminck and Dekker 2012). The electromagnets in magnetic tweezers must be designed quantitatively to predict forces on superparamagnetic particles. Due to the complexity of the geometries, numerical methods are more suitable than the analytical methods. Such a numerical analysis method allows one to obtain predictive calculations to optimize the selection of electromagnet materials, geometry and choice of beads for a given specific implementation before performing experiment studies. The numerical calculations are usually done with finite element methods. The finite element analysis is the most effective numerical calculation method for solving electromagnetic field problems and there are many commercially available software packages to apply this powerful method. Here we compute the specifications of the electromagnetic manipulator, i.e., the required magnetic fields and the forces applied to superparamagnetic beads, via numerical simulations since the complex geometry do not allow us to apply analytical Biot-Savart law. The magnetostatic problem is solved numerically in three dimensions using an effective finite element solver by considering geometry and material properties of magnets, yoke and magnetic bead. Using this ability to quantitatively predict the magnetic forces, we systematically investigate the effects of different magnet geometries and of adding an iron yoke to the magnet configuration. By considering a two-dimensional actuating system, several quadrupole magnetic manipulators are designed and analyzed for obtaining optimal designs. 2. MATERIALS AND METHODS The accurate analytical or semi-analytical analysis of magnetic fields of the complex geometries is usually not possible. Hence, alternatively the magnetostatic problem of the magnetic manipulators can solved numerically using finite element methods. We use both open source FEMM software for two dimensional analysis and the AC/DC module of the COMSOL Multiphysics software (COMSOL, Burlington, MA) to solve the partial differential equations related to Maxwell equations defined by B   A ,  H  J (1) where B is the magnetic flux density, A is the magnetic vector potential, H is the magnetic field intensity, J is the current density and defined by J   E  J e , J e  NI coil / Acoil (2) where E is the electric field intensity, σ is the electrical conductivity, N is the number of turns in the coil, Icoil is the total coil current, and Acoil is the total cross section area of the coil domain. COMSOL Multiphysics is a very powerful simulation platform that includes specification of materials and geometry, the physics of the specific phenomena to be solved, and post-processing models for producing accurate and trustworthy results. From solutions of magnetic vector potential A, COMSOL computes the magnetic field B and its components in a region of interest, which can be exported from the program. It requires a powerful computer for time-effective solutions, so all numerical calculations are performed on a dual processor powerful workstation. The physical concept of the magnetic force generated by the MTs can be explained as follows. The force on a superparamagnetic bead in a magnetic field gradient is calculated by (Shevkoplyas et al. 2007) ORAL PRESENTATION 141 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org F  0.5   m( B)  B  (3) where m(B) is the magnetic moment of the particle and its defined as = � � /�0 , where � is the susceptibility and � is the volume of the bead, for small external fields. Then, the force is given by F  Vb  B / 20 2 (4) For large external magnetic fields (under saturation conditions), the force is defined by F  0.5 (msat  B) (5) where � is the saturation value of the magnetic moment. It is clear that the superparamagnetic bead in an external magnetic field experiences a magnetic force which is proportional to the gradient of the square of the magnetic field under normal operating conditions. Normally, magnetic beads have different compositions, sizes and shapes that determine their chemical and physical properties depending on the related application. Magnetic beads can be coupled with specific ligands to allow the separation and purification of cells, nucleic acids, proteins, and other molecules in an efficient way. The main goal of the usage of superparamagnetic bead is because the superparamagnetic particles react similar to a paramagnet with a much higher susceptibility under external magnetic field while the net magnetic moment is zero without any external magnetic field. For these reasons, superparamagnetic beads find applications in manipulation and separation related biological and biomedical studies (Shevkoplyas et al. 2007; Jin et al. 2014). 3. RESULTS Coil design is one of the most important components in the generation of magnetic force, because the coil design must be optimal for effectively applying the magnetic force. There are an infinite number of coil design options by considering multi-dimensional force applications. In this work we considered two dimensional position control of superparamagnetic bead via external magnetic field generation. Hence, a four-coil based configuration is considered for symmetric force generations. While many different actuator designs are considered and tested, for comparison aim only four different magnetic actuator schemes are illustrated in this work as seen in Figure 1. In the designs, the coil is designed to have 300 copper turns with a height of 70 mm. The core is built with Nickel-Iron alloy material with a radius of 2.5 mm, because this alloy has a strong magnetic permeability and high saturation values as seen in Figure 2 (Davis 2001). The applied current is kept constant at 0.5 A. The superparamagnetic bead has a radius of β.8 µm, and the distance between the bead and coil tip is 50 µm. Figure 1a shows a four-coil design with circular core tips. Figure 1b displays the sharpened and extended core tips. Figure 1c displays the four-coil system designed in Figure 1b with a surrounding square yoke. Figure 1d shows the same coils with a surrounding circular yoke. Our goal is to analyze these different designs in order to find the optimal design for manipulation of a superparamagnetic bead in two dimensional space. For the analyses, the COMSOL Multiphysics as an advanced finite element numerical solver is used, since it is not possible to use analytical tools accurately due to complex geometries. It is found that while the first design given in Figure 1a produces the weakest magnetic flux on the tip of the core, the designs illustrated in Figures 1c and 1d produces the strongest magnetic flux density on the sharp tips. Designs with yokes generate higher magnetic flux density compared with designs without yokes because the yoke creates a path for magnetic field circulation. We have also found that the yoke shape, that is square or circular, does not have a considerable effect on the magnetic flux density. The structure of one electromagnet with magnetic flux density distribution is illustrated in Figure 3. To analyze the effect of taper length for optimal magnetic flux densities, various taper lengths are considered and the results are shown in Figure 4. The taper length ranges from 2mm to 16 mm. It is clearly seen in numerical calculations given in Figure 4 that for the given magnetic actuator design the maximum magnetic flux density is obtained for a taper length of 6mm. This is well-readable from Figure 5 where magnetic flux density variation for different taper lengths is shown. ORAL PRESENTATION 142 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org To sum up, the magnetic actuator generates an external force on the superparamagnetic bead proportional to the gradient of the square of magnetic field. Large magnets generate strong magnetic fields, but weak field gradient, and thus slowly changing forces in a large area. It is possible to produce strong magnetic forces and sharp field gradients with small magnets, but the magnetic force diminishes exponentially fast with distance. Hence, it is desirable to apply magnetic force in the close neighborhood of the magnets. Bead Coil Core (a) (b) (c) (d) Yoke Figure 5. Various magnetic actuator design concepts. M M ag ag net net ic ic sat sat ur ur ati ati Nickel, % Figure 6. Magnetic saturation of binary nickel-iron alloys at various field strengths (Davis 2001). ORAL PRESENTATION 143 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Coil Taper length Core Figure 7. Magnetic flux density in the core. Bead D=50um (a) (e) (c) (b) (f) (g) (d) (h) Figure 8. Magnetic flux density calculations for different taper lengths: a) 2mm, b) 4mm, c) 6mm, d) 8mm, e) 10mm, f) 12mm, g) 14mm, h) 16mm. Figure 9. Magnetic flux density variation for different taper lengths. ORAL PRESENTATION 144 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4. CONCLUSION Recent studies of magnetic actuators have been demonstrated that they can be integrated into molecule manipulation and force spectroscopy techniques efficiently. In this study, design and analysis of quadrupole magnetic micromanipulators are addressed for optimal solutions. In the designs two dimensional micromanipulations are considered and possible solutions with electromagnet based magnetic actuators are investigated. It is found that electromagnets with tip-shaped cores and yokes are able to provide the greater magnetic flux density and magnetic force for superparamagnetic beads. Magnetic micromanipulators have a high potential for various applications in various fields due to their biocompatible features, controllability, and lots of design options. ACKNOWLEDGEMENTS This work was supported by Turkish Scientific and Research Council (TUBITAK) under project number 116E168. REFERENCES Abbott JJ, Lagomarsino MC, Zhang L, Dong L, Nelson BJ. How Should Microrobots Swim? Int J Robot Res. 2009 Jul 21;1434–47. Belharet K, Folio D, Ferreira A. MRI-based microrobotic system for the propulsion and navigation of ferromagnetic microcapsules. Minim Invasive Ther Allied Technol. 2010 Jun;19(3):157–69. Cahill DG, Ford WK, Goodson KE, Mahan GD, Majumdar A, Maris HJ, et al. Nanoscale thermal transport. J Appl Phys. 2003 Jan 15;93(2):793–818. Charvin G, Strick TR, Bensimon D, Croquette V. Tracking topoisomerase activity at the single-molecule level. Annu Rev Biophys Biomol Struct. 2005;34:201–19. Davis JR. Asm Specialty Handbook: Nickel, Cobalt, and Their Alloys. ASM International; 2001. Donald BR, Levey CG, McGray CD, Paprotny I, Rus D. An untethered, electrostatic, globally controllable MEMS micro-robot. J Microelectromechanical Syst. 2006 Feb;15(1):1–15. Eroğlu Y, Ablay G. Cascade sliding mode–based robust tracking control of a magnetic levitation system. Proc Inst Mech Eng Part J Syst Control Eng. 2016 Sep 1;230(8):851–60. Gauthier M, Régnier S, Rougeot P, Chaillet N. Analysis of forces for micromanipulations in dry and liquid media. J Micromechatronics. 2006;3(3):389–413. Han H-S, Kim D-S. Magnetic Levitation: Maglev Technology and Applications [Internet]. Springer Netherlands; 2016 [cited 2018 Feb 5]. (Springer Tracts on Transportation and Traffic). Available from: //www.springer.com/us/book/9789401775229 Hosu BG, Jakab K, Bánki P, Tóth FI, Forgacs G. Magnetic tweezers for intracellular applications. Rev Sci Instrum. 2003 Aug 20;74(9):4158–63. Huang Y, Cheng P, Menq CH. Dynamic Force Sensing Using an Optically Trapped Probing System. IEEEASME Trans Mechatron. 2011 Dec;16(6):1145–54. İçöz K, Mzava O. Detection of Proteins Using Nano Magnetic Particle Accumulation-Based Signal Amplification. Appl Sci. 2016 Nov 29;6(12):394. Jin R, Lin B, Li D, Ai H. Superparamagnetic iron oxide nanoparticles for MR imaging and therapy: design considerations and clinical applications. Curr Opin Pharmacol. 2014 Oct;18:18–27. Jing W, Chen X, Lyttle S, Fu Z, Shi Y, Cappelleri DJ. A magnetic thin film microrobot with two operating modes. In: 2011 IEEE International Conference on Robotics and Automation (ICRA). 2011. p. 96–101. Kosa G, Shoham M, Zaaroor M. Propulsion Method for Swimming Microrobots. IEEE Trans Robot. 2007 Feb;23(1):137–50. Kriegel F, Ermann N, Lipfert J. Probing the mechanical properties, conformational changes, and interactions of nucleic acids with magnetic tweezers. J Struct Biol. 2017 Jan 1;197(1):26–36. Levi V, Ruan Q, Gratton E. 3-D Particle Tracking in a Two-Photon Microscope: Application to the Study of Molecular Dynamics in Cells. Biophys J. 2005 Apr 1;88(4):2919–28. Liew L-A, Bright VM, Dunn ML, Daily JW, Raj R. Development of SiCN ceramic thermal actuators. In: The Fifteenth IEEE International Conference on Micro Electro Mechanical Systems, 2002. 2002. p. 590–3. ORAL PRESENTATION 145 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Lipfert J, Hao X, Dekker NH. Quantitative Modeling and Optimization of Magnetic Tweezers. Biophys J. 2009 Jun 17;96(12):5040–9. Martel S, Mohammadi M, Felfoul O, Lu Z, Pouponneau P. Flagellated Magnetotactic Bacteria as Controlled MRI-trackable Propulsion and Steering Systems for Medical Nanorobots Operating in the Human Microvasculature. Int J Robot Res. 2009 Apr 1;28(4):571–82. Martel S, Tremblay CC, Ngakeng S, Langlois G. Controlled manipulation and actuation of micro-objects with magnetotactic bacteria. Appl Phys Lett. 2006 Dec 4;89(23):233904. Neuman KC, Nagy A. Single-molecule force spectroscopy: optical tweezers, magnetic tweezers and atomic force microscopy. Nat Methods. 2008 Jun;5(6):491–505. Onda K, Arai F. Parallel teleoperation of holographic optical tweezers using multi-touch user interface. In: 2012 IEEE International Conference on Robotics and Automation (ICRA). 2012. p. 1069–74. Peterman EJG, Gittes F, Schmidt CF. Laser-induced heating in optical traps. Biophys J. 2003 Feb;84(2 Pt 1):1308–16. Qiu F, Fujita S, Mhanna R, Zhang L, Simona BR, Nelson BJ. Magnetic Helical Microswimmers Functionalized with Lipoplexes for Targeted Gene Delivery. Adv Funct Mater. 2015 Mar 1;25(11):1666–71. Shevkoplyas SS, Siegel AC, Westervelt RM, Prentiss MG, Whitesides GM. The force acting on a superparamagnetic bead due to an applied magnetic field. Lab Chip. 2007 Oct;7(10):1294–302. Strick TR, Allemand JF, Bensimon D, Croquette V. Behavior of supercoiled DNA. Biophys J. 1998 Apr;74(4):2016–28. Vlaminck ID, Dekker C. Recent Advances in Magnetic Tweezers. Annu Rev Biophys. 2012;41(1):453– 72. Zhang Z, Huang Y, Menq CH. Actively Controlled Manipulation of a Magnetic Microbead Using Quadrupole Magnetic Tweezers. IEEE Trans Robot. 2010 Jun;26(3):531–41. ORAL PRESENTATION 146 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Pilot Ölçekli Biyoreaktör Depolama Alanlarında Metal Konsatrasyonlarının Değişimi Esra Tınmaz Köse1*, İbrahim Demir2 *1 Namık Kemal Üniversitesi, Çorlu Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Tekirdağ, Türkiye 2 İstanbul Teknik Üniversitesi, İnşaat Fakültesi, Çevre Mühendisliği Bölümü, İstanbul, Türkiye Sorumlu yazar e-mail: etinmaz@nku.edu.tr Özet Son yıllarda, depolama alanları ve bu alanlardaki atıkların bozunma prosesleri konusundaki bilgi birikiminin artması, depolama teknolojileri ile ilgili, bioreaktör depolama yöntemi gibi, gelişmeler üzerinde zorlayıcı olmuştur. Bioreaktör depolama alanları, atıkların organik kısmının hızlı bir şekilde bozunmasının sağlanarak kısa sürede stabil atığın oluşmasını öngören kapalı ve kontrollü mikrobiyolojik sistemlerdir. Bioreaktör depolama alanları (BDA) depolanan atığın minimum sürede stabil hale gelecek şekilde işletilmelerinin yanı sıra depolamadan doğabilecek çevresel etkilerin de minimuma inmesini amaçlamaktadır. Bu çalışmada, katı atıkların biyoreaktör depolama alanlarının depolanmasının atığın metal konsantrasyonları üzerindeki etkinliği incelenmiştir. Reaktörlerden biri konvansiyonel depolamayı simule etmesi amacıyla anaerobik, sızıntı suyu geri devirsiz (kuru) (Kontrol reaktörü, R1)ν ikinci reaktör (Rβ) anaerobik, sızıntı suyu geri devirli (ıslak) olarak çalıştırılmıştır. γ. ve 4. reaktörler (Rγ ve R4), aerobik, ıslak olarak çalıştırılmış ancak, Rγ’te hava girişi alttan yapılırken, R4’te üstten yapılmıştır. 5. reaktör (R5) aerobik, sızıntı suyu geri devirli (ıslak) olarak çalışmış ve hava girişi reaktör tabanından yapılmıştır. R1, Rβ, Rγ and R4, ham karışık atıkla doldurulurken, R5 aynı atığın 80 mm’lik elekten elendikten sonar elek altında kalan kısımla doldurulmuştur. Sızıntı suyu geri devir oranları Rβ, Rγ, R4 ve R5’te sırasıyla 0,5γν 0,4βν 0,56 and 0,β1 l/ton atık-gündür. Havalandırmalı reaktörlere verilen hava miktarları Rγ, R4 ve R5 için sırasıyla 1,81λν 4,γ5β and 1,565 m 3/ton atık-gün olarak belirlenmiştir. Çalışma sonuçlarına göre depolama alanlarının biyoreaktör olarak işletilmesinin atıkların metal konsantrasyonlarının azaltılmasında etkili olduğu sonucuna varılmıştır. Anahtar Kelimeler: Atık stabilizasyonu, Biyobozunma, Biyoreaktör, Metal, Sızıntı suyu geri devri. 1. GİRİŞ Bioreaktör depolama alanları, atıkların organik kısmının hızlı bir şekilde bozunmasının sağlanarak kısa sürede stabil atığın oluşmasını öngören kapalı ve kontrollü sistemlerdir. Bioreaktör depolama alanları (BDA) depolanan atığın minimum sürede stabil hale gelecek şekilde işletilmelerinin yanı sıra depolamadan doğabilecek çevresel etkilerin de minimuma inmesini amaçlamaktadır. Bioreaktör depolama alanlarında uygulanan temel proses, atık bozunması sırasında oluşan sızıntı suyunun depolama alanı içine geri devrettirilmesidir. Sızıntı suyunun geri devri, biyolojik olarak parçalanabilen atıkların daha hızlı parçalanabileceği bir ortam oluşmasını sağlamakla kalmayıp aynı zamanda sızıntı suyunun da kısmen arıtımını sağlamaktadır. Dizayn ve işletme açısından aerobik, anaerobik ve hibrit (aerobik-anaerobik) olmak üzere üç tip biorektör depolama alanından sözetmek mümkündür. Aerobik bioreaktör depolama alanlarından oluşan sızıntı suyu reaktör tabanından alınarak sızıntı suyu toplama tankında toplanır. Toplanan sızıntı suyu, atığın nem muhtevası ayarlanarak kontrollü bir şekilde alan içine geri devrettirilir. Atık kütlesi içine hava girişi yatay ve/veya düşey hava boruları ile sağlanır. Anaerobik bioreaktör depolama alanlarında nem ihtiyacı sızıntı suyu geri devriyle veya su ilavesi ile sağlanır. Bozunma anaerobik ortamda gerçekleşir ve oluşan depo gazının metan içeriği yüksektir. Hibrit (aerobik-anaerobik) bioreaktör depolama alanlarında aerobik ve anaerobic sistemler ardaşık olarak uygulanmaktadır. Alanların üst kısmında atığın bozunabilir kısmının hızlı bir şekilde bozunması sağlanırken alt kısımlarda ise oluşan gaz toplanmaktadır. Aerobik bioreaktör depolama alanlarıyla karşılaştırıldığında hibrit alanlarda metanojenik aktivitenin daha çabuk başladığı belirlenmiştir (www.epa.gov). ORAL PRESENTATION 147 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Bioreaktör depolama alanlarınının temel prosesi olarak değerlendirilen sızıntı suyu geri devrinin, sızıntı suyu kirletici parametrelerinin konsantrasyonlarında düşüş sağladığı gözlenmektedir. Bunun yanı sıra geri devir sırasında buharlaşmadan dolayı sızıntı suyu miktarı azalmaktadır. Sızıntı suyu kirletici konsantrasyonlarının ve sızıntı suyunun miktarının azalması, sızıntı suyu arıtma maliyetlerini de düşürmektedir (Quasim ve Chiang, 1λλ4). Atıkların önceden ıslatılması, spreyleme, yüzeyde göllenme, düşey enjeksiyon kuyularının oluştulması, yüzey altına yatay boruların döşenmesi, sızıntı suyunu geri devrettirilmesi amacıyla uygulanan başlıca yöntemlerdir (Yuen, 2001). Son yıllarda yapılan araştırmalarla, katı atıkların konvansiyonel depolama alanları yerine aerobic, anaerobik ya da hibrit bioreaktör depolama alanlarında atık stabilizasyonunu hızlandırarak (Cossu vd, β016ν Xu ve ark., β014ν Ni ve ark., β016) çevre sorunlarınının azaltılmasında etkin rol oynadığı belirlenmiştir. Atıkların anaerobik ortamda bozunarak stabil hale gelmeleri esasına dayalı olan konvansiyonel depolama alanları, her ne kadar zemin ve üst yüzey geçirimsizliğinin sağlandığı ortamlar olsa da insan ve çevre sağlığı açısından bir takım risklere de sahiptir. Bu tür alanlarda depolanan atıkların bozunması sonucu oluşan sızıntı suları, yüksek konsantrasyonlarda organik bileşikler, ağır metaller ve patojenler içermektedir. Konvansiyonel depolama alanlarında atıkların stabilizasyon sürecinin uzun olması nedeniyle oluşan sızıntı suyunun olumsuz etkileri uzun süre devam edebilmektedir. Depolama alanının taban geçirimsizliği sağlanmış olsa bile geçirimsiz taban zamanla tahrip olabilmekte ve bu nedenle sızıntı suyu depolama alanı dışına çıkabilmektedir (es.epa.gov). Depolama alanında oluşan depo gazı, anaerobik koşullar altında yüksek oranda metan ve VOC içermektedir. Geçirimsiz tabakada ve gaz toplama sisteminde meydana gelebilecek bir tahribat depo gazının yeraltı suyuna karışarak su ortamının kirlenmesine neden olabilmektedir. Bioreaktör depolama sistemlerinde, mikroorganizmaların yaşamsal faaliyetlerinin devamı için gerekli oksijenin sağlanabilmesi için ortama hava verilirken nem ve besi maddesi ihtiyacı sızıntı suyunun geri devrettirilmesi ile sağlanır. Katı atıklar, uygun hava ve nem sağlanmış ortamlarda aerobik bozunma ile anaerobik şartlara göre çok daha kısa sürede stabil hale gelmektedir. Buna ek olarak, sızıntı suyunun atık kütlesi içine geri devrettirilmesi bozunmayı hızlandırmakta, sızıntı suyu miktarını ve kirletici konsantrasyonlarını azaltmakta, organik asitlerin inhibitör etkisininin nötralize edilmesini sağlamaktadır (Rhyner ve diğ., 1λλ5). Atıkların, kontrollü şartların sağlandığı aerobik, anaerobik veya hibrit bioreaktörlerde depolanması, konvansiyonel metotla depolanması ile karşılaştırıldığında, atık stabilizasyonu, depolama alanının kullanım süresinin artması, kapatılan alanın rehabilitasyonu maliyetinin düşük olması gibi üstünlükleri mevcuttur (Adeleke, 2003). Literatürdeki pekçok çalışmada biyoreaktör depolama alnalrının atıkların metal konsantrasyonunun değişiminde etkili olduğunu ortaya koymuştur (Xi eve ark., β015ν Qu ve ark., β008, Long ve ark., β00λ) 2. MATERYAL VE METOD 2.1 Reaktör Dizaynı Çalışma kapsamında, farklı tiplerdeki bioreaktör depolama alanlarını simüle edecek beş adet reaktör kullanılmıştır. Reaktörlerin özellikleri Tablo 1’de, şematik görünümleri Şekil β’de gösterilmiştir. Tablo 1. Reaktörlerin Özellikleri Özellik Yükseklik (m) Çap (m) Çakıl tabakası yüksekliği (m) Örtü toprağı yüksekliği (m) Toplam reaktör hacmi (m3) Ortalama etkin reaktör hacmi (m3) ORAL PRESENTATION Değer 5,65 2,50 0,30 0,30 28 22 148 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Reaktörlerden biri konvansiyonel depolamayı simule etmesi amacıyla anaerobik, sızıntı suyu geri devirsiz (kuru) (Kontrol reaktörü, R1)ν ikinci reaktör (Rβ) anaerobik, sızıntı suyu geri devirli (ıslak) olarak çalıştırılmıştır. γ. ve 4. reaktörler (Rγ ve R4), aerobik, ıslak olarak çalıştırılmış ancak, Rγ’te hava girişi alttan yapılırken, R4’te üstten yapılmıştır. 5. reaktör (R5) aerobik, sızıntı suyu geri devirli (ıslak) olarak çalışmış ve hava girişi reaktör tabanından yapılmıştır. Depolama alanı koşullarının simule edilebilmesi amacıyla 4. reaktör hariç tüm reaktörler üst yüzeyleri açık, havalandırmanın üstten yapıldığı 4. reaktör (R4) ise üstü kapalı olarak dizayn edilmiştir. Tablo 2. Çalışmada Kullanılacak Reaktör Tipleri, Atık Özellikleri ve Uygulanacak Yöntemler Reaktör Tipi Reaktör Çalışma Süresi (Ay) R1 9 R2 9 R3 9 R4 9 R5 9 Anaerobik, Kuru Anaerobik, Islak Aerobik, Islak Aerobik, Islak Aerobik, Islak Uygulanan Yöntem Havalandırmasız, Sızıntı suyu geri devirsiz Havalandırmasız, Sızıntı suyu geri devirli Alttan havalandırmalı, Sızıntı suyu geri devirli Üstten havalandırmalı, Sızıntı suyu geri devirli Alttan havalandırmalı, Sızıntı suyu geri devirli Reaktördeki Ortalama Atık Miktarı (ton) Atık Özelliği 11 Karışık Atık 11 Karışık Atık 11 Karışık Atık 11 Karışık Atık 15 Elek Altı Atık Reaktörlerin yapımı aşamasında öncelikle, siloların iç yüzeyleri zımparalanarak pürüzsüzleştirilmiş ve daha sonra epoksi boya ile boyanmıştır. Oluşan sızıntı sularının drene edilebilmesi amacıyla reaktör tabanından yaklaşık 1 metre yükseğe yerleştirilen ızgaranın üzeri tıkanmaların önlenebilmesi amacıyla yaklaşık γ0 cm yüksekliğinde yıkanmış dere çakılı ile örtülmüştür. Sızıntı suyu reaktörlerin tabanından drene edildikten sonra reaktör dışında bulunan sızıntı suyu toplama tanklarında toplanmıştır. Sızıntı suyunun geri devrettirildiği reaktörlerde geri devir, dalgıç pompalar kullanılarak yağmurlama metoduyla yapılmıştır. Bu amaçla, reaktörlerin üst yüzeylerine spiral şeklinde delikli yerleştirilmiştir. Şekil 1. Reaktörlerin Şematik Görünümü Havalandırma, reaktör tabanından veya üst yüzeyden uygulanacak şekilde β500 mγ /saat kapasiteli fan yardımıyla yapılmıştır. Reaktörler atıkla doldurulduktan sonra atık yüzeyleri β0-γ0 cm örtü toprağı ile kapatılmıştır. Örtü toprağı olarak İBB Kompost ve Geri Kazanım Tesisinde üretilen kompostun 15 mm’lik elek üstü kısmı kullanılmıştır. 50 Reaktörlerin yan yüzeylerinde katı atık numunelerinin alınabilmesi için üç adet ORAL PRESENTATION 149 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org numune alma gözü yapılmıştır. En üstteki numune alma gözü 40x40 cm, alttaki iki göz ise γ0xγ0 cm boyutlarındadır. Reaktörlerdeki atık sıcaklığının ölçülebilmesi amacıyla her bir reaktörün farklı iki noktasına reaktörlerin ortalarına kadar uzanan ikişer adet sıcaklık probu yerleştirilmiştir. 2.2 Atık Özellikleri Çalışmada, İstanbul’un Avrupa yakasından toplanarak İBB Kompost ve Geri Kazanım Tesisi’ne getirilen evsel katı atık kullanılmıştır. Reaktörlerin içindeki atığın homojen olarak havalandırılabilmesi için tesise gelen atıkların içindeki poşetler açılmış ve içleri boşaltılmıştır. R1, Rβ, Rγ ve R4 reaktörleri bu atıkla (karışık atık) doldurulmuştur. Atık boyutunun ve karakterizasyonun atık stabilizasyonuna etkisinin gözlenebilmesi için, Tablo β’de de belirtildiği gibi R5’e tesise gelen atığın 80 mm’lik elekten elenmesiyle elde edilen elek altı atık doldurulmuştur. R5’e doldurulan atığın yoğunluğu 1040 kg/m 3, diğer reaktörlere doldurulan atığın yoğunluğu ise 670 kg/m3 olarak tespit edilmiştir. Atıklar reaktörlere doldurulmadan önce karıştırılarak homojen hale getirilmiş ve toplam atık kütlesi içindeki her bir madde grubunun oranı belirlenmiştir. Reaktörlere doldurulan atık bileşenlerinin yaş ağırlık bazında oranları Tablo γ’te verilmiştir. Bu çalışmada geri devrettirilen sızıntı suyu miktarı ve aerobik reaktörlere verilen hava miktarları ortamın nem muhtevası, sıcaklık ve depo gazı bileşenleri değerlendirilerek ayarlanmıştır. Çalışma süresince reaktörlere geri devrettirilen su/sızıntı suyu miktarları ve verilen hava miktarları Tablo 4’te belirtilmiştir. 2.3 Deneysel Çalışma Çalışma süresince, reaktörlerdeki katı atıkların metal konsantrasyonları aylık periyotta izlenmiştir. Sözkonusu parametrelerin analizlerinin ICP Optik Emisyon Spektrofotometrik Metot uygulanarak İSTAÇ AŞ’ye ait Çevre Laboratuarında ve Namık Kemal Üniversitesi Çevre Mühendisliği Bölümü Laboratuarında yapılmıştır. Tablo 3. Reaktörlerde Depolanan Atıkların Karakterizasyonu Atık Bileşeni Karışık Atık Ağırlık (%) Elek Altı Altı Ağırlık (%) Karışık Atık Ağırlık (%) Elek Altı Altı Ağırlık (%) Organik 57,72 65,55 Taş 2,18 4,35 Tekstil 10,67 3,99 Ambalaj 1,26 - Kağıt 7,23 10,73 Tahta 0,91 1,19 Cam 4,63 8,65 Pet 0,91 0,06 Teneke 4,00 1,12 Strafor 0,35 0,18 Plastik 3,58 2,28 Tetrapak 0,21 - Poşet 3,37 1,9 Kemik 0,21 - Ç.Bezi 2,74 - Toplam 100,00 100,00 ORAL PRESENTATION Atık Bileşeni 150 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tablo 4. Geri Devrettirilen Sızıntı Suyu Miktarı ve Hava Miktarı R2 R3 Sızıntı Suyu Geri Devri (l/ton atık-gün) 0,53 0,42 Havalandırma Debisi (m3/ ton atık-gün) 1,819 R4 0,56 4,352 R5 0,21 1,565 Reaktör 3. SONUÇ VE TARTIŞMA Literatürde yer alan çalışmalar incelendiğinde genel olarak katı atıkların metal konsantrasyonlarının zamanla arttığı ve bu artışın nedeninin kütle kaybı olduğu belirtilmiştir. Geri devirli sistemlerde sızıntı suyu geri devri metallerin tekrar atık kütlesine geri verilerek konsantrasyonun artmasına neden olabilmektedir. Ancak oluşan sızıntı suyunun tamamının geri devrettirilmemesi sonucu metallerin ortamdan uzaklaştırılması da sözkonusudur. Düşük geri devir oranlarının uygulandığı sistemlerde daha düşük metal konsantrasyonları ölçülmektedir. Bakır konsantrasyonu tüm reaktörlerde artış göstermektedir. Çalışma başlangıcında 0,7-6,5 mg/l ölçülen bakır konsantrasyonları çalışma sonunda 10-γ0 mg/l değerlerine kadar yükselmiştir. arasında Çinko konsantrasyonu da kurşun gibi çeşitli salınımlar göstermiş olmakla birlikte genel olarak 10-40 mg/l konsantrasyonları arasında ölçülmüştür. Kadminyum konsantrasyonları tüm reaktörlerde azalma eğilimi göstermekle birlikte havalandırmalı reaktörlerde daha düşük konsantrasyon değerleri ölçülmüştür. Cd konsantrasyonunun en düşük olduğu reaktör R4’tür. Kalsiyum konsantrasyonu tüm reaktörlerde azalma eğilimi göstermiştir. Katı atıkta ölçülen kalsiyum konsantrasyonlarının zamanla azalması, sızıntı suyundaki Ca konsantrasyonlarında önemli bir değişim gözlenmemiş olması sonucuyla birlikte değerlendirildiğinde, katı atıktaki Ca konsantrasyonun azalmasının kütle kaybından kaynaklandığı düşünülmektedir. Krom konsantrasyonları tüm reaktörlerde aynı artma ve azalma eğilimlerini göstermiştir. Çalışma sonunda tüm reaktörlerdeki krom konsantrasyonu 5 mg/kg değerinin altında ölçülmüştür. Kurşun konsantrasyonu, çalışma süresince artış ve azalmalar göstermiş olsa da tüm reaktörlerde, çalışma başlangıcında ve sonunda birbirine yakın değerler kaydedilmiş ve çalışma süresince tüm reaktörlerdeki kurşun konsantrasyonu 5 mg/l’nin altında ölçülmüştür. Magnezyum konsantrasyonu tüm reaktörlerde zamanla az miktarda olsa da azalma göstermiştir. Genel olarak magnezyum konsantrasyonu 400-600 mg/l arasında değişim göstermiştir. Nikel konsantrasyonu da krom konsantrasyonuyla eşdeğer zamanlarda paralel değişimler göstermiştir. Özellikle sızıntı suyunun yoğunluklu olarak geri devrettirildiği zamanlarda sızıntı suyunda bulunanan ağır metallerin tekrar katı atık kütlesine verilmesi bu zamanlarda krom ve nikel konsatrasyonlarının artmasına neden olmuştur. Yağışların başladığı Kasım ayından sonra krom ve nikel konsantrasyonlarında önceki aylardaki kadar önemli miktarda salınımlar gözlenmemiştir. Potasyum konsantrasyonunda tüm reaktörlerde zaman içinde değişen konsantrasyonlar gözlenmiştir. Genel olarak potasyum konsantrasyonu 3000-5000 mg/l arasında değişim göstermiştir. Tüm reaktörlerde sodyum konsantrasyonu zamanla artmıştır. Ancak artış oranının en fazla olduğu reaktör, sızıntı suyunun tersine Rγ’tür. Atık kütlelerinin metal konsantrasyonları değişimleri Tablo 5’te verilmiştir. ORAL PRESENTATION 151 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tablo 5. Reaktörlerdeki katı atık kütlelerinin metal konsantrasyonları değişimleri 45 40 Cu, mg/kg 35 30 R1 25 R2 R3 20 R4 R5 15 10 5 0 Temmuz Ağustos Eylül Ekim Kasım Aralık Ocak Şubat M art Aylar 900 800 Mg,mg/kg 700 R1 R2 600 R3 500 R4 R5 400 300 200 Temmuz Ağustos Eylül Ekim Kasım Aralık Ocak Şubat M art Aylar 8000 7000 Na, mg/kg 6000 R1 R2 5000 R3 R4 4000 R5 3000 2000 Temmuz Ağustos Eylül Ekim Kasım Aralık Ocak Şubat M art Aylar 3,5 80 3 70 60 R1 R1 R2 2 R3 1,5 R4 R5 1 Zn, mg/kg Pb, mg/kg 2,5 50 R2 R3 40 R4 30 R5 20 0,5 10 0 0 Temmuz Ağustos Eylül Ekim Kasım Aylar ORAL PRESENTATION Aralık Ocak Şubat M art Temmuz Ağustos Eylül Ekim Kasım Aralık Ocak Şubat M art Aylar 152 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4. TARTIŞMA Bu çalışma kapsamında, havalandırmalı ve havalandırmasız bioreaktör depolama yöntemi simüle bioreaktörlerde pilot ölçekli olarak denenmiştir. Farklı depolama alanlarını simule eden reaktörlerde, atık boyutunun, sızıntı suyunun geri devrettirilmesinin, havalandırmanın ve havalandırma yönünün değiştirilmesinin, katı atık kütlesinin metal konsantrasyonları üzerindeki etkileri değerlendirilmiştir. Tüm reaktörlerde metal konsantrasyonları zamanla salınım göstermiş olmasına rağmen, bakır ve potasyum haricindeki metallerin konsantrasyonları zamanla azalma eğilimi sergilemiştir. Sonuçlar literatür verileri ile benzerlik göstermektedir. TEŞEKKÜR Bu çalışma, “Aerobik Düzenli Depolama Yönteminin Ülkemiz Şartlarındaki Uygulanabilirliğinin Değerlendirilmesi Ve İşletme Esaslarının Belirlenmesi, İ.T.Ü. Araştırma ve Geliştirme Projeleri, Proje Noμ γ178β, Araştırıcı, β00λ” projesi kağsamında sürdürülmüş ve sonuçlandırılmıştır. KAYNAKLAR Adeleke OF 2003. Bioreactor Landfill, Shanghai University, Shanghai Cossua R, Morellob L, Ragaa R, Cerminarab G 2016. Biogas production enhancement using semi-aerobic preaeration in a hybrid bioreactor landfill, Waste Management, 55: 83-92, Kim H, Jang YC, Townsend T 2011. The behavior and long-term fate of metals in simulated landfill bioreactors under aerobic and anaerobic conditions, Journal of Hazardous Materials, 194: 369-377 Long YY, Hu LF, Fang CR, He r, Shen DS 2009. Releasing behavior of zinc in recirculated bioreactor landfill, Science of The Total Environment: 407(13): 4110-4116 Ni Z, Liu J, Girotto F, Cossu R, Qi G 2016. Targeted modification of organic components of municipal solid waste by short-term pre-aeration and itsenhancement on anaerobic degradation in simulated landfill bioreactors, Bioresource Technology, 216: 250-259 Qasim SR, Chiang W 1994. Sanitary Landfill Leachate Generation, Control and Treatment, Technomic Publishing Company, Switzerland. Qu X, He PJ, Shao LM, Le DJ 2008. Heavy metals mobility in full-scale bioreactor landfill: Initial stage, Chemosphere, 70(5): 769-777, Rhyner CR, Schwartz LJ, Wenger RB, Kohrell MG 1995. Waste Management and Resource Recovery, Lewis Publishers, USA. US Environmental Protection Agency, 2006, http://es.epa.gov , [Erişim β8.0λ.β007] US Environmental Protection Agency, 6-7 Ekim 2000. State of the Practice for Bioreactor Landfills Workshop on Bioreactor Landfills Arlington, Virginia Yuen, STS 2001. Bioreactor landfills: Do they work?, 2nd ANZ Conference on Environmental Geotechnics, Newcastle, Australia, 28-30 November Xie S, Ma Y, Strong PJ, Clarke WP 2015. Fluctuation of dissolved heavy metal concentrations in the leachate from anaerobic digestion of municipal solid waste in commercial scale landfill bioreactors: The effect of pH and associated mechanisms, Journal of Hazardous Materials, 299: 577-583 Xu O, Jin X, Ma Z, Tao H, Ko JH 2014. Methane production in simulated hybrid bioreactor landfill, Bioresource Technology, 168: 92-96, ORAL PRESENTATION 153 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org An Unsupervised Automated Classification Approach For Discrimination of Ailanthus altissima Tree Leaves Çağlar Cengizler Çukurova University, Faculty of Engineering and Architecture, Department of Biomedical Engineering, Adana, Turkey. Corresponding author e-mail: ccengizler@cu.edu.tr Abstract An unsupervised machine learning approach is presented for automated classification of Ailanthus altissima tree leaves in this study. Experimental setup is consist of a total of 390 leaf images taken from leafsnap dataset where a binary mask is extracted from each of the leaves. There are ten different tree specimens in the dataset and it was expected from presented methodology to classify Ailanthus Altissima tree leaves among other tree specimens. Accordingly three features, defining shape and morphology of the leaf is extracted from binary masks and discrimination process is conducted on these features. Two widely known unsupervised data clustering methods, Fuzzy C-means and K-Means are utilized for clustering previously extracted features into two clusters as Ailanthus Altissima group and others. F-Score is utilized for objective evaluation of the performance. Experiments revealed that presented approach is promising and both of the examined clustering methods may discriminate Altissima tree leaves with high accuracy and sensitivity. Keywords: Ailanthus Altissima Classification Unsupervised FCM K-Means. 1. INTRODUCTION Aailanthus altissima (A. altissima) tree widely known as tree of heaven from the family Simaroubaceae Genus Ailanthus is a highly invasive and fast growing species which is originating from china (Heisey, 1996). Automated classification of that tree would be a necessity due to its highly invasive character and applications in Chinese traditional medicine. Classification based on examination of leaf images is one of the low-cost solutions. Accordingly imaging leaves and discriminate them according to extracted measures would be an optimized solution to automated classification of tree species (Fu et al.,2004). It was aimed to classify A. Altissima according to leaf characteristics in this study. Automated discrimination of extracted features defining characteristics of leaves would be accomplished by both supervised and unsupervised machine learning approaches. For example probabilistic neural networks are utilized as an supervised approach in the previous literature (Kadir et al., 2013). Also generalized softmax perceptron model is previously utilized for classification leaves of the sunflowers (Arribas et al., 2011). Most of the supervised methods require a training stage with an extra teaching dataset (Kotsiantis et al., 2007). An unsupervised approach which is based on clustering extracted features is utilized in this study. Accordingly proposed system completes classification of shape and morphology based features without any training. Three features are extracted from each of the leaves. As an classifier to these features two of the well known clustering mechanisms, K-means and Fuzzy C-means are utilized to examine and compare the performance of clustering approaches. Both of them are organizing numerical data into clusters which consist of relatively similar elements of features (Bezdek at al., 1984) (Jain, 2010). Performance of the methodology is judged by F-score as an objective criteria. The rest of this paper is organized as follows. Section 2 introduces the utilized data set, extracted features and discrimination process, Section 3 presents the results of the experimental setup and Section 4 is consist of discussions of presented results and performance evaluation and finally Section 5 presents the conclusion. ORAL PRESENTATION 154 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS AND METHODS 2.1 Utilized Data Utilized data set consist of 390 leaf images and their binary masks. All data is taken from leafsnap database which covers tree species from the Northeastern United States (Kumar et al., 2012). Ten species including A. altissima are included in dataset. Names and image quantities of the species classified in this study is given in Table 1. Table 3. Classified species in the study Species Name Leaf Count Abies nordmanniana 35 Acer ginnala 31 Acer palmatum 92 Acer platanoides 20 Acer rubrum 45 Aesculus flava 15 Aesculus glabra 44 Ailanthus altissima 16 Amelanchier arborea 43 Quercus acutissima 49 All leaf images have a binary mask in the data set defining it's area and outline. A sample image and it's mask is shown in Figure 1. Figure 10. An A.altissima leaf image from data set (left) and it's binary mask(right) 2.2 Extracted Features Three features are extracted from each of the binary masks. These features are shape and morphology based numerical measurements which are defining the shape character of the specimen. First extracted feature is eccentricity which is a scalar value within a range of 0 and 1. It is measured by division of the distance between the foci of the ellipse (an ellipse which has the same second-moments as the region) and its major axis length. Second feature is minor axis length. Following final feature is ratio of major and minor axes. 2.3 Classification Stage Two clustering approaches are utilized for grouping extracted features into 2 clusters. Each of the method is experimented with same data. One of the methods is K-means. It is operating for partition n observations into certain number of clusters where observations belong to the cluster with the nearest mean (Kanungo et al., 2002). It is possible to formulate all observations by: ORAL PRESENTATION 155 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org X = {x1,x2,x3,……..,xn} (1) and centers by: V = {v1,v2,…….,vc} (2) With respect to (1) and (2) cluster centers are calculated by: (3) where ‘ci’ stands for the number of observations in ith cluster. Clustering process starts with random cluster centers then distance between each observation and cluster centers is calculated. Following by, each observation is assigned a cluster center according to its distance. Nearest cluster center should be chosen at that point. Then cluster centers are recalculated. K-means clustering algorithm repeats the calculating distances until minimizing the within-cluster sum of squares. which is formulated by: (4) In addition to K-means another well known clustering approach Fuzzy C-means (FCM) is examined in the study. FCM algorithm is based on similar principles however, in difference to K-means, FCM operates on membership degrees of observations (Cannon et al., 1986). Objective function of FCM with membership degree is given below: (5) where, uij is the degree of membership, xi is ith observation of data, and cj is center of the jth cluster. Accordingly uij is calculated by: (6) Where center of the clusters are calculated by: (7) 3. RESULTS Actual cluster centers of extracted features for ten species including A. altissima are given in Table 2 and standard deviations for all centroids are given in Table 3. ORAL PRESENTATION 156 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 2. Cluster centers for all features are given where A. altissima tree centroids are given under SP8 SP1 SP2 SP3 SP4 SP5 SP6 SP7 SP8 SP9 SP10 1 0,77 0,45 0,57 0,42 0,64 0,58 0,8 0,79 0,94 Eccentricity 31,7 211 278 308 270 326 258 264 234 160 MinorAxisLength Maj./Min. Axis Ratio 11,3 1,65 1,14 1,24 1,13 1,37 1,34 1,72 1,67 3,04 Table 3. Standard deviations for all clusters where values for A.altissima tree are given under SP8 SP1 0 Eccentricity 13,8 MinorAxisLength Maj./Min. Axis Ratio 1,59 SP2 0,09 39,7 0,31 SP3 0,13 41,8 0,1 SP4 0,12 27,7 0,11 SP5 0,12 41,3 0,15 SP6 0,14 67,7 0,24 SP7 0,17 65,8 0,33 SP8 0,07 36,4 0,27 SP9 0,05 42,4 0,25 SP10 0,02 18,5 0,4 Clustering performance of both of the methods is measured by several parameters. These are accuracy: (8) sensitivity: (9) recall: (10) and F-Score: (11) Where Tp, Tn, Fp, Fn and N are true positive, true negative, false positive false negative and number of observations respectively. Performance according to given criteria is presented in Table 4. Also total classification time is given in Table 4. for performance evaluation. Table 4. Classification Performance of two well known clustering mechanisms and their classification duration are presented. FCM K-Means ORAL PRESENTATION Accuracy Sensitivity 0,869 0,906 0,869 0,906 F-Score 0,93 0,93 Classification Time (seconds) 0,069 0,009 157 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4. DISCUSSION Actual cluster centers in Table 2. are indicating that utilized features for discrimination of A.altissima tree leafs varies with distinct tree species. According to Table 4, both of the methods are capable of classifying A.altissima tree with 0.93 F-Score which is indicating clustering approach would be an effective solution for automated detection of A.altissima. It should be also noted that, FCM approach is relatively more sophisticated than KMeans however results revealed that K-Means would complete classification task much more faster with similar discrimination success. 5. CONCLUSION It was aimed to present a novel utilization of basic unsupervised classification and shape and morphology based salient features for classification of a specific tree species. Results are promising and it would be possible to note that cost effective basic clustering approaches may be efficient classifiers for fast and reliable applications. REFERENCES Arribas, Juan Ignacio, et al. Leaf classification in sunflower crops by computer vision and neural networks. Computers and Electronics in Agriculture 78.1 (2011): 9-18. Bezdek, James C., Robert Ehrlich, and William Full. FCM: The fuzzy c-means clustering algorithm. Computers & Geosciences 10.2-3 (1984): 191-203. Cannon, Robert L., Jitendra V. Dave, and James C. Bezdek. Efficient implementation of the fuzzy c-means clustering algorithms. IEEE transactions on pattern analysis and machine intelligence 2 (1986): 248-255. Fu, Hong, et al. Machine learning techniques for ontology-based leaf classification. Control, Automation, Robotics and Vision Conference, 2004. ICARCV 2004 8th. Vol. 1. IEEE, 2004. Heisey, Rod M. Identification of an allelopathic compound from Ailanthus altissima (Simaroubaceae) and characterization of its herbicidal activity. American Journal of Botany (1996): 192-200. Jain, Anil K. Data clustering: 50 years beyond K-means. Pattern recognition letters 31.8 (2010): 651-666. Kadir, Abdul, et al. Leaf classification using shape, color, and texture features. arXiv preprint arXiv:1401.4447 (2013). Kanungo, Tapas, et al. An efficient k-means clustering algorithm: Analysis and implementation. IEEE transactions on pattern analysis and machine intelligence 24.7 (2002): 881-892 Kotsiantis, Sotiris B., I. Zaharakis, and P. Pintelas. Supervised machine learning: A review of classification techniques. Emerging artificial intelligence applications in computer engineering 160 (2007): 3-24. Kumar, Neeraj, et al. Leafsnap: A computer vision system for automatic plant species identification. Computer vision–ECCV 2012. Springer, Berlin, Heidelberg, 2012. 502-516. ORAL PRESENTATION 158 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Mersin İlinde Kan Donörlerinde Leishmania Parazitinin Moleküler Epidemiyolojisinin Araştırılması Gül Bayram Abiha1, Ender Dinçer2, Sema Erden Ertürk1, Eyüp Naci Tiftik3 Mersin Üniversitesi, Sağlık Hizmetleri Meslek Yüksekokulu, Mersin, Türkiye Mersin Üniversitesi, İleri Teknoloji Eğitim, Araştırma ve Uygulama Merkezi, Türkiye 3 Mersin Üniversitesi, Tıp Fakültesi, Dahili Tıp Bilimleri, Mersin, Türkiye Sorumlu yazar e-mail: gulbayram@mersin.edu.tr 1 2 Özet Amaç: Kan transfüzyonu ile bulaşan paraziter enfeksiyonlar, bakteriyel ve viral enfeksiyonlarla karşılaştırıldıklarında daha düşük oranda görülmelerine rağmen özellikle primer ya da sekonder enfeksiyon olarak immün sistemi baskılanmış bireylerde ve sık transfüzyon alan hastalarda önemli bir risk faktörü olarak ortaya çıkmaktadır. Dünya genelinde kan donörlerinde en çok bildirilen transfüzyon kaynaklı paraziter enfeksiyonlar Plasmodium spp., Trypanosoma cruzi, Babesia microti, Toxoplasma gondii ve Leishmania spp.’dir. Bu paraziter enfeksiyonlardan biri olan Leishmaniasis hastalığı ülkemizin de içinde bulunduğu akdeniz ülkelerinde, Ortadoğu, Orta ve Güney Amerika ve Hindistan’da endemiktir. Bu enfeksiyonla ilgili endemik bölgelerde kan donörlerinde yapılmış çalışma sayısı çok azdır. Bu çalışmada bölgemizde bu paraziter etkenin kan donörlerindeki moleküler epidemiyolojisinin ve karakterizasyonunun belirlenmesi amaçlanmıştır. Gereç ve Yöntem: Mersin Üniversitesi Sağlık Araştırma ve Uygulama Merkezi, Kan Merkezi'nde Haziran 2016- Haziran β017 yıllarını kapsayan 1β aylık bir sürede kan donörü olarak kabul edilen gönüllülerden, rutin işlemler sırasında elde edilmiş γ00 kan örneği toplanmıştır. Bu örneklerde Leishmania spp. parazitlerinin varlığı araştırılmıştır. Ayrıca donörlerden enfeksiyonlara maruziyet riskini belirlemek amacı ile hazırlanmış anket formları hazırlanmıştır. Toplanan γ00 kan örneğinden genomic DNA eldesi High pure Template Preparation Kit (Roche, Germany) ile yapılmıştır. Parazit DNA’sını saptamak için Taqman problar kullanılarak gerçek zamanlı PZR yapılmıştır. Bulgular: Çalışma sonuçları tanımlayıcı istatistik kullanılarak değerlendirilmiştir. Kan donörleri içerisinde çiftçilikle uğraşanların yüzdesi %5,8 olarak bulunurken bu oran ofis çalışanlarında %γλ,7’dir. Real-time PZR sonucunda tüm örnekler Leishmania spp. için negatif olarak bulunmuştur. Tartışma ve sonuç: Bölgemizde daha önce kan donörlerinin Leishmania spp. parazitinin taranmasına dair bir çalışma yapılmamıştır. Bu sonuçlar ilk edilen veriler olup daha fazla sayıda donörün katıldığı çok merkezli çalışmaların yapılması gerektiğini düşünmekteyiz. Anahtar Kelimeler: Kan donörü, transfüzyon, Leishmania spp., polimeraz zincir reaksiyonu. 1. GİRİŞ Günümüzde kan donörlerinde yapılan çalışmalarda en çok bildirilen transfüzyon kaynaklı paraziter enfeksiyonlar Plasmodium spp., Trypanosoma cruzi, Babesia microti, Toxoplasma gondii ve Leishmania spp. olarak sıralanmaktadır (Mansueto ve ark. 2014). Leishmaniasis hastalığı Leishmania cinsi parazitler ile enfekte dişi kum sineklerinin (Tatarcık, yakarca, Phlebotomus) kan emmesi sırasında insanlara bulaşması ile ortaya çıkmaktadır. Leishmaniasis, ülkemizin de içinde bulunduğu akdeniz ülkelerinde, Ortadoğu, Orta ve Güney Amerika ve Hindistan’da endemiktir (Savoia ve ark. 2015). Leishmaniasis'in parazitin türüne ve konağın immün yanıtına bağlı olarak gelişen asemptomatik (%80-95) enfeksiyonun üç ana klinik sendroma neden olan formları (5-β0%)ν visseral leishmaniasis (VL), kutanöz leishmaniasis (KL) ve mukokutanöz leishmaniasis (ML) olarak sıralanmaktadır (Mansueto ve ark. 2007, Thornton ve ark. β010). İnsanlarda üç tip klinik tablo ile seyreden hastalığın ülkemizde en çok görülen şekli Kutanöz Leishmaniasis (KL) olup, başta Şanlıurfa olmak üzere, Osmaniye, Adana, Hatay, Aydın, Kahramanmaraş ve Mersin illerimizde endemik olarak görülmektedir (Koltasve ark β014, Yldız ve ark. β007). L. major ve L. Donovani türleri endemik olarak Türkiye, Irak, İran ve Suriye gibi ülkelerde görülmektedir. Enfekte kişilerde bu parazit retiküloendotelyal sistem hücrelerinin içinde kalıp normal kan dolaşım sistemine girmemektedir. Genel olarak, kan bankalarındaki saklama koşullarında +4  C’de saklanan kan torbalarında bu parazitlerin 30 güne kadar canlı kalabildikleri saptanmıştır (Grog ve ark. 1993.).Kan donörlerinde asemptomatik Leishmania enfeksiyonu ile ilgili bildirimler Hindistan (Singh ve ark. 2002, Das ve ark.2011), Nepal (Bhattarai ve ark. 2009), Bangladeş (Huda ve ark. 2013), İran (Fakhar M ve ark. 2008), Irak (Souhaila ve ark. 2010), Türkiye (Ates ve ark . 2012, Ates ve ark 2013), İtalya (Scarlata ve ark. 2008, ORAL PRESENTATION 159 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Biglino 2010), Yunanistan (Kyriakou DS ve ark. 2013, Kubar J ve ark. 1997, Fichoux Y ve ark. 1999), İspanya (Martin-Sanchez J, ve ark. 2004, Riera C ve ark. 2004 Riera C ve ark. 2008), Brezilya (Luz KG ve ark. 1997, Otero AC ve ark.2000, Barao SC ve ark 2007,Clemente WT ve ark.2014) dünya genelinde yapılmıştır. Ülkemizde kan donörlerinde bu parazitin varlığı ile ilgili yapılan çalışmalar sınırlı sayıdadır. Bundan dolayı, bu çalışmada bölgemizde bu paraziter etkenin kan donörlerindeki moleküler epidemiyolojisinin ve karakterizasyonunun belirlenmesi amaçlanmıştır. 2. MATERYAL VE YÖNTEM Kan Örneklerinin toplanması: Mersin Üniversitesi Sağlık Araştırma ve Uygulama Merkezi, Kan Merkezi'nde Haziran 2016- Haziran β017 yıllarını kapsayan 1β aylık bir sürede kan donörü olarak kabul edilen gönüllülerden, donör olarak onaylanan, bilgilendirilmiş onam alınacak kişilerden rutin işlemler sırasında elde edilmiş γ00 kan örneği toplanmıştır. Bu örneklerde Leishmania spp. ve T. gondii parazitlerinin varlığı araştırılmıştır. Ayrıca donörlerden enfeksiyonlara maruziyet riskini belirlemek amacı ile hazırlanmış anket formları hazırlanmıştır. DNA izolasyonuμ Kan donörlerinden elde edilecek kan örneklerinden gDNA ekstraksiyonu High Template Preparation Kit (Roche, Germany) yardımıyla yapıldı EDTA’lı tüplere alınacak kanlardan santrifüj işlemi yardımıyla lökosit tabakası ayrılarak, kit prospektüsüne göre gDNA eldesi yapıldı Örneklerdeki DNA konsantrasyonu CapitalBio NanoQ drop kullanılarak spektrofotometrik ile belirlendi Çalışmanın bu aşaması Mersin Üniversitesi İleri Teknoloji Eğitim Araştırma ve Uygulama Merkezi laboratuvarlarında yapıldı. Gerçek zamanlı Polimeraz zincir reaksiyonu (PZR): Leishmania spp. saptamak için Taqman problar kullanılarak gerçek zamanlı PZR yapılmiştır (Özbel Y ve ark. β016). Yöntemin standardizasyonu için referans suşlar kullanılmıştır. 3. SONUÇ Elde edilen gDNA’larda Leishmania türlerinin tespiti için yapılan gertçek zamanlı PZR işlemi sonucunda , kan dönerlerinin hepsi negative olarak bulunmuştur. 4. TARTIŞMA Visseral leishmaniasis dünyada 88 ülkenin tropikal ve subtropikal bölgelerinde endemiktir. Dünyada bilinen 1β milyon leishmaniasis olgusu vardır, her yıl 1.5 -β milyon yeni olgu görülmektedir. Her yıl görülen 500.000 yeni visseral leishmaniasisun % λ0’ı Nepal, Bangladeş, Hindistan, Sudan ve Brezilya’dadır. Dünyadaki olguların yaklaşık %50’si Hindistan’da görülmektedir. İnfeksiyon erkeklerde kadından daha fazla görülmektedir (World Health Organization,β016). İspanya’da kan donörlerinde yapılan çalışmada %8 oranında Leishmania (L.) infantum, Brezilya’daki kan donörlerinde %11,4 L. braziliensis, yine Brezilya da başka bir bölgede yapılan çalışmada %1γ,β L. infantum saptanırken Nepal’de %5 oranında leishmanial IgG seropozifiliği bulunmuştur (Monteiro ve ark. 2016, Braga ve ark.2015, Fukutani ve ark.2014, Perez-Cutillasa ve ark.2015, Timilsana ve ark.β016.). Türkiye’de visseral Leishmaniasis daha çok Ege ve Akdeniz bölgelerinde görülmekle birlikte hemen hemen bütün bölgelerimizden bildirilmiş olgular bulunmaktadır (Özbel Y ve ark. β016, Ates ve ark . β01β, Ates ve ark β01γ) . Hastalığın etkeni olan Leishmania parazitleri hem insandan hem de köpeklerden izole edilmiş, izoenzim analizi, EF (excreted factor) analizi, monoklonal antikorlar ve PZR ile diğer Akdeniz bölgesi ülkelerinde olduğu gibi etkenin L. infantum olduğu ve doğadaki rezervuarlığını da köpeklerin yaptığı epidemiyolojik çalışmalarla kanıtlanmıştır. Ülkemizde β01γ yılında kan donörlerinde yapılan bir çalışma’da %4,γ oranında Leishmania spp. mikro kültür yöntemi ile pozitif bulunmuştur (Ates ve ark β01γ). Bu çalışmada elde edilen veriler bölgemize ait ilk verilerdir. Çalışmada çiftçilikle uğraşan donor sayısı az olup donörlerin büyük bir kısmı ofiste çalışmaktadır ve şehir merkezinde yaşamaktadır. Bu nedenle bu donörlerin vektörlerle karşılaşma şansı kırsal kesimde yaşayanlara göre azalmaktadır. Sonuç olarak, rutin kan tarama testlerinde bu paraziter etkenin varlığının araştırılması gerekli olmayıp mevcut tarama testleri yeterlidir. TEŞEKKÜR Bu çalışma Mersin Üniversitesi Bilimsel araştırmalar ve proje birimi tarafından 2016-2-AP4-1λβγ no’lu proje olarak desteklenmiştir. ORAL PRESENTATION 160 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org KAYNAKLAR Mansueto P, Seidita A, Vitale G, Cascio A 2014. Transfusion transmitted leishmaniasis. What to do with blood donors from endemic areas?. Travel Med Infect Dis,12:617-27. Savoia D 2015. Recent updates andperspectives on leishmaniasis. J Infect Dev Ctries 9(6):588-596. Mansueto P, Vitale G, Di Lorenzo G, Rini GB, Mansueto S, Cillari E 2007. Immunopathology of leishmaniasis: an update. Int J Immunopathol Pharmacol, 20:435-45. Thornton SJ, Wasan KM, Piecuch A, Lynd LL, Wasan EK 2010. Barriers to treatment for visceral leishmaniasis in hyperendemic areas: India, Bangladesh, Nepal, Brazil and Sudan. Drug Dev Ind Pharm, 36:1312-9. Koltas IS, Eroğlu F, Alabaz D, Uzun S 2014. The emergence of Leishmania major and Leishmania donovani in southern Turkey. Trans R Soc Trop Med Hyg, 108:154–158. Yıldız ZF, Korkmaz M, Ozbel Y 2007. Serodiagnosis of Anthroponotic Cutaneous Leishmaniasis (ACL) caused by Leishmaniatropica in Sanliurfa province, Turkey, Where ACL is Highly Endemic. Clin Vaccine Immunol, 14: 1409-15. Grogl M, Daugirda JL, Hoover DL, Magill AJ, Berman JD 1993. Survivability and infectivity of viscerotropicLeishmaniatropica from Operation Desert Storm participants in human blood products maintained under blood bank conditions. Am J Trop Med Hyg, 49:308-15. Singh S, Kumari V, Singh N 2002. Predicting kala-azar disease manifestations in asymptomatic patients with latent Leishmaniadonovani infection by detection of antibody against recombinant K39 antigen. ClinDiagnLab Immunol, 9: 568-72. Das VN, Siddiqui NA, Verma RB, Topno RK, Singh D, Das S et al 2011. Asymptomatic infection of visceral leishmaniasis in hyperendemic areas of Vaishali district, Bihar, India: a challenge to kala-azar elimination programmes. Trans R Soc Trop Med Hyg, 105:661-6. Bhattarai NR, Van der Auwera G, Khanal B, De Doncker S, Rijal S, Das ML, et al 2009. PCR and direct agglutination as Leishmania infection markers among healthy Nepalese subjects living in areas endemic for Kala-Azar. Trop Med Int Health, 14:404-11. Huda MM, Rudra S, Ghosh D, Bhaskar KR, Chowdhury R, Dash AP, et al 2013. Low prevalence of Leishmaniadonovani infection among the blood donors in kala-azar endemic areas of Bangladesh. BMC Infect Dis, 13:62. Fakhar M, Motazedian MH, Hatam GR, Asgari Q, Kalantari M, Mohebali M 2008. Asymptomatic human carriers of Leishmaniainfantum: possible reservoirs for Mediterranean visceral leishmaniasis in southern Iran. Ann Trop Med Parasitol, 102:577-83. Alborzi A, Souhaila MA, Khawla HZ, K YAD 2010. Indirect fluorescent antibody test for serodiagnosis of visceral leishmaniasis: an epidemiological study in Iraq. J Univ Anbar Pure Sci,4:1-4. Ates SC, Bagirova M, Allahverdiyev AM, Baydar SY, Koc RC, Elcicek S, et al 2012. Detection of antileishmanial antibodies in blood sampled from blood bank donors in Istanbul. Future Microbiol, 7:773-9. Ates SC, Bagirova M, Allahverdiyev AM, Kocazeybek B, Kosan E 2013. Utility of the microculture method for Leishmania detection in non-invasive samples obtained from a blood bank. Acta Trop, 128:54-60. ORAL PRESENTATION 161 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Scarlata F, Vitale F, Saporito L, Reale S, Vecchi VL, Giordano S, et al 2008. Asymptomatic Leishmania infantum/chagasi infection in blood donors of western Sicily. Trans R Soc Trop Med Hyg, 102:394-6. Colomba C, Saporito L, Polara VF, Barone T, Corrao A, Biglino A, Bolla C, Concialdi E, Trisciuoglio A, Romano A, Ferroglio E 2010. Asymptomatic Leishmania infantum infection in an area of northwestern Italy (Piedmont region) where such infections are traditionally nonendemic. J Clin Microbiol, 48:131-6. Kyriakou DS, Alexandrakis MG, Passam FH, Kourelis TV, Foundouli P, Matalliotakis E, et al 2003. Quick detection of Transfusion transmitted leishmaniasis 625 Leishmania in peripheral blood by flow cytometry. Is prestorage leucodepletion necessary for leishmaniasis prevention in endemic areas? Transfus Med, 13:59-62. Kubar J, Quaranta JF, Marty P, Lelievre A, Le Fichoux Y, Aufeuvre JP 1997. Transmission of L. infantum by blood donors. Nat Med, 3:368. Fichoux Y, Quaranta JF, AufeuvreJP, Lelievre A, Marty P, Suffia I, et al 1999. Occurrence of Leishmaniainfantumparasitemia in asymptomatic blood donors living in an area of endemicity in southern France. J ClinMicrobiol, 37:1953-7. Martin-Sanchez J, Pineda JA, Morillas-Marquez F, GarciaGarcia JA, Acedo C, Macias J 2004. Detection of Leishmania infantum kinetoplast DNA in peripheral blood from asymptomatic individuals at risk for parenterally transmitted infections: relationship between polymerase chain reaction results KAYNAKLAR Mansueto P, Seidita A, Vitale G, Cascio A 2014. Transfusion transmitted leishmaniasis. What to do with blood donors from endemic areas?. Travel Med Infect Dis,12:617-27. Savoia D 2015. Recent updates andperspectives on leishmaniasis. J Infect Dev Ctries 9(6):588-596. Mansueto P, Vitale G, Di Lorenzo G, Rini GB, Mansueto S, Cillari E 2007. Immunopathology of leishmaniasis: an update. Int J Immunopathol Pharmacol, 20:435-45. Thornton SJ, Wasan KM, Piecuch A, Lynd LL, Wasan EK 2010. Barriers to treatment for visceral leishmaniasis in hyperendemic areas: India, Bangladesh, Nepal, Brazil and Sudan. Drug Dev Ind Pharm, 36:1312-9. Koltas IS, Eroğlu F, Alabaz D, Uzun S 2014. The emergence of Leishmania major and Leishmania donovani in southern Turkey. Trans R Soc Trop Med Hyg, 108:154–158. Yıldız ZF, Korkmaz M, Ozbel Y 2007. Serodiagnosis of Anthroponotic Cutaneous Leishmaniasis (ACL) caused by Leishmaniatropica in Sanliurfa province, Turkey, Where ACL is Highly Endemic. Clin Vaccine Immunol, 14: 1409-15. Grogl M, Daugirda JL, Hoover DL, Magill AJ, Berman JD 1993. Survivability and infectivity of viscerotropicLeishmaniatropica from Operation Desert Storm participants in human blood products maintained under blood bank conditions. Am J Trop Med Hyg, 49:308-15. Singh S, Kumari V, Singh N 2002. Predicting kala-azar disease manifestations in asymptomatic patients with latent Leishmaniadonovani infection by detection of antibody against recombinant K39 antigen. ClinDiagnLab Immunol, 9: 568-72. ORAL PRESENTATION 162 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Das VN, Siddiqui NA, Verma RB, Topno RK, Singh D, Das S et al 2011. Asymptomatic infection of visceral leishmaniasis in hyperendemic areas of Vaishali district, Bihar, India: a challenge to kala-azar elimination programmes. Trans R Soc Trop Med Hyg, 105:661-6. Bhattarai NR, Van der Auwera G, Khanal B, De Doncker S, Rijal S, Das ML, et al 2009. PCR and direct agglutination as Leishmania infection markers among healthy Nepalese subjects living in areas endemic for Kala-Azar. Trop Med Int Health, 14:404-11. Huda MM, Rudra S, Ghosh D, Bhaskar KR, Chowdhury R, Dash AP, et al 2013. Low prevalence of Leishmaniadonovani infection among the blood donors in kala-azar endemic areas of Bangladesh. BMC Infect Dis, 13:62. Fakhar M, Motazedian MH, Hatam GR, Asgari Q, Kalantari M, Mohebali M 2008. Asymptomatic human carriers of Leishmaniainfantum: possible reservoirs for Mediterranean visceral leishmaniasis in southern Iran. Ann Trop Med Parasitol, 102:577-83. Alborzi A, Souhaila MA, Khawla HZ, K YAD 2010. Indirect fluorescent antibody test for serodiagnosis of visceral leishmaniasis: an epidemiological study in Iraq. J Univ Anbar Pure Sci,4:1-4. Ates SC, Bagirova M, Allahverdiyev AM, Baydar SY, Koc RC, Elcicek S, et al 2012. Detection of antileishmanial antibodies in blood sampled from blood bank donors in Istanbul. Future Microbiol, 7:773-9. Ates SC, Bagirova M, Allahverdiyev AM, Kocazeybek B, Kosan E 2013. Utility of the microculture method for Leishmania detection in non-invasive samples obtained from a blood bank. Acta Trop, 128:54-60. Scarlata F, Vitale F, Saporito L, Reale S, Vecchi VL, Giordano S, et al 2008. Asymptomatic Leishmania infantum/chagasi infection in blood donors of western Sicily. Trans R Soc Trop Med Hyg, 102:394-6. Colomba C, Saporito L, Polara VF, Barone T, Corrao A, Biglino A, Bolla C, Concialdi E, Trisciuoglio A, Romano A, Ferroglio E 2010. Asymptomatic Leishmania infantum infection in an area of northwestern Italy (Piedmont region) where such infections are traditionally nonendemic. J Clin Microbiol, 48:131-6. Kyriakou DS, Alexandrakis MG, Passam FH, Kourelis TV, Foundouli P, Matalliotakis E, et al 2003. Quick detection of Transfusion transmitted leishmaniasis 625 Leishmania in peripheral blood by flow cytometry. Is prestorage leucodepletion necessary for leishmaniasis prevention in endemic areas? Transfus Med, 13:59-62. Kubar J, Quaranta JF, Marty P, Lelievre A, Le Fichoux Y, Aufeuvre JP 1997. Transmission of L. infantum by blood donors. Nat Med, 3:368. Fichoux Y, Quaranta JF, AufeuvreJP, Lelievre A, Marty P, Suffia I, et al 1999. Occurrence of Leishmaniainfantumparasitemia in asymptomatic blood donors living in an area of endemicity in southern France. J ClinMicrobiol, 37:1953-7. Martin-Sanchez J, Pineda JA, Morillas-Marquez F, GarciaGarcia JA, Acedo C, Macias J 2004. Detection of Leishmania infantum kinetoplast DNA in peripheral blood from asymptomatic individuals at risk for parenterally transmitted infections: relationship between polymerase chain reaction results and other Leishmania infection markers. Am J Trop Med Hyg, 70:545-8. Riera C, Fisa R, Udina M, Gallego M, Portus M 2004. Detection of Leishmania infantum cryptic infection in asymptomatic blood donors living in an endemic area (Eivissa, Balearic Islands, Spain) by different diagnostic methods. Trans R Soc Trop Med Hyg, 98:102-10. ORAL PRESENTATION 163 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Riera C, Fisa R, Lopez-Chejade P, Serra T, Girona E, Jimenez M, et al 2008. Asymptomatic infection by Leishmaniainfantum in blood donors from the Balearic Islands (Spain). Transfusion, 48:1383-9. Luz KG, da Silva VO, Gomes EM, Machado FC, Araujo MA, Fonseca HE, et al 1997. Prevalence of antiLeishmaniadonovani antibody among Brazilian blood donors and multiply transfused hemodialysis patients. Am J Trop Med Hyg, 57: 168-71. Clemente WT, Rabello A, Faria LC, Peruhype-Magalhaes V, Gomes LI, da Silva TA, et al 2014. High prevalence of asymptomatic Leishmania spp. infection among liver transplant recipients and donors from an endemic area of Brazil. Am J Transplant: Official Journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 14:96-101. Özbel Y, Karakuş M, Arserim SK, Kalkan ŞO, Töz S 2016. Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyiadentata in a focus of human and canine leishmaniasis in western Turkey. Acta Trop, 155:89-94. World Health 12.06.2016). Organization. httpμ//www.who.int/leishmaniasis/resources/Cutaneous_leish_cm_. (Erişimμ Monteiro DCS, Sousa AQ, Lima DM, Fontes RM, Praciano CC, Frutuoso MS 2016. Leishmania infantum Infection in Blood Donors, North eastern Brazil.Emerg Infect Dis,4(22):739-40. Braga LS, Navasconi TR, Leatte EP, Skraba CM, Silveira TGV, Ribas-Silva RC, 2015. Presence of antiLeishmania (Viannia) braziliensisantibodies in blood donors in the West-Central region of theState of Parana, Brazil. Rev Soc Bras Med Trop, 448(5):622-625. Fukutani KF, Figueiredo V, Celes FS, Cristal JR, Barral A, Barral-Netto, M 2014. Serological survey of Leishmania infection in blood donors in Salvador, Northeastern Brazil. BMC Infect Dis, 14(422):1-8. Perez-Cutillasa P, Goyenab E, Chitimiab L, Ruac P, Bernald LJ, Fisae R 2015. Spatial distribution of human asymptomatic Leishmania infantum infection in southeast Spain: A study of environmental, demographic and social risk factors. Acta Trop, 46: 127–134. Timilsina S, Bhattarai N, Khanal B, Rijal S 2016. Serological Assessment for Leishmaniadonovani Infection in Blood Donors of Sunsari District, Dharan, Nepal. Indian J Hematol Blood Transfus, 32(1):95-9. and other Leishmania infection markers. Am J Trop Med Hyg, 70:545-8. Riera C, Fisa R, Udina M, Gallego M, Portus M 2004. Detection of Leishmania infantum cryptic infection in asymptomatic blood donors living in an endemic area (Eivissa, Balearic Islands, Spain) by different diagnostic methods. Trans R Soc Trop Med Hyg, 98:102-10. Riera C, Fisa R, Lopez-Chejade P, Serra T, Girona E, Jimenez M, et al 2008. Asymptomatic infection by Leishmaniainfantum in blood donors from the Balearic Islands (Spain). Transfusion, 48:1383-9. Luz KG, da Silva VO, Gomes EM, Machado FC, Araujo MA, Fonseca HE, et al 1997. Prevalence of antiLeishmaniadonovani antibody among Brazilian blood donors and multiply transfused hemodialysis patients. Am J Trop Med Hyg, 57: 168-71. Clemente WT, Rabello A, Faria LC, Peruhype-Magalhaes V, Gomes LI, da Silva TA, et al 2014. High prevalence of asymptomatic Leishmania spp. infection among liver transplant recipients and donors from an ORAL PRESENTATION 164 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org endemic area of Brazil. Am J Transplant: Official Journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 14:96-101. Özbel Y, Karakuş M, Arserim SK, Kalkan ŞO, Töz S 2016. Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyiadentata in a focus of human and canine leishmaniasis in western Turkey. Acta Trop, 155:89-94. World Health 12.06.2016). Organization. httpμ//www.who.int/leishmaniasis/resources/Cutaneous_leish_cm_. (Erişimμ Monteiro DCS, Sousa AQ, Lima DM, Fontes RM, Praciano CC, Frutuoso MS 2016. Leishmania infantum Infection in Blood Donors, North eastern Brazil.Emerg Infect Dis,4(22):739-40. Braga LS, Navasconi TR, Leatte EP, Skraba CM, Silveira TGV, Ribas-Silva RC, 2015. Presence of antiLeishmania (Viannia) braziliensisantibodies in blooddonors in the West-Central region of theState of Parana, Brazil. Rev Soc Bras Med Trop, 448(5):622-625. Fukutani KF, Figueiredo V, Celes FS, Cristal JR, Barral A, Barral-Netto, M 2014. Serological survey of Leishmania infection in blood donors in Salvador, Northeastern Brazil. BMC Infect Dis, 14(422):1-8. Perez-Cutillasa P, Goyenab E, Chitimiab L, Ruac P, Bernald LJ, Fisae R 2015. Spatial distribution of human asymptomatic Leishmania infantum infection in southeast Spain: A study of environmental, demographic and social risk factors. Acta Trop, 46: 127–134. Timilsina S, Bhattarai N, Khanal B, Rijal S 2016. Serological Assessment for Leishmaniadonovani Infection in Blood Donors of Sunsari District, Dharan, Nepal. Indian J Hematol Blood Transfus, 32(1):95-9. ORAL PRESENTATION 165 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Microwave- and Ultrasound-Assisted Extraction of Pectin From Mandarin Peel Pinar Karbuz, Meral Yildirim, Azmi Seyhun Kipcak, Emek Derun, Nurcan Tugrul* Yildiz Technical University, Faculty of Chemistry - Metallurgical, Chemical Engineering, İstanbul Turkey Corresponding author e-mail: ntugrul@yildiz.edu.tr Abstract Pectin was extracted from mandarin peel using ultrasound and microwave assisted extraction methods to investigate mandarin as an alternative source of pectin production. Hydrochloric acid (HCl) was used as an extracting agent. In this work, the effect of sonication time (15, 30, 45 min) and temperature (60, 75 °C) on the yield for ultrasound assisted extraction (UAE) was studied. Additionally, the parameters of microwave power 360, 600 W) and irradiation time (1, 2, 3 min) were investigated for microwave assisted extraction (MAE). The highest yield of pectin was found to be 20.01 % (w/w) for 2 min of extraction at 600 W. The results showed that the use of microwave promoted a better yield of pectin when compared to the ultrasound method and product yields in other extraction conditions were showed almost similar characteristics. Therefore, these results suggested that MAE could be used as an efficient and rapid technique for the extraction of pectin from mandarin peel. The chemical structure of the pectin obtained from mandarin peel was found to be similar in the two different extraction methods. Keywords: Mandarin waste, pectin, ultrasound, microwave, extraction. 1. INTRODUCTION In recent years, concerns about the transformation of resources and environmental awareness have been increasing. Therefore, the use of natural resources as an alternative to non-renewable resources is interested. Especially, the processing of fruits in the food industry leads to a large amount of by-products (Minjares-Fuentes et al., 2014) Pectin is a complex polysaccharide located on the cell wall of plants. Pectin is a linear chain structure formed by the α-1,4 bonds of galacturonic acid units. Pectin is widely used as a stabilizing, thickening and gelling agent in food industry such as jams, jellies and fruit juice. In addition, it possesses various activities such as wound healing, lipase inhibition, induction of cancer cell, anti-ulser and cholesterol decreasing effects in pharmaceutical industry (Wang et al., 2015). Carboxyl groups in the pectin molecule are partially esterified with methyl alcohol. Pectin can be classified as high methoxyl pectin (HMP) or low methoxyl pectin (LMP) according to amount of esterification of methanol and galacturonic acid. If the rate of the esterified galacturonic acid is below or above 50 % , it is called LMP and HMP, respectively (Espitia et al., 2014). The degree of esterification is an indication of the conditions and speed of gelling. HMP can only form gel in the environments where a large amount of sugar and acid is present, while LMP can form gel in low sugar concentrations or sugar-free but multivariate cations such as Ca, Mg (Güzel and Akpınar, β017). There are many different sources for pectin production and it can be extracted from peels of fruits (Freitas de Oliveira et al., 2016). However, commercially, the production of pectin is made of apple pomace and citrus peels. In dried peels of citrus fruits such as oranges, grapefruits and lemons contain 25-30 % pectin (Bagherian et al., 2011). The other plant sources of pectin extraction such as banana peels (Swamy et al., 2017), tomato waste (Grassino et al., 2016) and pomelo peels have been reported (Liew et al., 2016). Extraction is an important technique that is used for the isolation of bioactive products from natural sources for use in food systems (Bayar et al., 2017). Chemical extraction methods are widely used, but they can lead to serious environmental problems as they produce acidic waste water (Yang et al., 2017). Ultrasound fundamentally generates bubble cavitation in the biological matrix (Kadam et al., 2015). Ultrasonic waves create a cavitation effect in the solvent, causing the molecules to move faster and the solvent to higher penetrate the target material (Moorthy et al., 2016). The cavitation can destroy the cell wall of plant, increase mass transport and minimize particle sizes (Zhang et al., 2016). Ultrasound assisted extraction (UAE) is a clean, efficient and eco-friendly technique which can be completed in minutes and giving higher purity of the final product (Maran ORAL PRESENTATION 166 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org et al., 2016). Reducing extraction time, reducing energy consumption and a relatively lower use of solvent are some advantages of UAE (Chemat et al, 2016). Ultrasound system conditions contain temperature, pressure, frequency, sonication time and the solvent-biomass ratio (Chen et al., 2015). Microwave is an electromagnetic wave that contains electric and magnetic fields and microwave assisted extraction (MAE) is known as green technology (Adetunji et al., 2017). Microwave is an energy that used to extract the desired components from plants (Agarwal et al., 2015). MAE is an extraction technique that increases the mass transfer to the solvent from the sample by heating it with the microwave power and consists of irradiation of the samples (Valdes et al., 2015). MAE efficiency depends on several factors, such as pH, irradiation time, microwave power and sample/solvent ratio (Lefsih et al., 2017). MAE enables shorter extraction times, more efficient product and less solvent usage than conventional extraction techniques (Criminna et al., 2016). Therefore, this method provides low production cost, high efficiency and laboratory scale working (Hosseini et al., 2016). The purpose of this study is to determine and compare the qualitative and quantitative characteristics of pectin obtained by ultrasound and microwave assisted extraction methods from mandarin peels. Effect of extraction parameters such as temperature and sonication time for UAE were studied. The influences of microwave power and irradiation time on the pectin yield were investigated. This work reports the effects of microwave on the yield and quality of extracted pectin in comparison with ultrasound method. The product yield and morphological structure of pectin were performed. 2. MATERIALS AND METHODS Mandarins were collected from local market in Istanbul in January 2018. Mandarin peels were washed to remove dusts and dried in a hot air oven at 60°C overnight. The dried peel was grinded and the peel powder was stored in low density polyethylene bag at room temperature. a b c Figure 11. Mandarin peels a. wet, b. dry, c. powder 2.1 Ultrasound assisted extraction (UAE) of pectin from mandarin peels 2 g dried mandarin powder was weighed with SCALTEC SPB31 (Scaltec Instruments GmbH, Goettingen, Germany) and mixed with 0.5 M HCl (TEKKİM, Bursa, Turkey). The extraction process was performed using the following conditions: powder/solvent ratio 1:30 (g/ml) and pH 1.5 (0.5 M HCl). Then the samples were heated in a ultrasonic water bath (ISOLAB, Wertheim, Germany) at 60 and 75 °C and were simultaneously sonicated at 15, 30 and 45 min. ORAL PRESENTATION 167 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org a b Figure 12. a. Ultrasonic bath, b. extraction solution After extraction, the extraction mixture was transferred into centrifugal tubes after cooled at the room temperature. The centrifuge was carried out using a SCILOGEX DM0412 Centrifuge (SCILOGEX, Rocky Hill, United States). Then the mixture centrifuged at 2500 rpm 15 min and the filtrate was coagulated using three volumes of ethanol (180 ml) for overnight at 4 °C. The precipitated pectin was separated by vacuum filtration and rinsed three times with ethanol (Merck KGaA, Darmstadt, Germany). The pectin extracted ultrasonically was dried in an oven (MMM Ecocell 111, Munich, Germany) at 60 °C until a constant weight was attained. a b c Figure 13. a. Centrifuge, b. vacuum filtration, c. pectin 2.2 Microwave assisted extraction (MAE) of pectin from mandarin peels The dry mass (2g) of mandarin peels was mixed with 0.5 M HCl (60 ml, pH 1.5) as extracting agent. The mixture was placed in the center of microwave oven (Bosch HMT72G420, Stuttgart, Germany). The solution was then extracted 360 and 600 W for three times, 1, 2, 3 min. After the extraction, the mixture allowed to cool down to room temperature, and after cooling, the mixture was centrifuged at 2500 rpm for 15 min. The next steps are similar with UAE. a b c Figure 14. a. Microwave oven, b. precipitated pectin with ethanol, c. pectin product before drying ORAL PRESENTATION 168 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3. RESULTS AND DISCUSSION After extraction process, the product yield was calculated using (1) and the chemical structure of pectin was analyzed by FTIR (IRPrestige21, SHIMADZU CORPORATION, Kyoto, Japan). Pectin particles were mixed with KBr (1:100) and pressed into KBr pellets before FTIR analysis. Pectin yield (%) was expressed as the ratio of dried pectin mass (Wp) obtained after extraction to the initial mass of dried mandarin powder (Wm) used for extraction: �� 3.1. Yield of pectin � % =� � � (1) After ultrasound assisted extraction process, results of pectin yield of samples shown in Table 1. Table 4. Pectin yields of ultrasound assisted extraction at different parameters Extraction temperature Sonication time 60 °C 75 °C Pectin yield 15 min 13.61 % 15.12 % 30 min 16.85 % 17.43 % 45 min 15.80 % 16.74 % According to Table 1, the highest pectin yield was found as 17.4γ % at 75 °C and γ0 min extraction conditions. The increased in temperature was increased product yield and the maximum amount of pectin was obtained in about 30 min by UAE. The results of pectin yield by microwave assisted extraction shown in Table 2. Table 5. Pectin yields of microwave assisted extraction at different parameters Microwave power Irradiation time 360 W 600 W Pectin yield 1 min 11.30 % 17.62 % 2 min 18.61 % 20.01 % 3 min 17.57 % 16.50 % According to Table 2, the highest pectin yield was found as 20.01 % at 600 W microwave power and 2 min extraction conditions. The increased in microwave power was increased product yield and the maximum amount of pectin was obtained in about 2 min by MAE. Depends on the results of experiments, UAE and MAE techniques are efficient methods which give almost the same yield values for pectin extraction from mandarin peels. The maximum yield of UAE was obtained at 30 min and 75 °C. It was found that the optimum value of the sonication time was around 30 min, while the temperature increased the extraction efficiency. On the other hand, maximum product values for the MAE were observed at 2 min and 600 W parameters and these results have shown that the raise in microwave power increases the efficiency by shortening the extraction time. 3.2. Chemical structure analysis by FTIR The FTIR spectra of pectin samples obtained from mandarin peels by two different extraction methods were given in Figure 5 and Figure 6. ORAL PRESENTATION 169 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 60 °C – 15 min 60 °C – 30 min 60 °C – 45 min 75 °C – 15 min 75 °C – γ0 min 75 °C – 45 min Figure 15. FTIR analysis for pectin samples by UAE 360 W – 1 min ORAL PRESENTATION 360 W – 2 min 170 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 360 W – 3 min 600 W – 1 min 600 W – 2 min 600 W – 3 min Figure 16. FTIR analysis for pectin samples by MAE For mandarin peel pectin, the peaks at around 3780 cm -1, which are the characteristics absorption peaks of polysaccharides, are attribute to the stretching vibrations of hydroxyl (O-H) groups and these peaks are indicative of a large number of OH- bonds in pectin molecule. The adsorption bands at about 2900 cm -1 related to C-H (-CH, -CH2 and CH3) stretching of galacturonic acid. An absorption at ~ 1745 cm -1 is cause by C=O stretching vibration of methylesterified carboxyl groups while the absorption at ~ 1600 cm -1 is cause by C=O stretching vibration of free carboxyl group. The peaks about 1100 cm -1 are cause by C-O stretching vibration and the presence of these bands supports the presence of methyl esters in pectin. The wavelengths and intensities of the FTIR spectra have characteristics peaks to the pectin, confirming that the obtained polysaccharide is pectin. FTIR analysis showed that different extraction methods had little influence on the chemical structure of pectin. 4. CONCLUSION In this study, the effect of extraction type of pectin production from mandarin peels on product yield was investigated. Two different methods were implemented and effects of various extraction parameters were investigated. These parameters improved the qualitative and quantitative characteristics of extracted pectin. The results obtained indicated that MAE was an efficient and time saving technique for pectin extraction from mandarin peels. The highest yield (20.01 %) was obtained when the microwave power and irradiation time were 600 W and 2 min, respectively. Besides, the 1 min MAE period was enough to extract the same amount of pectin as obtained from the 30 min UAE period. Consequently, MAE may be preferred in terms of time and energy savings, although UAE is efficient. On the other hand, when FTIR analysis were examined, it was seen that pectin with the same chemical structure was obtained by both extraction methods. ORAL PRESENTATION 171 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org REFERENCES Adetunji L.R, Adekunle A, Orsat V, Raghavan V 2017. Advances in the pectin production process using novel extraction techniques. Food Hydrocolloids 62: 239-250. Agarwal A.K, Goyal P, Desai P, Singh G.K 2015. Isolation of pectin from emblica officinalis & linum unitatissimum using microwave assisted extraction technique and compare with conventional extraction method. International Journal of Pharma Research & Review 4(2): 16-20. Bagherian H, Ashtiani F.Z, Fouladitajar A, Mohtashamy M 2011. Comparisons between conventional, microwave- and ultrasound-assisted methods for extraction of pectin from grapefruit 50: 1237-1243. Bayar N, Bouallegue T, Achour M, Kriaa M, Bougatef A, Kammoun R 2017. Ultrasonic extraction of pectin from Opunta ficus indica cladodes after mucilage removal: Optimization of experimental conditions and evaluation of chemical and functional properties. Food Chemistry 235: 275-282. Chemat F, Rombaut N, Sicaire A, Meullemiestre A, Fabiano-Tixier A, Abert-Vian M 2016. Ultrasound assisted extraction of food and natural products. Mechanisms, techniques, combinations, protocols and applications. Ultrasonics Sonochemistry 34: 540-560. Chen C, You L, Abbasi A.M, Fu X, Liu R.H 2015. Optimization for ultrasound extraction of polysaccharides from mulberry fruits with antioxidant and hyperglycemic activity in vitro. Carbohydrate Polymers 130: 122-132. Criminna R, Carnaroglio D, Delisi R, Arvati S, Tamburino A, Pagliaro M 2016. Industrial feasibilty of natural product extraction with microwave technology. ChemistrySelect 3: 549-555. Espitia P.J, Du W, Avena-Bustillos R, Soares N, McHugh T 2014. Edible films from pectin: Physicalmechanical and antimicrobial properties. Food Hydrocolloids 35: 287-296. Feritas de Oliveira C, Giordani D, Lutckemier R, Gurak P.D, Cladera-Olivera F, Marczak L.D.F 2016. Extraction of pectin from passion fruit peel assisted by ultrasound. LWT-Food Science and Technology 71: 110-115. Grassino N, Brncic M, Vikic-Topic D, Roca S, Dent M, Brncic S.R 2016. Ultrasound assisted extraction and characterization of pectin from tomato waste. Food Chemistry 198: 93-100. Güzel M, Akpınar Ö β017. Turunçgil kabuklarından elde edilen pektinlerin karakterizasyonu ve karşılaştırılması. Akademik Gıda, 15(1)μ 17-28. Hosseini S.S, Khodaiyan F, Yarmand M.S 2016. Optimization of microwave assisted extraction of pectin from sour orange peel and its physicochemical properties. Carbohydrate Polymers 140: 59-65. Kadam S.U, Tiwari B.K, Alvares C, O’Donnell C.P β015. Ultrasound fort he extraction, identification and delivery of food proteins and bioactive peptides. Trends in Food Science & Technology 46: 60-67. Lefsih K, Giacomazza D, Dahmoune F, Mangione M.R, Bulone D, Biagio P, Passantino R, Costa M.A, Guarrasi V, Madani K 2017. Pectin from opuntia ficus indica: Optimization of microwave-assisted extraction and preliminary characterization. Food Chemistry 221: 91-99. Liew S.Q, Ngoh G.C, Yusoff R, Teoh W.H 2016. Sequential ultrasound-microwave assisted acid extraction (UMAE) of pectin from polemo peels. International Journal of Biological Macromolecules 93: 426-435. Maran J.P, Priya B, Al-Dhabi N.A, Ponmurugan K, Moothy I, Sivarajasekar N 2016. Ultrasound assisted citric acid mediated pectin extraction from industrial waste of musa balbisiana. Ultrasonics Sonochemistry 35: 204-209. Minjares-Fuentes R, Femenia A, Garau M.C, Meza-Velazquez J.A 2014. Ultrasound-assisted extraction of pectins from grape pomace using citric-acid: A response surface methodology approach. Carbohydrate Polymers, 106: 179-189. Moorthy I.G, Maran J.P, Ilakya S, Anitha S.L, Sabarima P, Priya B 2016. Ultrasound assisted extraction of pectin from waste artocarpus heterophyllus fruit peel. Ultrasonics Sonochemistry 34: 525-530. Swamy G.J, Muthukumarappan K 2017. Optimization of continuous and intermittent microwave extraction of pectin from banana peels. Food Chemistry 220: 108-114. Valdes A, Burgos N, Jimenez A, Garrigos M.C 2015. Natural pectin polysaccharides as edible coatings. Coating 5: 865-886. Wang W, Ma X, Xu Y, Cao Y, Jiang Z, Ding T, Ye X, Liu D 2015. Ultrasound-assisted heating extraction of pectin from grapefruit peel: Optimization and comparison with the conventional method. Food Chemistry, 178: 106-114. ORAL PRESENTATION 172 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Yang Y, Wang Z, Hu D, Xiao K, Wu J 2017. Efficient extraction of pectin from sisal waste by combined enzymatic and ultrasonic process. Food Hydrocolloids 79: 189-196. Zhang D, Wan Y, Xu J, Wu G, Li L, Yao X 2016. Ultrasound extraction of polysaccharides from mulberry leaves and their effect on enhancing antioxidant activity. Carbohydrate Polymers 137: 473-479. ORAL PRESENTATION 173 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Synthesis and Characterization of New Nanocomoposite Chitosan/Clay for Food Aplications A. Laaraibi*, I. Charhouf, S. Hamdouch, A. Bennamara, A. Abourriche, M. Berrada University Hassan II of Casablanca,Faculty of Sciences Ben M'sik, ,Department of Chemistry, Laboratory of Biomolecules and Organic Synthesis (BIOSYNTHO), Casablanca, Morocco Corresponding author e-mail:Asmae90laaraibi@gmail.com Abstract Biopolymer chitosan/bentonitenanocomposites have been prepared by dissolving chitosan powder in aqueous acetic acid solution. Plastic deformation of the chitosan is carried out using a thermomechanical treatment in the presence of a solvent and a plasticizer. The main objective of the present research is development and characterization of chitosan films and chitosan/clay nanocomposite based on the intercalation of chitosan into clay to form miscible, biodegradable nanocomposite polymers to be used as packaging films for food preservation. Strong interaction between chitosan and bentonite was revealed by FTIR. The structural properties, thermal behaviour and mechanical properties of nanocomposites of chitosan with various clays have been characterized using X ray diffraction (XRD), thermogravimetric analysis (TGA) and a tensile test.Thenanocomposite films obtained with and without glycerol show the best mechanical properties due to the reinforcement of chitosan intercalation in the silicate. These nanocomposite films made from naturally occurring materials might play an important role in advanced research in food and environmental science. 1. INTRODUCTION The present research is directed towards the development of biodegradable ecofriendly materials with enhanced properties [1]. The increase in living standards, changing habitsconsumer, industrial development led to a high consumption of biodegradable plastic materials[2]. Chitosan is a natural mucopolysaccharide of marine origin consists of a linear (1-4) linked 2- amino-2-deoxy-D glucan, obtained from chitin, is a relatively inexpensive material because chitin is the second most abundant polymer in nature, next to cellulose. The positive charge and molecular arrangement confer to chitosan interesting properties [3]. Clays are also abundant and low-cost natural materials. Chitin and chitosan are biopolymers having immense structural possibilities for chemical and mechanical modifications to generate novel properties, functions and applications[4-5], as biomedicine[6-7], pharmaceuticals [8-9-10], metal chelation[11-12], food additives [13], and in the fabrication of sensors or biosensors [14]. Figure 1: Chemical structure of Chitosan. Bentonite (named after Ford Benton, Wyoming) is rich in montmorillonite(usually more than 80%)[1518]. Its color varies from white to yellow, to olive green, to brown. The names bentonite and montmorillonite are often used interchangeably. However, the terms represent materials with different degrees of purity. Bentonite is the ore that comprises montmorillonite, inessentials minerals and others impurities. Beyond quartz, kaolinite, and many other minerals often present in small proportions (feldspar, calcite, dolomite, muscovite, chlorite, hematite, etc), organic matter is present in bentonites as intrinsic impurities composed predominantly of humid substances [19]. Since competitive reactions can take place between the organic matter present in the bentonite and the chitosan, the extent of intercalation and polymer/clay interactions can be affected. Purification capable of ORAL PRESENTATION 174 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org removing of organic matter from bentonites before intercalation is fundamental. Nano-biocomposites, obtained by adding nanofillers to biopolymers like chitosan, result in very promising materials since they show improved properties with preservation of the material biodegradability without eco-toxicity[20]. Although chitosan/clay nanocomposites are very interesting materials but they were not extensively investigated as potential films packaging for food application. Thus, the aim of this work is to analyze the role of plasticizer specially glycerol in the solution casting process for the achievement of chitosan/clay nanocomposite films. The interest in use of the glycerol is acting as plasticizer and reduces the intermolecular forces by increasing the mobility of the biopolymer chains[21]. The glycerol reduces the extent interactions between Na-MNT stacks making it possible to achieve a better dispersion of nanosized filler[22], and can modify the ability of water to swell MNT in the aqueous solution, due to the ability to reduce the surface energy of aqueous solution .In order to investigate the combined effect of glycerol and unmodified clay on the properties of chitosan based nanocomposites, films containing different amount of clay and glycerol were prepared and characterized with particular regard to structural, thermal , mechanical properties Finally, New nano-composite active film was proposed for safe packaging of edibles. 2. MATERIAL AND METHODS 2.1. Materials Chitosan (CS) with DDA ~ 87% in powder form was prepared in our laboratory. Its chemical structure is schematically shown in Scheme 1. The degree of deacetylation (DDA %) was determined by conductimetric titration. Analytical grade bentonitewas purchased from Sigma-Aldrich. All the other chemicals used are of analytical grade and used as received. 2.2.Preparation of chitosan film Chitosan solution was prepared by dissolving 1g of chitosan powder in 100 ml ofaqueous acetic acid solution(1%, v/v), under continuous stirring at room temperature for 2h followed by vacuum filtering to remove the insoluble residue. This solution was cast into petri dishes and dried at 50°C for β0 h to evaporate the solvent and form the films. The dried films were soaked with an aqueous solution of 0.05 M NaOH to remove residual acetic acid, followed by rinsing with distilled water to neutralize, and then dried at room temperature. 2.3. Preparation of chitosan/bentonite films Chitosan/clay films were prepared using the casting/solvent evaporation technique. Firstly, 1% chitosan solutions were prepared by dissolving 1g of chitosan powder in 100 ml of aqueous acetic acid solution(1%, v/v), under continuous stirring at room temperature for 2h followed by vacuum filtering to remove the insoluble residue. Nanocomposite samples were obtained by dispersing selected amounts of bentonite in water and stirred at 50°C until solubilisation. After, the dispersion was slowly added to the CS solution to reach a final clay concentration of 1, β, γ and 5 wt% followed by stirring at room temperature for 5h and then for γ0min at β5 °C in ultrasonic bath.The amounts of chitosan, clay and plasticizer used for each sample are listed in Table1. The nanocompositesolutionswere then poured into petri dishes and dried at 50°C for β0h to evaporate the solvent and form the films. Free chitosan and nanocomposite films plasticized with glycerol were obtained by adding glycerol (30% (wt/wt) on solid CS) to the CS solution while stirring for 20 min at room temperature. Following the same procedure used for chitosan films, the dried films were soaked with an aqueous solution of 0.05 M NaOH to remove residual acetic acid, followed by rinsing with distilled water to neutralize, and then dried at room temperature. ORAL PRESENTATION 175 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table1:Amounts (g and wt%) of chitosan, glycerol, Bentonite (BNT), used for the preparation of chitosan, chitosan/glycerol, chitosan/BNT, and chitosan/glycerol/BNT. Sample code CS Chitosan(g)wt% 1-100% BNT(g)wt% - Glycerol(g)-wt% - CSBNT1% 1-99% 1% - CSBNT2% 1-98% 2% - CSBNT3% 1-97% 3% - CSBNT5% 1-95% 5% - CSG 1-70% - 30% CSGBNT1% 1-69% 1% 30% CSGBNT2% 1-68% 2% 30% CSGBNT3% 1-67% 3% 30% CSGBNT5% 1-65% 5% 30% Abbreviations codes used:CS: Chitosan, BNT: bentonite, CSBNT1%: Film chitosan/bentonite 1%, CSBNT2%: Film chitosan/bentonite 2%,CSBNT3%: Film chitosan/bentonite 3%,CSBNT5%: Film chitosan/bentonite5%,CSG: Film Chitosan/Glycerol, CSGBNT1%: Film Chitosan/Glycerol/bentonite 1%, CSGBNT2%: Film Chitosan/Glycerol/bentonite 2%, CSGBNT3%: Film Chitosan/Glycerol/bentonite3%, CSGBNT5%: Film Chitosan/Glycerol/bentonite5%. 2.4. Characterization and measurements 2.4.1. Infrared spectroscopy (FTIR) Fourier transforms infrared (FTIR) spectra of the chitosan films and the chitosan/clay films werecollected using a Tensor 37 FT-IR Spectrophotometer (Spectrum 400 Perkin Elmer) operating in the range of 400-4000 cm−1 at a resolutionof 4 cm-1. 2.4.2. Mechanical properties: tensile measurement Mechanical properties of chitosan/clay nanocomposite were measured with a Universal Testing Machine Ludwig mpK, tensile strength (TS) and percentage elongation at break (EL) of the films at β5°C according to ASTM D882 standard procedures. The films were cut to a dog bone shape with a rectangular midsection (100 mm long x15 mm wide) flaring to 25 mm x 35 mm sections on each end. The thickness of each sample was measured with micrometer at three different locations and averaged. The films were conditioned at 50% RH for 72 h before each test. A 100 N load cell was used and the extension rate was set at 5 mm/min.The tensile strength (σ) and percentage of elongation at break (E) were calculated using the following equationsμ σ = F max/A E = ∆l/L0 X 100% Where F maxis the maximum load (N), A is the initialcross-sectional area (m2), ∆l is the extension of film strips (m) and L0 is the initial length (m). ORAL PRESENTATION 176 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2.4.3. Thermal stability analysis The thermal properties of nanocomposites and pure chitosan were investigated by thermogravimetric analysis (TGA). Samples were placed in the balance system and heated from β5°C to 600°C at a heating rate of 10°C/min under a nitrogen atmosphere. Three replicates were tested for each sample. 2.4.4. XRD analysis The X-ray diffraction analysis of the obtained films was performed by diffractometer with Cu Kα radiation (ζ=1.5418 A°) at room temperature. XRD scans were performed on sodium bentonite, chitosan films and chitosan/bentonite films with a βθ range between 5°-γ0°, at a scanning rate of 1°/min and scanning step of 0.01°. 3. RESULTS AND DISCUSSION 3.1. Infrared spectroscopy (FTIR) FTIR spectra of chitosan (CS), bentonite (BNT), and chitosan-bentonitenanocomposite (CSBNT) films are displayed in Fig. 2.The spectrum of chitosan shows a broad peak at 3475.80 cm −1 corresponding to amine N–H symmetrical vibration and H bonded O–H group, the peaks at 2924.44cm−1was assigned to the symmetric and asymmetric –CH2 vibrations of carbohydrate ring. The absorption peak at 1618.79 cm−1 (C=O in amide group, amide I vibration), 1545cm−1 (–NH2 bending of amide II) and 1390 cm−1 (N–H stretching or C–N bond stretching vibrations, amide III vibration). The peak at 1116.93 cm −1 corresponds to the symmetric stretching of C–O–C groups. The absorption peaks in the range 900–1200 cm−1 are due to the antisymetric C–O stretching of saccharide structure of chitosan. As can be seen in Fig. 2, the FTIR spectrum of BN shows a peak at 1010 cm −1that belongs to Si-O-Si linkage. In addition, the characteristic absorption peaks are found at˷3670cm−1 (stretching vibration of Al-OH and OH), at 3465 cm−1(stretching vibration of O-H and H-O-H groups), at 1638 cm−1 (H-O-H bending vibration), at 933cm−1(Al-Al-OH bending frequency), and at 509 cm−1 (bending vibration of Si-O). The FTIR was also used to study the polymer/clay interaction, since a shift in the NH 3+vibration may be expected when –NH3+groups interact electrostatically with the negatively charged sites of the clay[23]. Nevertheless, this shift is higher for CSBNTnanocompositefilm with the lowest amounts of CS, while the chitosan/clay films with the highest amounts of biopolymer show a frequency value that trends to that observed in the films of pure chitosan (CS). This fact may be related to the – NH3+groups that do not interact electrostatically with the clay substrate. Besides, the spectrum of CBNTnanocomposite film [Fig. 2] shows a characteristic band at 3462.78cm−1that due to hydrogen bonding formation the functional groups of CS spectrum (O-H and N-H groups) and BN (O-H groups)[24-25]. The intensity of the NH3+ band also increases for higher amounts of intercalated chitosan. The secondary amide band at 1645 cm -1 of chitosan is overlapped with the HOH bending vibration band at 1628 cm-1of the water molecules associated to the chitosan/clay films, which are present as in the starting clay, as expected for a biopolymer with high water retention capability[26-27]. ORAL PRESENTATION 177 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 2: FTIRspectrum of: Chitosan film (FCSBNT0%), Chitosan/BNT films respectively (FCSBNT3%) and (FCSBNT5%). 3.2. Tensile measurements of Chitosan, Chitosan/Bentonite and Chitosan/Glycerol/Bentonite films The stress–strain curves of the tested specimens are being presented in Fig. 3, while the average values along with thestandard deviation of the Young’s modulus, tensile strength and elongation at break of the films on thestress–strain behavior of the chitosan and chitosan/glycerol films, respectively [28]. The higher strength obtained in the caseof the CS films can be attributed to more efficient stress transferbetween the adjacent chains due to the strong electrostatic interactions between the NH 2 and NH3+ groups. The CSG specimen presents almost double strength (at yield and break) and elongation at break. Due to the lower acidity of the diluted films a weaker hydrogen bond network was established between the amino groups andthe glycerol chains. On the other hand the extensive deformationstrengthening in undiluted systems (CSG) suggests the creation of a longrange order and the formation of hydrogen bondingafter the addition of glycerol. The effect of BNT addition on the tensile response of thechitosan and chitosan/glycerol films is being depicted. The stress–strain curves of BNT composite films prepared from the 1w/v% chitosan solution is being presented. The addition of BNT results in a pronounced enhancement of thestiffness and a dramaticdecrease in the elongation at break of all clayaddedsystems. Further addition of BNT leads in intercalated structures which limited thepolymer–clay interactions and thus their reinforcing ability. In the fig.3,effect of BNT addition is being illustrated for the diluted systems (CS nanocomposites). The ductile response of the CS films is maintained after the addition of BNT withstrength and a relative lower decrease in the elongation at break. The systems with 3 wt% BNT presented the lowest enhancement in all mechanical properties. The fig.3 and 4presents the combined effect of glycerol and BNT onthe tensile response of the CS based nanocomposites. The firstobservation is that the addition of BNT results in a direct reduction of the strength of the chitosan/glycerol. A completely different stress-strain behavior is being obtained after the addition of BNT in diluted chitosan/glycerol systems (Fig. 3). The CS/glycerol based nanocomposites behave like hyper elastic materials rather than like ductile polymers. Its assumed that more water and glycerol is distributed in the chitosan network, inducing a very obvious plasticization effect.Theextend of hydrated chitosan crystals was confirmed from the intensities of the XRD patterns. It is very interesting to note that although the mechanical properties of the unreinforced chitosan are comparable before and after the application of the reflux processing, reflux resulted in a fourfold increase of the stiffness and strength of the nanocomposite films. Figure 3: Mechanical properties of chitosan/BNT particles films. ORAL PRESENTATION 178 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 4: Stress-strain curves of: Chitosan film (FCSBNT0%), Chitosan/BNT films respectively (FCSBNT3%), (FCSBNT5%) and Chitosan/Glycerol film (FCSGBNT0%), Chitosan/Glycerol/BNT films respectively (FCSGBNT3%), (FCSGBNT5%). 3.3. Thermal stability analysis The thermal stability of the chitosan (CS) and its nanocomposites has been investigated by TGA under nitrogen (Fig.5). There are two steps of degradation. The first range (50-β00°C) is associated with the loss of water, whereas the second range at β70°C corresponds to the deacetylation and degradation of chitosan and the third step, in the temperature range 450-550°C, can be associated with the oxidative degradation of the carbonaceous residue formed during the second step. The nano-dispersed clay in the chitosan matrix exhibits a significant delay in weight loss. The nanocompositeforms char with a multilayered carbonaceous-silicate structure, which may keep its multilayered structure in the polymer matrix. This high-performance carbonaceous-silicate char builds up on the surface during burning, thus insulating the underlying material and slowing the escape of the volatile products generated during decomposition. The decomposition temperature CS/BNT nanocomposites show higher thermal stability compared to those of the pure CS. For nanocomposites containing glycerol, a further degradation step at Tβ50°C is observed, related to the loss of unbound glycerol, as indicated in Fig.6. Furthermore, it can also be observed that the presence of glycerol plasticizer increases of about β0°C the degradation temperature for the third step, irrespective of the presence or not of the nanoclay. Figure 5: Thermal properties of: Chitosan (FCSBNT0%) and Chitosan/Bentonite films (FCSBNT3%), (FCSBNT5%). 3.4. XRD analysis The XRD patterns of chitosan and chitosan based nanocomposite films in the range of 5- γ0° (Fig 6). The basal plane of BNTshows a reflection peak at about 2θ= 8.8°.After incorporating BNT within CS, with CS/BNT, the basal plane of BNT at 2θ= 8.8° disappears, substituted by a new weakened broad peak at around 2θ= 1β.8° 1γ.0° (CSBNTγ%, CSBNT5%). It is suggested that the BNT form intercalated and flocculated structures. ORAL PRESENTATION 179 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 6: Thermal properties of: Chitosan (FCS), Chitosan/Glycerol (FCSGBNT0%) and Chitosan/Glycerol/Bentonite films (FCSGBNT3%), (FCSGBNT5%). On the base of XRD patterns, it is suggested that the BNT forms intercalated and exfoliated structures at higher CS content (CSBNT5%), while decreasing the CS content (CSBNT3%), clay layers (BNT) form intercalated and flocculated structures. According to[23], the formation of flocculated structure in CS/clay nanocomposites can be due to the hydroxylated edge-edge interactions of the clay layers. Since one chitosan unit possesses one amino and two hydroxyl functional groups, these groups can form hydrogen bonds with the clay hydroxyl edge groups. This strong interaction is believed to be the main driving force for theassembly of BNT in the CS matrix to form flocculated structures. Figure 7: XRD patterns of: Chitosan (CS), Bentonite (BNT) and Chitosan/Bentonite films (FCSBNT3%) and (FCSBNT5%). The XRD patterns of chitosan/glycerol films obtained from 30 w/v% solutions are shown. The addition of glycerol results in a pronounced peak at 12.5°. Because of thehydrophilic and polycationic nature of chitosan in acidic media, thisbiopolymer has good miscibility which is attributed to the interaction of glycerol molecules with chitosan macromolecules. Glycerol favors the chains mobility andthus the chitosan crystallization process in the early stage of thepost-processing aging the effect of glycerol addition. The XRD patterns of chitosan/glycerol/BNT films obtained from chitosan solution are shown.The combined addition of glycerol and clays resulted in greatenhancement of the chitosan crystallinity of the nanocomposite films prepared with 1 w/v% chitosan solution. This indicates thatthe presence of clay facilitates the distribution of glycerol withinthe chitosan matrix and the interaction of glycerol molecules with chitosan macromolecules. The combined addition of glycerol and clay had an opposite effect in films obtainedfrom low content chitosan solution leading to decrease ofthe XRDpeaks intensities. In addition a new peak at 18.β° appeared in XRDpatterns of all obtained films. This diffraction peak is characteristic forchitosan films prepared using acetic acid solution as solvent.The additionof glycerol favors the opening of the clay galleries resulting inintercalatednanocomposites in comparison tosamples without glycerol. ORAL PRESENTATION 180 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 8: XRD patterns of: Chitosan (CS), Bentonite (BNT), Chitosan/Glycerol (FCSG) and Chitosan/Glycerol/Bentonite films (FCSGBNT3%) and (FCSGBNT5%). 4.CONCLUSION Natural biopolymer-based biodegradable packaging materials are a new generation of polymers emerging on the packaging market. Biodegradable packaging materials have an expanding range of potential applications and, driven by the growing use of plastics in packaging and the perception that biodegradable plastics are ‘environmentally- friendly’, their use is predicted to increase chitosan, a biobased material, has interesting antimicrobial andfilm-forming activities. Its application in coatings, films and blendscan contribute to food preservation and shelf-life extension. In this study Chitosan/Bentonite films and Chitosan/Glycerol/Bentonite films were successfully prepared by the solution casting technique and characterized with particular regard to structural, thermal and mechanical properties. Since the nanocomposites prepared with purified bentonite (BNT) are less expensive and the bentonite may be employed in the preparation of chitosan/clay nanocomposites. The intercalation of the cationic biopolymer chitosan into layered silicate clay (bentonite) through a cation exchange process results in nanocomposites with interesting structural and functional properties. Chitosan/Na-MNT nanocomposites exhibit an intercalated or intercalated/orientated structure of clays. In particular, the X-ray diffraction results show that in film without glycerol the MNT stacks lay with their platelet surface parallel to the casting surface. The presence of glycerol, on the other hand, enhances the chitosan intercalation in the silicate galleries and hinders the flocculation process, leaving the MNT stacks randomly orientated in the space. The thermal stability of the nanocomposites increases systematically with increasing clay. The results on mechanical properties showed the increase in the TS and EM of such nanocomposite films can be attributed to the high rigidity and aspect ratio of the nanoclay as well as the high affinity between the biopolymer and the clay. On the other hand, the chitosan/clay nanocomposites have shown significant decrease in elongation at break (EB). This reduction can be attributed to the restricted mobility of macromolecular chains. The nanocomposite film prepared combines two inexpensive resources available and biocompatible . ORAL PRESENTATION 181 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org REFERENCES 1. W. Tan, Y. Zhang,Y. Szeto, L. Liao,Compos. Sci. Technol.68(2008) 2917–2921. 2. G. Martinho, N. Balaia, A. Pires, Waste.Manag. 61(2017) 3–12. 3. S. Bhuvaneshwari, D. Sruthi, V. Sivasubramanian, K. Niranjana, & J.Sugunabai,Int. J. Eng. Res. Appl. 1(2011) 292–299. 4. B. Christensen, I. Vold, K. M. Vårum,Carbohydr. Polym. 74(2008) 559–565. 5. V.K Mourya, N. N Inamdar, React. Funct. Polym.68 (2008) 1013–1051. 6. H. Luo, J. Li, X. Chen, Biomed. Pharmacother. 64 (2010) 521–526. 7. R. Drumright,D.J. Siegwart, K. Matyjaszewski, Prog. Polym. Sci. 33 (2008) 448–477. 8. P.Baldrick, Regul. Toxicol. 56(2010) 290–299. 9. R.A Muzzarelli, Carbohydr. Polym.77 (2009) 1–9. 10. V. Sinha, A. Singla, S. Wadhawan, R. Kaushik, R. Kumria, K. Bansal, S.Dhawan,Int. J. Pharm. 274 (2004) 1–33. 11. Y. Feng, L. Yang, F. Li, Anal. Methods. 2(2010). 12. K. Kofuji, C. Qian, M. Nishimura, I. Sugiyama, Y. Murata, S. Kawashima, Eur. Polym. J. 41(2005) 2784– 2791. 13. V. Ferraro, I. Cruz,R. F. Jorge, F. X. Malcata,M. E. Pintado, P. M. L. Castro,Food. Res. Int. 43(2010) 2221– 2233. 14. P. Jerónimo, A. N. Araújo, M. Montenegro, Sens. Actuators. B. Chem.103(2004) 169–177. 15. L. Holzer, B. Münch, M. Rizzi, R. Wep,P. Marschall, T. Graule, Appl. Clay. Sci.47(2010) 330–342. 16. Q. Li,Q. Y. Yue, H. Sun, Y. Su, Y. Gao, J. Environ.Manag. 91(2010) 1601–1611. 17. L. Utracki, Clay-containing polymeric nanocomposites. Shrewsbury: Rapra Technology Ltd. 18. J. Wei, R. Zhu, J. Zhu, J. Hazard. Mater. 166(2013) 195–199. 19. B. Bolto, D. Dixon, R. Eldridge, S. King,Water. Res.35(2002) 2669–2676. 20. S.K. Pillai, S. Ray,Natural Polymers: Nanocomposites.2(2012) (pp. 33–68). 21. P. Srinivasa,M.N. Ramesh, R.N. Tharanathan, J. Food. Hydrocoll. 21(2007) 1113–1122. 22. M. Darder, M. Colilla, E. Ruiz-Hitzky, J.Mater.Chem. 15(2003) 3774–3780. 23. L.Wang, A.Wang,J. Hazard. Mater. 147(2007) 979–985. 24. C. Paluszkiewicz,E. Stodolak,M. Hasik, M. Blazewicz.Spectrochim.Acta A. Mol. Biomol. Spectrosc. 79(2004) 784–788. 25. W. Tan, Y. Zhang,Y. Szeto, L. Liao, Compos. Sci. Technol. 68(2008) 2917–2921. 26. M. Darder, M. Colilla, E. Ruiz-Hitzky, Appl. Clay. Sci. 28(2005) 199–208. 27. Y. Han, S. H. Lee,K. H.Choi,I. Park, J. Phys. Chem. Solids. 71(2010) 464–467. 28. A. Laaraibi, I. Charhouf, A. Bennamara, A. Abourriche, M. Berrada, J. Mater. Environ. Sci. 6 (12) (2015) 3511-3516. ORAL PRESENTATION 182 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Eş Çökelme Yöntemiyle Al3+ Katkılı β-BaB2O4 Sentezi A. Abdullah Ceyhan1*, Binnaz Aydın2 *1 2 Selçuk Üniversitesi, Mühendislik Fak., Kimya Müh. B., Konya, Türkiye Selçuk Üniversitesi, Mühendislik Fak., Kimya Müh. B., Konya, Türkiye Sorumlu yazar e-mail: binnazzakdeniz@gmail.com Özet Bu çalışmada, yarı iletken özelliğe sahip ί-BaB2O4’ın yarı iletkenlik özelliğinin artırılması için Al3+ katkısı kullanılmıştır. Bu amaçla, eş-çökelme yöntemi ve ısıl işlem uygulanarak Al3+ katkılı ί-BaB2O4 sentezi gerçekleştirilmiştir. Elde edilen kristallerin sahip olduğu fonksiyonel gruplar FT-IR analizi, Kristal yapısı XRD analizi, yüzey morfolojisi SEM analizi ve katkı maddesinin yapı içerisindeki varlığı ESR analizi ile belirlenmiştir. Anahtar Kelimeler: ί-BaB2O4, alüminyum, eş çökelme yöntemi, yarı iletken. 1. GİRİŞ Baryum metaborat beyaz renkli ve kokusuz bir katı olup, mono hidratının öz kütlesi γ.β5-3.35 g/cm3, ergime sıcaklığı λ00-1050°C ve β1°C’de sudaki çözünürlüğü % 0.γ’dür (Dibello ve ark., β007ν Trтger, 2012). ί ve α olmak üzere sırasıyla düşük ve yüksek sıcaklıkta farklı kristal modifikasyonuna sahiptir ve α-BaB2O4 ve ί-BaB2O4 polimorfları arasındaki faz dönüşüm sıcaklığı λβ5°C’dir. Baryum metaboratın, düşük ve yüksek sıcaklık modifikasyonlarına ek olarak γ-BaB2O4 olarak tanımlanan kararsız bir düşük sıcaklık modifikasyonu da bulunmaktadır (Akşener, β01γν Wu ve ark., β00β). Uç ürünler olarak tanımlanan bor bileşikleri arasında yer alan baryum metaboratν lazerlerde, boyalarda biyolojik sistemlerde plastik, tekstil ve ahşap malzemelerde yaygın biçimde kullanılmaktadır (Akşener, β01γν Wu ve ark., 2002). Yüksek hasar eşiği, düşük lineer absorpsiyon ve geniş transparan bant genişliği sebebiyle ί-BaB2O4 üzerine yapılan çalışmalar bu özelliklerinin artırılması üzerine yoğunlaşmıştır. Literatürde ί-BaB2O4’ın fotolüminesans özelliklerinin ve yarı iletkenliğinin artırılması için yapılmış çalışmalar bulunmaktadır. Bu amaçla Cu2+, Fe3+, Cr3+, Pb2+, Co2+, Ni2+, Eu2+ ve Dy3+ katkıları kullanılmıştır (Reddy ve ark., 2012; Zhou ve ark., 2005). Bu çalışmada, ί-BaB2O4’ ın yukarıda bahsedilen sahip olduğu özelliklerinin artırılması amacıyla, yüksek iletkenlik özelliğine sahip olduğu bilinen alüminyum katkısı kullanılarak Al 3+ katkılı ί-BaB2O4 üretimi gerçekleştirilmiştir. Elde edilen ürün ί-BaB2O4, FT-IR, SEM-EDX, XRD ve ESR analizleri yardımıyla karakterize edilmiştir. 2. MATERYAL VE METOD Deneysel çalışmada kullanılan reaktiflerν Ba(NO3)2.6H2O, Na2B4O710.H2O ve Al(NO3)3.9H2O analitik saflıkta olup, Merck firmasından satın alınmıştır. De-iyonize su ise, S.Ü. İLTEK Araştırma Laboratuvarlarından temin edilmiştir. Çalışmanın başlangıcında, 0.0β mol Ba(NO3)2. 6H2O çözeltisi ile 0.01 mol Na2B4O7.10H2O çözeltisi ve 0.001 mol Al(NO3)3.9H2O katkı çözeltisi hazırlanmıştır. Baryum nitrat çözeltisi üzerine alüminyum katkı çözeltisi eklenmiş ve manyetik karıştırıcıda (IKA RCT Classic) λ00 rpm karıştırma hızında, β0 dakika süre ile 50oC’de karıştırma işlemi yapılmıştır. Ele geçen karışım, Na2B4O7 çözeltisi ile karıştırılmış ve γ0 dakika süre ile 50 oC’de manyetik karıştırıcıda karıştırma işlemi gerçekleştirilmiştir. İzlenen prosedür literatür ile (Reddy ve ark., 2012; Zhou ve ark., 2005) benzer olup, reaksiyon (1) denkleminde verildiği şekildedir. ORAL PRESENTATION 183 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org � . 6� + � 7. � + �� � → � �� ; �� � + � + − � � (1) Karıştırma işleminin ardından, vakumlu filtrasyon işlemi (Sartorius Stedim ve KNF N-840.γ FT 18) ile katı-sıvı faz ayrılmıştır. Katı faz, sıcak de-iyoize su ile yıkanmış ve sonrasında 85 oC’deki etüvde (Termal EPC 74β0) β4 saat süre ile kurutulmuştur. Elde edilen katıya, 10 oC/dk ısıtma hızı ile 800oC’deki boru tipi fırında (Magmatherm MTTF) hava ortamında bir saat süre ile kalsinasyon işlemi uygulanmıştır. Sentezlenen Al3+ katkılı ί-BaB2O4 kristallerinin karakterizasyon işlemiν FTIR analizi (Bruker Vertex 70), XRD analizi (Bruker D8 Advance), SEM-EDX analizi (ZEISS Evo/LS 10) ve ESR analizi (Jeol Jes-FA300) ile gerçekleştirilmiştir. 3. BULGULAR VE TARIŞMALAR Sentezlenen Al3+ katkılı ί-BaB2O4 kristallerinin karakterizasyonu işlemine FT-IR analizleri yapılarak başlanmıştır (Şekil 1). Şekil1’de, Al3+ katkısı varlığında ortaya çıkan, 1γβ5-1392 cm-1 dalga sayısı aralığındaki pikler metaborat, ortoborat ve piroborat yapısında yer alan BO 3 grubuna ait gerilim titreşimine, 1β7γ-1280 cm-1 dalga sayısı aralığındaki pikler [B3O6]3- içerisindeki [BO3]3- yapısındaki B-O gerilim titreşimine, 1006 cm-1 dalga sayısındaki pik tri, tetra ve pentaborat yapılarındaki BO 4 yapısına, 847-960 cm-1 dalga sayısı aralığındaki pikler 1006 cm-1 dalga sayısındaki tri, tetra ve pentaborat yapılarındaki BO 4 içerisindeki B-O’nun gerilim titreşimine, 650-784 cm-1 dalga sayısı aralığındaki pikler ise B-O-B bükülme titreşimine işaret etmektedir. Bu sonuçlar, herhangi bir katkının yapılmadığı durumdaki ί-BaB2O4 kristallerine ait sonuçlar ile uyum içerisindedir. Şekil 1. Al3+ katkılı ί-BaB2O4 kristallerinin FTIR analizi İkinci aşamada, ele geçen kristallerin XRD analizleri yapılarak yapı içerisinde Al varlığı incelenmiştir. Elde edilen sonuç, Şekil β’ de verildiği gibidir. Şekil β’den görüldüğü gibi üretim sonucu ele geçen katı baryum alüminyum borat (BaAl2B4O10) yapısı ile uyum içerisindedir. Ayrıca reaksiyon sonrasında ortamda ί-BaB2O4 kaldığına da işaret etmektedir. ORAL PRESENTATION 184 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 3. Al3+ katkılı ί-BaB2O4 kristallerinin XRD analizi Çalışmanın üçüncü aşamasında, ί-BaB2O4 içerisine katılan Al3+ katkısının yapı içerisinde yer aldığının gösterilmesi amacıyla, ESR analizi gerçekleştirilmiştir (Şekil γ). Şekil γ’ den görüldüğü gibi, 0-500 mT tarama aralığında oda sıcaklığında elde edilen ESR spektrumu, spektroskopik yarılma çarpanı g değeri 1,λ68781 bölgesinde belirgin şiddetli bir sinyalden oluşmaktadır. Katkısız ortamda mevcut olmayan spektroskopik yarılma çarpanı g = 1,λ68781 olan belirgin şiddetli sinyalin ί-BaB2O4 içerisindeki Al3+ katyonundan kaynaklandığı düşünülmektedir. Şekil 3. Al3+ katkılı ί-BaB2O4 kristallerine ait ESR analizi Çalışmanın son aşamasında, elde edilen Al3+ katkılı ί-BaB2O4 kristallerinin SEM-EDX analizi gerçekleştirilmiştir. Şekil 4’ den görüldüğü gibi, % β,6 oranında alüminyum varlığı söz konusudur. Al3+ katkısı ORAL PRESENTATION 185 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org varlığında üretilen kristallerin SEM görüntülerinden kesilmiş kristaller şeklinde bulunduğu, yüzeylerde gözeneklerin yer aldığı, aglomere olmadığı 1µm’nin altında partikül boyutunun oranının arttığı da görülmektedir. Element wt.% Oksijen 61.92 Baryum 31.22 Alüminyum β.60 Bor 16.96 Toplam: 100.00 Şekil 4. Al3+ katkılı ί-BaB2O4 kristallerine ait SEM- EDX analizi 4. SONUÇLAR Bu çalışma kapsamında, eş çökelme yöntemi ile Al3+ katkılı ί-BaB2O4 kristal üretimi gerçekleştirilmiştir. FTIR analizi ile katkı maddesi varlığında üretilen ί-BaB2O4’ın, katkısız ortamda üretilen ί-BaB2O4’a ait fonksiyonel gruplarla benzerlik gösterdiği tespit edilmiştir. Al3+ katkılı ί-BaB2O4’ın partikül boyutunun 1µm’in altına düştüğü belirlenmiştir. Ayrıca SEM-EDX analizi ile Al3+ iyonlarının nitel analizleri yapılmış olup söz konusu katkının %β,60 oranında varlığı göstermiştir. XRD analizi katkının yapıya katıldığına işaret etmiştir. ίBaB2O4μAl yapılarına sahip kristallerin teyit edilmesi amacıyla ESR analizi gerçekleştirilmiştir. ESR analizi ile Al3+ iyonlarının ί-BaB2O4 yapısına katıldığı tespit edilmiştir ve spektroskopik yarılma çarpanı g değeri 1,λ68781 olarak hesaplanmıştır. TEŞEKKÜR Bu çalışma Selçuk Üniversitesi Bilimsel Araştırma Projeleri Koordinatörlüğü tarafından desteklenmiştir. Proje No : 15201029. KAYNAKLAR Akşener, A. E., (β01γ) “Farklı yöntemlerle baryum metaborat üretimi ve üretim sürecine etki eden faktörlerin incelenmesi”, Doktora Tezi, Yıldız Teknik Üniversitesi, Fen Bilimleri Enstitüsü, İstanbul. Dibello, P., Manganaro J. and Aguinaldo, E., (2007) Barium compounds. In: Kirk–Othmer encyclopedia of chemical technology, vol.3, John Wiley & Sons, Inc., New Yok, A.B.D., 2007. Fedorov P., Kokh A., Kononova N. and Bekker T., (β008) “Investigation of phase equilibria and growth of BBO (ί-BaB2O4) crystals in BaO–B2O3–Na2O ternary system”, J Cryst Growth, vol.310 (7), pp.1943-1949. Koçak, F. Z., (β01γ) “Baryum metaborat tetrahidrat'ın üretimi ve üretimi artlarının belirlenmesi”, Yüksek Lisans Tezi, Selçuk Üniversitesi Fen Bilimleri Enstitüsü, Konya. Reddy C. V., Krishna C. R., Thampy U. U., Reddy Y., Rao P. and Ravikumar R., (β011) “Spectral investigations of Cu2+ doped beta-barium borate nanopowder by the co-precipitation method”, Phys. Scr., vol. 84 (2), pp.025602. Reddy C. V., Krishna C. R., Rao T. R., Sathish D., Rao P. and Ravikumar R., (β01β) “Synthesis and optical properties of Co2+ and Ni2+ ions doped ί-BaB2O4 nanopowders”, J Lumin, vol.132 (9), pp.2325-2329. Reddy C. V., Krishna C. R., Rao T. R., Thampy U. U., Reddy Y., Rao P. and Ravikumar R., (β01β) “Synthesis and spectral characterizations of Fe3+ doped ί-BaB2O4 nano crystallite powder”, J. Mol. Struct., vol.1012, pp.17-21. ORAL PRESENTATION 186 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Reddy C. V., Kumar K. V., Vattikuti S. P. and Ravikumar R., (β01γ) “Structural and spectral features of Cr 3+ doped ί-BaB2O4 nanopowder by co-precipitation method”, Physica Bμ Condensed Matter, vol.429, pp.1823. Trтger F., (2012) Springer handbook of lasers and optics, Springer Science & Business Media, New Yok, A.B.D. Zhou Y. F., Hong M. C., Xu Y. Q., Chen B. Q., Chen C. Z. and Wang Y. S., (β005) “Preparation and characterization of ί-BaB2O4 nanoparticles via coprecipitation”, J Cryst Growth, vol.276, pp.478–484. Zou W. G., Lü M., Gu F., Xiu Z., Wang S. and Zhou G., (β006) “Luminescence properties of Eu 3+ and Dy3+ doped ί-BaB2O4 nanocrystals”, Opt. Mater., vol.28 (8), pp.988-991. Zou W. G., Lu M. K., Gub F., Wang S., Xiu Z. and Zhou G., (β006) “Photoluminescence characteristics of BaB2O4 nanoparticles co-doped with Cu2+ and Pb2+” Mater. Sci. Eng., B., vol.127, pp.134–137. Wu S., Wang G., Xie J., Wu X., Zhang Y. and Lin X., (β00β) “Growth of large birefringent α-BBO crystal”, J Cryst Growth, vol.245 (1), pp.84-86. ORAL PRESENTATION 187 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Analytical Approach to the Waste Management of Nanomaterials in Developıng Countries Mehtap Kara1*, Özlem Nazan Erdoğan2 1 İstanbul University, School of Pharmacy, Department of Pharmaceutical Toxicology, İstanbul, Turkey 1 İstanbul University, School of Pharmacy, Department of Pharmacy Management, İstanbul, Turkey e-mail:matost@gmail.com Abstract Nanotechnology has been worldwide rapidly growing and developing scientific and industrial field since 1990s. Nanomaterials (NMs) and nanoparticles (NPs) refer the materials having thousand millionth of a meter (10-9 meter) size. NMs production and consumption increase every passing day. Different variety of consumption products as sunscreen, cosmetics, antibacterial textile, batteries, automotive industry, glass coating, medical and pharmaceutical include NMs. Some consumer products including NMs such as cosmetics, drugs etc. directly expose humans and the environment. Although nanotechnology field exhibit large scale economic and research potential, there are limited information about biological and environmental risk of nanoproducts during their “end of life” release to environment. It is very difficult to detect and prevent NMs release to the environment at their end of life. NMs have strong interaction with biological structures, due to their size, shape and chemical features. Many different types of NMs released to environment have bioaccumulation feature which is very important for biological structures, human health and pollution. NMs are called as “nanocontaminats” when they release to environment and offer hazardous effects. Also they can be classified as “nanowaste” when show accumulation features and hazardous effects. Toxicological risks of nanocontaminats and nanowastes are not fully understood. NMs behaviour in the environment is fully different from regular materials and they may show more reactive and toxic effects compared to other bulk waste materials in the environment. Unfortunately there are no sufficient scientific data about toxicological profile of nanocontaminats and nanowastes after they released to environment. In developed countries legislative regulations were constituted and been improved parallel to the development of the product range, however in developing countries there is wide gap about determination of nanowastes and legislative regulations are still insufficient. The goal of this article is to initiate discussion on handling of NMs containing wastes and nanowaste management in developing countries. INTRODUCTION The Latin word “nano” that means dwarf, that refers one thousand millionth of a meter (10 -9 m). Nanotechnology is that rapidly progressing and multidisciplinary scientific filed and has wide scope of application area. (Bhatia S. 2016; Nanoodpadów N. 2016). Nanotechnlogic researches are highly attract attentions of scientists and paper on nanotechnology is being published rapidly (Lewinski N. 2008). Nanoparticles, nanoplates and nanofibers are the International Organization for Standardization (ISO) classification of nanomaterials (Nanoodpadów N. 2016). Nanoparticles have three main classifications that based on dimensions are; one dimension (1-100 nm thin film sized) ,two dimension (carbon nanotubes) and three dimension (Dendrimers, Quantum Dots, Fullerenes). Nanoparticles can be characterized by advanced electron microscopy techniques as atomic force microscopy (AFM), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). (OECD Testing Programm, 2008; Bhatia S. 2016;). Materials that 1-100 nanometers (nm) or incluse nanoscale particles are termed as nanomaterials (figure 1). (Lewinski, N. 2008). It has been reported that nanomaterials production annual production amount will increse 58,000 tons by 2020 (Maynard 2006). It has been reported that, global nanomaterial production is regularly increase 25% per year and (Nanoodpadów N. 2016) Due to different research reports, global nanomaterial market growing rate will be reach to 55.0 billion USD by 2022. Prominent regulatory coordinators about nanomaterials are The United States Environmental Protection Agency (EPA), The European Chemicals Agency (ECHA), Registration, Evaluation, Authorisation and Restriction of Chemicals (REACH) in the US and the EU and also the Ministry of Industry and Information Technology (MIIT) in China. (Allied Market Research ORAL PRESENTATION 188 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org September 2016; Allied Market Research, October 2016; Mordor Intelligence, 2017; Inshakova, E., and Inshakov, O., 2017). Concerning about NMs effects on human health and environment cause restrictions in global marketing. Most of NMs are toxic or include toxic solvents, release hazardous intermediate compounds during production phases. Thus governmets should organize critical legislative regularions and managements. (Inshakova E., and Inshakov, O., 2017.) Figure 1. Summarized definition of nanomaterials (IS0, 2008) (adapted from Faunce, T., & Kolodziejczyk, B. (2017). NANOCONTAMINATS AND NANOWASTE Particles that sized at nanoscales regularly occurs in the environment. Also increasing number of nanomaterials releasing to environment from market products that include cosmetics, textiles, lubricants, batteries and solar cells products, drug delivery materials, medical imaging agents and medical implants etc. regularly . Nanomaterials conducts different types of transformations dependent to their molecular spesifications which sometimes resulted with hazardous residuals in the environment called as “nanocontaminats”. There are contradictory evidences in the literature about effect of nanomaterials on human and environmental health in the literature, however important issues for risk characterization of nanomaterials are size, shape, solubulity, chemical parameters, biocompatibility features of the particles to qualify (spesify) them as “nanowaste”. (Nanoodpadów N. 2016; Part F. Et al., 2015) During regular production and usage phases of nanomaterial and nanpoarticles, their wastes disposed like large scale sized products commonly (Nanoodpadów N. 2016). And also nanoproducts that reach its end of life mix waste circulation too. (Caballero-Guzman et al., 2015; Gottschalk et al., 2013; Keller and Lazareva, 2013; Mueller and Nowack, 2008). This case make monitoring and quantification of nanowastes in complex environmental matrixes a current issue for ecosystem to do hazard identification. There are several different analytical methods for the characterisation of nanomaterials in the environment as waste. These methods based on nanomaterials particle number, elemental composition, particle size, particle distribution, aggregation state, shape, structure, surface area, surface charge and surface spesifications. (Part F. Et al., 2015) Nanowastes bahviour are not same as normal wastes in the environment and it is hard to detect these materials with nowadays technology. Legal regulations and managements have critical role on identify and control of nanowastes (Bystrzejewska-Piotrowska G, et al., 2009) TOXICOLOGICAL RISKS OF NANOWASTES There were limited data about distribution of nanomaterials into the environment and biological systems due to their uncontrollably entrance to environment (Moore 2006). (Musee N. 2011). Environmental detection and monitoring of nanowastes are important issues. Detection, quantification and analysis of nanowastes aremore difficult compared large sized bulk wastes, because of their low concentrations, large chemical variety, other nanomaterials interferance which ocuurs naturally in the environment as Al2O3, CuO, SiO2, TiO2, or ZnO and insufficient analytical methods. Although there are different improved imaging techniques as Transmission ORAL PRESENTATION 189 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org electron microscopy (TEM), scanning electron microscopy (SEM) and ICP-MS, it is still impossible determinaton and quantşfşcation af nanoparticles ib complex solid phases (Part F. Et al., 2015). Nanomaterials effects on environment and biological systems are not fully understood and unclear because of their wide range physical, chemical and biological features (Colvin, 2003; Hoet et al., 2004). And these features of nanomaterials could be enhance their spread in environment and may increase toxic effects on the biological systems. Also nanomaterials may play role as a particle carrier in water and air due to their physical and chemical characteristics (Kleiner and Hogan, 2003). While with nonotechnology it is possible to work at nano scales, this new era intoduce a new waste definition as “nanowaste”. Nanowastes can be spread out during production, storage and distribution and usage phases (Table 1). Nanowaste contamination routes were shown in figure 2 According to British Standarts Guide (BSI) in the environment there are four form of nanowastes as pure, material and surfaces include nanowaste, liquid phases include nanowastes and solid matrixes include nanowastes. There were several studies about nanowastes health and toxicological effects in the literature (Colvin, 2003; Moore, 2006; Nel et al., 2006; Holbrook et al., 2008), however limited studies on nanowaste controlling and management. Nanomaterials uncontrolled releasing into the environment may generate short and long term high risks of nanowaste contamination of soil, agriculturel products, underground waters and air. (Musee N. 2011) Figure 2. Nanowaste contamination routes. (Adopted from Marcoux MA. et al., 2013 ) Evaluating nanowaste is not same with larger particles in case of different physical and chemical properties of nanomaterials and nanoparticles. Althoug toxicological properties of larger molecules well defined, conditions are different in nanoscales and it is needed re-evaluating toxicological properties of these nanomaterials. For instance, if molecule size get smaller, its surface area and also its biological activity increse. (Lewinski, N. 2008). There are some examples at the below how nanoparticle contamination of goundwaer, soil, air and water occurs. Nanoparticle directly releasing from technical compartments for instance using for water treatment or groundwater remediation, effects groundwaters and air. Diffuse sources like fuels including CeO2 or Paints incuding TiO2 effects soil, water and air. (central.oak.go.kr ) There are unsufficient toxicological data from scientific studies about nanomaterials effects on mammalian and aquatic model systems in the literature that make complicate risk assemment and hazard identification of these materials. These limitations also negatively effect to arrengment of nanowaste management. While physical and chemical features are an advantage for usage of nanomaterials, same features are disadvantage for evaluate their toxicological profiles in biological systems and environment. In different areas as air, soil, water, nanaowastes shows different toxcological characteristics (Musee N 2011). Due to their different physical and chemical properties, nanoscales of bulk materials have higher toxicity and chemical reactivity. For instance, as a nanoparticle character asbestos was highly used without sufficient toxicty and hazardous data in the past caused several serious health impacts. Today asbestos is a banned product in many countiries ( Faunce, T., & Kolodziejczyk, B. 2017). There are limited and contradictory data in the literature about toxic effects of nanomaterials. These data reported that some nanoparticles may pass the biological membrane barriers, transport via body fluids and may ORAL PRESENTATION 190 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org accumulate in target organs. Respiratory, cardiovascular, reproductive, central nerveus system and urinary system are the main targets of nanoparticles that effects cellular molecular mechanisms of these systems. nanoparticles cause toxic effects primarily in respiratory system In case of their smaller size that enhance enterance respiratory system. Nanoparticles toxic effects are related their particle size than their molacular mass. Also nanoparticles surface encapsulation properites alter their toxicological effects in the biological system. Nanocapsules, nanospheres and quantum dots are the another nanomaterials that commonly used as biopharmacological vectors. A few toxicological data were in the literature about these types of nanomaterials. These studies repored that nanodots may release cytotoxic ions and initiate oxidative stress in cellular systems, however toxicologic data in workers of nanomaterial production were insufficient (Ostiguy C. 2006). Titanium dioxide (TiO2) nanoparticle was classified as possible human (group 2B) carcinogen by the International Agency for Research on Cancer (IARC). TiO2 distribution to environment as waste cause disruptions and death of benefical soil microorganisms may result with imbalance of ecosystem. Althoug carbon based nanomaterials have wide range production and application field in electronics, their hazardous toxic and carcinogenic effects limited their applications in biological systems. Carbon nanotubes usage in buidings initiate asbestos like toxic effects (Thomas Faunce T& Kolodziejczyk B. G20 Insigts-2017). Table 1. significant nanotechnology appliaiton areas Automotive Construction Electronics Fooddrink Catalysts Insulation Displades Packaging Painting Flame Laser additives Sensors retardants diodes Fiber optics transistos Medicine Textile Cosmetics Military Drug Surface Sunscreen delivery coating Lipsticks Coast Coloring Creams medium Test systems Diagnositc systems (Table 1 is adopted from ; Danail Hristozov and Ineke Malsch. 2009) Neutralizator of chemical weapons Enenrgy Lighting Fuel cells Solar cells NANOMATERIALS USAGE IN MEDICINE AND PHARMACY Nanotechnological improvements in medicine may lead to more effective and personalized therapy for diseases with lower adverse effects of drugs. Nanomaterials can be used as imaging with high resolution, targetting disease area, increasing bioavailability of drugs, increasing effects of the drugs and in tissue engineering. Carbon nanotubes, several nanoparticle types as superparamagnetic iron oxide nanoparticles (SPIONs), gold (AuNPs), magnetic, ferrofluidic, fleyroscent, silver and copper nanoparticles, quantum dots (QD), nanogels, dendrimers and liposomes are commonly used nanomaterial types in medical applications. With further studies, nanomaterial options for medicinal applications will be increased (Marchesan S and Prato M. 2013; Bystrzejewska-Piotrowska et al., 2009). Several different type of barriers plays key roles on absorbtion, distrubition, metabolisation and exrection of the drugs. Recent studies are focused on the bypass of biological barriers that decrease drugs effectiveness in the body. Some examples that cross the biologic barriers are given in the below paragraphs. PEGylation (grafting with polyethilene glycol) one of the process that increase the hemodynamics of the drugs in the body. Micelles are the another nano-drug composing type that increase the effects of drugs with hydrophobic interaction. For instance, anticancer drugs encapsulated into the micells and then these micells including drugs are decomposed in the acidic environment of the tumor cells. And also nanoparticles design and use for induce immune system to initiate immune response to influenza infections through respiratory administration. Several types nanocarriers and nanocontainers are designed for DNA therapy, and stil investigating under in vitro studies. Thus, several from basic to complex nanomaterials and nanoparticles designed and studied for several aspects for medicinal applications. These materials enable to drugs; accessing target area by-passing the biologic barriers, decreasing the drug tolerence, escape from drug clerance, increasing drug activity (Hubbell JA and Chilkoti A. 2012). Nanoparticles and nanodevices usage in medicinal applications and drug delivery are growing rapidly scientific area (Verma A. et al., 2008). Some examples about nanoparticle usage in medicinal area listed below; ORAL PRESENTATION 191 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org        Magnetic nanoparticles for quatify several parameters in polirized cells, in molecular biology studies and diagnostic purpose. For cancer therapy, for the purpose of transporting chemical factors in drug targetting. Drug biomanipulation Labelling biomolecules to evaluate physiological features of the cell Contrasting agent in imaging Antibacterial, biocidal and antifungal properties Biochemical tests and analysis (Verma A. et al., 2008; Gao et al., 2008; Liu, 2006; Kirchner et al., 2005; RISK ASSESSMENT OF NANOWASTES IN THE ENVIRONMENT Automotive, cosmetic, medical, textile industries are the main nanowaste sources and different type of nanomaterials, bare or functionalized nanoparticles are released into the air, soil and water rapidly in the environment after production processes from these industries. After degradation in the environment these nanowastes may accumulate and show ecotoxicological effects. Degradated nanowastes which released to environment have short-term effects on biological systems, however low soluble and degradable nanomaterials have tendency to accumulate in the environment and biological systems. Despite to several scientific studies and technological improvement about nanotechnology, it is stil difficult to descirbe toxicity and bioavailibility of nanomaterials in biological systems (BystrzejewskaPiotrowska G, et al., 2009 ) There are two risk categories defined in the literature as “known risks” and “potential risks”. Nanoparticles risks are categrized under “potential risks”. Potentials risk factors have features asν it is not certain that material or chemical have danger and when this material or chemical occur is it cause a significant damage. There are several in-vitro and in vivo studies about nanoparticles toxic effects, however further studies should done to explain detailed hazard effects of these materials. Different types of nanoparticles different toxic doses and dose-response associations evaluated and revealed in different species, however it is needed compherensive and extensive guidelines that include these studies and explain detailed toxicity and risk assessments. Due to non-standartized testing protocols, it is difficult to clearly determine chemical properties of nano sized particles, their characteristics in the environment and biological systems, and also their adverse effects (Hristozov D and Malsch I. 2009). MANAGEMENT In Turkey, Medical Waste Control Regulation was first put in place in 1993 from Ministry of Environment and Forestry legislators, then in 2005 this regulation revised to New Medical Waste Control Regulation (MWCR) which in align with EU Environmental Directives was published. MWCR include issues on collection, transportation, storage, disposal of medical wastes that classified into four group as municipal, medical waste which are infectious, pathological and sharps, hazardous and radioactive wastes (Eker HH, et al., 2010) In 1983, Ministry of Environment published Law 2872 which include regulations about improving environmental contidions in Turkey and after 20 year duration only three regulative management update became to main topic which in 1993, 2003 and 2005. This law regulation is not enough for today because of several type of waste characteristics and different disposal methods for different types of wastes. Although strict regulaions about municipal solid waste regulations, wrong disposal methods of municipal solid waste like open dumping ongoing problem in developing countries. According to The Turkish State Statistical Institute (TURKSTAT) 2014 report, municipal solid waste generation was approximately 26 million ton and this number rising each passing year. In our country, different departments and organisations work on waste managemnet which cause interaction problems and serious implementation and administrative disruptions. In rural areas this problems increase incrementally due to controlling disruptions (Sarptaş, H., & Erdin, E. 2015). In Turkey there is no information or ragulation about nanowaste in “Hazardous Waste Management of Turkey” and in “cosmetic management”. However in the world few developed countries refers nanowaste risk in their managements or waste guidelines as shown in Table 2. (resmigazete.gov.tr-a,b). ORAL PRESENTATION 192 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 2. Regulations for nanosafety in major countries Country USA EU JAPAN Regulations TSCA REACH MOE-METI FIFRA CLP including FFDCA RoHS informations CR (Table 2 adopted from central.oak.go.kr ) THAILAND AUSTRALIA KOREA NANOTEC NICNAS Comprehensive plans of nanosafety (2011.10) DISCUSSION Nanotechnological scientific studies and industry improving each passing day, therefore in parallel with this, wastes releaseing environment increase too. Further studies and observations needed to determination and advanced risk assessment of nanowastes in the environment. There is big deficiency about management and nanobiomonitoring of nanowastes in developing countries. It is needed to prepare regulative managements on nanowastes releasing to environment before the nanoproduct come to marketting. With todays technology it is limited and very expensive to detect nanowastes in the environment and also evalute their toxicological risk assesment in the biological systems. Before publish highly effective nanowaste management, it is needed to develop recent and cheaper technology strategies which faster and include easier protocols to identfy nanowastes in the environment and also in biological systems. Possible remediation and deactivation techniques should be developed thet incorporate with waste managements. Within this review article we want to fill existing knowledge gaps on NMs “end of life process” in Turkish Waste Management and provide data for scientist and regulatory authorities. For this purpose, some directions and suggestions to manage safe and effective waste regulations about nanowastes were given in this paper. Developing country governments should make a nanowaste detection, elimination, recycling and prevention strategies and technologies in contact with researches works on nanotechnology before preparing legislative managements. With recent scientific researches high throughput analytical methods should be developed for detecting nanowastes during their contaminating phases and effecting biological structures. And also improved detection technologies needed which discriminate new and old nanocontaminants in the environmental and biological samples. After detection, identfying and classification of nanocontaminats, improved technologies should be developed for removal of nanocontaminants from environment, especially from waste water. Scientist should carefully work on artificial intelligence softwares to predict early nanowaste release to environment from industries, medical and pharmaceutical sector. Official and semi-official organisations should set up by related ministry and semi-official organisations should organize regular survelliance to nanotechnology producing, using and nanotechnology research places regularly about waste releasing with developed new technology strategies. Industry, universities and governments in developing countries should handle nanowaste issue and recycling of nanocontaminants to prevent pollution and adverse health effects of these materials on biological structures. During landfilling, incineration and recycling processes of nanomaterials, several amounts of nanocontaminants release to the environment. To minimize releasing during landfilling, nanocontaminants chemical properties should known clearly and storage should convenient to this chemical properties. Governments in developing countries should pay a special budget to scientific research activities on highly sensitive detection protocols and analytical equipments which discriminate nanocontaminants from their natural counterparts. Educative conference and workshops thet organized by official and semi-official organisations to universities, industries, medical sector workers about nanowaste and their adverse effects on environment and heath. To high quality and enhanced detection and prevention strategies, a formal nanocontaminant and nanowaste analyzing laboratories shoul open in every region. To limiting occupational exposure of workers on this area, health control centers and hospitals should updated for monitoring nanocontaminats exposure. And another important issue is, organizing routinely ground water analysis from government. CONCLUSION Although nanotechnology research area and industrial activities and also medical applications grow exponantial, controlling, recycling and disposal management of nanocotaminants and nanowaste grow more slowly. Different international organisations as OECD, IUON and developed countries seriously handle nanocontamination however develoing countries have big gap about managing and controlling on ORAL PRESENTATION 193 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org nanocontamination. These countries should seriously attain importance to nanocontamination and nanowaste management, because developed countries works is not provide worldwide efficient and effective protection about this type contamination and adverse effects. There were few study on nanowaste from Turkey and unfortunately there is no diverse regulatory management. Immediately workshops, educations, research activities should organise in our country to prepare a detailed management. In this paper we aimed to attarct attention on nanocontamination and nanowaste issue in Turkey and step by step set a course for improving nanowaste researhes and organising official managements. REFERENCES Allied Market Research, October 2016; Europe Nanomaterials Market by Type of Material, by End User – Opportunity Analysis and Industry Forecast, 2014–2022 Allied Market Research, September 2016; Nanomaterials Market – Global Opportunity Analysis and Industry Forecast, 2014–2022 Bhatia S. 2016. Nanoparticles Types, Classification, Characterization, Fabrication Methods and Drug Delivery Applications. Natural Polymer Drug Delivery Systems, DOI 10.1007/978-3-319-41129-3_2. Blaser, S.A., Scheringer, M., MacLeod, M., Hungerbühler, K., β008. Estimation of cumulative aquatic exposure and risk due to silver: contribution of nanofunctionalized plastics and textiles. Science of the Total Environment 390, 396– 409. Bystrzejewska-Piotrowska G, Golimowski J, Urban PL. 2009. Nanoparticles: their potential toxicity, waste and environmental management. Waste Manag. Sep;29(9):2587-95. Bystrzejewska-Piotrowska G, Golimowski J, Urban PL. 2009. Nanoparticles: their potential toxicity, waste and environmental management. Waste Manag. Sep;29(9):2587-95. Caballero-Guzman, A., Sun, T., Nowack, B., 2015. Flows of engineered nanomaterialsthrough the recycling process in Switzerland. Waste Manage. 36, 33–43. Colvin VL. 2003. The potential environmental impact of nanomaterials. Nat Biotechnol;21(10):1166–70. Danail Hristozov and Ineke Malsch. 2009. Hazards and Risks of Engineered Nanoparticles for the Environment and Human Health. Sustainability, 1, 1161-1194 ) Eker HH, Bilgili MS, Sekman E, Top S. 2010.vEvaluation of the regulation changes in medical waste management in Turkey. Waste Manag Res. 28(11):1034-8.) Faunce T and Kolodziejczyk B. 2017. Nanowaste: Need for Disposal and Recycling Standards.. G20 Insigts Faunce, T., & Kolodziejczyk, B. 2017. Nanowaste: Need for Disposal and Recycling Standards. https://sustainabledevelopment.un.org/content/documents/9539GSDR_Nano_brief%204.pdf ) Faunce, T., & Kolodziejczyk, B. 2017. Nanowaste: Need for Disposal and Recycling Standards.https://sustainabledevelopment.un.org/content/documents/9539GSDR_Nano_brief%204.pdf Gao, J., Zhang, W., Huang, P., Zhang, B., Zhang, X., Xu, B., 2008. Intracellular spatial control of fluorescent magnetic nanoparticles. Journal of American Chemical Society 130, 3710–3711. Gottschalk, F., Sun, T., Nowack, B., 2013. Environmental concentrations of engineered nanomaterials: review of modeling and analytical studies. Environ. Pollut. 181, 287–300. Hoet PHM, Brüske-Hohlfeld I, Salata OV. 2004. Nanoparticles—known and unknown health risks. J Nanobiotechnol;2:12. Holbrook RD, Murphy KE, Morrow JB, Ken D, Cole KD. 2008. Trophic transfer of nanoparticles in a simplified invertebrate food web. Nat Nanotechnol;3:352–5. Hristozov and Malsch. 2009. Hazards and Risks of Engineered Nanoparticles for the Environment and Human Health. Sustainability, 1, 1161-1194. http://central.oak.go.kr/journallist/journaldetail.do?article_seq=11682&tabname=abst&resource_seq=1&keywords=null http://central.oak.go.kr/journallist/journaldetail.do?article_seq=11682&tabname=abst&resource_seq=1&keywords=null http://www.resmigazete.gov.tr/eskiler/2005/03/20050314-1.htm http://www.resmigazete.gov.tr/eskiler/2005/05/20050523-3.htm Hubbell JA and Chilkoti A. 2012. Nanomaterials for Drug Delivery.. SCIENCE VOL 337,303-305 Inshakova, E., & Inshakov, O. 2017. World market for nanomaterials: structure and trends. In MATEC Web of Conferences (Vol. 129, p. 02013). EDP Sciences. ORAL PRESENTATION 194 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Kirchner, C., Liedl, T., Kudera, S., Pellegrino, T., Javier, A.M., Gaub, H.E., Stolzle, S., Fertig, N., Parak, W.J., 2005. Cytotoxicity of colloidal CdSe and CdSe/ZnS nanoparticles. Nano Letters 5, 331–338. Kleiner K, Hogan J. 2003. How safe is nanotech? New Sci Tech:14–5. Lewinski, N. 2008. Nanotechnology for Waste Minimization and Pollution Prevention. Rice University: Houston, TX. List of Manufactured Nanomaterials and List of Endpoints for Phase One of the OECD Testing Programme: June 2, 2008; Organization for Economic Cooperation and Development (OECD),. Liu, W.T., 2006. Nanoparticles and their biological and environmental applications. Journal of Bioscience and Bioengineering 102, 1–7. Marchesan S and Prato M. 2013. Nanomaterials for (Nano)medicine.. dx.doi.org/10.1021/ml3003742 еACS Med. Chem. Lett., 4, 147−14λ Marcoux MA, Matias M, Olivier F, Keck G. 2013. Review and prospect of emerging contaminants in waste--key issues and challenges linked to their presence in waste treatment schemes: general aspects and focus on nanoparticles. Waste Manag. Nov;33(11):2147-56. Maynard AD. 2006. Nanoparticles and Occupational Health. ISBN-13-978-1-4020-5858-5, Springer Moore MN. 2006. Do nanoparticles present toxicological risks for the health of the aquatic environment? Environ Int;32:967–76. Mordor Intelligence, Hyderabad, Telangana, March 2017; Nanomaterials Market – Global Trends, Investment Analysis and Future Scope to 2022 Mueller, N.C., Nowack, B., 2008. Exposure modeling of engineered nanoparticles in the environment. Environ. Sci. Technol. 42, 4447–4453. Musee N. 2011. Nanowastes and the environment: Potential new waste management paradigm. Environ Int. Jan;37(1):112-28. Nel A, Xia T, Mтdler L, Li N. β006. Toxic potential ofmaterials at the nanolevel. Scienceνγ11μ6ββ–7. Niebezpieczeństwo nanoodpadów. β016. Risk of nanowastes. Inżynieria i Ochrona Środowiska, 1λ(4), 469-478. Ostiguy C. β006. Health Effects of nanoparticles. Dépôt légal Bibliothèque et Archives nationales ISBN 13 : 978-2-89631-060-9 Part F, Zecha G, Causon T, Sinner EK, Huber-Humer M. 2015. Current limitations and challenges in nanowaste detection, characterisation and monitoring. Waste Manag. Sep;43:407-20. Sarptaş, H., & Erdin, E. 2015. Municipal Solid Waste Management in Turkey: Status, Challenges and Future Strategies Waste-to-Resources. Verma, A., Uzun, O., Hu, Y., Hu, Y., Han, H.S., Watson, N., Chen, S., Irvine, D.J., Stellacci, F., 2008. Surface-structure-regulated cell-membrane penetration by monolayer-protected nanoparticles. Nature Materials 7, 588–595. Weir, E., Lawlor, A., Whelan, A., Regan, F., 2008. The use of nanoparticles in antimicrobial materials and their characterization. Analyst 133, 835–845. ORAL PRESENTATION 195 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org HEC/Chitosan Blend Pervaporation Membranes for the Separation of Dimethyl Carbonate/Methanol Mixtures Derya Ünlü, Aynur Hacıoğlu, Nilüfer Hilmoğlu* Kocaeli Unversity, Engineering Faculty, Chemical Engineering Department, Kocaeli, Turkey Corresponding author e-mail:niluferh@kocaeli.edu.tr Abstract In this study, chitosan and hydroxyethyl cellulose blend membranes were developed for the pervaporation of methanol from a Dimethyl Carbonate (DMC) solution. Chitosan and hydroxyethyl cellulose were chosen as membrane material due to the biodegradable and nontoxic properties. Separation experiments were carried out in a pervaporation system. Pervaporation is an alternative process for the separation of dimethyl carbonate (DMC)/methanol mixture. The effects of HEC/chitosan ratio, feed MeOH ratio and operation temperature on pervaporation (PV) performance were investigated and interpreted. In addition, the membrane characterization and membrane swelling effects were investigated. The blend membrane with a HEC/chitosan ratio of 7/3 exhibited a separation factor of 28.25 and a total flux of 0.00054 kg/m 2 h in the pervaporation of 10 wt% methanol ratio at γ0 °C. The results of the HEC/chitosan blend membrane exhibited higher separation performance and more mechanic and chemical stable performance in separating methanol from the DMC solution. The HEC/chitosan blend membrane can be a suitable pervaporation membrane to separate methanol from a DMC solution. Keywords: Chitosan, Pervaporation. Dimethyl carbonate, Hydroxyethyl Cellulose, Membrane, Methanol, 1. INTRODUCTION Dimethyl carbonate has wide application in chemical and petrochemical industry. Because of its hypotoxicity, degradability, high oxygen content; it is called as a green chemical. Dimethyl carbonate, which has carbonyl and methyl functional groups in its structure, is an important intermediate chemical for the carbonylation and methylation reactions. In these reactions, DMC is used in place of carcinogenic and environmentally harmful chemical substances such as dimethyl sulfate and methyl chloroformate. It is also a safe candidate for the phosgene which is used in the synthesis of polycarbonate resins (Zhou et al., 2014). DMC has also 53% oxygen content, so it can be used as fuel additive alternative to MTBE. The usage of MTBE in gasoline is restricted due to the environmental concerns. Therefore, DMC is a good oxygenate alternative for the gasoline (Won et al., 2002). DMC has been synthesized by oxidative carbonylation of methanol, transesterification of ethylene carbonate with methanol. DMC is obtained as a mixture with methanol at the end of the synthesis reaction. This mixture has a separation problem because methanol forms an azeotrope with DMC. Various separation methods such as distillation, extraction, adsorption are used to separation of DMC, but these methods need high energy and high capital investment (Zhu et al., 2013). Pervaporation (PV) is a developing alternative technology for the conventional separation process due to the eco-friendly and energy saving properties. The separation processing by pervaporation is explained by the solution-diffusion model. The permeability of the membrane is determined by solubility and diffusivity. Processing takes place in three steps. In the first step; one of the components which is selective for the membrane is sorbed on the membrane surface. In the second step; the selective component is diffused through the membrane. In the last step; the component is desorbed in the vapor phase from the membrane (Wang et al., 2011). ORAL PRESENTATION 196 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org In pervaporation process, the chosen of membrane material is an important factor for the diffusion and permeability. Polymers, which have high thermal and chemical stability, high permeability, good sorption properties, are preferred for the membrane preparation (Smitha et al., 2004). In this study, chitosan and hydroxyethyl cellulose were used for the preparation of pervaporation membrane. Both of polymers are natural, non-toxic, and, biodegradable (Liu et al., 2005; Chanachai et al., 2000). The structures of chitosan and HEC contain hydroxyl groups which take an important role in diffusion and sorption of methanol. Methanol and water have close polarity values and therefore, transport of methanol facilitates due to the presence of hydroxyl groups. In this study, separation of methanol from DMC is carried out by using biodegradable HEC/chitosan blend membrane with pervaporation process. The effects of HEC/chitosan ratio, feed MeOH ratio and operation temperature on flux and selectivity values were determined and the optimum ratios were 7/3, 10 wt. % and 30oC for HEC/chitosan ratio, feed MeOH ratio and operation temperature, respectively. 2. MATERIALS AND METHODS 2.1 Materials The polymers used for membrane synthesis, chitosan and HEC were received from Sigma Aldrich. Methanol, DMC, and acetic acid were also purchased from Merck Chemicals. All chemicals were used without further purification. 2.2 Membrane preparation HEC/chitosan blend membrane was prepared by solution casting method. The 1.5 wt.% solution of chitosan and the 5 wt.% solution of HEC were mixed separately. The different ratios of HEC/chitosan blend membranes were prepared by physically mixing both solutions. The blend membrane solution was stirred for 24 hours. The prepared polymeric membrane solution was cast on a poly(methyl methacrylate) surface and dried at ambient conditions. Chemical bond structure of HEC/chitosan blend membrane was characterized by FTIR. Furthermore, the thermal stability of the HEC/chitosan blend membrane was investigated by thermogravimetric analysis (TGA) by using a Mettler Toledo thermal analyzer. Blend membrane samples were heated from 25 oC to 600 oC at a heating rate of 50 oC/min. 2.3 Pervaporation experiments The scheme of pervaporation process is shown in Fig. 1. Figure 1. Pervaporation scheme of PVCMR systemμ (1) agitator, (β) oven, (γ) membrane cell, (4) Dewar flasks, (5) vacuum pump ORAL PRESENTATION 197 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The volume of the membrane cell is 100mL and the effective membrane area is 9.62 cm2. DMC/methanol solution was fed to the feed side of membrane cell and was mixed with an agitator. The temperature control was provided by using an oven. The vacuum pump was used to reduce the pressure down to 20 mbar in permeate side. The feed side pressure of the membrane is atmospheric pressure. This pressure differences facilitated the diffusion of components through the membrane. The permeated stream samples were collected in liquid nitrogen flask. Compositions of permeate were analyzed by an Agilent GC-7820A installed with FID and DB-1 column. The separation performance of pervaporation process was determined by flux and separation factor of components. Flux and separation factor formulas are given as below in Equation 1 and Equation 2, respectively: J= m A.t (1) α= Ya / Yb Xa / Xb (2) In Equation 1; J indicates the flux, m is the mass of the permeate, A is the membrane area and t is the time. α P represent the separation factor of the membrane. X and Y show the mass fractions of components in the feed and permeate and, a and b signify the methanol component and DMC component in the sample. 3. RESULTS 3.1 Membrane characterization Structure of HEC/chitosan blend membrane was determined by Fourier transform infrared spectroscopy (FTIR). Figure 2 shows the FTIR spectra of the blend HEC/chitosan membrane. Figure 2. FTIR spectra of HEC/chitosan blend membrane (7:3 ratio of HEC/chitosan blend) The 1580.8 cm-1 band of the HEC/chitosan blend membrane can be assigned to the stretching vibration of −C=O in–NH3+−OOCCH3 of chitosan acetate salt. The band of the 1038 cm -1 band is attributed to the stretching vibrations of C–O bonds (Chanachai et al., 2000). The peaks in the 1650.9 cm -1 and 1364.9 9 cm-1 are assigned to the NH3+ deformation in chitosan and –OH deformation in HEC occurring on blending the chitosan and HEC polymers (Sridhar et al., 2005). The TGA confirms the thermal stability of the HEC/chitosan blend membrane. Figure γ shows the TGA profile of the membrane. ORAL PRESENTATION 198 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 3. TGA curves for the HEC/chitosan blend membrane The TGA of HEC/chitosan blend membrane shows the mass loss due to the water molecules within a temperature range of 100–200oC. The weight loss in the temperature range of 200-300oC is related to the evaporation of small molecules such as acetic acid. The last mass loss was seen between 300-600oC is due to the decomposition of the chitosan and HEC. TGA results show that the HEC/chitosan blend membrane has the stability to operation temperatures for the separation of methanol/DMC (Ghasemzadeh et al., 2016). 3.2 Pervaporation experiment 3.2.1 Effect of HEC ratio in the HEC/Chitosan blend membrane Polymer blending is an efficient technique for modification of the pristine membrane. In this study, HEC was introduced to modify the chitosan membranes. Figure 4 shows the effect of HEC ratio in blend membranes on separation performance for DMC/MeOH azeotropic mixture at 50◦C. Figure 4. Effect of HEC ratio in the HEC–chitosan blend membrane on PV performances for 70 wt. % methanol at 50◦C (a) total flux (b) methanol selectivity. The obtained results show that the total flux increases with an increase in HEC ratio. The separation factor decreases with HEC ratio. Methanol affects the swelling properties of the membrane due to the close solubility parameter of the HEC polymer. Hydrophilicity of membrane increases with an increase in HEC ratio. Methanol has close polarity value with water. Therefore, an increase in the HEC ratio leads to higher affinity and resulting in increased permeation. High HEC ratio results in more flexible polymer networkν chain mobility increases and diffusion facilitates by large free volume (Zhou et al., 2014, Chanachai et al., 2000). When the blend membrane contains 70 wt. % HEC and 30 wt.% chitosan, the membrane shows the highest total flux of 0.014β kg/m2.h. It is also seen from Figure 4 that the flux value tends to unchangeable above 70 wt.% HEC. ORAL PRESENTATION 199 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3.2.2 Effect of methanol ratio in feed mixture The variation of pervaporation performance over different methanol ratio in feed mixture at 50oC was investigated using the blend membrane of 70 wt.% HEC. Figure 5 shows the effect of methanol ratio on pervaporation separation performance. Figure 5. Effect of methanol ratio in feed mixture on PV performances for 70 wt. % HEC at 50◦C (a) total flux (b) methanol selectivity. The total flux increased and the separation factor decreased with methanol ratio increasing in the feed mixture. These could be explained by that the free volume and swelling degree of membrane increased significantly with methanol ratio in the feed. The swollen membrane becomes more flexible and methanol can be diffuse easily through the membrane. Diffusion of DMC is difficult into the membrane because of its molecule size, but it easily penetrates with methanol through the swollen membrane. Therefore, the increased swelling has an unfavorable effect on the selectivity value. The total flux increases while the methanol selectivity decreases (Chen et al., 2008, Jiraratananon er al., 2002, Sridhar er al., 2005, Zhu et al., 2013). Furthermore, the increasing feed methanol ratio also enhanced the partial pressure difference between the upstream side and the downstream side. This differences creates the driving force for the permeation, and flux increased (Zhu et al., 2013). 3.2.3 Effect of operation temperature Temperature has an important effect on permeation flux and separation factor, because all steps of pervaporation process are influenced the temperature. The effect of operation temperature on the flux and selectivity is shown in Figure 6. Figure 6. Effect of operation temperature in the HEC–chitosan blend membrane on PV performances for 70 wt. % HEC, 10 wt. % methanol in feed (a) total flux (b) methanol selectivity. It can be seen from Figure 6 that total flux increased and selectivity decreased by temperature. The driving force and the free volume increased with an increase in operation temperature. Higher temperature encourages the motion of the polymer chains, the free volume of membrane increases and diffusion of molecules facilitates ORAL PRESENTATION 200 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org through the membrane (Zhou et al., 2014). Furthermore, the saturated vapor pressure of feed mixture increases with increasing the operation temperature, and the vapor pressure at the permeate side remains constant. The driving force increases for mass transfer. As a result, the diffusion of methanol and DMC increased, and this led to higher flux but lower methanol selectivity (Chen et al., 2008, Zhu et al., 2013). 5. CONCLUSION A HEC-chitosan blend membrane was successfully fabricated to separate methanol from a DMC solution. HECchitosan blend membranes were prepared by solution casting and solvent evaporation methods. The effects of membrane composition (HEC ratio), feed composition (methanol ratio) and operating temperature on the membrane performance were investigated. Higher temperature, higher HEC ratio, and higher feed methanol ratio resulted in higher membrane swelling. Swollen membrane greatly improves the flux and decreases the selectivity. The highest flux was found to be 0.0142 kg/ m 2h at 90 wt % HEC ratio in the membrane for 70 wt % of methanol ratio in the feed at 50oC. Maximum methanol selectivity was also observed as 28.25 at 70 wt % HEC ratio in the membrane for 10 wt % of methanol ratio in the feed at 30oC. The obtained results indicated that the HEC-chitosan blend membrane should be used to separate DMC-methanol mixtures. Therefore, the developed HEC-chitosan blend membrane is a promising candidate for purification of DMC from methanol. ACKNOWLEDGEMENTS This study was supported financially by the Kocaeli University Scientific Research Projects Unit. REFERENCES Chanachai A, Jiraratananon R, Uttapap D, Moon GY, Anderson WA, Huang RYM 2000. Pervaporation with chitosan/hydroxyethylcellulose (CS/HEC) blended membranes. J Journal of Membrane Science, 166: 271–280. Chen JH, Liu QL, Zhu AM, Zhang QC, Fang J 2008. Pervaporation separation of MeOH/DMC mixtures using STA/CS hybrid membranes. Journal of Membrane Science, 315: 74-81. Ghasemzadeh H, Mahboubi A, Karimi K, Hassani S 2016. Full polysaccharide chitosan-CMC membrane and silver nanocomposite: synthesis, characterization, and antibacterial behaviors. Polymers for Advanced Technologies, 27: 1204–1210. Jiraratananon R, Chanachai A, Huang RYM, Uttapap D 2002. Pervaporation dehydration of ethanol–water mixtures with chitosan/hydroxyethylcellulose (CS/HEC) composite membranes I. Effect of operating conditions. Journal of Membrane Science, 195: 143–151. Liu YL, Su YH, Lee KR and Lai JY 2005. Crosslinked organic–inorganic hybrid chitosan membranes for pervaporation dehydration of isopropanol–water mixtures with a long-term stability. Journal of Membrane Science, 251: 233–238. Smitha B, Suhanya D, Sridhar S, Ramakrishna M 2004. Separation of organic–organic mixtures by pervaporation a review. Journal of Membrane Science, 241: 1-21. Sridhar S, Ganga D, Smitha B, Ramakrishna M 2005. Dehydration of 2-Butanol by Pervaporation Through Blend Membranes of Chitosan and Hydroxy Ethyl Cellulose. Separation Science and Technology, 40: 2889–2908. Wang L, Han X, Li J, Zhan X, Chen J 2011. Separation of Azeotropic Dimethylcarbonate/Methanol Mixtures by Pervaporation: Sorption and Diffusion Behaviors in the Pure and Nano Silica Filled PDMS Membranes. Separation Science and Technology, 46: 1396–1405. Won W, Feng X, Lawless D 2002. Pervaporation with chitosan membranes: separation of dimethyl carbonate/methanol/water mixtures. Journal of Membrane Science, 209: 493–508. Zhou H, Lv L, Liu G, Jin W, Xing W 2014. PDMS/PVDF composite pervaporation membrane for the separation of dimethyl carbonate from a methanol solution. Journal of Membrane Science, 471: 47-55. Zhu T, Li Z, Luo Y, Yu P 2013. Pervaporation separation of dimethyl carbonate/methanol azeotrope through cross-linked PVA–poly(vinylpyrrolidone)/PAN composite membranes. Desalination and Water Treatment, 51: 5485-5493. ORAL PRESENTATION 201 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Gaziantep İl Merkezi ve Çevre Florasının Hemerobik Açıdan İncelenmesi Mustafa Pehlivan1*, Necattin Türkmen2 1 Gaziantep Ünüversitesi, Nurdağı MYO, Bitkisel ve Hayvansal Üretim Bölümü, Gaziantep/TÜRKİYE 2 Çukurova Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, Adana/TÜRKİYE Corresponding author e-mail: mpehlivan27@hotmail.com Özet Bu çalışma, nüfus ve sanayi bakımından ülkemizin en büyük kentlerden biri olan Gaziantep’in, il merkezi ve çevresindeki köylerinin florası incelenerek, hemerobi (doğallık derecesi) açısından değerlendirilmesi amacıyla yapılmıştır. Çalışma kapsamında β00λ-β011 yılları arasında il merkezi ve çevre köylerini kapsayan β15 örnek parsel belirlenmiş ve bu alanlarda bulunan floristik yapı ortaya konulmuştur. Çalışma sonucunda, alanda toplam 87 familya ve β58 cinse ait tür ve tür altı seviyede γλ5 takson tespit edilmiştir. Bu taksonlardan 18’i endemik olup toplam tür sayısı içerisinde egzotik ve dikili-doğal türlerin sayısı 11λ’dur. IUCN Tehlike kategorilerine göre endemik taksonların β’si CR, 4’ü VU, 1β’si ise LR kategorisindedir. Örnek parsellerde tespit edilen floristik yapı, TWINSPAN Multivariate istatistik programında, taksonların parsellerde bulunma/bulunmama durumuna göre analize edilmiş ve bunun sonucunda 7 farklı bitki grubu elde edilmiştir. Ayrıca, alandaki floristik içeriğe bağlı olarak 17 farklı biyotop tipi tespit edilmiştir. Tespit edilen taksonların, ait olduğu alanların floristik yapılarının hemerobi skalasındaki yerleri belirlenmiştir Yapılan çalışma sonucunda alandaki floristik kompozisyonun yüksek oranda sinantropik özellik gösterdiği tespit edilmiştir. Anahtar Kelimeler: Gaziantep, flora, biyotop, hemerobi. 1.GİRİŞ Bir ekosistem, sadece bir coğrafi birim (veya ekobölge) değil, aynı zamanda belirli girdileri ve çıktıları bulunan, sınırları doğal ya da isteğe bağlı olarak belirlenebilen, işlevsel bir sistem birimidir (Odum ve Barrett, 2008). Uygulamalı Ekolojinin bir alt dalı olarak ortaya çıkan kentsel ekolojinin (urban ekoloji) başlıca amacı, kentlerin ve kentleşmenin doğal çevre üzerindeki doğrudan veya dolaylı etkilerini incelemektir (Kocataş, 1λλ4). Kentler, küresel ölçekte dünyanın %γ’lük bir alanını kaplamasına rağmen (MAE, β005), kentsel gelişim, mevcut peyzaj düzeyinde büyük dönüşümü teşvik eder ve biyoçeşitlilik için büyük bir tehlike olarak kabul edilir. Çünkü kentsel gelişim biyoçeşitliliğin korunması için büyük zorlukları barındırır (Antrop, β004ν Hansen ve ark., β005). İnsanların ekosistem üzerinde meydana getirdiği değişikliklerin en bariz olarak ortaya çıktığı alanlar kent merkezleri ve civar alanlarıdır (Alberti ve ark., β00γ). Bu etkilerden biri olan kentsel alanlarda yoğun toprak kullanımı, flora, fauna, biyosenöz ve habitatların nicel ve nitel koşullarının önemli ölçüde kaybına neden olmaktadır (Tüxen, 1λ61ν Sukopp, 1λ76). Kent ekolojisi kapsamında yapılan çalışmalarda insan faktörünün etki alanının ve derecesinin ortaya konması ve gerekli önlemlerin alınabilmesi için, özellikle 1λ50’li yıllardan sonra, “Hemerobi” adı verilen bir kavram adı altında çalışmalar yoğunlaşmaya başlamıştır. Bu konu ile ilgili yapılan çalışmalarν insanoğlunun kentleşme faaliyetleri sonucu, doğal çevre üzerinde oluşturduğu tahribatın derecesini ortaya koymayı amaçlamaktadır. Doğal çevre üzerindeki değişimleri derecesi, söz konusu bölgenin “hemerobi” sinin bir kriteri olarak görülebilir. “Hemerobi” terimi ile “insanların ekosistemler üzerine isteyerek veya istemeyerek olan tesirlerinin tamamı” anlaşılır. Biyotopların hemerobi cetvelindeki düzeni içinν tek yıllık türlerin oranları, geçmiş zamanlarda göç etmiş bitki türlerinin (neofit) miktarları ve doğal flora türlerinin kaybı gibi parametreler önemlidir ve bunlar göz önüne alınır (Kowarik,1λλ8). ORAL PRESENTATION 202 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Çevre üzerindeki insan kaynaklı değişimler, özellikle kent ortamlarında kısaca gradient olarak adlandırılan ve çevre üzerine etkisi bulunan her bir değişkenin miktarını veya şiddetini etkilemektedir. Bu değişkenler özellikle kent ortamlarında çok daha hızlı ve etkili sonuç vermektedir. Kentlerde, toprağın, havanın, nemin ve canlı çevre üzerine etkisi olan diğer tüm parametrelerin değişiminin temel belirleyicisi çoğu zaman insan ve insan kaynaklı etkilerdir. Kentlerde gelişen tohumlu bitkiler, kent vejetasyonun aslî üyeleridir. Öyle ki, tohumlu bitkiler dışında, kent vejetasyonunda yer alan başka bitkiler pek seyrektir. Kent ortamlarında, civardaki doğal çevreye ve bilhassa da ormanlara göre kilometrekarede daha fazla tür bulunmaktadır. Bunun nedenleri, her şeyden önce özellikle bu tohumlu bitkilerin gelişmiş su kullanım kabiliyetleri ve baskılara (antropojenik vs.) karşı olan adaptasyon kabiliyetleridir. Bununla birlikte, bütün tohumlu bitki türlerinin, şehir şartlarına aynı şekilde adapte olabildiklerini söylemek de mümkün değildir. Çünkü şehir florasının geliştiği ve varlığını idame ettirdiği ortam, şehir civarındaki doğal ortamlardan oldukça farklıdır (Hodgson, 1986; Altay, 2009). Hemerobi kavramının belirli ölçekler üzerinden açıklanmasının daha doğru olacağı düşüncesi ile antropojenik etkilerin derecesini belirten 0-1 aralığında 11 farklı skalalı bir hemerobi cetvel ortaya konmuştur (Jalas, 1955). Bu araştırmada, Gaziantep kentsel ve kırsal alanlarındaki insan etkisinin biyotop çeşitliliğine ve floristik yapıya ne şekilde etki etttiği ve bu etkinin bitki örtüsünün yapısını belirlemede rol oynayıp oynamadığı tespit edilmeye çalışılmıştır. 2.MATERYAL VE METOD Materyal Araştırma alanı olan Gaziantep ili, Akdeniz Bölgesiyle Güneydoğu Anadolu Bölgesi'nin birleşme noktasında yer almakta olup γ6° β8' ve γ8° 01' doğu boylamları ile γ6° γ8' ve γ7° γβ' kuzey enlemleri arasında bulunmaktadır. Gaziantep ili 6.βββ km²'lik alanıyla Türkiye topraklarının yaklaşık olarak % 1'lik bölümünü kapsamaktadır. Kentin merkez nüfusu 1λ. Yüzyıl sonlarına doğru yaklaşık 15.000 iken (Şıvgın, β000), β000 yılında toplam nüfus 1.β85.β4λ’e ulaşmıştır. Çalışma alanının denizden ortalama yükseltisi 850 metre olup Maraş, Halep, Urfa’dan Akdeniz’e kadar uzanan önemli yolların kesişme noktası üzerinde önemli bir yerleşim yeri, kültür ve ticaret merkezidir. Dünyanın en eski yerleşim yerleri (M.Ö. 5600 ) arasındadır (Anonim, β010). Gaziantep Meteoroloji İstasyonu iklimsel verilerine göre uzun yıllara ait ortalama sıcaklık değeri 15.0β oC’dir. En sıcak ayın maksimum sıcaklık ortalaması β7.λ °C ve en soğuk ayın minimum sıcaklık ortalaması -0.3 °C’dir. Yıllık ortalama yağış toplamı 56β.6 mm’dir. Kurak devre Mayıs-Ekim aylarını kapsamaktadır (Şekil γ). Metod Gaziantep il merkezi ve çevre köylerinin floristik yapısının hemerobi kavramı ışığında irdelenmesi amacıyla β00λ-β011 yılları arasında arazi çalışmaları yapılmıştır. Kent merkezinde 370.0γ” kuzey ve γ70.ββ” doğu enlemlerinden Güney yönüne doğru γ6 0.55” kuzey ve γ70.β1” enlemlerine kadar 15 km boyunda bir transekt seçilmiştir. Kent merkezinden γ70.0γ” kuzey ve γ70.ββ” doğu enlemlerinden Doğu yönünde γ7 0.04” kuzey ve 370.γ7” doğu enlemlerine kadar β1.8 km’lik bir transekt belirlenmiştir. Kent merkezinden γ7 0.04” kuzey ve 370.ββ” doğu enlemlerinden Kuzey yönünde γ7 0.1β” kuzey ve γ70.βγ” enlemlerine kadar 16.γ km’lik bir transekt ve son olarak kent merkezinde 37 0.0γ” kuzey ve γ70.ββ” doğu enlemlerinden Batı yönüne doğru 370.04” kuzey ve γ70.11” doğu enlemlerine kadar 16.γ km’lik bir transekt seçilmiştir (Şekil β.). ORAL PRESENTATION 203 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 1. Araştırma alanına ait ombro-termik iklim diyagramı Şekil 2. Çalışma alanında belirlenen transektler ve bilinçli seçilen biyotoplar Çalışma alanının floristik karakterinin hemerobi dereceleri Tablo 1’de verilen 11 skalalı ölçeğe göre değerlendirilmiştir (Jalas, 1λ55ν Sukopp, 1λ76ν Kowarik, 1λ88ν Kowarik 1λλ0). Çalışmalarda toplana bitki örnekleri Türkiye Florası ile ilgili temel kaynaklara göre teşhis edilmiştir (Davis, 1λ65-1λ88ν Güner ve ark., 2000). 3.BULGULAR Araştırma alanının tümünde (doğal-kentsel alanlarda) doğal yayılış gösteren 60 familyaya ve 1λ1 cinse ait β86 tür ve tür altı takson belirlenmiştir. Kentsel alanda ise, dikili taksonlar veya egzotik flora olarak tabir edilen 50 familya, 86 cins ve 11λ tür ve tür altı takson yer almaktadır. Bu iki alana ait flora üyelerinden β1 familya 17 cins ve 8 takson hem doğal florada hem de kent içi açık-yeşil alanlarda ortak olarak temsil edilmektedir. Toplam olarak alanda 8λ familya ve β60 cinse ait γλ7 takson tespit edilmiştir. Araştırma alanındaki doğal olarak yayılış gösteren türlerin en çok takson içeren familya ve cinsleri şöyledirμ Asteraceae % 15 (4β), Lamiaceae %9 (25), Fabaceae %7 (21), Poaceae %6 (17), Rosaceae %5 (15), Brassicaceae %5 (1γ), Boraginaceae %5 (1γ) ve diğer 5γ familyanın toplamı ise %4λ (140)’luk bir orana sahiptir. En çok türe sahip olan cinsler ise şu şekildedirν Salvia (6), Astragalus (5), Euphorbia (5), Trifolium (5) ve Verbascum (5) tür ile temsil edilmektedir. ORAL PRESENTATION 204 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tablo 1. Hemerobi dereceleri ve muhtemel biyotop tipleri (Jalas, 1955; Sukopp, 1976; Kowarik, 1988; Kowarik 1990) Hemerobi Basamağı H0 ahemerob %0 NDP=0.0 H1 oligohemerob %10 NDP=0.1 H2oligomesohemerob %20 NDP=0.2 H3 mesohemerob %30 NDP=0.3 H4 mesoίeuhemerob %40 NDP=0.4 H5 ί-euhemerob %50 NDP=0.5 H6 ί-eu-a-euhemerob NDP=0.6 H7 a- euhemerob %70 NDP=0.7 H8 a-eu-polyhemerob %80 NDP=0.8 H9 polyhemerob %90 NDP=0.9 %60 Metahemerob %100 NDP=1.0 Bulunduğu Yerler/Vejetasyon Antropojenik aktivitelerden etkilenmemiş veya insan aktivitelerine maruz kalmamış bir ekosistem Tesir görmemiş sık ormanlar, Bataklıklar, kayalık deniz kenarı vejetasyonu Geniş kapsamlı, sulardan arındırılmış nemli bölgeler. Odunsu türleri az olan alanlar, bazı nemli çayırlıklar Sık kullanılan ormanlar, bozulmamış ikincil ormanlar, antropojen bölgelerdeki otlaklar, geleneksel olarak kullanılan çayırlar Tek ağaç türünden oluşan ve müdahale edilmiş kültür korulukları (örnν hatıra ormanı), ikincil ormanlar, örtü vejetasyonu ruderalize edilmiş kuru çayırlar Genç ormanlar, sık çayırlar ve otlaklar, ruderal yüksek çalı vejetasyonu, antropojen alanlardaki kuvvetli ruderalize edilmiş kuru çayırlar Tek ağaç türünden oluşan ve müdahale edilmiş geleneksel segetal vejetasyon, üstüne basılan çimler, ruderal çayırlar, Yoğun tarım faaliyetleri olan alanlar ve bahçeler Kuvvetli ilaçlanmış tarla vejetasyonu, ruderal öncül vejetasyon, üzerine basılan tek yıllık otsu türler. Tren yolu kenarlarındaki öncül vejetasyon, çöp dökülen yerler, tuz dökülmüş karayolları, moloz atıklarının olduğu yerler, Vejetasyonda vasküler bitkiler yoktur. Taksonların fitocoğrafik bölgelere göre dağılımındaν İran – Turan 69 takson (%24.1), Akdeniz 46 takson (%16.1), Avrupa-Sibirya 10 takson (%γ.5), kozmopolitler ve bilinmeyenler 5 takson (%56.γ) ‘dir. Çalışma alanının İran-Turan ve Akdeniz fitocoğrafik bölgelerinin kesiştiği bir alanda bulunması nedeniyle her iki bölgeye ait taksonların %40’lık bir oranda olması doğaldır. Araştırma alanındaki bitkilerin hayat formları dağılışında Hemikriptofitler %45, Terofitler %γ1, Fanerofitler %1β, Kriptofitler %λ ve Kamefitler %γ ile temsil edilmektedir. Toplam floranın 18’i (%5) endenmik taksonlardır. Bu endemik taksonlardan Satureja aintebensis ve Centaurea haussknechtii Türkiye Bitkileri Kırmızı kitabına (Ekim ve ark., β000) göre “CR” (Çok Tehlikede) kategorisinde olduğundan özellikle korunması gereken taksonlardır. Çalışma alanında tespit edilen toplam takson sayıları içerisinde, doğal olarak yayılış gösteren taksonlar β86 (%71), dikili taksonlar olarak bulunan ancak aynı zamanda ülkemiz florasında da doğal yayılış gösteren taksonlar 59 (%14) ve egzotik taksonlar 60 (%15) olarak tespit edilmiştir. Özatlı, (β00λ) yaptığı çalışmada Balıkesir kent merkezinin florasını araştırmış ve bu alandaki egzotik türlerin toplam türlere oranını %1β olarak tespit etmiştir. Göktürk (1λλ4), Antalya’nın florasını çalışmış ve alandaki egzotik taksonların toplam taksonlara oranının %16 olduğunu belirtmiştir. Yapılan çalışmada, doğal yayılış gösteren β86 taksonun en çok takson içeren familya ve cinsleri şu şekildedirμ Asteraceae % 15 (4β), Lamiaceae %λ (β5), Fabaceae %7 (β1), Poaceae %6 (17), Rosaceae %5 (15), Brassicaceae %5 (1γ), Boraginaceae %5 (1γ) ve diğer 5γ familyanın toplamı ise %4λ (140)’luk bir orana sahiptir. En çok türe sahip olan cinsler ise şu şekildedirν Salvia (6), Astragalus (5), Euphorbia (5), Trifolium (5) ve Verbascum (5) tür ile temsil edilmektedir. Doğal flora elamanlarının fitocoğrafik bölge dağılımı şu şekildedirν İran-Turan elementlerinin 69 takson (%β4) hâkimiyeti görülmektedir. Akdeniz elementleri (Doğu Akdeniz dâhil) 46 takson (%16) ile ikinci, AvrupaSibirya elementleri 10 takson (%γ) kozmopolit taksonlar 5 takson (%β) ve son olarak bölgesi bilinmeyen taksonlar veya çok bölgeli 156 (%55) taksondur. Çalışma alanının İran-Turan ve Akdeniz fitocoğrafik ORAL PRESENTATION 205 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org bölgelerinin kesiştiği bir alanda bulunması nedeniyle her iki bölgeye ait taksonların %40’lık bir oranda olması doğaldır. Çalışma alanında dikili ve egzotik türler haricinde doğal olarak yayılış gösteren taksonların hayat formlarının yüzde dağılışları ise şu şekildedirν Hemikriptofitler (%45), Terofitler (%γ1), Fanerofitler (%12), Kriptofitler (%λ) ve Kamefitler (%γ) ile temsil edilmektedir. Kent içerisinde özellikle fanerofitlerin doğal olarak yayılış göstermesine engel olan birçok antropojenik faaliyet (yapılaşma ve ulaşım), aynı zamanda zamanda toprağın hem mekanik hem de fiziksel yapı bakımından yoğun baskı altında olması nedeniyle kriptofitlerinde bu tip alanlarda düzenli olarak yayılışına müsaade etmemektedir. Alanda tespit edilen floristik kompozisyondaki taksonların hayat formları bazında karşılaştırma yapıldığında ise, açık bir şekilde hemikriptofitlerin ve terofitlerin hayli yüksek oranlarda temsil edildiği görülmektedir. Yalnızca Quercus coccifera L. bitki topluluğunda Fanerofit hayat formuna ait taksonlarında belli bir ağırlığı (%β5) sözkonusudur. Alanın maki formasyonu olması nedeniyle de bu sonuç doğaldır. Çalışma alanı gerek coğrafi olarak gerekse iklim yapısı olarak İran-Turan Fitocoğrafik Bölgesi ile Akdeniz fitocoğrafik bölgesinin kesiştiği bir konumdadır. Alan, bir yönüyle (Güney ve Batı) Akdeniz bölgesinin özelliklerini göstermekle beraber diğer taraftan ilin kuzey ve doğu kısımları Yarı Karasal iklim tipinin tesiri altındadır. Ancak son yıllarda özellikle Fırat nehri ve üzerinde kurulu barajların bölgenin ikliminde tesiri olduğu söylenebilir. Nitekim uzun yıllara dayalı meteorolojik kayıtlarda, ilin β0-γ0 yıl öncesine kadar daha fazla kar yağışı aldığı ve sıcaklığın 0 oC’nin altına düştüğü günlerin daha fazla olduğu bilinmektedir. Fitocoğrafik bölge dağılımlarında bölgesi bilinmeyen taksonlar kent ortamında yaklaşık %50 civarında olmaktadır. Bu durumun nedeninin yukarıda bahsedildiği üzere kent ortamlarının habitat koşullarının sadece belli bazı türlere (Urbanofil veya Urbanonötr) müsaade etmesi olduğunu düşünmekteyiz. İran-Turan ve Akdeniz Fitocoğrafik bölge elementlerinin oransal olarak birbirine yakın bir şekilde karışım oluşturduğu alanlar, çalışma alanının doğala yakın alanlarıdır. Çalışmamızda tespit edilen toplam γλ7 taksonun 18’i endenmik taksonlardır. Bu endemik taksonlardan Satureja aintebensis ve Centaurea haussknechtii Türkiye Bitkileri Kırmızı kitabına (Ekim ve ark., β000) göre “CR” (Çok Tehlikede) kategorisinde olup özellikle korunması gereken taksonlardır. Bu nedenle alan ayrı bir öneme sahiptir. Bu taksonlardan Satureja aintebensis türüne diğer bazı araştırmacılar tarafından Gaziantep ili Sakçagözü ilçesinde rastlanmış ve çalışmamız kapsamında Aktoprak beldesi ve Organize Sanayi Bölgesi ile tarihi Dülük Köyü arkasındaki tepeliklerde tespit edilmiştir. Alanda tespit edilen Arum balansanum, Euphorbia anacampheros var. tmolea, Symphymtum aintabicum ve Verbascum diversifolium taksonları “VU” (Zarar Görebilir) kategorisinde olup yine korunma konusunda dikkatli olunması gereken türlerdir. Bu kategorideki tüm taksonlar alanın doğala yakın kesimlerinden olan Sof dağı ve çevresinde bulunmaktadır. Alanda tespit edilen endemik taksonlardan “LR” (Az Tehdit Altında) kategorilerisinde olanlarν Acanthus hirsutus, Centaurea tomentella, Tanacetum argenteum subsp. argenteum, Astragalus aintabicus, Astragalus leporinus var. hirsutus, Lathyrus elongatus, Crocus biflorus subsp. pseudonubigena, Phlomis armeniaca, Salvia pisidica, Stachys cretica var. mersinae, Helleborus vesicarius ve Sideritis condensata’dır. Bitki Toplulukları Günümüzde, flora ve vejetasyon çalışmalarında klasik metodların yanı sıra bu alanlarla ilgili verilerin istatistiksel olarak değerlendirilmesine olanak sağlayan bilgisayar programlarının kullanımı giderek artmaktadır. Bu nedenle çalışmamızda da bu istatistik programlarından TWINSPAN (Two-way indicator species analysis) programı kullanılarak türlerin örnek parsellerde bulunma veya bulunmama durumlarına göre bu örneklik alanlar gruplandırılmaya çalışılmıştır. 4’lü dallanma temeline dayanan analiz sonucunda ortaya 7 farklı grup çıkmıştır (Şekil γ). Toplam β15 örnek parsele ait flora verileri analiz edilmiş ancak β08 örnek parsel bu gruplarda kümelenmiştir. 7 örnek parselin ise ortaya çıkan bu 7 grupta yer edinecek özellikte olmadığı anlaşılmıştır. ORAL PRESENTATION 206 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 3. Araştırma alanındaki örneklik alanların floristik yapısının Twinspan yöntemi ile bulunma sınıfına göre dağılımı gösteren dendrogram TWINSPAN Grup A Topluluk, alandan toplam 17 örneklik alan seçilerek bu örneklik alandan Nisan-Temmuz ayları arasında yapılan arazi çalışmaları sonucunda toplanan ve kaydedilen bitki örneklerinin teşhisi sonucunda tanımlanmıştır. Bölgede Sof Dağı olarak adlandırılan ve çalışma alanındaki topografyanın (1486 m.) zirve yaptığı bu alan bölgenin floristik içerik bakımından en zengin bölgesidir. Alanın hakim vejetasyon yapısı Quercus cocciferaPistacia terebinthusbitki toplulukları olmasına rağmen, bölge, Styrax officinalis, Rhamnus aleternus, Rhamnus oleoides, Crateagus monogyna, Crateagus orientalis, Phyllarea latifolia ve Lonicera etrusca gibi taksonlarında geniş yayılış gösterebildiği bir alandır. Çalışma alanında Sof dağı kadar olmasada hala maki formasyonunun özelliklerini gösteren bir diğer alan olan ilin kuzeyindeki, Karacaören ve Göksuncuk köylerinin tepelikleri, giderek bölgede hızla genişleyen Organize sanayi bölgesinin baskısı altına girmektedir. Bu alanda da yer yer maki formasyonuna ait taksonlar (Quercus coccifera, Pistacia terebinthus, Rhamnus oleoides, Crateagus monogyna) kendilerini muhafaza edebilmişlerdir. Topluluğun alanı floristik içerik ve antropojenik etki açısından alanların hemerobik skala içerisindeki yeri H5 ß-euhemerob derecesindedir. Topluluktaki taksonlardan örnek parsellerde bulunma sıklığı en fazla olanlarν Quercus coccifera L. 17 (%90), Pistacia terebinthus L. subsp. palaestina, 15 (%79), Crataegus monogyna subsp. monogyna, 9 (%47), Paliurus spina –christi 9 (47), Rhamnus oleoides subsp. graecus 8 (%42), Styrax officinalis 8 (%42), Phillyrea latifolia 7 (%37), Lonicera etrusca var. etrusca 7 (37) ve Rubus sanctus 7 (%37) örnek parselde tespit edilmiştir. TWINSPAN Grup B Çalışma alanında Grup B’nin kapsadığı örneklik alanlar kentsel alanlardaki yapılar arası boşluklar ile anropojenik aktivitenin yoğun olduğu (bağ evleri, tarım arazileri, yol kenarları) kırsal alanlardır. Bu tip alanlara urbanofob taksonların dahil olması mümkün olamadığı gibi kentin sınırlarındaki alanlarda bulunan urbanofob taksonlar gün geçtikçe insan kaynaklı baskılara maruz kalmaktadır. Her ne kadar il merkezinde farklı fonksiyon alanları bulunsa da tüm bu alanlardaki floristik yapı, ekolojik istekleri bakımından benzer özellik gösteren urbanofil taksonların varlığıyla karakteristiktir. Yapılan istatistiksel analizde 154 örnek parsel Grup B’de kümelenme göstermiştir. Büyük bir kısmı kentsel alanlara ait olan 154 örnek parselde doğal yayılış gösteren toplam 161 tür ve tür altı takson bulunmaktadır. Kent merkezinde doğal yayılış gösteren 4β familyaya ait bu taksonların hemen hemen üçte biri 5β (%γβ) Asteraceae, Poaceae ve Brassicaceae familyalarına aittir. ORAL PRESENTATION 207 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Taksonların örnek parsellerde bulunma durumları, yapılan istatiksel analizde ortaya çıkan grupları açıklamada önemlidir. Bu nedenle, yapılan analizde Grup B’de kümeleşme gösteren örnek parsellerin floristik yapısı aynı zamanda bu alanlarla ilgili bir kısım ekolojik özellikler konusunda bazı bilgileride bize verebilmesi açısından önemlidir. Bu nedenle 154 örnek parselin kümeleşme gösterdiği alanlarda bulunma sıklığı β0 parselden fazla olan taksonlar ele alınmıştır. Toplam β0 parsel ve üzerinde bulunma sıklığına sahip olan takson sayısı γβ’dir. Bu taksonlar içerisinde de bulunma sıklığı en fazla olan taksonlar, Chenopodium album L. subsp. album 59 (%38), Cynodon dactylon (L.)Pers. var. dactylon 50 (%32), Cardaria draba (L.) Desv. subsp. draba 43 (%28), Hordeum murinum L. subsp. murinum 43 (%28), Cichorium intybus L. 41 (%27), Echium italicum L. 40 (%26) ve Sisymbrum officinale (L.) Scop. 40 (%β6) şeklindedir. Kentsel habitatlara ait bu örnek parsellerin floristik içerikleri, alanın hemerobi skalasındaki yerini Hλ polyhemerob, H8 a-eu-polyhemerob H7, a- euhemerob olarak değerlendirmemize sebep olmuştur. Çünkü alanda tespit edilen taksonların örnek parsellerde bulunma sıklığına göre yapılan istatistiksel analizde 154 örnek parselin Grup B’de toplanmış olması bu 154 alanın bazı kesimlerini farklı hemerobik skalada değerlendirmemize sebep olmuştur. Şöyle ki, kent ortamlarında bir çok farklıkullanım alanları mevcuttur ve bu alanların her taksonu bulundurma durumu veya bulundursada geniş yayılış alanlarına yayılmasına izin vermesi aynı olamamaktadır. Bu durum, aslında kullanım alanının nüfus yoğunluğu, fonksiyon alanı, kullanım sıklığı gibi nedenlerden kaynaklanmaktadır. TWINSPAN Grup C Grup C’de toplam 1γ örnek parsel tanımlanmıştır. Alan, kent içerisinden geçen ve Şehitkamil ve Şahinbey ilçelerinin sınırının büyük kısmınıda oluşturan Allaben deresi ve çevresidir. Derenin kent merkezinden geçen büyük bir kesimi sağlısollu park alanlarıdır. Cumhuriyetin ilk yıllarında derenin merkezden geçen kesimi tamamen doğal akışında olup, dere kenarları bölge halkı tarafından mesire alanıolarak kullanılmaktaydı. Dere içerisinden geçen suyun zamanla kirlenmesinden ve civarına kötü koku yaydığı gerekçesiyle içerisi tamamen betonlaştırılmış ve neredeyse doğal türlerin yayılışı sonlandırılmıştır. Ancak kentin dış kesimlerine doğru dere kenarında bazı doğal taksonlar yayılış gösterse de bu taksonlar da yine çoğunlukla urbanofil taksonlardır. Özellikle son yıllarda Alleben deresinin kent dışındaki güzergahında, çevre yolunun yapılmasıve aktif olarak kullanılmasıyla birlikte dere yatağının betonlaştırılması hız kazanmıştır. Üstelik çevre yolunun kenarları için açık yeşil alan uygulaması ile birlikte özellikle yoğun olarak Nerium oleander L. dikimi yapılmıştır. Ayrıca derenin çevre yolu kenarından geçen kolu moloz atıklarıyla beslenmiş ve taşıma topraklar ve beton atıkları alanın toprağınının doğal yapısını bozmuştur. Ancak yine de Rhus coriaria, Capparis spinosa, Tamarix smyrnensis gibi bazı taksonlar dere kıyısında varlığını koruyabilmiştir. Alanda doğal, dikili doğal ve egzotik olmak üzere toplam 78 takson bulunmaktadır. Bu taksonlardan 7’si egzotik, γ’ü dikili 68’i ise doğal yayılış gösteren taksonlardır. Doğal yayılış gösteren taksonlardan Echium italicum 4 (%31), Silybum marianum, Cichorium intybus ve Malva sylvestris γ’er (%β1) örnek parselle alanda en sık rastlanan türlerdir. Bu alanın, il içerisindeki kalan kesimi, Hλ polyhemerob olarak değerlendirilsede, alanın il sınırlarına yakın alanlarındaki kesimleri H7 a-euhemerob olarak değerlenrilebilir. TWINSPAN Grup D Çalışma alanında tespit edilen taksonların örnek parsellerde bulunma sıklığına göre yapılan Twinspan analizinde gruplaşma yapan taksonlar alanda, mezarlıklar ve çevresinde bulunmaktadır. Çalışma alanında iki büyük mezarlık bulunmaktadır. Bunlardan ilki ve en eski olanı Asri Mezarlık’tır. Diğeri ise Yeşilkent Mezarlığı’dır. Bu habitatı diğer habitatlardan ayıran temel faktör hem odunsu hem otsu egzotik türlerin yoğun olarak kullanılmasının yanı sıra mezarlıkların kendi dinsel dokunulmazlıklarının getirdiği statik yapı bu alanlarda doğal flora üyelerinin de kendine yer bulabilmesidir. Öyle ki, bu mezarlıklarda, özellikle de uzun bir geçmişe sahip ORAL PRESENTATION 208 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Asri mezarlıkta, kent içerisinde kalmış olmasına rağmen şehrin yoğun antropojenik baskısı içerisinde doğal flora elemanlarının sığınabildiği ender alanlardan birisidir. Üstelik bu mezarlık alanlarında ilgili resmi birimlerin yaptığıpeyzaj düzenlemesinin yanı sıra her mezarlıkta, mezarlığa gelen ziyaretçilerin kendi yakınlarına ait mezarlıklarda mini bir açık yeşil alan düzenlemesi yapması bu biyotopların biyoçeşitliliğini arttırmaktadır. Bu bakımdan her ziyaretçi kendi zevkine göre getirdiği bitkileri veya tohumları alana dahil etmesiyle alanın tür sayısı suni olsa da artmaktadır. Grubun karakterize ettiği örnek parsel sayısı 8’dir. Mezarlık alanlarındaki odunsu taksonların tamamı dikili doğal veya egzotik taksonlardır. Örneklik alanlarda tespit edilen ve en sık karşılaşılan taksonlar; Pauwlonia tomentosa, Platanus orientalis, Pinus brutia, Pinus pinea, Cupressus sempervirens var. horizontalis, Cupressus sempervirens var. pyramidata, Cupressus arizonica, Thuja orientalis, Nerium oleander, Robinia pseudoacacia, Mirabilis jalapa, Yucca elephantipes, Syringa vulgaris, Viburnum opulus, Albizia julibrisin, jasminium mesnyi, Vitis vinifera, Morus alba ve Lonicera japonica’dır. Ancak, çalışma alanında, mezarlıkların yoğun müdahale edilmiş yapısında bazı spontan türler kendilerini bu alanlarda koruyabilmiştir. Bu taksonlar; Carduus nutans, Anemone coronaria, Trigonella coelasyriaca, Urtica dioica, Polygonum arenastrum, Hordeum murinum, Centaurea solstitialis, Carthamus persicus, Ixilorion tataricum, Malva neglecta, Alcea setosa, Alcea digitata, Galium verum, Muscari neglectum, Salvia multicaulis, Teucrium polium, Verbascum lasianthum ve Verbascum alepense’dir. Grup D’nin barındırdığı alanlar, büyük bir kısmı plantasyon da olsa ağaç ve çalı türlerinin çok oluşu, bu taksonların yanında bazı spontan türlerinde bu alanlşara dahil olmuş olması ve hatta bu alanların kent merkezinde çok sık rastlanmayan bazıkriptofit taksonlara yer vermesinden dolayı H5 ί-euhemerob olarak değerlendirilmesini sağlamıştır. TWINSPAN Grup E Yapılan istatistiksel analize göre bu Grup’ta karakterize olan örnek parsel sayısı λ’dur. Bu örnek parsellerin tamamı alandaki parklara aittir. Bu parklar, alan büyüklüğü bakımından kentin belli başlı parklarıdır. Kent ortamında bulunan bu parkların tamamı tek veya birkaç bitki türü ile karakterize olmayıp çoğunlukla birçok dikili veya egzotik bitki türü ile çeşitlendirilmiştir. Alandaki bu parklar, kent ortamının yoğun günlük aktivitelerinden bunalan halkın kendini dinlenme amacıyla bu alanlara sevk etmesi nedeniyle ayrı bir önem kazanmaktadır. Bu tip alanlarda genellikle çimlendirme çalışmaları nedeniyle doğal türlerin yayılışına çok fazla izin verilmemekte ve çimlendirme alanları dışındaki yerlerde ya eğlence alanları ya da yürüyüş parkurları yapılarak toprak yüzeyi örtülmektedir. Ayrıca parkların yeşil örtüsünün bakımı düzenli olarak yapıldığı için bizler için doğal, yerel yöneticiler için “yabani ot” olarak kabul edilen türler alandan temizlenmektedir. Bu parklarda doğal türler sadece parkların çimlendirme alanlarının sınır kesimlerinde kendilerine yer bulabilen bir kısım terofit karakterde taksonlardır. Çalışma alanındaki parklarda sık rastlanan doğal-dikili veya egzotik bitki türleriν Robinia pseudoacacia, Salix babylonica, Morus alba, Vitis vinifera, Hedera helix, Paulownia tomentosa, Viburnum opulus, Cupressus arizonica, Cupressus sempervirens var. horizontalis, Thuja orientalis, Rosmarinus officinalis, Rosa foetida, Cupressus macrocarpa, Juniperus sabina, Hibiscus syriacus, Hibiscus rosa-sinensis, Ailanthus aitissima, Tilia argentea, Acer negundo, Fraxinus angustifolia subsp. oxycarpa, Yucca elephantipes, Pyracantha coccinea, Cedrus libani, Abies cilicica subsp. cilicica, Picea pungens, Coteneaster horizontalis, Aesculus hippocastanum, Lonicera japonica, Laurus nobilis, Lagerstroemia indica, Magnolia grandiflora, Nerium oleander, Washingtonia filifera’dır. Grup E’ye ait örnek parsellerde sıklıkla rastlanılan doğal flora elemanlarıμ Senecio vulgaris, Vicia cracca, Trifolium pratense, Polygonum aviculare, Hordeum murinum, Poa annua, Taraxacum officinale, Plantago lanceolata, Tragopogon longirostris, Malva neglecta, Capsella bursa-pastoris’dir. Bu alanın genellikle dikili doğal veya egzotik taksonlarla ağaçlandırılmışpark alanlarının olması ve spontan türlerin sadece bu park alanlarının sınır kesimlerinde bulunması nedeniyle alan H7 a-euhemerob skalasında değerlendirilmiştir. Çünkü ildeki parklar zaten günlük olarak yoğun insan baskısıaltında ve alanda ORAL PRESENTATION 209 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org spontan türlere rutin olarak yetkililer tarafından yapılan bakım çalışmasıyla nedeniyle yaşam şansı tanınmamaktadır. TWINSPAN Grup F ve G Bu iki grubu aynı başlık altında toplamamızın sebebi her iki grubunda kent içerisindeki yapay ormanlık alanlara ait örnek parsellerden oluşmasıdır. Toplam 1β örnek parsel bu alanlara aittir. Çalışma kapsamındaki alanda irili ufaklı birçok yapay olmasına rağmen bunlardan en önde gelenleri Dülük Baba, Burç ve Gerciğin ormanlıklarıdır. Bu yapay ormanların tamamı tek türün dominantlığı üzerine kurulmuşken yer yer ikincil türlerin mevcudiyeti tespit edilmiştir. Bu alanlarda Pinus brutia dominant tür iken yer yer Pinus halepensis’e de rastlanmaktadır. Burç ormanlığı, diğer iki yapay ormanlık alanı olan Gerciğin ve Dülük Baba ormanlık alanından genel örtü olarak olmasa da orman altı örtüsü bakımından ayrılmaktadır. Aynı zamanda bu ormanlık bir yandan çevre yolu ile diğer yandan Gaziantep Üniversitesi kampüs alanı ile sınırlanmaktadır. Bu nedenle hem kentin neredeyse merkesinde kalması hem de içerisindeki yoğun antropojenik etkiler nedeni ile orman altı örtüsüne çok fazla izin vermemektedir. Hem hayvanat bahçesinin il içerisinden ve il dışından yoğun ziyaretçi alması hem de kampüs alanının giderek büyüme ihtiyacı bu alanı giderek darltmaktadır. Hayvanat bahçesi içerisinde ziyaretçilere görsel bir mekan sunma ihtiyacından dolayı doğal yapı bozularak yeşil alan uygulamasına gidilmektedir. Ayrıca ormanlığın içerisinde hala şahıslara ait bağevlerinin bulunması bir diğer sorundur. Üstelik bu alanlarda zaman içerisinde ortaya çıkan tahribatlar sonucunda (yangın, kesim v.s) boş kalan kesimlerde yeşil alan tasarımına gidilerek ormana bazı farklı türler de dâhil olmuştur (Cupressus sempervirens var pyramidata, Cupressus sempervirens var. horizantalis, Robinia pseudoacacia). Bu tip ormanlarda bölgenin toprak ve iklim şartlarına uyum sağlayabilen ve sistematik bir şekilde bakıma ihtiyaç duymayan türlerin tercih edilmesi bu taksonların büyüme ve gelişmesi için pozitif parametreler olmuşlardır. Halkın daha çok “sahre” adını verdiği ve hafta sonları ailesi ve aile dostlarıyla birlikte veya esnaf birliklerinin düzenlediği pikniklerin mekanı olan bu alanlar sınır kesimleri ve içerisinden geçen yol kenarları ve ormanın tahrip edildiği alanlar hariç hemen hemen otsu türlerden yoksundur. Dülük ve Gerciğin ormanlıklarının bugün hala orman altı örtüsünde, Quercus coccifera, Paliurus spinachristi, Pistacia terebinthus, Crateagus monogyna subsp. monogyna, Crateagus orientalis, Pyrus syriaca, Rhamnus aleternus, Rhamnus oleoides, Prunus spinosa ve Rosa canina, gibi maki formasyonun üyelerini barındırmaktadır. Grup F ve G’nin barındırdığı alanların, büyük bir kısmı yapay ormanlık alanlardır. Ancak yukarıda belirttiğimiz nedenlerden dolayı, Grup F’yi oluşturan alanlar çok fazla antropojenik baskı altındadır. Bu nedenle alanda doğal flora elemanlarının önemli bir yayılış gerçekleştirebilği söylenemez. Bu durumun sonucunda Grup F ve oluşturan alanlar H5 ί-euhemerob olarak değerlendirilmiştir. Ancak Grup G’yi ortaya çıkaran Dülük ve Gerciğin ormanlık alanlarının tamamı Burç ormanlığı kadar yoğun baskı altında değildir. Bu nedenle her iki yapay ormanlık alan, aynı zamanda alanın doğal potansiyel bitki örtüsü olarak değerlendirilebilecek taksonların yayılış göstermesini ve hatta bir anlamda bu yayılışıkoruma altına alınmasını sağlamıştır. Eğer alandaki maki formasyonuna ait bu taksonlar kentin bu kadar yakınındaki bir alanda yapay ormanlık alan yerine tarım arazileri yakınında olmuş olsaydı muhtemelen günümüzde bu taksonları kente yakın bu alanlarda göremeyecektik. Bu nedenler Grup G’yi ortaya çıkaran bu yapay ormanlık alanların hemerobi skalasındaki yerleri H4 mesoίeuhemerob olarak değerlendirilmiştir. 4. TARTIŞMA Kentsel ortamdaki antropojenik kaynaklı her türlü yapay girdiler urbanofil familyalara ait üyelerin yayılış alanlarını etkilememekte aksine değişen ortam şartlarına hızlı adapte olamayan diğer bazı türlerin ortamdan yok olmasına neden olduğu için bu familyaların alandaki yayılışına ivme kazandırmaktadır. Çalışma alanımızda, kentsel ve kırsal habitatlarda elde edilen floristik veriler mevcut flora elemanlarının başlı başına sintaksonomik bir grup olarak değerlendirilmesini mümkün kılmamaktadır. Her ne kadar alanda bazı taksonların (Carduus nutans subsp. nutans, Cardaria draba, Sinapis arvensis, Rhus coriaria, Chenopodium ORAL PRESENTATION 210 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org album, Conyza canadensis, Silybum marianum, Verbascum alepense, Salsola ruthenica, Urtica dioica, Cichorium intybus, Amaranthus blitoides, Sisymbrium officinale, Hordeum murinum subsp. murinum, Rumex crispus) gerek bulunma sıklığı gerekse örtüş bakımından diğer taksonlara nazaran belli bir hakimiyeti söz konusu olsa da elimizdeki veriler ışığında yapılan istatistiksel analizler bu taksonları sintaksonomik olarak değerlendirmemize olanak sağlamamıştır. Bu durum, kentsel açık alanların hem süreklilik arzetmeyen arazi parçaları şeklinde bulunması hem de bu arazi parçalarının hemen hergün yoğun baskı altında oluşundan dolayı kararlı bir hale geçememesinden kaynaklanmış olabilir. Çünkü, kentsel alanlarda flora elemanlarının bulunuşuna ve yoğunluğuna etki eden faktörler (nüfus, ulaşım, yapılaşma, sanayileşme, zirai faaliyetler,) flora üyelerinin değişimine bazen çok yönlü etki edebilmektedir. Özellikle Gaziantep gibi büyük metropollerde belli bir açık alanın yapısal değişimi bazen 1-β yıl gibi kısa bir sürede gerçekleşmektedir. Kentin doğala yakın alanları için durum farklıdır. Bu alanlarda bulunan maki formasyonunun karakteristik türü olan Quercus coccifera L. geniş yayılış alanına sahiptir. Alandaki tek doğal topluluk olarak adlandırılabilen topluluğunun bulunduğu alan olan Sof Dağı ve ilin kuzeyindeki dağlardır. Ancak, maki formasyonu, farklı bilim adamları tarafından değişik açılardan yorumlanmaktadır. Kimi bilim adamları bu formasyonu sekonder vejetasyon olarak nitelendirirken (Polunin ve Huxley, 1λ68ν Akman ve ark., 1λλ5ν Altay, β00λ), bazıları ise bu görüşe katılmayıp, Akdeniz Bölgesi’nin klimaks vejetasyonu olduğunu görüşündediler (Rikli, 1λ48). İkinci görüşe katılan bir araştırıcı olan Walter (1λ6β), makinin sekonder vejetasyon olduğunu savunan bilim adamlarının aksine, sert yapraklı ağaçların Akdeniz Bölgesi’nin alt kademelerinde klimaksı oluşturduğunu söylemektedir. Ancak, çalışmamızda gerek arazi gözlemleri sırasında gerekse çalışma alanı hakkında elde edilen bilgiler, alanın önceki dönemlerde özellikle Pinus brutia Ten. gibi orman vejetasyonu ile anılan bazı taksonların alanda var olduğu yönündedir. Bu nedenle çalışmamızda makilik alan olarak tespit edilen bu alanlarda aslında önceleri orman vejetasyonunun hâkim olduğu ve mevcut vejetasyon yapısının sekonder vejetasyon özelliği taşıdığı kanaatini oluşturmuştur. Araştırmamızda Quercus coccifera L. topluluklarının yayılış alanları alanı İlin Batı kısmında yer alan ve Batı-Doğu yönünde uzanan Sof Dağı ve çevresidir. Aynı zamanda ilin kuzeyinde Yavuzeli ilçesi yolu üzerinde bulunan Göksuncuk köyü ve çevresindeki makilik alanlar da çalışmamız kapsamında bilinçli seçilen biyotoplar içerisinde yer almıştır ve bu alan ilk kez tarafımızdan incelenmiştir. Sof Dağı’nda ise daha önce Özuslu, (β005) floristik anlamda bir çalışma yapmış ve tür listesi vermiştir. Sof dağının genel bitki örtüsü maki vejetasyonu olmakla birlikte alanın hakim türleri Quercus coccifera ve Pistacia terebinthus subsp. palaestina’ dır. Ayrıca, alanda yoğun olarak Rhus coriaria, Paliurus spina-christi, Styrax officinalis, Rosa canina, Rhamnus alaternus, Createagus orientalis ve Crataegus monogyna subsp. monogyna taksonlarıda bu taksonlara eşlik etmektedir. Bu taksonlardan Rhus coriaria her ne kadar ruderalize olmuş bir takson olsa da çalışma alanında doğal yayılış gösterebildiği bir alandır. Bu takson kentin hemen hemen her yönünde fakat özellikle de üzerinde hiçbir antropojenik faaliyet gerçekleşmeyen boş arazilerde yoğun olarak bulunmaktadır. Bu durum, belli bir alanda geçmişte var olan ve günümüzde doğal potansiyel bitki örtüsü olarak birkaç örnekle temsil edilen maki formasyonun yerini bu taksonun aldığı kanaatini oluşturmuştur. Biyotoplar ve Hemerobi Dereceleri Kentsel alanlarda, antropojenik etkiler öncelikle alandaki biyotoplar üzerinde etkisini göstermektedir. Bu etki, doğal veya doğala yakın alanları kentlerde azalttığı gibi aynı zamanda insan kaynaklı bilinçli-bilinçsiz olarak ortaya çıkan etkiler bu tip alanlarda çok farklı biyotop tiplerini ortaya çıkarmaktadır. Bu nedenle örneğin kentlerde sıcaklığın kent dışı alanlara nazaran birkaç derece yüksek olması, toprağın daha sık, pH’nın alkali özellikte olması gibi nedenler, farklı biyotop tiplerinin oluşmasında etkendir. Kentsel alanlarda, özellikle de büyük kentlerde, konut alanları, parklar, bahçeler birer farklı biyotop tipini oluşturdukları gibi, demiryolları, tarım alanları, endüstriyel alanlar da farklı birer biyotop tipi olarak karakterize olurlar. Kentsel alanlara ait biyotoplar konusunda yapılan çalışmalarda, bazı araştırmacılar (Atik ve Yılmaz, 1λλ7ν Sayar, 1λλ8ν Kunick, 1λλβν Beyhan, β007) biyotopları hemerobi skalasına göre değerlendirmişken, bazı araştırmacılar da (Kim ve ark., β00βν Godefroid ve ark., β007ν Altay, β00λ) biyotoplardan ziyade kentsel alanlardaki bu biyotopların floristik veya sintaksonomik yapılarına göre bir hemerobi skalası belirleme yoluna ORAL PRESENTATION 211 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org gitmişlerdir. Çalışmamızın ana konusu kentsel ve kırsal alan flora yapısı ve bu flora yapısını barındıran farklı biyotoplar olması nedeni ile çalışmamızda da birinci grup araştırmacılar gibi biyotop tipi esas alınarak hemerobi skalası tespiti yoluna gidilmiştir. Kentsel alana ait biyotoplar konusunda yapılan benzer çalışmalarda, Yılmaz (1λ86) yaptığı çalışmasında İzmir ili Buca ilçesine ait ekoloji yönünden önemli biyotopları tespit etmiştir. Bu biyotopları, Yapı alanları, Yeşil Alanlar ve Yapı Alanları Çevresi olmak üzere γ ana başlık altında toplamıştır. Bu γ ana başlık altında ise 1γ farklı biyotop tipi olduğunu bildirmiştir. Atik ve Yılmaz (1λλ7), yaptığı çalışmada Adana kentindeki biyotopların sınıflandırılması konusunda yaptığı çalışmada, alandaki biyotopları 6 ana başlık altında toplamış ve bu başlıklar altında toplam γγ biyotop tipi tespit etmiştir. Aynı zamanda araştırmacı alandaki biyotopların hemerobi derecelerini, 6’lı hemerobi skalasına (Seiberth, 1λ81) göre ortaya koymuştur. Özatlı (β00λ) yaptığı çalışmada Balıkesir ilinin kentsel alanlardaki biyotop tiperini belirlemiş ve 1γ farklı biyotop tipi tespit ettiğini bildirmiştir. Beyhan (β007), ise yaptığı çalışmada İzmit ilinin kentsel ekolojik verilerini incelemiş ve bu kapsamda çalışma alanında 15 farklı biyotop tipi tespit etmiştir. Ersoy (β008), yaptığı çalışmada, İzmir Aliağa’da uydu görüntülerini kullanarak önemli biyotopları sınıflandırmış ve 14 farklı biyotop tipi tespit edildiğini bildirmiştir. Biyotop haritalama konusunda yapılan bir diğer çalışmada Nayim (β010), Amasra-İnkum (Bartın) arasında yer alan önemli biyotopların haritalanması konusunda araştırma yapmış ve alanda 11 farklı ana biyotop tipi tespit etmiş ve bu biyotop tipleri altında γ0 farklı biyotop tipi sınıflandırıldığını bildirmiştir. Çalışmamız sonucu tespit edilen biyotop tiplerinden kentsel alanlar bazı alt biyotop tiplerini barındırsa da hemen hemen birçok kentte insan kaynaklı etkilerin yoğun olduğu alan floralarının, bulunduğu habitata göre giderek urbanofil, ruderal ya da segetal flora olmaya doğru evrildiği bir gerçektir. Bu tip alanlarda urbanofil, ruderal veya segetal flora elemanları sayıca az olsa bile kentlerde bulunma sıklığı olarak çok yoğun ve örtüşleride bir o kadar fazladır (Kunick, 1λ8γνWittig, 1λλ1ν Celesti-Grapow ve ark., 1λλ6ν Doğan, β007νAltay, β00λν Özatlı, β00λ). Kunick (1λ8γ)’in Almanya’nın Stutgart eyaletinde kentlerde spontan olarak yayılabilen urbanofil olarak değerlendirdiği taksonlardan Poa annua, Taraxacum officinale, Plantago major, Lolium perenne, Hedera helix, Trifolium repens, Dactylis glomerata, Solidago canadensis, Circium arvense, Conyza canadensis, Urtica dioica ve Convolvulus arvensis’in aynı zamanda çalışmamızda da kentsel ortamlarda yoğun olarak bulunduğu tespit edilmiştir. Wittig (1λλ1), Orta Avrupa’da yaptığı çalışmada urbanofil olarak tespit ettiği Hordeum murinum ve Salsola ruthenica türleri çalışma alanımızdaki kentsel alanlarda da tespit edilmiştir. Ancak, daha çok iki katlı müstakil yapılarda, konut sahipleri şahsi çabaları ile konut bahçelerinin ağaçlandırılmasında öncelikle meyve ağaçlarını tercih etmekte ve bu sayede toprağın yapısı çok fazla değiştirilmemektedir. Bu tip alanlarda da en azından konut duvarlarının kenarlarında bazı hemikriptofit ve terofit karakterde taksonlar müdahale edilmedikçe kendilerine yer bulabilmektedir. Hatta çok fazla işlenmeyen kimi konut bahçelerinde genelde kent ortamlarının geofit taksonlar için uygun ortamlar olmadığı bildirilmiş olmasına rağmen (Gutte 1λ78, 1λ8λν Rapoport ve ark. 1λ8γ) Muscari neglectum, Hyacinthella nervosa gibi geofit taksonlar kendilerine yer bulabilmektedir. Çalışma örnek parsellerin bulunduğu demiryolları ve karayollarında kent merkezinde daha çok yeşil alan düzenlemesi yapılarak dikili doğal -egzotik türlerle bezenmiş, kenarları kaldırımlarla döşenmiş ve toprağın çok fazla yüzeye çıkmadığı alanlar olarak yer almaktadır. Ancak kentin sınırlarına ve kırsal alanlara doğru yeşil alan düzenlemelerinin yapılmadığı ve kaldırımların olmadığı alanlarda toprağın kent merkezine nazaran daha çok yüzeyi gördüğü alanlarda ve tarım alanlarına doğru açılan tali yollarda birçok ruderal karakterdeki taksona rastlamak mümkündür. Bu alanlardaki ruderal floranın yanında yer yer bazı doğal flora üyeleri de bu alanlara sokulabilmişlerdir. Genelde kurak olan kesimlerde Asteraceae (Cichorium intybus, Lactuca serriola, Carduus nutans, Echinops ritro, Scolymus hispanicus ve Onopordum carduchorum) ve Poaceae (Hordeum murinum, Festuca rubra) nemli alanlarda ise Fabaceae (Trifolium repens, Vicia cracca, Lotus corniculatus ve Medicago orbicularis), Brassicaceae (Sinapis arvensis, Sisymbrium officinale), ve Polygonaceae (Rumex pulcher) familyalarına ait taksonlar haha sık göze çarpmaktadır. Benzer bir çalışmada, Doğan ve ark. (β004), Batı Anadolu’da yol kenarı bitkilerini araştırmış ve β.700 km boyunda bir alan üzerinde 17 farklı karayolunu ORAL PRESENTATION 212 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org incelemişlerdir. Çalışma sonucunda toplam 51 familyaya ait β71 takson tespit etmişlerdir. Yapılan çalışmada en çok tür sayısına sahip olan taksonları Asteraceae, Fabaceae ve Poaceae familyaları olarak sıralamışlardır. Yapılan çalışma, bu yönüyle çalışmamızda tespit edilen ve tür yoğunluğu fazla olan familyalar ile paralellik arz etmektedir. Demiryolu kenarlarında ise kent merkezinde ruderal karakterde bazı hemikriptofitler ve terofitler ön plana çıkarken kentten uzaklaştıkça bu taksonlara Rhus coriaria, Amygdalus orientalis, Crataegus monogyna subsp. monogyna. ve Rosa canina gibi bazı fanerofitler de eşlik etmektedir İl merkezine yakın ve bağ evi olarak kullanılan alanlar, sahipleri tarafından hem seyrek ziyaret, hemde ticari kaygı olmamasından dolayı egzotik türler, çim ve çit bitkilerinin mekânsal zararı dışında çok yoğun mekanik ve kimyasal etki yönüyle zarar görmemektedir. Ancak kentten uzak ve daha çok kırsal kesimde yaşayan insanların geçim kaynağı olan bağ alanları daha sık müdahaleye maruz kalmaktadır. Bu müdahale şekli, dikim öncesi ve sonrası toprak yüzeyini tamamen traşlama, dikim sonrası toprak sürüm faaliyetleri ve zararlılar için pestisit kullanımı şeklinde olmaktadır. Çalışmamız sonucu, alandaki floristik yapının hemerobi durumu göz önüne alındığında, çalışma alanında H0-H3 (Ahemerob-Mezohemerob) derecelerine ait alanlar tespit edilememiştir. Bu durumun nedeni, hemerobi cetvelinde belirtilen antropojenik baskılardan etkilenmemiş alanların ve doğal ormanların bulunmayışıdır. Bununla birlikte kent ortamlarında veya yoğun antropojenik faaliyetlerin olduğu kırsal ortamlarda, birliklerin hemerobi skalasındaki yerleri (H7), (H8) ve (Hλ) skalasında olmasına rağmen kırsal alanlar ve yapay ormanlık alanlarda bu skala (H4) veya (H5) seviyesindedir. Atik ve Yılmaz (1λλ7), yaptıkları çalışmada Adana kentinde biyotopların haritalanması amacıyla yaptıkları çalışmalarında, eski kent merkezlerinde tespit ettikleri Parieteria judaica, Vitis vinifera, Ficus carica, Morus nigra türleri aynı zamanda çalışma alanımızdaki benzer biyotop tipinde de tespit edilmiştir. Ülkemizde bu konuda yapılan bir çalışmada, Balıkesir il merkezinin farklı biyotopları araştırılmış ve 1γ farklı biyotop tipi tespit edilmiştir (Özatlı, β00λ). Araştırmacının tespit ettiği biyotop tiplerinden eski yerleşim alanlarındaki taksonlardan Ficus carica ve Parieteria judaica türleri aynı zamanda çalışma alanımızın benzer biyotop tipinde de tespit edilmiştir. Altay (β00λ), İstanbul ilinin Anadolu yakasının kentsel vejetasyonunu araştırma amacıyla yaptığı çalışmada ise kent merkezindeki alanlarda Parieteria judaica’nın bitki topluluğu oluşturduğunu tespit etmiştir. Araştırmacının alanda tespit ettiği Parieteria judaica, Sonhus asper, Stellaria media taksonları aynı zamanda araştırma alanımızda da tespit edilmiştir. Alanda tespit edilen γλ7 taksondan 11λ’unun dikili doğal veya egzotik olması başlı başına alana insan etkisinin bir göstergesidir. Bu anlamda dikili doğal veya egzotik bitki türlerinin alanda tespit edilen toplam taksonlara oranı %γ0’dur. Benzer bir çalışma sonucunda Godefroid ve ark. (β007) Brüksel’de, kentsel ortamlarda toprak ve mikroklimatik çeşitliliğin kentsel flora üzerine etkisini araştırdığı çalışmada, ββ farklı kentsel açık alanda toprak ve flora yapısını incelemiş ve alandaki floristik kompozisyonun toprağın pH, organik madde içeriği ve nem şartlarından etkilendiğini belirtmiştir. Ayrıca alanda 74 takson tespit edilmiş ve yoğunluklu olarak bu türlerin Buddleja davidii, Cirsium arvense, Hordeum murinum, Plantago major, Elymus repens, Rumex obtusifolius ve Conyza canadensis türleri olduğunu belirtmiştir. Ayrıca, tespit edilen floranın %β8’inin egzotik türlerden oluştuğunu bildirmiştir. Kentsel alanların doğal tür kayıplarına ilişkin bir araştırmada ise DeCandido (β004), yaptığı araştırmada New York eyaletinin Pelham bölgesinde kentsel alanlardaki yerel tür oranının %71,1’den %5λ,6’ya düştüğünü belirtmiş ve alanda öncelikli olarak otsu türlerin yok olduğunu bildirmiştir. Kim ve ark. (β00β) Güney Kore, kırsal alanda Hemikriptofitler ve Kamefitler açısından hemerobi skalası arasında herhangi bir korelasyon olmadığını, Fanerofit ve Geofit türler açısından hemerobi dereceleri ile bu hayat formlarına ait türler arasında negatif bir korelasyon olduğunu vurgulamıştır. Nitekim çalışmamızda da doğala yakın alanlar ile kentsel alanlar arasında Hemikriptofitler ve Kamefitler açısından herhangi bir ORAL PRESENTATION 213 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org korelasyon bulunmazken özellikle H5 ve H6 ölçeğindeki hemerobi derecelerine sahip olan doğala yakın alanlarda Fanerofitler ve Geofitlerin artış gösterdiği tespit edilmiştir. Bu durumun başlıca sebebi kentsel ortamlarda özellikle toprak yapısında meydana gelen bozunmalar ve toprağın işlenmesi sonucu diğer bazı mekanik etkiler öncelikle geofit türlere zarar vermekte ve diğer yandan kentsel alanlarda araziler tarımsal veya konut yapımı amacıyla işlenirken ağaç ve çalı türlerinin öncelikle yok edilmesi yoluna gidilmesi olarak açıklanabilir. Ancak Hemikriptofitler veya terofitlere aynı derecede engel olunamamasından dolayı aynı etki bu hayat formlarının üyeleri için geçerli olamamaktadır. Ayrıca terofitler ve hemikriptofitlerin üreme potansiyeli açısından fanerofitler ve geofitlere oranla bir üstünlüğü olmasınında kentsel alanlarda bu hayat formlarına sahip taksonlara daha sık rastlanılmasının bir sebebi olarak değerlendirilebilir. KAYNAKLAR Akman, Y., Düzenli, A., Güney, K., β005. Biyocoğrafya. Palme Yayınlarıμ γ44, 44λ sayfa. Albertı, M., Marzluff, J.M., Shulenberger, E., Bradley, G., Ryan, C., Zumbrunnen, C., 2003. Integrating humans intoecology: opportunities and challenges for studying urban ecosystems. BioScience 53: 1169–1179. Altay, V., β00λ. İstanbul’un Anadolu Yakası’nın Kentsel Vejetasyonu. Marmara Üniversitesi, Fen-Edebiyat Fakültesi - Doktora tezi 436 sayfa. Anonim, β010. İl Çevre Durum Raporu. Gaziantep Çevre ve Orman İl Müdürlüğü, Antrop, M., 2004. Landscape change and the urbanization process in Europe. Landscape and Urban Planning, 67: 9-26. Aslan, O., β010. Arslanbey (İzmit) Çevresi ile İzmit Şehir Florasının Tespiti. Sakarya Üniversitesi, Fen-Edebiyat Fakültesi - Yüksek Lisans Tezi 1β8 sayfa. Atik, M., Yilmaz, K.T., 1λλ7. Adana Kentinde Biyotopların Haritalanması. Ç.Ü. Fen ve Mühendislik Bilimleri Dergisi, Vol. 7, Sayı 1μ β4γ-257. Beyhan, D.E., β007. İzmit’in Kent Planlamasında Ekolojik Verilerin Değerlendirilmesi. Marmara Üniversitesi, Fen-Edebiyat Fakültesi – Doktora tezi 255 sayfa. Braun-Blanquet, J. 1λ64. Pflanzensoziologie. Grundzüge der Vegetationskunde. Springer-Verlag, Wien and New York. Buzas, I., 1988. Talaj- és agrokémiai vizsgalati módszerkönyv β. A talajok fizikaikémiai és kémiai vizsgalati módszerei. (Methods of soil and agricultural chmistry analysis β. Physical-chemical and chemical methods of soil analysis.) Mezőgazdasagi Kiadó, Budapest, Hungary. Celesti G.L., Ricciardi, M., Blasi, C., 1996. Confronta tra la flora di alcune citta mediterranee in Italia. S. It. E. Atti, 17: 257-259. Ceylan, E., 1λλλ. Gaziantep Tarihi. Gaziantep Ticaret Odası, Kültür Yayınları, λλ/β. Davis, P.H., 1965. Flora of Turkey and the East Aegean Islands. Vol.1, Edinburgh Univ. Press., Edinburgh. Davis, P.H., 1965-1985. Flora of Turkey and the East Aegean Islands. Vol.1-9, Edinburgh Univ. Press., Edinburgh. Decandido, R., 2004. Recent changes in plant species diversity in urban Pelham Bay Park, 1947–1998. Biological Conservation 120:129–136. Dogan, Y., Baslar, S., Celik, A., Mert, H.H., Ozturk, M., 2004. A Study Of The Roadside Plants Of West Anatolia, Turkey. Nat. Croat., Vol 3, No 1: 63-80. Ekim, T., Koyuncu, M., Vural, M., Duman, H., Aytaç, Z., Adıgüzel, N., β000. Türkiye Bitkileri Kırmızı Kitabı (Red Data Book of Turkish Plants). Türkiye Tabiatını Koruma Derneği ve Van 100. Yıl Üniversitesi, β46 sayfa. Ersoy, E., β008. Uydu görüntüsü kullanımıyla Aliağa (İzmir) kıyı bölgesinde ekolojik açıdan önemli biyotopların haritalanması. Ege Üniversitesi, Ziraat Fakültesi, Peyzaj Mimarlığı – Yüklek Lisans Tezi, 102 sayfa. Godefroid, S.,Monbaliu, D., Koedam, N., 2007. The role of soil and microclimatic variables in the distribution patterns of urban wasteland flora in Brussels. Landscape and Urban Planning 80:45–55. Göktürk, S. R., 1λλ4. Antalya Şehir Florası Üzerine Bir Araştırma. Akdeniz Üniversitesi, Fen-Edebiyat Fakültesi - Yüksek Lisans Tezi ββ5 sayfa. Gutte, P., 1978. Ruderalpflanzengesellschaften von Lima und Huanuco. Beitrag zur Kenntnis zentralperuanischer Pflanzengesellschaften I. Feddes Repertorium, 89: 75-97. ORAL PRESENTATION 214 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Gutte, P., 1989. Ein Beitrag zur Kenntnis von Flora und Vegetation der stadt Santa Clara in Cuba. Wiss. Ztschr. Friedrich-Schiller-Univ. Jena, Naturwiss. R., 38: 297-314. Hansen, A.J., Knight, R.L., Marzluff, J.M., Powell, S., Brown, K., Gude, P.H., Jones, K., 2005. Effects of exurban development on biodiversity: patterns, mechanisms, and research needs. Ecological Applications 15: 1893-1905. Jalas, J., 1955. Hemerobe und hemerochoer Pflanzenarten. Ein terminologoscher Reformversuch – Acta Soc. Fauna Flora Fenn. 72, 11: 1–15. Kim, Y., Zerbe, S., Kowarik, I., 2002. Human impact on flora and habitats in Korean rural settlements. Preslia, Praha, 74: 409–419. Kocataş, A., 1λλλ, Ekoloji, Çevre Biyolojisi. Ege Üniversitesi Su Ürünleri Fakültesi Yayınları, Noμ51, Ders Kitabı Dizini Noμ β0, Bornova/İzmir. Kowarik, I., 1992. Zur Rolle nichteinheimischer Waldarten bei der Waldbildung auf innerstтdtischen Standorten in Berlin. Verhandl. Ges. Ökol., β1μβ07- 213. Kowarik, I., 1998. Zum menschlichen EinfluB auf flora und Vegetation. Landschaftsentwicklung und Umweltforschung TU, Berlin, 56. Kunick, W., 1λ8γ. “Köln, Landschaftsökologische Grundlagen – Teil γ”, Biotopkartierung, Grünflтchenamt, Köln. Kunick, W., 1λλβ. Möglichkeiten der naturnтheren Anlage und Pflege öffentlicher Grünflтchen. Das Gartenamt, 10:685-690. Nayim, S.Y., 2010. Amasra-İnkum (Bartın) arasında yer alan önemli biyotopların haritalanması. İstanbul Üniversitesi, Mühendislik Fak., Peyzaj Mimarlığı – Yüksek Lisans Tezi, γ11 sayfa. Odum, E.P., Barret, G.W., β008. Ekoloji’nin Temel İlkeleri. Palme Yayıncılık, (5. Baskıdan Çeviri, Editör, Kani Işık), 6β4 sayfa. Özatli, D., β00λ. Balıkesir İlinin Kentsel Ekolojik Özellikleri. Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Doktora tezi 226 sayfa. Özuslu, E., İskender, E., Özaslan, M., Zeynalov, Y., β005. The Investigation of the Flora of Sof Mountain (Gaziantep, Turkey). Flora Mediterranea, Italia, 15:179-209. Polunin, O., Huxley, A., 1968. Flowers of the Mediterranean. London, 272 pages. Rapoport, E. H., Dıaz Betancourt, M. E., Lopez Moreno, I. R., 1λ8γ. Aspectos de la ecologia urbana en la ciudad de Mexico. Flora de las calles baldios, Editorial Limusa, 197 pages. Rikli, M., 1948. Dans Pflanzenkleid der Mittelmeerlander. Bern: Huber. Vol. 3, 148 pages. Sayar, A., 1λλ8. Kent Planlamasında Ekolojik Verilerin Değerlendirilmesi Muğla Örneği”, Ege Üniversitesi, Ziraat Fakültesi, Doktora tezi, İzmir Seiberth, H., 1λ8γ. Stadtökologie – Naturschutz Und Landschaftspflege In Grossstadt. Grün Un Der Stadt, Veröffentlicht Im Rowohlt Tascherbuch Verlag GmbH, Reinbek Bei Hamburg, Sukopp, H., 1λ76. Verтnderungen der Flora und Fauna in der Bundesrepublik Deutschland (W. Trautmann. edts.). Schr.-R. Vegetationkde. 10:1–409. Şıvgın, H. β000. Ankara Üniversitesi Osmanlı Tarihi Araştırma ve Uygulama Merkezi Dergisi, Sayı 11, sayfa. 503-553. Walter, H., 1λ6β. Anadolu’nun Vejetasyon Yapısı. (Çeviri Editörü.μ S.Uslu) İst. Üniv. Orm. Fak. Yay. Noμ 80. Wittig, R., 1λλ1. Ökologie der GroBstadtflora. G. Fischer, Stuttgart. Yilmaz, K.T., 1λ86. Buca Yerleşme Merkezinde Ekoloji Yönünden Önemli Biyotoplar Üzerine Arştırmalar. Ege Üniversitesi, Ziraat Fakültesi, Y. Lisans Tezi 44 sayfa. Yilmaz, T.K., 1λλγ. Amanos Dağları Dörtyol Kesiminde Yayla Yerleşimlerinin Doğala Yakın Vejetasyonlar Üzerine Etkilerinin Araştırılması. Ç.Ü. Ziraat Fakültesi-Doktora Tezi, 171 sayfa. ORAL PRESENTATION 215 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Wound Healing Properties of Capparis ovata desf. var. paleastina zoh. Methanol Extract Mehmet Evren Okur1*, Şule Ayla2, Derya Çiçek Polat3, Mehmet Y. Günal4 *1 2 Universtiy of Istanbul Medipol, School of Medicine, Department of Histology and Embryology, Istanbul, Turkey 3 4 University of Anadolu, Faculty of Pharmacy, Department of Pharmacology, Eskişehir, Turkey University of Ankara, Faculty of Pharmacy, Department of Pharmaceutical Botany, Ankara, Turkey University of Alanya Alaaddin Keykubat, Faculty of Medicine, Department of Physiology, Antalya, Turkey Corresponding author e-mail: evrenokurecz@gmail.com Abstract Wound healing is a natural process that enables tissue repair after an injury. In most cases, wounds can occur resulting from an accident, an infection, a surgery, or a hidden etiological ailment. The aim of the present study was to evaluate in vivo the wound healing property and in vitro antioxidant activities of C. ovata Desf. var. palaestina zoh. methanol fruit extract. HPLC, phenolic and flavonoid compounds analysis were performed. The wound healing effect was tested by excisional wound model. Wound closure was measured for 14 days and at 14 th day, wound healing was assessed by levels of TGF-ί, VEGF, COL1A1 and angiogenesis, granulation tissue thickness, epidermal and dermal regeneration. The antioxidant activity was calculated by DPPH and ABTS free radical scavenging assays. The extract indicated significant antioxidant activity while it also exhibited antimicrobial activity. HPLC study revealed that rutin was found the extract. Moreover, the extract was found to have rich phenolic and flavonoid contents. The total phenolic value, which was obtained from the fruit-methanol extract, found to be 1017.4β±44.18 mgGAE/100g. Histological evaluation showed that extract group induced significant (p<0.001) wound healing activity compared to control group. Furthermore, extract group increased wound healing rates by promoting granulation tissue, epidermal regeneration, angiogenesis, collagen, TGF-ί, and VEGF. The results showed that the extract indicated antioxidant activities and thus could provide a valuable contribution to the wound healing. Keywords: Wound healing, Capparis ovata var. palaestina, Antioxidant, Extract 1. INTRODUCTION Wound is an inevitable part of the human life. The body is provided with a complicated self-healing mechanism (Joshi et al., 2016). In scientific meaning, wound healing is achieved through four exactly and highly programmed stages: hemostasis, inflammation, proliferation, and remodeling (Han and Ceilley, 2017). For a wound to be healed successfully, all of these stages must occur in the appropriate sequence and time frame. Nonetheless, many factors can affect one or more stages of the process that cause deficient or impaired wound healing (Guo and Dipietro, 2017). It should be noted that a complex signaling system, including various growth factors, chemokines, and cytokines, coordinate the wound healing process (Joshi et al., 2016). Many wounds and ulcers types including diabetic foot ulcers, venous ulcers as well as pressure wounds present delayed healing and sustained inflammation and impaired extracellular matrix function. Subsequently, such wounds are associated with chronic healing process whereas are mainly colonized by bacteria, filamentous fungi and yeasts prolonging more the healing process (Han and Ceilley, 2017). The Caper (Capparis) which is known kapari, keper, kebere, and gevil in different regions of Turkey, is a perennial shrub and it grows as spontaneously throughout Mediterranean basin (Ozcan M, 2005). In this study a newer approach to evaluate Capparis ovata desf. var. palaestina and its wound healing, antioxidant activities are proposed. ORAL PRESENTATION 216 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS AND METHODS 2.1 Plant material and extraction C. ovata var. palaestina fruits were collected from Batman, Turkey. Voucher samples were deposited in Herbarium of Ankara University Faculty of Pharmacy (No:AEF 26797, AEF 26798). For methanolic extract, the fruits of C. ovata var. palaestina was extracted with methanol for 24 h. 2.2 Total phenolic and flavonoid contents of the extract The amount of phenolic content was measured according to Folin-Ciocalteu technique. The absorbance of the sample was determined at 765 nm (Spanos and Wrolstad, 1990).The amount of flavonoid content was determined by the aluminum chloride colorimetric assay. The absorbance of each sample was determined at 510 nm (Chia-Chi Chang et al., 2002). 2.3 High-performance liquid chromatography (HPLC) analyses Chromatographic separation of the compound was achieved using a Discovery HS C18 column maintaining at β5°C. Elution was achieved at a flow rate of 0.4 mL/min in a gradient. The mobile phase consisted of 0.1% formic acid solution and acetonitrile. Chromatograms were acquired at 280 nm. 2.4 In vitro antioxidant activity The DPPH (2,2-diphenyl-1-picrylhydrazyl) free radical scavenging activity of the extract was detected by its capacity of bleaching the stable radical DPPH (Blois M,1958). Absorbance was measured at 517 nm, and the free radical scavenging activity was detected as the percentage of the radical reduction. The antioxidant activity of the extract was also determined by ABTS [β,β’-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid)] radical cation decolorization test (Re R et al., 1999). The results were expressed as IC 50. 2.5 Animals, Excisional wound model and experimental groups Balb-c mice (25-28 g) were procured from Medipol University, MEDITAM, Istanbul, Turkey. The mice were hosted in regular cages with food and water ad libitum, at room temperature (β0±β°C) with artificial light from 7.00 am to 7.00 pm. Before performing in vivo experiments, ethical clearance approval was obtained from the Institutional Animals Ethical Committee (Approval No:38828770-604.01.01-E.20553). A total of thirty-two mice were assigned randomly into four groups of eight animals each as follows; Group 1: Untreated (UG) as the control group (with sterile saline). Group 2: Blank gel (no drug content) (BG) as the vehicle group. Group 3: C. ovata extract gel (EG) group. Group 4μ Madecassol® (Bayer Consumer Care AG, Switzerland) (MG) as the topical standard group. The animals were anesthetized by intraperitoneal injection of 80-100 mg/kg xylazine and 10 mg/kg ketamine, after that the hair on the back of mice were shaved and the skin was washed with povidone-iodine solution. Two full excisional skin wounds were formed 1 cm from the midline and 1 cm apart using a punch biopsy tool (diameter; 5 mm). Wounds were treated according to the designated treatment group. All treatments were topically administered to coat the surface of the wounds once daily for 14 days. Photographs were taken using a Canon digital 160 camera with an internal scale of each wound at days 0, 2, 4, 6, 8, 10, 12 and 14 to measure wound contraction. The pictures of the wounds were taken at a λ0° angle to the plane of the wound. Wound surface areas were calculated using an image analyzer to assess changes in size during healing. 2.7 Histology and immunohistochemistry On the 14th day post-wounding, the animals were sacrificed by decapitation and the skin of the back including the wound area was removed. Full-thickness biopsy samples extended from the outside margin to the center of the treated area. The tissue samples were fixed in neutral formalin at room temperature for 24 h. Thereafter, the fixed tissue samples were dehydrated in ethanol, cleared in xylene and embedded in paraffin. 5 ηm thick sections were mounted on glass slides, dewaxed, rehydrated with distilled water and stained with vascular endothelial ORAL PRESENTATION 217 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org growth factor (VEGF) (Santa Cruz sc-7269), collagen type1 alpha1 (COL1A1) (Santa Cruz sc-293182), transforming growth factor beta1 (TGF-ί1) (Santa Cruz sc-65378) and hematoxylin-eosin (HE) in accordance with procedures for light microscopy. Wound healing for each group was evaluated using the scoring system described by Galeano et al., 2006. Immunoreactivity of immunohistochemical stain was evaluated by the semiquantitative method. The evaluation was carried out on 5 randomly selected areas for each experiment and the averages were taken. Score 0: No painting, 1: Little painting, 2: Medium painting, 3: Heavy painting. 2.8 Statistical analysis Statistical significance between groups was analyzed by one-way ANOVA followed by Dunnett’s post hoc test. Values for p<0.05 were considered statistically significant. Wherever significance has been confirmed, it is showed by p < 0.05, p < 0.01 and p < 0.001. 3. RESULTS AND DISCUSSION The total phenolic (TP) value, which was obtained from the fruit-methanol extract, found to be 1017.4β±44.18 mgGAE/100g. In our results, total flavonoid (TF) content of the C. ovata var. palaestina extract was also screened, exhibiting a TF value of β785±β1.β1 mgQE/100g from fruit extract. In general, the phenolic compounds are recognized to have the capacity to decrease oxidative damage. This activity is thought to be by way of their redox properties, which play a key role in decomposing peroxides, absorbing and neutralizing free radicals, or quenching singlet and triplet oxygen (Sakat et al, 2010). Antioxidant activities of C. spinosa are connected to the high level of phenolic compounds (Tlili et al, 2011). Further, phenolic compounds possess the capability to ease wound healing at different phases of the healing either by stimulating proliferation, angiogenesis and collagen synthesis (Joshi et al, 2016). It has been already stated, flavonoids are one of the most common groups of plant phenolics which could be graded such as flavones, flavonols, flavanones, flavonols, anthocyanins, and isoflavonoids (Eddouks et al, 2005). Rutin is a phenolic compound which has antioxidant and anti-inflammatory activities (Sharma et al, 2010). It’s previously reported that rutin was found in different parts of C. moonii and C. spinosa (Gull et al, 2015). According to results of the quantitative analysis of rutin, fruit ethanol extract include 0.027% rutin amount. As a result, its determined that Capparis ovata var. palaestina’s fruits are source of rutin. Oxidative stress is characterized by the impaired balance between higher cellular levels of reactive oxygen species and cellular antioxidant mechanisms (Nazıroğlu et al, β011) and the free radicals can induce chronic illnesses, such as inflammation and neurodegenerative disorders (Gull et al, 2015). In previous studies, it was demonstrated that wound healing activity was related to the antioxidant activity (Fikru et al, 2012). DPPH free radical scavenging test value of the extract was 0.γ4γ±0.0γγ mg/ml (IC50) and has shown free radical scavenging activity as compared to the reference (BHTν 0.018±0.001 mg/ml) (IC 50) (p<0.05). On the other side, ABTS free radical scavenging test value of the extract was 0.106±0.001mg/ml (IC 50) and also has shown free radical scavenging activity as compared to the reference (Troloxν 0.015±0.001 mg/ml) (p<0.05). Both tests were indicated the strong resemblance that the extract shown antioxidant activity. As it is shown in Figure 1, the surface area of the wound of each group was screened on the day 0, 2, 4, 6, 8, 10, 12, and 14. It was observed that MG and EG displayed wound scabs on early stages as compared to the UG and BG. After dropping of the crust, a residual lesion remained on the wound. Furthermore, EG and MG were almost fully healed on the day 14. ORAL PRESENTATION 218 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 1. Macroscopic examples of wound healing with sterile saline, blank gel, extract gel and madecassol after excision at 0, 2, 4, 6, 8, 10, 12 and 14 days. The measurement of the wound closure rate is useful for evaluate the progress of wound healing (Zeng and Zhu, 2014). The wound closure rates in mice were shown in Figure 2. UG and BG indicated least rate of wound healing and the wound area of EG and MG rapidly decreased. Further, compared to the UG treated mice, EG (p<0.001 at 2, 4, 6, 8 days; p<0.01 at 10, 12, 14), MG (p<0.001 at 2, 4, 6, 8 days; p<0.05 at 10, 12 days; p<0.01 at 14 days) treated mice indicated significant reduction in the wound surface at all time points (Table 1). The goal of the wound treatment is to either shorten the time required for healing or to reduce the undesired consequences, hence scarring (Maver et al, 2015). Figure 2: Healing percentage of scar tissue surface area in each group. Table 1: Wound surface areas calculated using an image analyzer (%) Day 14 βγ,γ4±1, 41,5β±γ,78 β6,81±1,7γ 08 βγ,71±1, 4β,47±γ,0γ γ0,8λ±β,1γ Blank gel 10λ,5±γ,ββ *** 3 81,γ1±5,β6 5β,71±6,45 ββ,17±1,55 11,61±0,84 6,08±0,5 Extract *** *** *** *** ** ** 3** gel ** 5γ,78±γ,7β β0,78±1,βγ 14,λ6±1,16 λ,λ4±0,75 5,7λ±0,γ Madecass λβ,07±4,4β λγ,1±γ,75 *** * *** *** * * 9** ol Values are percentage of open wound surface. Statistically significant as compared to control; P<0.05 (*), P<0.01 (**), P<0.001 (***).Values are presented as the mean±SEM. Untreate d Day 2 11β,7β±4,6 5 Day 4 1γ6,γ7±6,γ 3 116,54±β,λ 8*** 8β,14±6,08 Day 6 116,λλ±5,γ 9 86,0γ±6,01 Day 8 Day 10 Day 12 β4,1γ±1,8 5 β6,4λ±1,8 6 7,λ1±0,87 The proliferative phase starts after nearly 3 days from the early lesion. Proliferation is formed over different stages including angiogenesis, epithelialization, granulation tissue formation, in order to repair barrier function, protection against fluid loss and bacterial intrusion (Joshi et al, 2016). In this study, granulation tissue thickness, ORAL PRESENTATION 219 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org angiogenesis, and epidermal-dermal regeneration were evaluated separately. Granulation tissue progress during wound healing is one of the indicators to determine of wound treatment (Ayla et al, 2017). As seen in Fig. 3, according to the results obtained from the tissue samples, it was determined that MG (p<0.001) and EG (p<0.001) had a significant effect compared to control group and BG. In addition, it was observed that thicker granulation tissue was formed in extract group as compared to MG after treatment (Fig. 5). Angiogenesis plays an essential role in physiological and pathological processes such as wound healing, embryonic development, tumor growth, and chronic inflammation (Park et al, 2017). Actually, angiogenesis has a dual function, which provides the oxygen and essential nutrients to the lesion site and accelerating granulation tissue formation (Zeng and Zhu, 2014). In this work, according to the results of histological evaluation, more blood vessel formation was determined on EG (p<0.001) and MG (p<0.001) as compared to control group and BG. Also, extract group provides new blood vessel formation as nearly as MG (Fig. 3-5). Epidermal regeneration is characterized by well-structured epithelial layers with no evidence of crusting or intraepithelial inflammatory cells (Galeano et al, 2006). Our study also revealed that there were significantly higher percentages of dermal and epidermal regeneration with the EG (p<0.001) and MG (p<0.001) compared to control group; otherwise, a difference was also seen between the BG (p<0.05) and control group (Fig. 3-5). It was suggested that extract group accelerates the regeneration of the epidermal layer in part by enhancing keratinocyte migration (Shen et al, 2016). Figure 3: Microscopic examination of granulation tissue thickness, anjiogenesis and epidermal-dermal regeneration on sterile saline (control-untreated), blank gel, extract gel and madecassol groups by histological wound healing scores among. Statistically significant as compared to control; P<0.05 (*), P<0.01 (**), P<0.001 (***). A chronic wound tends to show decreased levels of platelet-derived growth factor (PDGF), transforming growth factor-ί (TGF-ί), fibroblast growth factor (FGF), epidermal growth factor (EGF), VEGF and while expressing lower levels of tumor necrosis factor-a (TNF-a) and interleukins (IL) 1 and 6 (Han and Ceilley, 2017). Targeting of TGF-ί has been shown to accelerate wound healing and reduce scarring (Sinno and Prakash, 2013). Immunohistochemical staining for TGF-ί revealed that there was a significantly increased of the expression of TGF-ί in EG (p<0.001) and MG (p<0.001) as compared to control group and BG (Fig. 4-5). Also, both two effective groups showed nearly 3 fold increase in TGF-ί compared with the control group and BG. The strength of the repaired wound tissue is a result of the remodeling of collagen and the formation of stable intra and intermolecular cross-linking to form fiber (Fikru et al, 2012). A statistically significant difference was seen in collagen formation, in EG (p<0.001) and MG (p<0.001) compared to the control group and BG (Fig. 4-5). As seen in Fig. 4, it was also monitored that EG and MG showed nearly two-fold collagen formation than the control group and BG. VEGF is one of the most important cytokines for stimulating angiogenesis, which is necessary for the formation of granulation tissue. Up-regulation of VEGF expression can increase the number of newly formed capillaries and accelerate the formation of granulation tissue, thereby enhancing angiogenesis and wound healing (Shen et al, 2016). Immunohistochemistry demonstrated that EG (p<0.001) and MG (p<0.001) showed the significant increase of VEGF as compared to the control group and BG in wound tissue. Otherwise, it was also detected that both two treatment groups showed nearly two-fold increase of VEGF than the control group and BG (Fig. 4-5). ORAL PRESENTATION 220 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 4: Comparison of immunohistochemistry wound healing scores among groups. Statistically significant as compared to control; P<0.05 (*), P<0.01 (**), P<0.001 (***). Figure 5. Histopathological view of injured tissues of the untreated (control), blank gel, extract gel and madecassol groups on 14th day after wound incision (Hemotoxylen and eosin (H&E) (original magnificationX10) and immunohistochemistry (TGF-ί (original magnificationX10), VGF (original magnificationX20) and Collagen (COL1A1) (original magnificationX10)) 4. CONCLUSION The data obtained from this work revealed that methanol extract exhibited antioxidant activity. In addition, methanol extract was involving high levels of phenolic substances and flavonoids as well as rutin compound. Due to in vivo macroscopic wound healing assessment and evaluation of histological strain, extract group demonstrated increased rates of granulation tissue, epidermal-dermal regeneration, and angiogenesis. It was also found that the extract group showed a significant increase TGF-ί, VEGF and collagen formation, which are important criteria for wound healing, compared to the control group. The results of our study depicted that methanol extract of C. ovata var. palaestina fruit is a valuable candidate for further research as an alternative therapy for the treatment of wounds. REFERENCES Ayla Ş et al. 2017. Effects of Prunus spinosa L . fruits on experimental wound healing. Medeni Med J, 32(3):152-158. ORAL PRESENTATION 221 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Blois M 1958. Antioxidant Determinations by the Use of a Stable Free Radical. Nature, 181:1199-1200. Chia-Chi Chang et al. 2002. Estimation of Total Flavonoid Content in Propolis by Two Complementary Colorimetric Methods. J Food Drug Anal, 10(3):178-182. Eddouks M et al. 2005. Hypolipidemic activity of aqueous extract of Capparis spinosa L. in normal and diabetic rats. J Ethnopharmacol, 98(3):345-350. Galeano M et al. 2006. Recombinant human erythropoietin improves angiogenesis and wound healing in experimental burn wounds. Crit Care Med, 34(4):1139-1146. Fikru A et al. 2012. Evaluation of in vivo wound healing activity of methanol extract of Achyranthes aspera L. J Ethnopharmacol, 143(2):469-474. Gull T et al. 2015. Capparis species: A potential source of bioactives and high-value components: A review. Ind Crops Prod, 67:81-96. Guo S, Dipietro LA 2010. Factors Affecting Wound Healing. J Dent Res, 89(3):219-229. Han G, Ceilley R β017. Chronic Wound Healing μ A Review of Current Management and Treatments. Adv Ther, 34(3):599-610. Joshi A et al. 2016. Systematic investigation of ethanolic extract from Leea macrophylla: Implications in wound healing. J Ethnopharmacol, 191:95-106. Maver T et al. 2015. A review of herbal medicines in wound healing. Int J Dermatol, 1-12. Nazıroğlu M et al. 2011. Capparis ovata modulates ovariectomize induced-oxidative toxicity in brain, kidney and liver of aged mice. Cell Membr Free Radic Res, 3(1):186-193. Ozcan M 2005. Mineral Composition of Different Parts of Capparis ovata Desf. var. canescens (Coss.) Heywood Growing Wild in Turkey. J. Med. Food, 8:405-407. Park JY et al. 2017. Abietic acid isolated from pine resin (Resina Pini) enhances angiogenesis in HUVECs and accelerates cutaneous wound healing in mice. J Ethnopharmacol, 203:279-287. Re R et al. 1999. Antioxidant Activity Applying an Improved Abts Radical Cation Decolorization Assay. Free Radic Biol Med, 26(9):1231-1237. Sakat SS et al. 2010. In-vitro antioxidant and anti-inflammatory activity of methanol extract of Oxalis corniculata linn. Int J Pharm Pharm Sci, 2(1):146-155. Sharma B et al. 2010. Anti-diabetic potential of alkaloid rich fraction from Capparis decidua on diabetic mice. J Ethnopharmacol, 127(2):457-462. Shen HM et al. 2017. The N-butyl alcohol extract from Hibiscus rosa-sinensis L. flowers enhances healing potential on rat excisional wounds. J Ethnopharmacol, 198:291-301. Spanos GA, Wrolstad RE 1990. Influence of processing and storage on the phenolic composition of Thompson Seedless grape juice. J Agric Food Chem, 38(7):1565-1571. Tlili N et al. 2011. The caper (Capparis L.): Ethnopharmacology, phytochemical and pharmacological properties. Fitoterapia, 82(2):93-101. Zeng Z, Zhu B-H 2014. Arnebin-1 promotes the angiogenesis of human umbilical vein endothelial cells and accelerates the wound healing process in diabetic rats. J Ethnopharmacol, 154(3): 653-662. ORAL PRESENTATION 222 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Üçlü Nd-Fe-B Tipi Mıknatısların Çeşitli Yöntemlerde Üretim Aşamalarına Oksidasyonun Etkisi Sefa DURMUŞ1, Kübra ZENKİN2*, Mecit AKSU1, Aslıhan DALMAZ3 Düzce Üniversitesi, Fen-Edebiyat Fakültesi, Kimya Bölümü, Düzce, Türkiye. Düzce Üniversitesi, Fen Bilimleri Enstitüsü, Kimya Anabilim Dalı, Düzce, Türkiye. 3 Düzce Üniversitesi, Fen Bilimleri Enstitüsü, Kompozit Materyal Teknolojileri Anabilim Dalı, Düzce, Türkiye. 1 *2 Sorumlu yazar e-mail: kubrazenkin@gmail.com Özet Manyetik malzemeler alanında yapılan araştırmalar, sentez, karakterizasyon, teorik kavramlar ve mühendislik uygulamalarının zengin bir kombinasyonudur. Özellikle Nd 2Fe14B sert manyetik malzemelerin üstün manyetik özellikleri bulunduğundan, araştırmalar yeni sentez teknikleri ve optimum mikro yapı geliştirme konularına odaklanmıştır. Nd-Fe-B kalıcı manyetik malzemeler, yüksek zorlayıcı ve enerji ürünlerinin ((BH) max) mükemmel kombinasyonu sayesinde muazzam bir teknolojik uygulama yelpazesine sahiptir. 1980'lerin başından beri rüzgar türbinleri, hibrit ve elektrikli araçlarda (HEV'ler ve EV'ler), elektrikli ev aletleri, endüstriyel ve robotik motorlar, sabit disk sürücüleri ve birçok küçük tüketici elektronik cihazlarında yaygın olarak kullanılmaktadır. Toz metalurjisi veya hızlı söndürme gibi Nd 2Fe14B mıknatıslarının üretimi için farklı geleneksel yöntemler vardır. Bununla birlikte, bu yöntemler, başlangıç malzemeleri olarak yüksek saflıkta metallerin kullanılması ihtiyacından dolayı pahalıdır. Püskürterek kurutma ve sol-jel usulü olarak bir redüksiyon-difüzyon işlemini içeren bir başka yöntem, demir, neodmiyum ve borik asit tuz karışımlarının kullanılmasıdır. Bu yöntem, toz metalurjisi veya hızlı söndürme işlemlerine kıyasla daha ucuzdur. Aynı zamanda, Nd-Fe-B manyetik malzeme, parçacık boyutu, manyetik anizotropi ve faz saflığı gibi çeşitli faktörlerden yüksek oranda etkilenir. Örneğinν Neodim ve amorf borun aşırı eklenmesi Nd-Fe-B mıknatıslarının manyetik özelliklerini iyileştirir. Bu çalışmada, NdFeB tipi kalıcı mıknatıslar üretmek için farklı yöntemler denenmiştir. Oksitlenmenin mıknatıs üretim süreci üzerindeki etkisi araştırılmış ve reaksiyonun birkaç aşamada gerçekleştiği görülmüştür. Son olarak, atmosferik koşulların etkisi altında orta kademeli olarak oluşan NdFeO3, hematit ve manyetit ürünleri XRD analizleri ve çeşitli spektral yöntemler ile araştırılmıştır. Anahtar Kelimeler: Neodmiyum, Manyetizma, Nd-Fe-B, Oksidasyon, Kalıcı mıknatıs 1. GİRİŞ Mıknatıslar manyetik alan üreten materyallerdir. Mıknatısν demir, kobalt, nikel gibi ferromanyetik materyalleri çekmektedir. Mıknatısların genel özellikleri ise kısaca şöyledirν mıknatıslar ferromanyetik objeleri çeker, mıknatıs kutuplarındaki manyetik alan orta kısmındaki manyetik alandan daha büyüktür, mıknatıs kutupları birbirlerini iterken zıt kutuplar birbirlerini çeker, mıknatıs serbestçe askıya alındığında güney kutbu ve kuzey kutbu, sırasıyla dünyanın kuzey ve güney kutbuna doğru hareket etme özelliğine sahiptirler. Modern endüstri ve bilgi teknolojilerindeki gelişmiş mıknatıslar için yüksek enerji gereksinimlerini karşılamak için sürekli mıknatıslar geliştirmek için sürekli bir çaba olmuştur (Yu ve ark., 2013). Kalıcı manyetizmanın tarihi yüzyıllar öncesine dayanmaktadır. Manyetizmanın ilk araştırmaları M.Ö. 6. yüzyıldaki Yunan filozof Thales’e kadar uzanır. Buna rağmen manyetizmanın modern anlayışı 1600’lü yıllarda başlamıştır. Kalıcı manyetik maddelerin gelişimi adım adım olmuştur ve her madde yenisi ile yer değiştirmeden önce geliştirilmiş ve yenilenmiştir. β0. yüzyıl boyunca kalıcı manyetik maddelerin gelişimi Şekil 1’de görülmektedir. Bu şekilde, yatay eksen yılları verirken düşey eksenler mıknatısların ürettiği maksimum enerjiyi göstermektedir (Başoğlu, β01γ). ORAL PRESENTATION 223 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 1. β0.yüzyılda kalıcı mıknatısların gelişimi. İlk olarak mıknatıs taşının demiri çektiğini Yunanlı bilim insanları tarafından keşfedilmiştir. Bunlar ayrıca ihtiyaca göre farklı boyut ve şekillerde yapay yöntemlerle oluşturulabilmektedirler. Sık kullanılan mıknatıs, çubuk mıknatıs olup demir nesneleri çeken uzun biçimli dikdörtgen çubuktur. Benzer şekilde pusula iğnesi bir mili kuzey yönünde diğer mili de güney yönünde yatay olarak serbestçe hareket edebilen mıknatıstır. Mıknatıs çevresindeki alan manyetik alanı algılar. Mıknatıs etkisi etrafındaki manyetik kuvvetten kaynaklanmaktadır. Bu nedenle, bir alanda bir çubuk mıknatıs koyduğumuzda manyetik kuvvetler meydana gelir ve bu manyetik kuvvetler mevcut manyetik alandan uzaklaştırıldıktan sonra da etkisini sürdürür. Akımın akışı tarafından manyetik alan üretilir. Manyetik özelliklerine ve manyetizma gösterme etkilerine göre mıknatısların farklı çeşitleri vardır. Mıknatıslarν etki sürelerine göre, genellikle geçici mıknatıslar ve kalıcı mıknatıslar olarak ikiye ayrılır. Geçici mıknatıs uzun süre mıknatıslanmaya devam etmeyen mıknatıs türüdür. Manyetik alanın veya manyetik gücün etkisinde olduklarında mıknatıs özelliklerini gösterirler. Geçici mıknatıslara örnek elektromıknatıstır. Akım çekirdekten geçtiğinde mıknatıslanır, aksi takdirde mıknatıs olarak davranmazlar. Kalıcı mıknatıslarν Mıknatıslandığında bir miktar manyetizmayı koruyan mıknatıs türleridir. Bu da isminin neden kalıcı mıknatıs olduğunu açıklamaktadır. Bazı doğal kalıcı mıknatıslar, mıknatıs taşı ya da magnetit içeren mıknatıslardır. Mıknatısların iki kutbu vardır, bunlar kuzey ve güney kutbudur. 100 cm uzunluğunda iki kutba sahip bir mıknatıs 50 cm’lik iki yarıma bölündüğünde, her biri kuzey ve güney kutba sahip iki mıknatıs elde edilecektir. 100 cm’lik mıknatıs dört parçaya bölünmüş olsa da iki kutba sahip olacaktır. Bunun anlamı, bir mıknatıs doğada asla tek kutuplu var olmamaktadır. Kalıcı mıknatısların sınıflandırılması şu şekildedirμ Alniko Mıknatıslar ( Al, Co ve Ni tabanlı alaşımlar )μ 1λγ0’larda keşfedilen Alniko ilk modern kalıcı mıknatıstır. Bu mıknatısların özellikleri şekil anizotropisine dayanır. İki fazlı nano yapıya sahip olan bu mıknatısta manyetik olmayan Al-Ni matrisi içine dağılmış manyetik Fe-Co iğneli yapı vardır. Yüksek Curie sıcaklığından dolayı (з850 °C), bugün hala bazı uygulamalarda kullanılmaktadır (Permanent Magnet Catalog, β007). Ferrit, mıknatıslar manyetiti (Fe3O4) ve asemitat (Fe2O3) gibi kimyasal bileşiklerden oluşan mıknatıslardır. Ferrit mıknatıslar dünyadaki en doğal manyetik mineraldir. Ferrit mıknatıslar kimyasal bileşimde seramiktir ve mıknatıstır. Ferrit mıknatısı ferromanyetik malzemeleri çeker ve diğer mıknatısları iter veya çeker (Özdinçer ve ark., 2017). Samaryum Kobalt (SmCo), kobalt, demir, nadir toprak elementlerinin alaşımı olan bu mıknatıs 1λ60’larda keşfedilmiştir. Samaryum-kobalt, yüksek ortam sıcaklığında yüksek itme ve çekme kuvveti ile çalışmanın gerekli olduğu uygulamalar için en uygun malzemedir. Manyetik malzemeden olan Samaryum-kobalt, özellikle 300 ℃ ve üzerindeki çalışma sıcaklığında mükemmel ısıl performansı gösterir. Fakat Samaryum ve Kobalt’ın yüksek maliyetleri bu mıknatısı kullanılan en pahalı mıknatıs yapar (Permanent Magnet Catalog, β007). ORAL PRESENTATION 224 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Neodmiyum Demir Bor (NdFeB ya da NIB)ν en yaygın kullanılan nadir toprak mıknatıs türü, Nd 2Fe14B tetragonal kristal yapısını oluşturmak için neodmiyum, demir ve borun alaşımından yapılmış kalıcı bir mıknatıstır (Fraden, β010). Neodmiyum mıknatısların gücü çeşitli faktörlerden kaynaklanmaktadır. Tetragonal Nd2Fe14B kristal yapısı son derece yüksek tek eksenli manyetokristalin anizotropisine sahiptir (Boysen ve Muir, 2011). Bu, maddenin bir kristali belirli bir kristal ekseni boyunca tercihen mıknatıslanır, ancak diğer yönde mıknatıslanması çok zor olduğu anlamına gelir. Neodmiyum atomu aynı zamanda büyük bir manyetik dipol momentine sahip olabilir, çünkü demirdeki üç elektronunun aksine yapısında yedi eşleşmemiş elektrona sahiptir (Chu, 2011). 2. MATERYAL VE METOD 2.1. Materyal Neodmiyum(III) nitrat hekzahidrat (Nd(NO3)3.9H2O), demir(III) nitrat hekzahidrat (Fe(NO3)3.9H2O), borik asit (H3BO3), sitrik asit (C6H8O7), mono etilen glikol (MEG), sodyum bor hidrür (NaBH4), demir(II) klorür tetrahidrat (FeCl2.4H2O), sodyum hidroksit (NaOH), neodmiyum(III) klorür hekzahidrat (NdCl3.6H2O) ve Mg tozu Merck'ten ticari olarak satın alındı ve tekrar saflaştırma işlemi uygulanmadan kullanıldı. İlave bir çözücü olarak deiyonize su ve aseton (Merck) kullanıldı. Elde edilen nihai ürünler, kristal faz kompozisyonunu belirlemek için X-ışını kırınım çalışmalarına [bir Panalytical diffraktometre ve bir Cu Ka radyasyon kaynağı kullanılarak] tabi tutuldu. Bileşiklerin kızılötesi spektrumları ise Perkin Elmer ATR spektrometresi kullanılarak kaydedildi. 2.2. Metod 2.2.1. Nd2Fe14B Sentezi Yöntem A Bu yöntemdeν Nd15Fe77.5B7,5 stokiyometrik oranı baz alınarak neodmiyum(III) nitrat hekzahidrat, demir nitrat hekzahidrat ve borik asit deiyonize suda çözülerek sulu çözeltileri ayrı ayrı hazırlandı ve karıştırıldı. Daha sonra, sitrik asit çözeltisi ve etilen glikol metal tuzlarına oranı βμβμ1 olacak şekilde hazırlandı. Bunu takiben termal olarak kararlı solüsyon oluşturmak için hazırlanmış olan Nd-Fe-B sulu çözeltisine ilave edildi. Ardından çözeltinin viskoz jel olması için λ0 ˚C ısıya maruz bırakıldı. Viskoz jel daha sonra β00 ˚C’de kurutuldu. Kurutulan jel 400 ˚C de β saat kalsine edildi. Sonrasında ise 800 ˚C de tavlanması için yine β saat işlem gördü. Oluşan ürün istenen Nd2Fe14B fazını elde etmek amacıyla redüksiyon-difüzyon işlemine tabi tutuldu. 800 ˚C’de işlem görecek olan ürüne redüksiyon-difüzyon işlemi için 1μβ molar oranında elementel Mg tozu ilave edildi. (Şekil β) Şekil 2. Yöntem A’ya göre Nd2Fe14B sentezinin akış şeması. ORAL PRESENTATION 225 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Yöntem B İlk olarak Fe-B partiküllerini sentezlemek amacıyla, üç boyunlu β50 mL yuvarlak dipli balonun bir girişinden yüksek saflıkta Ar gazı geçirildi. Diğer bir girişinden ise, meydana gelecek olan hidrojen gazının çıkışı sağlandı. Ar atmosferi altında yaklaşık 0.0β mol NaBH 4, 150 mL saf suda çözüldü. Daha sonra hazırlanmış olan NaBH4 çözeltisinin üzerine, FeCl2.4H2O ( 50 mL saf suda 0.014 mol) çözeltisi ilave edildi. Ardından 30 dakika boyunca manyetik karıştırıcıda karıştırıldı. Daha sonra aynı molar oranda ayrıca hazırlanan phμ10’a ayarlanmış NaBH 4 çözeltisi, 1 M NaOH çözeltisi ile muamele edildi. Ve bu çözelti karışımının üzerine 0.00β mol NdCl 3.6H2O ilave edildi. Daha sonra başta hazırlanmış olan Fe-B çözeltisine ilave edilerek yarım saat manyetik karıştırıcıda karıştırıldı. Oluşan ürün birçok kez saf su ve aseton ile yıkandıktan sonra santrifüjlendi, inert atmosferde kurutuldu. (Şekil γ) Şekil 3. Yöntem B’ye göre Nd2Fe14B sentezinin akış şeması. 3. SONUÇ Çalışmadaν Neodmiyum(III) nitrat hekzahidrat, demir(III) nitrat hekzahidrat ve borik asit, Nd-Fe-B jeli sentezlenmek amacıyla kullanıldı. Kalsine edilmiş numunenin fazları ve kristallenmesi, X-ışını toz kırınımı ile tanımlandı. Şekil 4 ve 5’te gösterildiği gibi, sentezlenmiş olan magnetit, neodmiyum demir oksit, hematit, neodmiyum oksitin X-ışını deseni tasvir edildi. XRD deseninde, magnetit, neodmiyum demir oksit, hematit, neodmiyum oksit haricinde başka hiçbir karakteristik pik tespit edilmedi. Yöntem A sonucunda elde edilen ürünün XRD analiz sonucu incelendiğindeν % 78 magnetit, % 15 neodmiyum demir oksit, % 6,β hematit oluştuğu görüldü. Tek fazlı bir kristal yapı meydana gelmediği görüldü. Yöntem B sonucunda elde edilen ürünün XRD analiz sonucu incelendiğinde iseν % λ1 magnetit, % λ neodmiyum oksit oluştuğu görüldü. Bu yöntemde de aynı şekilde tek fazlı bir yapı meydana gelmediği görüldü. Demir oksitin iyonlaşma enerjisi düşük olduğundan dolayı, reaksiyon sonucunda elde edilen ürün daha kararlı yapı olan magnetite dönüşmüştür. FT-IR spektrum sonuçları incelendiğinde, yöntem A sonucunda elde edilen ürünün titreşim spektrumunda 450-500 cm-1 aralığında metal oksitlere ait titreşim piklerinin görülmesi, 160λ cm -1’de neodmiyum demir oksite ait titreşim piklerinin görülmesi, yine Yöntem B sonucunda elde edilen ürünün titreşim spektrumunda aynı şekilde 450-500 cm-1 aralığında metal oksit titreşim piklerinin görülmesi, 1γγ0 cm -1’de neodmiyum oksite ait titreşim piklerinin görülmesi de XRD analiz sonucuyla birbirini desteklemektedir. (Şekil 6 ve 7) ORAL PRESENTATION 226 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 4. Yöntem A’ya göre elde edilen ürünün XRD deseni. Şekil 5. Yöntem B’ye göre elde edilen ürünün XRD deseni. ORAL PRESENTATION 227 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 6. Yöntem A’ya göre elde edilen ürünün FT-IR Spektrumu. Şekil 7. Yöntem B’ye göre elde edilen ürünün FT-IR Spektrumu. TEŞEKKÜR Bu çalışma Düzce Üniversitesi Bilimsel Araştırma Fonu (BAP) tarafından desteklendi (Proje Noμ 2017.05.03.643). KAYNAKLAR Başoğlu M β01γ. Ni Ve Cu Katkılı Nd-Fe-B Mıknatıslarının Üretimi Ve Manyetik Özelliklerinin İncelenmesi, Doktora Tezi, Karadeniz Teknik Üniversitesi. Boysen E, Muir Nancy, C 2011. Nanotechnology For Dummies, 2nd Ed. Chu S 2011. Critical Materials Strategy. United States Department of Energy. Fraden J 2010. Handbook of Modern Sensors: Physics, Designs and Applications, USA. Özdinçer M, Durmuş S, Dalmaz A 2017. Magnetic Spinel-Type CoFe2O4 Nanoparticles: Synthesis and Investigation of Structural, Morphological Properties. Süleyman Demirel Üniversitesi Fen Bilimleri Enstitüsü Dergisi, 21: 311-315. Permanent Magnet of Materials 2007. Permanent Magnet Catalog, Dexter Magnetic Technologies. Yu LQ, Zhang YP, Yang Z, He JD, Donga KT, Hou Y 2013. Chemical Synthesis of Nd2Fe14B/Fe3B Nanocomposites. Journal Name, 00: 1-3. ORAL PRESENTATION 228 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Determining the Optimum Insulation Material through Life Cycle Assessment Figen Balo 1,1, Lutfu Sagbansua2 Firat University, 1 Industrial Engineering Department, Elazig, Turkey 2 Assoc. Prof. of Industrial Engineering, Elazig, Turkey Corresponding author e-mail: figenbalo@gmail.com Abstract Utilization of proper insulation materials in construction industry contributes significantly in providing the required environmental protection and reducing the annual energy demand. Various alternatives for insulation materials exist in order to obtain high energy efficiency and low environmental effects through the design of building insulation. This study aims to determine the best insulation material alternative for buildings considering a set of factors listed throughout the literature and industry standards. These factors mainly indicate the environmental effects and thermal conductivity characteristics of the materials evaluated. A selection method that can take these factors into account during the selection process is required. A hierarchical decision-making method is utilized in this research to determine the optimum insulation material with low thermal conductivity and along with desired environmental characteristics like air pollution, waste water, and solid waste. A life cycle assessment of insulation materials from an environmental point of view based on the multi-criteria decision making method has been presented in this paper. The implementation of this method has allowed an objective assessment of the building sustainability behavior and the required environmental protection while using four groups of criteria. The applied method has shown more accurate estimates of the presented criteria groups with experienced specialists, therefore the result is more objective in comparison to other currently used multi-criteria methods. Keywords: Hierarchical decision-making, Green insulation, Life cycle, Air pollution 1. INTRODUCTION The big part of main energy consumption and CO 2 emissions in architectonics industry originate from insulation materials production and building design. Globally, one-third of bad emissions and over 40% of main energy consumption are related with the architectonics industry and 60% of the mineral sources in the world are used for the building sector [1, 2]. For this reason, the use of proper thermal insulation in buildings contributes in providing the required environmental protect and reducing the annual energy cost [3]. Thus, building envelope could play a significant role in accomplishing high energy efficiency in a building design project. The life cycle evaluation of the building insulation materials is also necessary for the environmentally conscious design. In terms of the environmental effect, implementation of this type of design must generally provide in-depth analysis of the related environmental problems. The life cycle evaluation of the building insulation materials is necessary for the green building assessment. Lately, the multi-criteria decision making methods have been quantitatively used to successfully assess such controversial and complex phenomena. The AHP is a decision assistance tool developed by Saaty [4]. It is one of the most powerful and popular methods for efficient decision making used in advisable project design. With this multi-criteria decision making method, the criteria weights are generally detected according to expert opinion. 1 Corresponding author. E-mail: figenbalo@gmail.com Tel: +90 0424 2370000/5646; Fax: +90 424 2370000 ORAL PRESENTATION 229 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org In the related literature, it can be seen that there are many papers concerning environmental effects of the building insulation materials. Huang et al. provided materials choice to achieve environment friendly design by uncertainty analysis and multi-criteria decision making [5]. Čulákov et al. drafted nearly zero-energy building with optimized materials. With this aim, he studied the multi-criteria decision making analysis of building material choice to decrease environmental effects at all construction options of building external wall [6]. Sabapathy and Maithel evaluated the wall materials that use non-fired products as masonry units. The environmental performance of these wall materials are compared with the multi-criteria decision making method [7]. Tudora analyzed the environmental criteria of building materials from ecological point of view [8]. Parganaa et al. compared the environmental life cycle evaluation of insulation materials in buildings [9]. Vilcekovaa et al. compared the environmental and energy performance of materials used at the exterior walls of the building design [10]. Carreras et al. identified the solutions that improves significantly the environment efficiency for the optimum design with lower environmental effect in building projects. With this aim, environmental and economic solutions are analyzed for the five sites thinking diverse insulation thicknesses in roof and walls [11]. Rosa et al. investigated the environmental effects and building insulation efficiency of novel insulation material solutions for building design projects with low environmental impacts and low thermal conductivity [3]. Tingley et al. researched by comparing the environmental effects of the diverse insulation selection of external walls from the perspective of minimizing effect [12]. Milani et al. evaluated the life cycle for material choice of composites by multi criteria decision making method [13]. In terms of energy savings, Ma et al. compared the three different building insulation materials (rigid foam polyurethane board polystyrene board and rock wool board) on life cycle evaluation. According to the manufacturing of insulation materials in unit mass, the life cycles environmental effects of these insulation materials were investigated [14]. To assess the environmental effects, Perez et al. determined the best environmental option among the building insulation materials for diverse climatic conditions [15]. Tettey et al. determined building designs that fix importantly the environmental effect at the increase in total cost. In addition, they investigated the effects on emissions and energy savings of the diverse insulation materials [16]. Giudice et al. described a novel analysis of the materials choice in the life cycle design procedure by environmental performance and integrating mechanical criteria. Their method utilized a multi-objective analysis technique to show the application of the approach for material selection of a car brake disk [17]. Biswas et al. evaluated the building insulation materials with regard to the environmental effects and life-time energy. According to the author, the environmental effect criteria were evaluated by global warming problem in terms of CO2 emissions and energy consumption [18]. The hazardous environmental effects of insulation materials in fire were determined in terms of performance criteria by Hidalgo et al. [19]. Lolli and Hestnes researched the effect of diverse emissions conversion elements at the selection of insulation materials [20]. Giama analyzed environmental effect assessment along the material’s choice of thermal insulation [21]. Ginevicius et al. evaluated the most energy efficient building insulation material option by different multicriteria assessment methods (VS, GV, COPRAS, VIKOR, TOPSIS and SAW) [22]. In the present research, the life cycle evaluation is described quantitatively the depletion of diverse energies and resources besides the bad emission in the life cycle of manufacturing and the environmental effect of the manufacturing process is evaluated in a systematical nature. This study has applied the life cycle evaluation of four most extensively available building insulation materials (polyurethane, EPS, glass wool and rock wool) by AHP. The study aims to exemplify the fundamental information on the life cycle environmental responsibility of building insulation materials in construction sector, considering the properties of the usage of such insulation materials in diverse sites. Data on life cycle evaluation are obtained from institutions where these insulation materials are manufactured. To build up a sequence of criteria defining the process of environment friendly building insulation material, which can be used in selecting the most proper alternative, a questionnaire applied to the experts from the insulation material products and services, as well as researchers and specialists from reconstruction and construction enterprises is conducted. ORAL PRESENTATION 230 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. ENVIRONMENTAL EFFECTS OF INSULATION MATERIAL: MULTI-CRITERIA MAKING DECISION 2.1. Main and Sub Criteria Environment Friendly Insulation Material Air Pollution M Waste Water Solid Waste acro Global Warm. Water Cons. Energy Cons. Acidific ation Eutrop hicatio n Photo chemi cal CO2 NOx CO SOx CxHy AKM BOD Na+ Cl- KOI Industrial Resi. Mineral Che. Dust 4 4 Fig. 1. The Hierarchy of Criteria The reason for using an AHP-based decision analysis approach in this study is that it allows decision makers to analyze complex decision-making problems using a systematic approach that breaks down the main problem into simpler and affordable sub-problems. In an AHP hierarchy for choosing an insulation material, the goal would be to choose the best material in terms of the selected criteria. This study aims to contribute to the existing literature by helping decision makers in selecting the best material based on various groups of criteria. A set of macro criteria, air pollution, waste water, and solid waste related factors are the four groups of criteria that are evaluated to be the factors reflecting the effects of materials on environment. These criteria can be subdivided into several sub-criteria. In this study, the macro criterion is investigated under six sub-criteria. The air pollution criterion is subdivided into six sub-criteria as well. The waste water criterion comprises of five factors. Finally, the solid waste criterion is measured using four factors. Four alternative materials are compared using AHP technique. The structure of the problem composed of these criteria is constructed as shown in Fig. 1. As it is the case in all multi-criteria decision making methods, the relative weights of criteria need to be determined initially. In AHP, this is accomplished by pairwise comparison of the elements, starting with the main criteria. Fig.2 shows the resulting priorities of four main criteria. These are the resulting weights for the criteria based on pairwise comparisons. ORAL PRESENTATION 231 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org MAIN CRITERIA PRİORİTIES 8,9% 17,8% 43,0% 30,3% Macro Air pollution Waste water Solid Waste Fig. 2. Main Criteria priorities At this point, the comparison of macro criteria set has been made and the AHP method has derived the local priorities for this group which includes global warming, water consumption, energy consumption, acidification, eutrophication, and photochemical effects. These priorities reflect on how much a sub-criterion contributes to the priority of its parent, thus we need to calculate the global priority of each sub-criterion. That will show us the priority of each sub-criterion with respect to the overall goal. The global priorities throughout the hierarchy should add up to one. The global priorities of each sub-criterion in this category are calculated by multiplying their local priorities with the priority of parent criterion. The sub-criteria priorities are given in Fig. 3. Factors related to the air pollution includes CO2, CO, CxHy, NOx, SOx, and dust. In waste water subgroup, there are five sub-criteria (AKM, BOD, KOI, Na+, Cl-) available. These elements are compared as to how significant they are with respect to the waste water. Solid waste factors considered are industrial, residential, mineral, and chemical waste. Comparison of these elements with respect to solid waste leads to the associated weights. 2.2. Pairwise Comparison of the Alternatives with Respect to the Criteria After determining the priorities of each criterion with respect to the overall goal of determining the most environment friendly material and priorities of sub-criteria with respect to their associated main criteria, the alternatives need to be compared two by two with respect to each sub-criterion. The properties of the selected thermal insulation materials for 1m2K/W are presented in Table 1 [23-40]. Table 2 shows life cycle inventory and environmental impacts across the life cycle, for 0.1 m 3 XPS [23-40]. ORAL PRESENTATION 232 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org MACRO AIR POLLUTION PRIORITIES PRIORITIES 40% Lo al… Glo al… 30% 30% 20% 20% 10% 10% 0% 0% 1 40% Local Priority 40% 2 3 4 5 6 1 3 4 5 6 SOLID WASTE PRIORITIES WASTE WATER PRIORITIES Lo al… Glo al… 30% 2 80% Lo al… Glo al… 60% 20% 40% 10% 20% 0% 0% 1 1 2 3 4 2 3 4 5 Fig. 3. Sub-criteria priorities Aır pollutıo su - rıterıa Macro sub- rıterıa M1 M2 M3 M4 M1 120,0% 100,0% 80,0% 60,0% 40,0% 20,0% 0,0% M2 M3 M4 CO2 Waste water sub- rıterıa M1 M2 M3 CO CxHy SOx Local Global Local NOx Global Local Global Global Local Local Global Local Global 120,0% 100,0% 80,0% 60,0% 40,0% 20,0% 0,0% Dust Solıd waste su - rıterıa M4 M1 120,0% 100,0% 80,0% 60,0% 40,0% 20,0% 0,0% M2 M3 M4 AKM BOD Na+ Cl- Industrial Residential Mineral Global Local Global Local Global Local Global Local Global Local Global Local Local KOI Global Global Local Global Local 120,0% 100,0% 80,0% 60,0% 40,0% 20,0% 0,0% Chemical Fig. 4. Priorities of the alternatives for sub-criteria The next step in applying the AHP technique is pairwise comparisons of the alternatives with respect to each sub-criterion. Remainder of this section presents the priorities obtained under each sub-category using this ORAL PRESENTATION 233 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org technique. Fig. 4 shows the resulting weights of the material alternatives for the groups of criteria based on pairwise comparisons. The resulting weights by the principal eigenvector of the decision matrix are given in Table 3. Table 1. Life cycle of insulating material providing thermal insulation for 1m2K/W [23-40] Poliüretan EPS Glass Wool Global Warming g CO2 Equivalent Water Consumption kg Energy Consumption MJ Acidification g SO2 Equivalent 3.200 4.380 2.200 Rock Wool 1.449 297.7 - 47.3 16.6 93.6 71.9 27 3.9 27.9 24 8.4 12.3 Eutrophication g PO4 Equivalent 2.94 2 1.3 1.2 Photochemical Ozone Formation g C2H4 Equivalent 1.4 3 2.5 4.6 CO2 3.4 2.298 1.814 1.421 CO 5 6.2 7.62 105.35 CxHy 6.1 13.18 21 0.02 NOx 8.2 11.97 8.22 2.47 SOx 11 13.38 1.09 6.08 Toz(PM10) 4.3 2.31 0.29 1.19 AKM 23 - 0.583 0.02 BOD 4.7 0.146 - - KOİ 0.82 0.84 0.429 0.05 Na+ Compounds 280 - - 0.01 Cl- 520 2.53 - - Industrial Waste Municipal Solid Waste Mineral Waste Chemical Waste 13 2.25 6.70 - -13 5.92 - 53 79 30.91 - - - 6.42 62.2 1 Air Emissions Waste Water Solid Waste Table 2. For 0.1 m3 XPS, Life Cycle Inventory and Environmental Impacts Across the Life Cycle [23-40] Life Cycle Phases For XPS Production Build Disposal Recycle Global Warming g CO2 Equivalent Water Consumption kg Energy Consumption MJ Acidification g SO2 Equivalent Eutrophication g PO4 Equivalent 14.150 527 6.183 -3.591 39 0.00005 10 -2 323.7 - 7.4 5.2 61.9 46 3 0.002 -9 3 0.0005 0.0004 -0.0008 Photochemical Ozone Formation g C2H4 Equivalent Solid Waste Dangerous 38 0.0003 0.0002 -0.0007 11 - 5 - NonDangerous 7.149 18.7 1.769 -2.803 Radioactive 4 - - -2 ORAL PRESENTATION 234 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 3. The resulting weights are based on the principal eigenvector of the decision matrix Consistency Ratio (CR) Macro Criteria Air Pollution Criteria Waste Water Criteria Solid Waste Criteria Global Warming Water Consumption Energy Consumption Acidification Eutrophication Photochemical CO2 CO CxHy NOx 6.6% Principal Eigen Value 4.180 Eigenvector Solution (Iteration) 5 Elta 0.0% 4.000 1 0.0E+0 6.0% 4.164 5 5.9E-8 3.0% 4.9% 5.8% 4.6% 0.0% 6.6% 4.5% 4.081 4.133 4.158 4.126 4.000 4.180 4.123 4 5 5 5 1 5 4 2.3E-8 1.3E-8 4.7E-8 1.9E-8 0.0E+0 9.0E-8 7.7E-8 SOx Dust AKM BOD KOI Na+ Cl- 5.6% 6.3% 0.0% 5.7% 4.9% 0.0% 0.0% 4.152 4.171 4.000 4.154 4.133 4.000 4.000 4 5 1 5 5 1 1 6.3E-8 8.3E-8 0.0E+0 2.0E-8 1.4E-8 0.0E+0 5.8E-34 Industrial 4.5% 4.123 4 8.4E-8 Residential 6.0% 4.165 5 8.1E-8 Mineral Chemical 6.9% 0.0% 4.187 4.000 4 1 1.3E-8 3.9E-34 9.0E-8 3. CONCLUSIONS Based on the calculations above, the relative priorities corresponding to the attractiveness of each material about all factors of macro, air pollution, waste water and solid waste are presented in Fig 5. Fig. 5 indicates that M4 is the material that contributes most to the overall goal in terms of macro properties, air pollution, and waste water categories with total global priorities of 0.1984, 0.1292, and 0.0821, respectively. GLOBAL PRIRITIES MATERIAL 1 0,45 0,4 0,35 0,3 0,25 0,2 0,15 0,1 0,05 0 MATERIAL 2 MATERIAL 3 MATERIAL 4 Macro Air Pollution Waste water Solid waste Total MATERIAL 1 0,0386 0,0603 0,0143 0,007 0,1198 MATERIAL 2 0,0293 0,0396 0,0364 0,052 0,1572 MATERIAL 3 0,1641 0,0738 0,0453 0,016 0,299 MATERIAL 4 0,1984 0,1292 0,0821 0,014 0,4242 Fig. 5. Global Priorities Fig 5 indicates that M2 has the highest global priority in terms of solid waste considerations. M1 has the lowest score in all categories but air pollution where it is ranked the third. ORAL PRESENTATION 235 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org In overall, adding the global priorities in all categories, the obtained results indicate that the material M4 is the alternative that contributes the most to the goal of choosing the best material that satisfies all the criteria selected. For insulation materials, the evaluation of environmental potential is needed for the environmentally conscious design of sustainable buildings. The purpose of environment friendly insulation materials is to obtain harmless growth in terms of environmental effects, social advances, utilize environment friendly resources financially, guarantee favorable living conditions, and maintain ecological balance for the future and present posterity. The aim of the present work is to choose the most proper environmental insulation material to reduce building energy consumption and its associated negative effect on the environment. A life cycle assessment of insulation materials from an environmental point of view based on the multi-criteria decision making method has been presented in this paper. AHP method used here has utilized a hierarchy of related factors for specialists who have evaluated them using four groups of criteria. For the specialists’ assessment, the outputs obtained from the manufacturers are used. The implementation of this method has allowed an objective assessment of the building sustainability behavior and the required environmental protection while using four groups of criteria. AHP method has shown more accurate estimates of the presented criteria groups with experienced specialists, therefore the result is more objective in comparison to other currently used multi-criteria methods. REFERENCES [1] United Nations Environment Programme, Buildings and Climate Change Status, Summary for DecisionMakers, United Nations Environment Programme, 2009, ISBN: 987-92-807-3064-7. [2] I. Z. Bribian, A.V. Capilla, A.A. Uson, Life cycle assessment of building materials: Comparative analysis of energy and environmental impacts and evaluation of the eco-efficiency improvement potential, Building and environment, 2011, 46(5), 1133-1140. [3] A.D. La Rosa, A. Recca, A. Gagliano, J. Summerscales, A. Latteri, G. Cozzo, G. Cicala, Environmental impacts and thermal insulation performance of innovative composite solutions for building applications, Construction and Building Materials, 2014, 55, 406-414. [4] T.L. Saaty, Decision making with the analytic hierarchy process, International journal services sciences, 2008, 1(1), 83-98. [5] H. Huang, L. Zhang, Z. Liu, J.W. Sutherland, Multi-criteria decision making and uncertainty analysis for materials selection in environmentally conscious design, Int J Adv Manuf Technol, 2011, 52, 421-432. [6] M. Čulákov, S. Vilčekov, J. Katunsk, E.K. Burdov, Multi-Criteria Analysis of Material Selection in order to Reduce Environmental Impacts, Chemical Engineering Transactions, 2013, 35. [7] A. Sabapathy, S. Maithel, A Multi-Criteria Decision Analysis based assessment of walling materials in India, Building and Environment, 2013, 64, 107-117. [8] A.C. Tudora, Assessments criteria of building materials from ecological point of view, Buletinul institutului politehnic din iaşi, Publicat de Universitatea Tehnică, Gheorghe Asachi” din Iaşi Tomul LIV (LVIII), Fasc, 2011, 57(4), 129. [9]N. Parganaa, M.D. Pinheiro, J.D. Silvestre, J. de Brito, Comparative environmental life cycle assessment of thermal insulation materials of buildings, Energy and Buildings, 2014, 82, 466-481. [10] S. Vilcekovaa, A. Sedlakovab, E.K. Burdovaa, J. Vojtus, Comparison of Environmental and Energy Performance of Exterior Walls, Energy Procedia, 2015, 78, 231-236. [11] J. Carreras, D. Boer, L.F. Cabeza, L. Jiménez, G. Guillén-Gosálbez, Eco-costs evaluation for the optimal design of buildings with lower environmental impact, Energy and Buildings, 2016, 119, 189-199. [12] D.D. Tingley, A. Hathway, B. Davison, An environmental impact compariso n of external wall insulation types, Building and Environment, 2015, 85, 182-89. [13] A.S. Milani, C. Eskicioglu, K. Robles, K. Bujun, H. Hosseini-Nasab, Multiple criteria decision making with life cycle assessment for material selection of composites, EXPRESS Polymer Letters, 2011, 5(12), 1062-1074. ORAL PRESENTATION 236 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org [14] L.P. Ma, Q. Jiang, P. Zhao, C.Z. Zhao, Comparative Study on Life Cycle Assessment for Typical Building Thermal Insulation Materials in China, Materials Science Forum, 2014, 787, 176-183. [15] J. Sierra-Perez, J. Boschmonart-Rives, X. Gabarrell, Environmental assessment of façade-building systems and thermal insulation materials for different climatic conditions, Journal of Cleaner Production, 2016, 113, 102113. [16] U.Y.A. Tettey, A. Dodoo, L. Gustavsson, Effects of different insulation materials on primary energy and CO2 emission of a multi-storey residential building, Energy and Buildings, 2014, 82, 369–377. [17] F. Giudice, G. La Rosa, A. Risitano, Materials selection in the life-cycle design process: A method to integrate mechanical and environmental performances in optimal choice, Materials and Design, 2005, 26, 9-20. [18] K. Biswasa, S.S. Shresthaa, M.S. Bhandarib, A.O. Desjarlais , Insulation materials for commercial buildings in North America: An assessment of lifetime energy and environmental impacts, Energy and Buildings, 2016, 112, 256–269. [19] J. P. Hidalgo, S. Welch, J.L. Torero, Performance criteria for the fire safe use of thermal insulation in buildings, Construction and Building Materials, 2015, 100, 285-297. [20] N. Lolli, A.G. Hestnes, The influence of different electricity-to-emissions conversion factors on the choice of insulation materials, Energy and Buildings, 2014, 85, 362-373. [21] E. Giama, A. M. Papadopoulos, Environmental performance evaluation of thermal insulation materials and its impact on the building, Mechanical Engineer, MSc, 2000. [22] R. Ginevicius, V. Podvezko, S. Raslanas, Evaluatıng the alternatıve solutıons of wall ınsulatıon by multı crıterıa methods, Journal of cıvıl engıneerıng and management, 2008, 14(4), 217-226. [23] M. Pfundstein, R. Gellert, M. Spitzner, A. Rudolphi, Insulating Materials: Principles, Materials, Applications, 2008. [24] Thermal insulation handbook, Incorporating the architectural glass industry, the thermal insulation association of southern Africa, 2001. [β5] E. Alkaya, M. Böğürcü, F. Ulutaş,Yaşam döngüsü analizi ve bina isi yalitim malzemeleri için uygulamalar, Çevre Bilim & Teknoloji, β01β, 3(4), 261-274. [26] European Extruded Polystyrene Insulation Board Association – EXIBA “Extruded Polystyrene (XPS) Foam Insulation Environmental Product Declaration According to ISO 140β5” Environmental Construction Products Organisation (ECO), 2010. [27] A. C Schmidt, A comparative life cycle assessment of building insulation products made of stone wool, paper wool and fl ax: Comparative assessment, The International Journal of Life Cycle Assessment 2004, 9(2), 122–129. [β8] IVPU e.V. “Extruded Factory-made Polyurethane Insulation Products Environmental Product Declaration According to ISO 140β5” Environmental Construction Products Organisation (ECO). Institut Bauen und Umwelt e.V., 2010. [29] http://www.eceinsaat.com/Upload/Files/tasyunu.pdf [30] http://energy.gov/energysaver/types-insulation [31] http://www.izobedel.com/isi_yalitimi_satandart_mevduat.html [32] http://www.mmo.org.tr/resimler/dosya_ekler/cf3e258fbdf3eb7_ek.pdf [33] http://www.fao.org/docrep/006/y5013e/y5013e08.htm [34] http://www.homeadvisor.com/cost/insulation/ [35] https://en.wikipedia.org/wiki/Building_insulation_materials [36] http://www.thermaxxjackets.com/5-most-common-thermal-insulation-materials/ [37] http://www.ode.com.tr/insulation-glossary/ [38] (http://www.aaamsa.co.za/images/technical%20publications/tiasa/handbook%20chapter1.pdf) [39] http://www.designingbuildings.co.uk/wiki/Thermal_insulation_for_buildings [40] https://www.gnyapi.com.tr/isi-yalitim-malzemeleri ORAL PRESENTATION 237 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Sakarya Nehri Boyunca Sülfametaksazol, Trimetoprim ve Diklorafenak Mikrokirleticilerin İncelenmesi ve Farklı Ultrafiltrayon Membranlar ile Arıtımı Fatma Büşra Yaman Büyükbüberoğlu*, Mehmet Çakmakçı Yıldız Teknik Üniversitesi, İnşaat Fakültesi, Çevre Mühendisliği Bölümü, İstanbul, Türkiye * Sorumlu yazar e-mail:fbyaman@gmail.com Özet Bu çalışmada Türkiye için önemli su kaynaklarından biri olan Sakarya Nehri boyunca 5 farklı noktadan numune alınarak sülfametaksazol, trimetoprim ve diklorafenak mikrokirleticileri ve çözünmüş organik karbon (ÇOK), ultraviolet absrobance at β54 nm dalga boyu (UVβ54), sertlik, iletkenlik gibi su kalite parametreleri incelenmiş, mikrokirleticilerin giderilmesi ve su kalitesinin iyileştirilmesi amacıyla mikrofiltrasyon (MF) ve ultrafiltrasyon (UF) membranları ile arıtım çalışmaları yapılmıştır. En iyi arıtma verimi UP005 UF membran ile elde edilmiştir. Küçük por çaplı ultrafiltrasyon membranlar ileν TMP, SMX ve DFN gibi sularda çok sıklıkla ve yüksek miktarlarda bulunabilen farmakolojik kirleticilerin %66 ’ya kadar çıkabilen bir verimle arıtılabildiği görülmüştür. Anahtar Kelimeler: sülfametaksazol, trimetoprim ve diklorafenak, ultrafiltrasyon membran 1. GİRİŞ Son zamanlarda yapılan çalışmalarda tıbbi kaynaklı ilaçlar, pestisit gibi tarımsal alanda kullanılan ilaçlar ve kişisel bakım ürünleri gibi genel olarak mikrokirletici adı verilen kimysalların içme suyu kaynağı olarak kullanılan sucul ortamlarda sıklıkla görülmeye başlanmıştır.(Alexander ve ark.,β01β) Bu tip kirleticiler “öncelikli kirleticiler” olarak adlandırılmakta ve ng/L-µg/L gibi düşük konsantrasyonları bile sucul ortamdaki canlılar ve insan sağlığı açısından endişe verici olumsuz sonuçlara yol açmaktadır (Broséus ve ark.,β00λν Shen ve Andrews, β011).Tıp ve veterinerlik kullanımı sonucu 5000‘den fazla ilaç doğaya karışmaktadır (Van Doorslaer ve ark.,β014). Avrupa Birliği (AB)’nde şu an kullanımda olan, farklı terapötik sınıflara ait çok farklı kimyasal özelliklerde, insani kullanım amaçlı yaklaşık 5000 farklı farmasötik madde bulunmaktadır (Wen ve ark.,β014). Son yıllarda yapılan araştırmalar sonucunda farmasötik maddelerin yüzey ve yeraltı sularında geniş bir dağılım gösterdiği görülmüştür Derco ve ark., β015ν Azzouz ve Ballesteros, 2013). Yüzeysel sularda, yeraltı sularında ve içme sularında 150’den fazla farmasötik madde tespit edilmiştir (Cristale ve ark., β01γ). Bu maddeler günlük kullanımdaki yüzlerce ilaç, deterjan, kişisel bakım, zirâi vb. ürünlerden kaynaklanmakta ve genel olarak bunlar literatürde PPCPs ( pharmaceuticals and personal care products) olarak geçmektedir (Shen ve Andrews, β011). Bu atıklar evsel,endüstriyel deşarjlar ile rögar, hastane, mezbaha, tarımsal alanlardan gelen yağmur akışları ve yetersiz arıtma yapan atıksu arıtma tesislerinin deşarjları sonucu su kütlelerine karışabilmektedirler. Şekil 1 (a) ’da kirleticlerin doğaya karışım döngüsü verilmiştir. Su ortamında en büyük endişe ilaç grubunda bulunan antibiyotiklerden kaynaklanmaktadır (Johnson ve ark.,β015). Antibiyotikler çok düşük konsantrasyonlarda bile alg çeşitliliğini azaltmakta ve bakteri direncini artırarak sucul yaşamı olumsuz etkilemektedir (Zhang ve ark.,β016). Antibiyotikler yüksek dayanım güçleri sebebiyle bozunmadan uzun süre alıcı ortamda kalabilmektedirler (Van Doorslaer ve ark.,β014) Sülfametaksazol (SMX) ve Trimetoprim (TMP) ilaçları bronşit ve idrar yolu enfeksiyonlarının tedavisinde genellikle beraber olarak kullanılmaktadır (Daneshvar ve ark.,β01β). Beraber kullanıldıklarında birbirinin etkisini artırmaktadır. Bu ilaçlar veterinerlik alanında da kullanılmaktadır (Yang ve ark.,β014ν Peng ve ark.,2016). ORAL PRESENTATION 238 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org (a) (b) Şekil 1. Kirleticilerin doğaya karışım şekilleri SMX tetrahydrafolik asit sentezleyen enzimleri inhibe eder, TMP ise tetrahydrafolik asiti yok etmek için farklı bir enzim salgılar. Bu sebeple bu iki ilaç 1λ60‘dan beri beraber kullanılmaktadır (Dias ve ark.,β014ν Johnson ve ark.,β015ν Peng ve ark.,β016). TMP ve SMP konvansiyonel atıksu arıtma tesislerinde tamamen arıtılamamakta, yüzeysel sulara kadar ulaşmaktadır (Yang ve ark.,β015ν Zheng ve ark.,β015) Su ortamında SMX’lerin sucul ortamlarda yaygın olarak görülmesi potansiyel ekotoksik etkisi ve bakterilere karşı yüksek dirence sahip olmalarından dolayı büyük endişe oluşturmaktadır (Dias ve ark.,β014). Barnes ve ark.(β008) yaptığı çalışmada yüzeysel sularda SMX’in 1,11 mg/L’ye kadar çıktığını belirtmişlerdir. Loos ve ark.(β00λ) alıcı ortamda SMX’in maksimum 4 mg/L olduğunu görmüşlerdir TMP’nin atıksu arıtma tesisi çıkışında 0,00γ to 4,γ0 µg/L konsantrasyon aralığında olduğu ve bu konsantrasyonun yüzeysel sulara deşarj edildiği belirtilmiştir. Diklorafenak (DCF) reçete olmadan satılan en yaygın nonsteroid antiinflamatuvar ilaçlardan biridir, Avrupa‘da yılda yaklaşık 100 ton satılmaktadır(Esteban ve ark., β016ν Lu ve ark.,β016). DCF suda yaşayan canlılar ve bitkiler üzerinde toksik etkiye sahiptir aynı zamanda insanlarda da hemodinamik değişiklikler ve tiroid tümörlerine neden olduğu belirtilmiştir. DCF’nin tüketildikten sonra %15‘i değişmeden doğaya karışmaktadır. DCF biyolojik olarak birikme eğilimi göstermektedir ve başka ilaçlar ile birleşerek toksik etkisi önemli derecede artmaktadır (Bhadra ve ark.,β016). Atıksu arıtma tesislerinde konvansiyonel arıtımla DCF tam olarak arıtılamadığı için alıcı su ortamlarında da en sık saptanan kirleticilerden biridir (Perisic ve ark.,β016). Félix– Cañedo ve ark. (β01γ) yaptıkları çalışmada yüzeysel sularda DCF konsantrayonunun β8-γβ ng/L olduğunu belirtmişlerdir. Bazı çalışmalarda da yüzeysel sularda 1-γ10 ng/L gibi geniş bir konsantrasyon aralığında bulunduğu belirtilmiştir .( Chong, ve ark.,β017ν Félix–Cañedo ve ark.,β01γ) Mikrokirleticilerin yüzeysel ve yeraltı sularından arıtımı her geçen gün daha çok önem kazanmaktadır. Amerika’da ve Avrupa ülkelerinde yapılan çeşitli araştırmalarda yüzeysel ve yeraltı sularında ve hatta arıtma tesisi çıkış sularında, γ00’ün üzerinde mikrokirleticiye rastlandığı bildirilmiştir. Özellikle tıbbi ilaçlar insan metabolizmasından dışkı ve idrarla ilaç kalıntıları olarak veya ana madde olarak atılmakta ve sucul sistemlere çeşitli yollarla ulaşmaktadırlar (Şekil 1(b)). Bütün bu sebeplerden dolayı her geçen gün mikrokirletici arıtımı önem kazanmaktadır. Son zamanlarda yapılan çalışmalarν koagülasyon/flokülasyon, filltrasyon, klorlama gibi sistemleri içeren klasik (konvansiyonel) içme suyu arıtma tesislerinin mikrokirletici gideriminde etkisiz olduğu belirtilmiş ve ileri arıtım yöntemlerinin uygulanması gerektiği vurgulamıştır (Broséus ve ark.,β00λνFélix– Cañedo ve ark.,β01γ). 2. MATERYAL VE METOD 2.1 Numune Alma Noktaları Çalışmada Sakarya Nehri boyunca 5 farklı noktadan numune alınmıştır. Ilk nokta Sakarya nehrinin doğduğu nokta olan Çiftelerdir. İkinci ve üçüncü noktalar sırasıyla Gökçekaya ve Yenice barajlarıdır. Dördüncü nokta ORAL PRESENTATION 239 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org olarak yerleşmenin ve sanayinin yoğun olduğu bir bölge olan Geyve seçilmiştir. Son numune alma noktası ise Sakarya Nehrinin Karadeniz’e döküldüğü nokta olan Karasu bölgesidir. Böylelikle nehir boyunca doğduğu noktadan denize döküldüğü noktaya kadar hem yüksek kirlilik içermesi (Geyve gibi) hem de yüksek kalitede olması beklenen noktalardan (Gökçekaya ve Yenice barajları gibi) numune alınarak su kalitesi izlenmiş olacaktır. Numune alma noktaları Şekil β’de görülmektedir. Şekil 2 Numune alma noktalarının haritadaki konumu 2.2 Deneysel Yöntem Ham su analizi Tablo 1 ‘de ve yöntemleri ile verilmiştir. Tablo 1.Karakterizasyon için ölçülen parametreler 2.3 Membran Deney Düzeneği Ham suların süzülmesi amacıyla Şekil γ‘de gösterilen Amicon 8400 membran düzeneği kullanılmıştır. Karıştırmalı süzme düzeneğinde bulunan membran hücresinin hacmi 400 ml ve çapı ise 76 mm’dir. Sistem işletilirken magnet manyetik karıştırıcı ile döndürülmekte ve membran yüzeyinde dik filtrasyon sebebiyle ORAL PRESENTATION 240 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org oluşabilecek birikim engellenmektedir. Böylece sistem çapraz akışlı düzeneğe benzer şekilde işletilmiştir. Membran hücresinde istenilen basınç değeri azot gazı ile oluşturulmaktadır. Şekil 3 Membran deney düzeneği 3. SONUÇ Sakarya Nehrinden numune ilkbahar mevsiminde (Mart β015’de) alınmıştır. Tablo γ’de su karakterizasyonu verilmiştir. Numunelerin ortalama pH, sıcaklık ve iletkenlik değerleri sırasıyla 7,76, λ,04 0C, λ01 µS/cm olarak ölçülmüştür. pH ve sıcaklık parametreleri açısından sular 5 noktada da Yüzeysel Su Kalitesi Yönetimi Yönetmeliği (YSKYY)’ne 1. Sınıf su özelliği gösterirken, İçme suyu Elde Edilen veya Elde Edilmesi Planlanan e Yüzeysel Suların Kalitesine Dair Yönetmelik](İSEEPSHY)’e göre de A1 sınıfına girmektedir. İletkenlik değerlerine göre Geyve γ. Sınıf Çifteler, Gökçekaya, Yenice ve Karasu ise β. sınıf su özelliği taşımaktadır. Tablo 3. Sakarya Nehrine ait su karakterizasyonu Deney Adı pH Sıcaklık (0C) İletkenlik (ηS/cm) Çözünmüş oksijen (mg O2/L) Çifteler Gökçekaya Yenice Geyve Karasu TS266 EPA 7,83 7,86 7,88 7,98 7,28 9,5-6.5 6.6-8.5 14,4 15,2 12,28 16,3 14,5 795 858 845 1012 988 2500 7,2 6,9 7,54 7,93 7,2 AKM (mg/L) Bulanıklık(NTU) 20 10,22 26 11,63 28 15 32 20,12 24 18,00 Nitrat (mg NO3/L) 0,32 0,86 0,81 0,99 0,78 Florür (mg F/L) Bromür (mg /L) Demir (mg Fe/L) Mangan (mg Mn/L) Bakır (mg Cu/L) Çinko (mg Zn/L) Nikel (mg Ni/L) 0,61 0,08 < 0,25 < 0,2 < 0,25 0,129 <0,5 0,62 0,17 < 0,25 < 0,2 < 0,25 <0,1 <0,5 <0,1 <2 <1 <0,1 <2 <1 Kadmiyum (mg Cd/L) Toplam krom (mg Cr/L) Kurşun (mg Pb/L) ORAL PRESENTATION 0,19 0,11 0,17 0,18 < 0,25 < 0,25 < 0,2 < 0,2 < 0,25 < 0,25 <0,1 <0,1 <0,5 <0,5 <0,1 <2 <1 <0,1 <2 <1 - - 0,5 45 1,50 0,17 0,07 < 0,25 < 0,2 < 0,25 <0,1 <0,5 0,002 2 1 0,2 0,05 2 5 0,002 <0,1 <2 <1 0,005 0,005 0,01 0,005 0,05 0,015 0,2 0,05 - 241 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Deney Adı Çifteler Gökçekaya Yenice Geyve Karasu TS266 EPA Sülfat (mg SO4/L) 187 189 Klorür (mg CI/L) 21,99 UV254 (cm -1) 0,026 TOK (mg/L) 140 97 128 250 250 87,47 84,9 0,104 0,198 57,48 40 250 250 0,185 0,137 - - 9,72 10,12 11,6 13,62 12,4 - - SUVA254 0,27 0,87 1,71 1,27 1,1 - - Alkalinite(mg CaCO3/L) Sertlik (mg CaCO3/L) Sülfametaksazol (ng/L) Trimetoprim (ng/L) Diklorafenak (ng/L) 330 464 0 0 13,26 260 400 17,6 2,1 0,4 255 386 31,2 1,5 1,2 250 348 15,2 0 0,2 265 328 13,2 0 0,4 - - Organik madde giderimi için numunelerin UV254 ve ÇOK giderim verimleri kıyaslanmıştır. Şekil 4.’de UV 254, ÇOK, giderim verimleri verilmiştir. En yüksek UV 254 giderimi UP005 membranı ile %46 ile Geyve’de elde edilirken en düşük UV254 giderimi ise %1γ ile Çifteler ve Gökçekaya’da MV0β0 membranı ile elde edilmiştir. ÇOK giderim verimleri ise en düşük MV0β0 membran ile %10 Çifteler’de, en yüksek giderim verim ise UP005 membran ile %61 Geyve’de görülmüştür. UP0β0 membranında görülen en düşük ve en yüksek ÇOK giderim verimi ise sırasıyla %15 Çifteler ve %βλ Gökçekaya’da görülmüştür. Sutherland ve ark.(β015) tarafından yapılan çalışmalarda <10 kDa UF membranlar ile γ7-87% arasında ÇOK giderimi sağlanmıştır. Bu çalışmada da membranların gözenek boyutu veya moleküler ağırlığı azaldıkça organik madde giderme verimi artmıştır. Şekil 5 ‘de Mikrokirleticilerin membran ile giderim verimi verilmiştir. MV0β0 membran ile her üç kirletici için giderim veriminin %1 ile β arasında olduğu ve mikrofiltrasyon membran ile mikrokirleticilerin gideriminin yok denecek kadar az olduğu görülmüştür. En yüksek giderim %66 ile Karasu ve Çifteler ‘de UP005 membran ile SMX ‘de görülürken onu %6γ ve %61 ile Geyve ve Gökçekaya takip etmiştir. UP005 membran ile TMP ‘nin arıtım verimi %5λ ile %46 DFN ‘nin ise %55 ile %44 arasında bulunmuştur. UP0β0 membran ile ise giderim %β1 ve %1β arasında değişim göstermiştir. Küçük por çaplı ultrafiltrasyon membranlar ile TMP, SMX ve DFN gibi sularda çok sıklıkla ve yüksek miktarlarda bulunabilen farmakolojik kirleticilerin %66 ’ya kadar çıkabilen bir verimle arıtılabildiği görülmüştür. Şekil 4. Organik maddelerin membran ile giderim verimi ORAL PRESENTATION 242 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 5. Mikrokirleticilerin membran ile giderim verimi 3. TARTIŞMA Türkiye‘nin dördüncü büyük su kaynağı olan Sakarya Nehri boyunca nehrin doğduğu ve denize döküldüğü noktaya kadar 5 farklı noktadan dört farklı mevsimde numune alınarak karakterizasyon ve SMX, TMP, ve DFN giderimi çalışılmıştır. Su Kalitesi Kontrol yönetmeliği su kalitesi sınıflarına göre Sakarya Nehri pH açısından 1. Sınıf iletkenlik açısından Geyve’de γ. Sınıf diğer noktalarda ise β. su özelliği göstermektedir. Su karakterizasyonlarına göre Sakarya Nehiri’nin en temiz noktası nehrin doğduğu nokta olan Çifteler ve en kirli nokta ise sanayilerin ve yerleşimin yoğun olarak bulunduğu Geyve’dir. Bu çalışmada ilk defa Sakarya Nehri’nde mikrokirleticiler nehir boyunca incelenmiştir. Hem en yüksek organik madde hem de en yüksek mikrokirletici giderimin UP005 membran ile olduğu görülmüştür. Sakarya Nehri içme suyu kaynağı olarak kullanılması durumunda ilk tercih edilecek noktanın Çifteler olması gerekmektedir. Diğer noktalar veya yakın civarlarından su alınacak ise ızgaralar, biriktirme yapısı, konvansiyonel arıtma ve sonrasında ise membran ile arıtım tercih edilmelidir. Geyve ve Karasu noktasında nehrin kirlendiği göz önüne alınırsa bu noktalardaki yerleşim yerlerinin ve kontrolsüz deşarj yapabilecek noktaların denetlenmesi ve gerekli önemlerin alınması gerekmektedir. TEŞEKKÜR Bu Çalışma YTÜ Bilimsel Araştırma Projeleri Koordinatörlüğü (BAPK) tarafından desteklenmiş olup (β015-0502-DOP0γ), koordinatörlük çalışanlarına da proje faaliyetleriyle ilgili yardımlarından dolayı teşekkür ederim. Deneysel çalışmalar aşamasında desteklerini esirgemeyen Ebubekir YÜKSEL’e teşekkürlerimi sunarım. KAYNAKLAR Alexander JT. Hai F I, Al-Aboud TM 2012. Chemical coagulation-based processes for trace organic contaminant removal: current state and future potential, J Environ Manage, 111: 195-207. ORAL PRESENTATION 243 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org An Y, Wang Z, Wu Z, Yang D, Zhou Q 2009. Characterization of membrane foulants in an anaerobic nonwoven fabric membrane bioreactor for municipal wastewater treatment, Chemical Engineering Journal, 155: 709-715. Azzouz A ve Ballesteros E 2013. Influence of seasonal climate differences on the pharmaceutical, hormone and personal care product removal efficiency of a drinking water treatment plant, Chemosphere, 93: 20462054. Barnes KK, Kolpin, DW, Furlong ET, Zaugg SD, Meyer MT, Barber LB 2008. A national reconnaissance of pharmaceuticals and other organic wastewater contaminants in the United States--I) groundwater", Sci Total Environ, 402: 192-200. Bhadra BN, Seo PW, Jhung SH, 2016 Adsorption of diclofenac sodium from water using oxidized activated carbon, Chemical Engineering Journal, 301: 27-34. Broséus R. Vincent S, Aboulfadl K, Daneshvar A, Sauvé S, Barbeau B, Prévost M β00λ. Ozone oxidation of pharmaceuticals, endocrine disruptors and pesticides during drinking water treatment, Water Res, 43: 4707-4717. Chong S, Zhang G, Wei Z, Zhang N, Huang T, Liu Y 2017. Sonocatalytic degradation of diclofenac with FeCeOx particles in water", Ultrasonics Sonochemistry, 34: 418-425. Cristale J, Katsoyiannis A, Sweetman AJ, Jones KC, Lacorte S 2013. Occurrence and risk assessment of organophosphorus and brominated flame retardants in the River Aire (UK), Environ Pollut, 179: 194200. Daneshvar A, Aboulfadl K, Viglino L, Broseus R, Sauve S, Madoux-Humery AS., Weyhenmeyer GA, Prevost M. 2012 Evaluating pharmaceuticals and caffeine as indicators of fecal contamination in drinking water sources of the Greater Montreal region, Chemosphere, 88: 131-139. Derco J, Dudáš J, Valičková M, Šimovičová K, Kecskés J β015. Removal of micropollutants by ozone based processes, Chemical Engineering and Processing: Process Intensification, 94: 78-84. Dias, IN, Souza BS, Pereira JHOS, Moreira FC, Dezotti M, Boaventura RAR, Vilar VJP 2014. Enhancement of the photo-Fenton reaction at near neutral pH through the use of ferrioxalate complexes: A case study on trimethoprim and sulfamethoxazole antibiotics removal from aqueous solutions, Chemical Engineering Journal, 247: 302-313. Drinking Water Contaminants – Standards and Regulations: EPA 2003 Esteban S, Moreno-Merino L, Matellanes R, Catalá M, Gorga M, Petrovic M, López de Alda M, Barceló D Silva A, Durán J, López-Martínez J, Valcárcel Y, β016 Presence of endocrine disruptors in freshwater in the northern Antarctic Peninsula region, Environ Res, 147: 179-192. Félix–Cañedo TE, Durán–Álvarez JC, Jiménez–Cisneros B 2013 The occurrence and distribution of a group of organic micropollutants in Mexico City's water sources, Science of The Total Environment, 454-455: 109-118. Fu G,Peng J, Wang Y, Zhao S, Fang W, Hu K, Shen J, Yao J 2016. Pharmacokinetics and pharmacodynamics of sulfamethoxazole and trimethoprim in swimming crabs (Portunus trituberculatus) and in vitro antibacterial activity against Vibrio: PK/PD of SMZ-TMP in crabs and antibacterial activity against Vibrio, Environmental Toxicology and Pharmacology, 46: 45-54. İçmesuyu Elde Edilen veya Elde Edilmesi Planlanan Yüzeysel Suların Kalitesine Dair Yönetmelik Orman ve Su İşleri Bakanlığı, (βλ Haziran β01β). Johnson AC, Keller V, Dumont E, Sumpter JP. 2015. Assessing the concentrations and risks of toxicity from the antibiotics ciprofloxacin, sulfamethoxazole, trimethoprim and erythromycin in European rivers Sci Total Environ, 511: 747-755. Kim HC ve Yu MJ, 2007. "Characterization of aquatic humic substances to DBPs formation in advanced treatment processes for conventionally treated water, J Hazard Mater, 143: 486-493. Loos R, Gawlik BM, Locoro G, Rimaviciute E, Contini S, Bidoglio G 2009 EU-wide survey of polar organic persistent pollutants in European river waters, Environ Pollut, 157: 561-568 ORAL PRESENTATION 244 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Lu X, Shao Y, Gao N, Chen J, Zhang Y, Wang Q,mLu Y 2016 Adsorption and removal of clofibric acid and diclofenac from water with MIEX resin", Chemosphere, 161: 400-411. Perisic DJ. Gilja V, Stankov MN. Katancic Z, Kusic H, Stangar UL, Dionysiou DD, Bozic AL 2016 Removal of diclofenac from water by zeolite-assisted advanced oxidation processes, Journal of Photochemistry and Photobiology A: Chemistry, 321: 238-247. Petrie B., Barden R, Kasprzyk-Hordern B 2015 A review on emerging contaminants in wastewaters and the environment: Current knowledge, understudied areas and recommendations for future monitoring, Water Res, 72: 3-27. Rivera-Utrilla J, Daiem MM, Sanchez-Polo M, Ocampo-Perez R, Lopez-Penalver, JJ, Velo-Gala I, Mota AJ 2016 Removal of compounds used as plasticizers and herbicides from water by means of gamma irradiation, Sci Total Environ, 569-570: 518-526. Shen R ve Andrews SA 2011. Demonstration of 20 pharmaceuticals and personal care products (PPCPs) as nitrosamine precursors during chloramine disinfection, Water Res, 45: 944-952. Su T, Deng H, Benskin JP, Radke M, 2016 Biodegradation of sulfamethoxazole photo-transformation products in a water/sediment test, Chemosphere, 148: 518-525. Sutherland S, Parsons SA, Daneshkhah A, Jarvis P, Judd SJ 2015 THM precursor rejection by UF membranes treating Scottish surface waters. Separation and Purification Technology, 149: 381-388. TSβ66 Standartları - İnsanь Tüketim Amaçlı Sular. β005 Van Doorslaer X, Dewulf J, Van Langenhove H, Demeestere K 2014. Fluoroquinolone antibiotics: An emerging class of environmental micropollutants, Science of The Total Environment, 500-501: 250-269. Van Doorslaer X. Dewulf J, Van Langenhove H, Demeestere K, 2014 Fluoroquinolone antibiotics: An emerging class of environmental micropollutants, Science of The Total Environment, 500-501: 250-269. Wang Z, Wu Z, Yin X, Tian L, 2008. Membrane fouling in a submerged membrane bioreactor (MBR) under sub-critical flux operation: Membrane foulant and gel layer characterization, Journal of Membrane Science, 325: 238-244. Wang Z. Chen Z, Chang J, Shen J. Kang J, Chen Q 2015 Fabrication of a low-cost cementitious catalytic membrane for p-chloronitro benzene degradation using a hybrid ozonation-membrane filtration system", Chemical Engineering Journal, 262: 904-912 Wen ZH, Chen L. Meng XZ, Duan YP, Zhang ZS, Zeng EY, 2014 Occurrence and human health risk of wastewater-derived pharmaceuticals in a drinking water source for Shanghai, East China, Sci Total Environ, 490: 987-993. Yang GC, Yen CH, Wang CL, 2014. Monitoring and removal of residual phthalate esters and pharmaceuticals in the drinking water of Kaohsiung City, Taiwan, J Hazard Mater, 277: 53-61. Yang L, Kim D, Uzun H. Karanfil T, Hur J.2015 Assessing trihalomethanes (THMs) and Nnitrosodimethylamine (NDMA) formation potentials in drinking water treatment plants using fluorescence spectroscopy and parallel factor analysis, Chemosphere, 121: 84-91. Yüzeysel Su Kalitesi Yönetimi Yönetmeliği, Ankaraμ Orman ve Su İşleri Bakanlığı, (γ0 Kasım β01β). Zhang Y, Wang A, Tian X, Wen Z, Li D, Li J. 2016 Efficient mineralization of the antibiotic trimethoprim by solar assisted photoelectro-Fenton process driven by a photovoltaic cell, J Hazard Mater, 318: 319-328. Zheng D, Andrews RC, Andrews SA, Taylor-Edmonds L, 2015 Effects of coagulation on the removal of natural organic matter, genotoxicity, and precursors to halogenated furanones, Water Res, 70: 118-129. ORAL PRESENTATION 245 POSTER PRESENTATIONS International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Polypropylene/synthetic hydroxyapatite polymer composites: physical friction and wear behaviors Elif ULUTAS1 Munir TASDEMIR2 1 2 Marmara University, Ins. for Graduate Studies in Pure and Appl. Sci., Istanbul 34722, Turkey Marmara University, Technology Faculty, Metallurgy and Materials Eng. Dep., Istanbul 34722, Turkey elifulutas24@gmail.com Abstract In this investigation, composites of polypropylene, synthetic hydroxyapatite and maleic anhydride powder were prepared. The effects of synthetic hydroxyapatite and maleic anhydride powder ratio on the physical, friction and wear properties of the polymer composites are presented. Synthetic hydroxyapatite powder (30 wt %) was added to PP to produce composites. Maleic anhydride powder, in four different concentrations (1, 5, 10 and 15 wt %), were added to PP to produce composites as well. The physical properties, including the vicat softening point, heat deflection temperature, melt flow index and water absorption of the composites were investigated. On the other hand, the friction properties, including the static friction, and the wear properties of the composites were investigated as well. The structure of the composites were investigated by scanning electron microscopy and compared to friction and wear properties as a function of maleic anhydride powder content. Keywords: Mechanical properties, synthetic hydroxyapatite, polypropylene, bio composites 1. INTRODUCTION Hydroxyapatite (HA) reinforced polymer bio composites were first conceived by W. Bonfield and colleagues [1–6] as a bone analog biomaterial enabling mechanical properties to be tailored to mimic those of bone tissue. Polyolefin cannot interact by themselves effectively with living tissues. Hence, hydroxyapatite (HA), a material highly compatible with those of bones and bioactive, has been incorporated into polyethylene and polypropylene to obtain bone implants or substitutes. In fact, hydroxyapatite is one of the major components of human bones [7]. These composites comprise a polymeric ductile matrix and a stiffer ceramic dispersed phase. However, some incompatibility problems arise when hydroxyapatite is mixed with non-polar polymers. Thus, to obtain an effective compatibility between the hydroxyapatite and the polyolefin, a third component has to be incorporated into the composite. This compatibilizer must contribute to promote the interaction among the phases. Albano et al. have incorporated coupling agents [8,9], functionalized polyolefin [10] and copolymers of ethylene-acrylic acid [11] into composites of high-density polyethylene and HA. Recent progress in nanotechnology has allowed the synthesis of nanomaterials with excellent physical and mechanical properties [12] as well as biocompatibility [13,14]. For example, synthetic nanoscale HA strongly promotes the adhesion and proliferation of osteoblasts [15–17]. Liao et all [18] prepared polypropylene (PP) composites with 5–20 wt% HA nanorods (HANRs). The results showed that the addition of 20 wt% HANRs (6.67 vol%) to PP improves its mechanical performance and biocompatibility. PP exhibits excellent chemical resistance, durability, dimensional stability, and flexibility. PP exhibits higher fatigue resistance than HDPE, and thus can replace ductile HDPE for biomedical implants experiencing frequent cyclic stress. The wear resistance of polymer composites is significantly decreased and increased depending upon the type of particles, particles size and size distribution, interfacial actions between polymer matrix and fillers, as well as wear test conditions, i.e., wear mode, sliding distance, applied load, test temperature, and humidity [19]. In recent years, thermoplastic resin/mineral filler composites have been widely used in molded products due to effective cost reduction. Much effort has been devoted to improving the properties of polymers by the addition of inorganic fillers, such as Talc, SiO 2, ZnO, CaCO3, and carbon fibers [20-25]. In this investigation, composites of polypropylene, synthetic hydroxyapatite and maleic anhydride powder were prepared. The effects of synthetic hydroxyapatite and maleic anhydride powder ratio on the physical, friction and wear properties of the polymer composites are presented. Synthetic hydroxyapatite powder (30 wt %) was added to PP to produce composites. Maleic anhydride powder, in four different concentrations (1, 5, 10 and 15 wt %), were added to PP to produce composites as well. POSTER PRESENTATION 247 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS and METHODS 2.1 Compositions and Materials Six different polymer composites were prepared. Compositions of polypropylene/hydroxyapatite/maleic anhydride grafted polypropylene (PP/HA/MA) polymer composites that were formed are given in Table 1. PP (Moplen EP 3307) supplied by Lyondell Basell. Its density is 0.900 g/cm 3, MFI value is 15 g/10 min (230 o C, 2,16 Kg) and its head deflection temperature (0.45 MPa, unannealed) is 95.0 oC. Synthetic hydroxyapatite (acros 371260010) supplied by Acros Organics. Table 1. Composition of the PP/HA/MA polymer composites formulations Groups Polypropylene (wt %) Hydroxyapatite (wt %) 1 2 3 4 5 6 100 70 70 70 70 70 30 30 30 30 30 Maleic anhydride (wt %) 1 5 10 15 2.2 Sample Preparation Polypropylene, synthetic hydroxyapatite and maleic anhydride were dried overnight at 105 oC for 24 h in a vacuum oven prior to melt blending. Mechanical premixing of solid compositions was done using a LB-5601 liquid-solids blender (The Patterson-Kelley Co., Inc.USA) brand batch blender for 15 min. Samples with various proportions of PP/HA/MA polymer composites were produced between 180-220 oC at 15 bar pressure, and a rotation rate of 25 rpm, with a Microsan extruder (Microsan Instrument Inc. Turkey). Polymer composites were also dried in vacuum oven at 105 oC for 24 hours after extrusion. Subsequently, test samples were manufactured by injection molding. Injection temperature was 180-220 oC, pressure was 90-110 bar and screw speed was 25 rpm. 2.3 Test Procedure Flow behavior testing of all the mixtures was done according to ISO 1133 standard with Zwick 4100 MFI equipment. Heat deflection temperature (HDT) and Vicat softening point tests were done according to ISO 75 and ISO 307 standard with determined by CEAST 6521 (Ceast SpA, Italy) HDT-Vicat test equipment. Water absorption (WA) test was carried out according to ISO 62. Three specimens for each type of composite were used in the WA test. The conditioned specimens were entirely immersed for 1 day in a container of water at βγ± β oC. At the end of immersion time, the specimens were taken out from the water and all surface water was removed with a clean dry cloth. The specimens were immediately weighed to the nearest 0.01 g. The wear tests were done according to the DIN 53 516 method with Devotrans DA5 (Devotrans quality control test equipment Istanbul-Turkey) abrasion test equipment. The thickness of the test specimens was 7.0 mm and diameter was 15.5 mm. Cylinder rotational speed was selected as 40 rpm and normal load (FN) of 10N was used. Total sliding distance (L) was 40 m. The mass loss of the samples (Δm) was measured after the wear process, and the specific wear rates (Ws) were calculated using the following equation: Ws=(Δm) / ρ.FN.L (mm3/Nm) (1) Where Δm is the specimen’s mass loss, ρ is the density of specimen, F N is the normal load applied, and L is the total sliding distance. Static coefficient of friction: The force increases linearly to a maximum which represents the static frictional force FS. Measurements made at a high friction drag permit the dynamic coefficient of friction to be calculated, but not the static coefficient of friction. The static coefficient of friction µs is given by the equation, POSTER PRESENTATION 248 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org µs=FS/FP (2) Where FS is the static frictional force, expressed in Newton, FP is the normal force exerted by the mass of the sled, expressed in Newton (=1.96 N) [26]. The friction coefficients and wear rates reported in the present study were the averages of at three measurements. The fractured surfaces of the PP/HA/MA polymer composites were coated to thickness of β0 Å of a gold (Au) to prevent electrical charging by Polaron SC7640 (high resolution sputter coater) (United Kingdom). The surfaces of the prepared samples were observed by the FEI Sirion XL30 FEG (Nederland) scanning electron microscopy (SEM) at an acceleration voltage of 10 and 20 kV. 3. RESULT and DISCUSSION 3.1 Physical properties of the PP/HA/MA polymer composites The effects of hydroxyapatite and maleic anhydride content on the physical properties of the PP/HA/MA polymer composites are given in Figure 1. The relationship between the heat deflection temperature and the percentage of the maleic anhydride of PP composites is shown in the Figure 1-A. With inclusion of maleic anhydride particles in the polymer matrix the heat deflection temperature of the composite is found to be decreasing. For example, the heat deflection temperatures of the five different samples (with 0, 1, 5, 10 and 15 wt% of maleic anhydride) are measured as 68.33, 65.07, 63.0, 62.3 and 61.33 oC respectively. The heat deflection temperature of pure PP is 65.47 oC. In comparison with the heat deflection temperature of virgin PP, the heat deflection temperature decreased by 6% for the composites with a 15 wt % maleic anhydride concentration. The relationship between the Vicat softening point and the percentage of the maleic anhydride of PP composites is shown in the Figure 1-B. With inclusion of maleic anhydride particles in the polymer matrix the Vicat softening point of the composite is found to be decreasing. For example, the Vicat softening point of the five different samples (with 0, 1, 5, 10 and 15 wt% of maleic anhydride) are measured as 145.95, 140.15, 139.2, 138.1 and 136.05 oC respectively. The vicat softening point of pure PP is 144.85 o C. In comparison with the vicat softening point of virgin PP, the vicat softening point decreased by 6% for the composites with a 15 wt % maleic anhydride concentration. Group 1 PP (100) Group 2 PP/HA (70/30) Group 3 PP/HA/MA (70/30/1) Group 4 PP/HA/MA (70/30/5) Group 5 PP/HA/MA (70/30/10) 74 68,33 69 65,47 64 63 62,3 155 150 61,33 65,07 Group 1 PP (100) Group 2 PP/HA (70/30) Group 3 PP/HA/MA (70/30/1) Group 4 PP/HA/MA (70/30/5) Group 5 PP/HA/MA (70/30/10) 160 Vicat Softening Point (oC) (1Kg) HDT (°C) (1.8 MPa) 79 145,95 144,85 145 140,15 140 59 138,10 136,05 135 54 130 0 5 10 Maleic Anhydride (wt%) 15 0 5 10 Maleic Anhydride (wt%) A 0,160 15,68 0,120 Water Absorption (%) 15 12,70 12,34 9,51 4,60 Group 1 PP (100) Group 2 PP/HA (70/30) Group 3 PP/HA/MA (70/30/1) Group 4 PP/HA/MA (70/30/5) Group 5 PP/HA/MA (70/30/10) 0,0766 0,0757 0,0603 0,0364 0,040 5,51 3 0,1001 0,080 11 7 15 B Group 1 PP (100) Group 2 PP/HA (70/30) Group 3 PP/HA/MA (70/30/1) Group 4 PP/HA/MA (70/30/5) Group 5 PP/HA/MA (70/30/10) 19 MFI (g/10 min) (280°C/10 kg) 139,20 0,0319 0,000 0 5 10 Maleic Anhydride (wt%) C 15 0 5 10 Maleic Anhydride (wt%) 15 D Figure 1. Physical properties of PP/HA/MA polymer composites POSTER PRESENTATION 249 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The relationship between the melt flow index and the percentage of the maleic anhydride of PP composites is shown in the Figure 1-C. With inclusion of maleic anhydride particles in the polymer matrix the melt flow index of the composite is found to be increasing. For example, the melt flow index of the five different samples (with 0, 1, 5, 10 and 15 wt% of maleic anhydride) is measured as 4.6, 5.51, 9.51, 12.7 and 15.68 g/10min respectively. The the melt flow index of pure PP is 12.34 g/10min. The melt flow index increased by 240% for the composites with 15 wt % maleic anhydride when comparison with PP/HA (70/30) concentration. The relationship between the water absorption and the percentage of the maleic anhydride of PP composites is shown in the Figure 1-D. With inclusion of maleic anhydride particles in the polymer matrix the water absorption of the composite is found to be decreasing. For example, the water absorption of the five different samples (with 0, 1, 5, 10 and 15 wt% of maleic anhydride) is measured as 0.1001, 0.0766, 0.0757, 0.0603 and 0.0364 % respectively. The the water absorption of pure PP is 0.0319 %. The water absorption decreased by 64% for the composites with 15 wt % maleic anhydride when comparison with PP/HA (70/30) concentration. 3.2 Wear and friction properties of the PP/HA/MA polymer composites Obviously, the tribological processes involved in this investigation are complex. The effects of maleic anhydride content on the tribological behaviors of PP composites were examined. The wear loss for various specimens sliding distance against the sand paper (#60) under 10N load and 0,32 m/s abrasion speed. The values of wear rate is shown in Figure 2-A. The wear rate of PP/HA/MA composites decreases as the maleic anhydride concentration increases from 0 to 15 wt %, which could be attributed to the adhesion between the fillers and polymer matrix. Static friction performance is shown in Figure 2-B when speed was 100mm/min; load separately was 1.96, 2.94, 3.92, 4.90 and 6.86 N respectively. It is seen that the load had a great effect on the static friction coefficient of the composite. As the load increases, the static friction coefficient of all kinds of composites increases. Figure 2-B shows that static coefficient of friction of PP/HA/MA (70/30/15, load: 1.96 N) is much lower than that of pure PP. Same situation was seen PP/HA/MA (70/30/15, load: 6.86 N) composites at 100mm/min. 0,08 0,0661 0,0602 0,0624 0,06 0,0545 0,0532 Static Friction Wear Rate (cm3/Nm 10-3) 1,2 Group 1 PP (100) Group 2 PP/HA (70/30) Group 3 PP/HA/MA (70/30/1) Group 4 PP/HA/MA (70/30/5) Group 5 PP/HA/MA (70/30/10) Group 6 PP/HA/MA (70/30/15) 0,10 0,8 Group 1 PP (100) Group 2 PP/HA (70/30) Group 3 PP/HA/MA (70/30/1) Group 4 PP/HA/MA (70/30/5) Group 5 PP/HA/MA (70/30/10) Group 6 PP/HA/MA (70/30/15) 0,4 0,04 0,0319 0 0,02 0 5 10 Maleic Anhydride (wt%) 15 1,96 2,94 3,92 4,9 Applied Load (N) A 6,86 B Figure 2. Wear and friction properties of the PP/HA/MA polymer composites 3.3 Morphological properties of the PP/HA/MA polymer composites The SEM study was carried out to study the dispersion of hydroxyapatite in the PP matrix. The boundaries and the contrast can be obviously seen between the hydroxyapatite and PP matrix on the fractured surfaces of polymer matrix (Figure 3). The micrographs indicate that the all particulates are homogeneously dispersed on the fractured surfaces of polymer matrix. POSTER PRESENTATION 250 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Pure PP PP/HA (70/30) PP/HA/MA (70/30/5) PP/HA/MA (70/30/10) PP/HA/MA (70/30/1) PP/HA/MA (70/30/15) Figure 3. SEM photograph of PP/HA/MA polymer composites 4. CONCLUSIONS The effects of hydroxyapatite and maleic anhydride on the some properties, vicat softening point, heat deflection temperature, melt flow index, water absorption, static friction, wear properties and morphological of PP/HA/MA composites were investigated. It has marginal effects on some properties of the composites. The following results were obtained: 1. Heat deflection temperature, vicat softening point and water absorption values of PP/HA/MA composites decreased as the maleic anhydride concentration increases. On the other hand, MFI values increased as the maleic anhydride concentration increases. 2. The wear rate of PP/HA/MA composites decreases as the maleic anhydride concentration increases from 0 to 15 wt %. 3. The addition of maleic anhydride to the PP changed significantly the friction coefficient of the composites. Applied load had a great effect on the friction coefficient of composites 4. The micrographs indicate that the HA particulates are homogeneously dispersed on the fractured surfaces of PP matrix. ACKNOWLEDGEMENT This work has been supported by the Scientific Research Project Program of Marmara University REFERENCES [1] W. Bonfield et al., 1981. “Hydroxyapatite Reinforced Polyethylene-A Mechanically Compatible Implant Material for Bone Replacement,” Biomaterials, β, pp. 185–186. [2] W. Bonfield, 1988. “Composites for Bone Replacement,” J. Biomed. Eng., 10 (6), pp. 522–526. [3] M. Wang, D. Porter, and W. Bonfield, 1994. “Processing, Characterisation, and Evaluation of Hydroxyapatite Reinforced Polyethylene Composites,” Brit. Ceram. Trans., λγ (γ), pp. 91–95. [4] M. Wang, R. Joseph, and W. Bonfield, 1998. “Hydroxyapatite Polyethylene Composites for Bone Substitution: Effects of Ceramic Particle Size and Morphology,” Biomaterials, 1λ (β4), pp. 2357–2366. [5] P.T.T. That, K.E. Tanner, and W. Bonfield, 2000. “Fatigue Characterization of a HydroxyapatiteReinforced Polyethylene Composite. I. Uniaxial Fatigue,” J. Biomed. Mater. Res., 51 (3), pp. 453–460. [6] L.D. Silvio, M.J. Dalby, and W. Bonfield, 2002. “Osteoblast Behaviour on HAP/PE Composite Surfaces with Different HA Volumes,” Biomaterials, βγ, pp. 101–107. POSTER PRESENTATION 251 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org [7] R. Perera, C. Albano, R. Casella, L. Cataño, A. Karam, G. González, 1λλλ. SPE/ANTEC Proceedings. [8] C. Albano, R. Perera, G. González, A. Karam, N. Domínguez, Y. Sánchez, J. Puerta, 2006. Mol. Cryst. Liq. Cryst., 448, 251. [λ] C. Albano, R. Perera, A. Karam, G. González, N. Domínguez, Y. Sánchez, J. Brito, 2007. Macrom. Symp., 247, 190. [10] C. Albano, R. Perera, L. Cataño, S. Alvarez, A. Karam, G. González, Y. Sánchez, β008. Proc. of 4th International Symposium on Nanostructured and Functional Polymer-Based Materials and Nanocomposites (NANOFUN POLY), Rome, Italy. [11] C. Albano, L. Cataño, L. Figuera, R. Perera, A. Karam, G. González, K. Noris, 2009. Polym. Bull., 62, 45. [12] Tjong SC, Chen H., 2004. Nanocrystalline materials and coatings. Mater Sci Eng R Rep., 45(1–2):1–88. [13] Yang L, Zhang LJ, Webster TJ, 2011. Nanobiomaterials: state of the art and future trends. Adv Eng Mater, 13(6):B197–B217. [14] Zhang LJ, Webster TJ., 2009. Nanotechnology and nanomaterials: promises for improved tissue regeneration. Nano Today, 4(1):66–80 [15] Ergun C, Liu HN, Halloran JW, Webster TJ. 2007. Increased osteoblast adhesion on nanograined hydroxyapatite and tricalcium phosphate containing calcium titanate. J Biomed Mater Res A., 80(4): 990– 997. [16] Li K, Tjong SC, 2011 Hydrothermal synthesis and bio-mineralization of hydroxyapatite nanorods. J Nanosci Nanotechnol,11: 10444–10448. [17] Zhou H, Lee J., 2011. Nanoscale hydroxyapatite particles for bone tissue engineering. Acta Biomater. 7(7):2769–2781. [18] Liao CZ, Li K, Wong HM, Tong WY, Yeung KW, Tjong SC, 2013 Novel polypropylene biocomposites reinforced with carbon nanotubes and hydroxyapatite nanorods for bone replacements. Mater Sci Eng C Mater Biol Appl., 33(3):1380–1388 [19] P. Podsiadlo, A. K. Kaushik, E. M.Arruda,A.M.Waas,B.S.Shim, J. Xu, H. Nandivada, B. G. Pumplin, J. Lahann, A. Ramamoorthy, and N. A. Kotov, 2007. Science, 80, 318. [20] Srivastava, S.; Tiwari, R. K., 2012. Int. J. Pol. Mater., 61, 999. [21] Sun SS, Li CZ, Zhang L, Du HL, Burnell-Gray JS, 2006. Eur Polym J, 42, 1643. [22] Lin HB, Cao MS, Zhao QL, Shi XL, Wang DW, Wang FC, 2008. Scripta Mater, 59, 780. [23] Zheng J, Ozisika R, Siegel RW, 2005. Polymer, 46, 10873. [24] Zuiderduin W.C, Westzaan JC, Huetink J, Gaymans RJ, 2003. Polymer, 44, 261. [β5] Taşdemir, M., Yerleşen, U., 2015. Study on the friciton and wear behaviors of modified HDPE/glass spheres composites, Romanian journal of materials. 1, 45, 59-66. [26]ISO 8295:1995(E) test standard: Plastics-Film and sheeting-Determination of the coefficients of friction POSTER PRESENTATION 252 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Flor Toksikasyonu Oluşturan Broylerlerde Rasyona Epigallokateşin-3-Gallat İlavesinin Bazı Kan parametreleri ve Karaciğer Histopatolojisi Üzerine Etkisi İlkay Aydoğan1*, Ebru Yıldırım2*, Miyase Çınar3*, Tugçe Sümer4* *1 Kırıkkale Üniversitesi, Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları, Kırıkkale, Türkiye *2 Kırıkkale Üniversitesi, Veteriner Fakültesi, Farmakoloji ve Toksikoloji, Kırıkkale, Türkiye *3 Kırıkkale Üniversitesi, Veteriner Fakültesi, Biyokimya, Kırıkkale, Türkiye *4 Kırıkkale Üniversitesi, Veteriner Fakültesi, Patoloji, Kırıkkale, Türkiye Sorumlu yazar e-mail:ilkayaydogan@kku.edu.tr Özet Bu çalışmaν Flor toksikasyonu oluşturulmuş broylerlerde epigallokateşin-3-gallat (EPG) kullanımının kan parametreleri ve karaciğer histopatolojisi üzerine etkilerini incelemek amacıyla yapılmıştır. Araştırma, I. grup kontrol grubu, II. grup Flor (800 mg/kg) (F)ν III. grup EPG 400 mg/kg (E)ν IV. grup EPG (400mg/kg)+Flor (E+F) olacak şekilde gruplara ayrılarak yapılmıştır. Deneme 4β gün sürmüştür. Flor verilen grupta serum ALP, ALT, ve TOS seviyeleri yükselmiştir. Histopatolojik değerlendirmede, F+E grubunda hafif portal bölge değişikliklerine (portal enflamasyon ve ödem) rastlanırken, bunların dışında karaciğerin normal yapısını koruduğu ve flor katılan grupla karşılaştırıldığında ise iyileşme görüldüğü dikkati çekmiştir. Anahtar Kelimeler: Antioksidan, broyler, epigallakateşin, flor toksikasyonu, kan parametreleri, karaciğer patolojisi. 1. GİRİŞ Yeşil çayın türüne göre değişmek üzere polifenollerden (+) kateşin, epikateşin, epigallokateşin ve epigallokateşingallat gibi kateşinleri içermektedir (Önenç ve ark, β006). Bu bileşikler yeşil çayda miktarca epigallokateşingallat (toplam kateşin miktarının % 60’ı)>epigallokateşin>epikateşin≥ epikateşingallat şeklinde sıralanmaktadır (Şahin ve Özdemir, β006). Yeşil çay yaprakları (Camellia sinensis) antioksidatif kateşinleri kapsar (Miura ve ark., β001). Çay kateşinlerininν antioksidatif (Fujiki, β005), hipolipidemik, kan (Sarıca ve ark, β008ν Arina ve ark, β011) ile kan kolesterolü düşürücü etki (Biswas ve ark, β000) gibi sağlık üzerine olumlu etkileri vardır. Flor doğada bulunan en elektronegatif element olup, pek çok elementle iyonize floridler halinde bulunan (Chlubek β00γ), hem doğal hemde endrüstriyel kaynaklar yoluyla çevre kirliliğine sebep olan önemli kirleticilerdendir (Whitford, 1λ8γ). Aşırı Flor birikimi iskelet, dişler ve yumuşak dokularda hasara neden olabilmektedir. Floride toksisitesinin patogenezinde üretimi artan serbest oksijen türleri, artmış lipidperoksidasyonu ve bozulmuş antioksidan savunma sistemi rol oynar (Vani ve Reddy, β000). Özellikle miktarı artmış serbest radikaller membran fosfolipidlerine saldırır ve bu da lipidperoksidasyonu, mitokondriyal membran depolarizasyonu ve apoptozis yoluyla membran hasarına neden olur (Barbier ve ark., β010). Bunun yanı sıra florid hücre membranını geçerek (Carlson ve ark., 1λ60), kan (Karadeniz ve Altıntaş, β008) ve karaciğer (Mittal ve Flora β006) gibi yumuşak dokularda çeşitli değişiklikler oluşturmaktadır. Karaciğer oldukça aktif bir metabolizmaya sahip olduğu için florid toksisitesine karşı oldukça hassastır (Guo ve ark., β007). Bu çalışmaν Flor toksikasyonu oluşturulmuş broylerlerde epigallokateşin-3-gallat (EPG) kullanımının kan parametreleri ve karaciğer histopatalojisi üzerine etkilerini incelemek amacıyla yapılmıştır. 2. MATERYAL VE METOD 2.1. Hayvan Materyali Günlük 160 adet Ross PMγ erkek etlik civciv kullanılacaktır. Her bir grup 40 hayvandan oluşacak şekilde 4 gruba ayrılacak ve her bir grubun 4 alt grubu olacak şekilde düzenlenmiştir. Deneme, 40 × 65 × λ8 cm, ölçülerinde kafes siteminde yapılmıştır. Çalışma, Kırıkkale Üniversitesi Hayvan Deneyleri Yerel Etik Kurulu’nun β014/41 sayılı kararı ile onaylanmıştır. 2.2. Yem Materyali POSTER PRESENTATION 253 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Her bir gruba civciv döneminde (0-β hafta) etlik civciv başlangıç yemi (% βγ,γ0 HP ve γ060 kcal/kg ME), 14. günden 4β. güne kadar (γ-6 hafta) (% β1,70 HP ve γ174 kcal/kg ME) büyütme yemi, verilmiştir (Tablo 2). Araştırma rasyonlarının temelini mısır, soya küspesi ve tam yağlı soya oluşturmuştur. Denemede yeşil çay yapraklarından elde edilen TeavigoTM (λ4% EPG) kullanılmıştır (DSM, İstanbul, Türkiye). Sodyum florür (NaF) ise Merck ten satın alınmıştır (Darmstadt, Germany). Araştırma grupları I. grup kontrol grubu, II. Grup Flor (800 mg/kg); III. Grup EPG 400 mg/kg; IV. Grup EPG(400mg/kg)+Florν olacak şekilde düzenlenmiştir. Deneme 4β gün sürmüştür. 2.3. Kan Parametrelerininin Analizi: Serum test tüplerine alınan kan örnekleri 1600 x g'de, 4 ° C'de 10 dakika santrifüj edildi ve -80 ° C'de saklandı. Toplam kolesterol, yüksek yoğunluklu lipoprotein (HDLkolesterol) yanı sıra, serum alkalin fosfataz (ALP) (EC γ.1.γ.1) ve alanin aminotransferaz (ALT) (EC β.6.1.β) aktiviteleri, glukoz konsantrasyonları otoanalizör ile belirlendi (Gesan Chem 400, İtalya). Düşük yoğunluklu lipoprotein (LDL kolesterol) Friedewald'ın ampirik formülü kullanılarak primer ölçümlerden hesaplandı[16]. TAS seviyeleri, ticari bir kit (Rel Assay Diagnostics, Gaziantep, Türkiye) aracılığıyla serumda belirlenmiştir [17]. TAS seviyeleri otoanalizör (Gesan Chem 400, İtalya) ile ölçüldü. Sonuçlar, ηmol Trolox Denklem / L'olarak ifade edildi. TOS değerleri serumda ticari kit (Rel Assay Diagnostics, Gaziantep, Türkiye) ile tespit edildi [18]. Sonuçlar litre başına mikromolar hidrojen peroksit eşdeğeri olarak ifade edildi (ηmol HβOβ Eşit / L). 2.4. Histopatalojik değerlendirme Histopatolojik değerlendirme içinν ötenazi sonrasında 48 adet tavuktan alınan karaciğer örnekleri %10’luk tamponlu formalin içinde 48-72 saat fikse edildi. Fikse olan dokular; 2-γ mm kalınlığında trimlenerekν rutin doku takip, parafin emdirme ve bloklama işlemlerine tabi tutuldu. Hematoksilen ve eozin (HE) boyaması için, parafin bloklardan adezivli lamlara 4-5µm kalınlığında kesitler alındı. Kesitler sırasıylaν ksilol ve dereceli alkol (%100, %96, %80, %70 ve %50) serilerinden geçirilerek deparafinize ve dehidre edildi ve sonrasında hematoksilen ve eozin boyandı. Boyamanın ardından entellanla kapatılan lamlar, ışık mikroskobunda (Olympus BX51,Tokyo, Japonya) histopatolojik olarak değerlendirilmiştir. Tablo 1. Etlik Civciv ve Piliç Rasyonlarının Bileşimi (%) Etlik Civciv Etlik Piliç (0-14. Gün) (15-42. Gün) Mısır 46.60 53.60 Soya küspesi 30.00 22.00 Tam yağlı soya 15.00 15.00 Bitkisel yağ 4.00 5.50 Kireç taşı 0.90 0.90 DCP 2.35 2.20 DL-Metiyonin 0.35 0.25 L-Lizin 0.15 0.00 L-Treonin 0.10 0.00 Tuz 0.35 0.35 Vitamin+Mineralpremix* 0.20 0.20 23.40 19.90 3065 3200 0.89 0.88 0.60 0.58 Yemler Hesapla bulunan HP, % ME, kcal/kg Ca, % P, % *Vit. A 12.000.000 IU/kg, Vit D3 2.500.000 IU/kg, Vit. E 40.000 mg/kg, Vit K3 5.000 mg/kg, Vit B1 2.500 mg/kg, Vit B2 6.000 mg/kg, Vit B6 5.000 mg/kg, Vit B12 20 mg/kg, Pantotenik Asit 15.000 mg,kg, Niasin 25.000 mg/kg, Folik Asit 1.000 mg/kg, Biotin 50 mg/kg. Bakır 5.000 IU/kg, İyot 1.000 IU/kg, Kobalt β00 mg/kg, Selenyum 150 mg/kg, Demir 60.000 mg/kg, Çinko 60.000 mg/kg, Mangan 80.000 mg/kg. POSTER PRESENTATION 254 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2.5. İstatistik Analizler Gruplara ait istatistik hesaplamalar ve grupların ortalama değerleri arasındaki farklılıkların önemliliği variyans analiz metodu, gruplar arası farkın önemlilik kontrolü için Duncan testi uygulanmıştır. İstatistik analizler SPSS 16.0 paket programına göre yapılmıştır. 3. BULGULAR Flor verilen grupta kontrol grubu ile karşılaştırınca ALP, GPT, ve TOS seviyesi yükselmiştir. Flor verilen grupta istatistiksel bir fark olmasa da kontrole göre kolesterol seviyesinde sayısal bir artış görülmüştür. EPG florla birlikte verildiğinde ALT, total kolesterol ve TOS seviyesi, kontrol grubuna göre düşmüştür (Tablo β). Table 2. Rasyonlara ilave edilen Flor ve EPG’ın Kan Parametreleri Üzerine Etkisi Parametre K F E F+E ALP (IU/L) β77λ,08± 145,69b 6,58±0,4γb 108,75±4,84ab 4γλ0,64± 295,60a 11,β1±β,14a 1βγ,50±γ,8λa β645,40± 171,34b 6,50±0,60b 11β,00±4,74ab γ845,γγ± 249,27a 6,11±0,λβb 101,00±8,86b P 0,000 ALT (IU/L) 0,033 Total kolesterol 0,034 (mg/dL) HDL (mg/dL) 47,75±1,87 5γ,λβ±1,71 5γ,44±1,λ4 5γ,50±β,50 0,073 Glukoz (mg/dL) 1λ7,80±7,17 β04,58±6,56 β04,71±6,15 18β,67±6,λγ 0,114 TAS (ηmol 1,55±0,10a 1,λ6±0,β5a 0,85±0,05b 0,66±0,0γb 0,000 Trolox Eq/L) TOS (ηmol γ,84±0,66b 7,β1±1,60a γ,67±0,61b β,λλ±1,04b 0,046 Trolox Eq/L) a, bν Aynı satırda farklı harf taşıyan ortalama değerler arasındaki farklılıklar istatistiksel olarak önemlidir (P<0.01). Karaciğerin histopatolojisindeν Kontrol ve epigallokateşin ilave edilen grupta hafif portal enflamasyon dışında hiçbir patolojik değişikliğe rastlanmamıştır. Bununla birlikteν Grup F de ise şiddetli portal ve sinüzoidal enflamasyona, orta derecede portal bölge değişiklikleri (portal ödem, portal venkonjesyonu) ile birlikte safra kanalı epitelyum hiperplazisinin de eşlik ettiği gözlendi. Bunların yanısıra Flor katılan gruptaν hepatositlerde hafif intrastoplazmik vakuolleşme ve hepatosit dejenerasyonu gibi parankimal değişikliklere de rastlandı. F+E grubunda hafif portal bölge değişikliklerine (portal enflamasyon ve ödem) rastlanırken, bunların dışında karaciğerin normal yapısını koruduğu ve flor katılan grupla karşılaştırıldığında ise iyileşme görüldüğü dikkati çekmiştir. Bulgular Şekil 1, Şekil β’de verilmiştir. Şekil 1: Grup III (flor)’ ün karaciğer dokusunun histopatolojik kesitleri. (A) Portal bölge, ok portal enflamasyonu gösteriyor. (a) hepatik arter (v) portal ven, portal vendekikonjesyon. (d) safra kanalı, asteriks safra kanalı epitelhiperplazisini gösteriyor. HE, 200X büyütme. (B) Sinüzoidal konjesyon ve enflamasyon. HE, 100X büyütme. (C) Hepatositlerdedejenerasyon, sinüzoidal konjesyon ve enflamasyon, ok hepatositlerdekiintrastoplazmikvakuolizasyonu gösteriyor. HE, 1000X büyütme. POSTER PRESENTATION 255 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 2: Tüm çalışma gruplarında karaciğer dokularının histolojik kesitleri. (A) Grup I (kontrol)’de hafif portal enflamasyon, normal karaciğer yapısı. HE, 100X büyütme. (B) Grup II (epigallokateşin)’ de normal karaciğer yapısı. HE, β00X büyütme. (C) Grup III (flor)’de şiddetli portal enflamasyon, orta derecede venözkonjesyon ve portal ödem. HE, β00X büyütme. (D) Grup IV (flor + epigallokateşin)’de hafif portal enflamasyon, normal karaciğer yapısı. HE, β00X büyütme 4. TARTIŞMA Broylerlerde flor zehirlenmesinin etkisini araştırmak amacıyla birçok çalışma yürütülmüştür. Kanbur ve ark (2009), flor verilen farelerde, GOT ve glıkoz seviyesinde kontrole göre bir yükselme, GPT, kolesterol ve trigliserid düzeyinde seviyesinde bir düşüş saptamışlardır, ALP düzeyinde bir değişiklik bulamamışlardır. Eraslan ve ark (β007), flor verilen sıçanlarda ALT sayısal ve ALP de istatistiksel bir azalma, AST’de istatistiksel bir artış bulmuşlardır. Deng ve ark (β014), broiler ırkı tavuklara 400, 800 ve 1β00 mg/kg yüksek doz flor vermiştir ve ALT, ALP ve AST seviyesinde artma, ALT düzeyinde ise kontrole göre azalma bulmuşlardır. Bizim çalışmamızın sonuçları Deng ve ark (β014) sonuçlarından ALT, ALP parametreleri ile uyumludur. Bu durum karaciğerde oluşan hasarı işaret etmektedir. Deng ve ark (β014) floridin MDA seviyesini artırdığını saptamışlardır. Bu çalışmada da TOS seviyesi 800 mg/kg florid verilen grupta artmıştır. Florid maruziyeti, anyon süperoksit üretiminin artmasına, Oβ-konsantrasyonunun artmasına ve hidrojen peroksit, peroksinitrit, hidroksil radikallerinin artmasına neden olmaktadır. Ayrıca florid nitrik oksit oluşumunu da artırır. Süperoksitlerle birleşerek peroksinitrit ve proteinlerde thiollerle birleşerek nitrosiladduktlar oluşturur. Disülfid bağların oluşmasına sebep olarak endoplazmikretikulumda yanlış yapılandırılmış proteinlerin birikmesine ve sonuçta ER stres ve ROS üretimine neden olur. Oksidatif stress flor zehirlenmesinin ana etki mekanizması olarak nitelenmektedir (Barbier ve ark, β010). Epigallokateşinin antioksidan etkisi Zhen ve ark (β007), Tipoe ve ark (β010), Atmaca ve ark (β014) tarafından gösterilmiştir. Muhtemelen bizim çalışmamızda da karaciğer hasarındaki histopatolojik azalma epigallokateşinin flor toksikasyonunda meydana getirdiği oksidatif hasarın düzeltilmesi ile ilgilidir. Çalışmamızdaki birçok karaciğer biyokimya verileri ve TOS’ da meydana gelen değişiklikler epigallokateşin ile düzeltilmiştir. Bu bulgular patoloji bulgularını destekler niteliktedir. Zhen ve ark (β007), benzer şekilde karaciğerde fibrozis oluşturulan sıçanlarda AST ve ALT seviyesini yükseltmiş epigallokateşin uygulaması bu verileri düşürmüştür. Tuzcu ve ark (β008) bıldırcın rasyonlarına EPG ilavesinde, serum kolesterol seviyesinin düştüğünü saptamışlardır. Bizim çalışmamızda da EPG florla birlikte verildiğinde GPT, kolesterol ve TOS seviyesi, kontrol seviyesine düşmüştür. Sıçanlarda yapılan birçok çalışmada flor intoksikasyonunun karaciğerde gerek biyokimyasal gerek morfolojik değişikliklere neden olduğunu göstermiştir (Iano ve ark β014, Zhou ve ark β015, Wang ve ark β000, Atmaca ve ark β014, POSTER PRESENTATION 256 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Nabavi ve ark 2012). Iano ve ark (β014), Zhou ve (β015) flor verilmesinin sıçanlarda karaciğerde antioksidan sistemi değiştirdiğini bildirmişlerdir. Zhou ve ark, sıçanlarda oluşturulan flor zehirlenmesinin, hepatositler karışık bir biçimde dizilim göstermiş ve bir kısmı eriyerek küçük parçalar haline gelmiştir. Karaciğerde hücre sınırları belirgin değildir ve çekirdekte bile çok hafif boyanma bulunmaktadır. Ersan ve ark farelerde yaptığı çalışmada 10, β0 ve 40 ppm düzeyinde suya katılan florun λ0 günün sonunda karaciğerde lokal nekroz, vakuoler dejenerasyon ve merkezi toplar damar çevresindeki hepatositlerde şişmeler tespit etmişlerdir. Abdelsalam ve Dorra (1λλβ), broiler yemine toksik dozda flor ilavesinin genel bakı ve postmortem bulgulara bakılarak karaciğerde bozukluk yaptığını bildirmişlerdir. Bizim çalışmamız da yukarıdaki çalışmalara benzer olarak karaciğerde şiddetli portal ve sinüzoidal enflamasyona, orta derecede portal bölge değişiklikleri (portal ödem, portal venkonjesyonu) ile birlikte safra kanalı epitelhiperplaziye neden olmuştur. Yeşil çay ekstresinin karaciğer üzerinde olumlu etkileri oldukça fazladır. Kurşun (Mehana ve ark, β01β), konkanavalin (Liu ve ark, β014), karbontetraklorür (Tipoe ve ark, β010, Zhen ve ark, β007) ile oluşturulan karaciğer hasarının, epigallokateşin ile düzeldiği saptanmıştır. Bu çalışmanın bulguları da benzer şekilde florun karaciğerde oluşturduğu patolojik hasarı düzeltmiştir. Bu sonuçlar epigallokateşinin karaciğer hasarını önlediğini kanıtlar niteliktedir. Bu çalışmada epigallokateşin ilavesi florun karaciğer üzerinde oluşturduğu zararlı etkiyi ortadan kaldırdığı görülmektedir. Bunun yanı sıra kan analiz sonuçları da yeşil çay ekstresinin antioksidan etkisini destekler niteliktedir. KAYNAKLAR Abdelhamid AM, Dorra TM 1992. Effect of feedborne fluorine intoxication on broiler chicks' performance, biochemistry, physiology and pathology. Arch Anim Nutr, 42:133-45. Arina M, Samie A, Edriss MA, Jahanian R, 2011. Effects of powder and extract form of green tea and marigold, and alfa-tocopheryl acetate on performance, egg quality and egg yolk cholesterol levels of laying hens in late phase of production. J Med Plant Res, 5(13): 2710-2716. Atmaca N, Atmaca HT, Kanici A, Anteplioglu T 2014. Protective effect of resveratrol on sodium fluorideinduced oxidative stress, hepatotoxicity and neurotoxicity in rats. Food Chem Toxicol, 70:191-197. Barbier O, Arreola-Mendoza L, Del Razo LM 2010. Molecular mechanisms of fluoride toxicity. Chem-Biol Interact, 188:319-333. Barbier O, Mendoza LA, Del Razo LM 2010. Molecular mechanisms of fluoride toxicity. Chemico-Biol Interact, 188(2):319-333. Biswas AH, Miyazaki Y, Nomura K, Wakita M 2000. Influences of long-term feding of japanese green tea powder on laying performance and egg quality in hens. Asian-Aust J Anim Sci, 13(7): 980-985. Carlson CH, Armstrong WD, Singer L 1960. Distribution and excretion of radio fluoride in the human. Proc Soc Exp Biol Med, 104:235-239. Chlubek D 2003. Fluoride and oxidative stress. Fluoride, 36, 217-228. Deng Y, Cui H, Peng X, Fang J, Zuo Z, Deng J, Luo Q 2014. Effects of high dietary fluoride on serum biochemistry and oxidative stress parameters in broiler chickens. Health, 6:1840-1848. Eraslan G, Kanbur M, Silici S 2007. Evaluation of propolis effects on some biochemical parameters in rats treated with sodium fluoride. Pestic Biochem Physiol, 88:273-283. Erel O 2004. A novel automated direct measurement method for total antioxidant capacity using a new generation, more stable ABTS radical cation. Clin Biochem, 37:277–285. Erel O 2005. A new automated colorimetric method for measuring total oxidant status. Clin Biochem, 38:1103–1111. Ersan Y, Koç E, Ari I, Karademir B β010. Histopathological effects of chronic fluorosis on the liver of mice (Swiss albino). Turk J Med Sci, 40 (4):619-622. Friedewald WT, Levy RI, Fredrickson DS 1972. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clinical Biochem, 18(6): 499–502. Fujiki H, 2005. Green tea: health benefits as cancer preventive for humans. Chem. Rec, 5: 119-132. Iano FG, Cecília M, Giovana F, Mileni BQ, Fernandes S, Cardoso R, Valdecir O, Marília FX, Buzalaf AR 2014. Effects of chronic fluoride intake on the antioxidant systems of the liver and kidney in rats. J Fluorine Chem, 168:212-217. Kanbur M, Eraslan G, Silici S, Karabacak M 2009. Effects of sodium fluoride exposure on some biochemical parameters in mice: Evaluation of the ameliorative effect of royal jelly applications on these parameters. Food Chem Toxicol, 47:1184-1189. POSTER PRESENTATION 257 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Karadeniz A, Altıntaş L β008. Effects of Panax Ginseng on fluoride-induced haematological pattern changes in mice. Fluoride, 41:67-71. Killham K 1994. Soil ecology. Cambridge: Cambridge University Press, 242 pp. Mehana EE, Meki AR, Fazili KM 2012. Ameliorated effects of green tea extract on lead induced liver toxicity in rats. Exp Toxicol Pathol, 64μβλ1-βλ5. Mittal M, Flora SJ 2006. Effects of individual and combined exposure to sodium arsenite and sodium fluoride on tissue oxidative stress, arsenic and fluoride levels in male mice. Chem Biol Interact, 162(2):12839. Miura Y, Chiba T, Tomita I, Koizumi H, Miura S, Umegaki K, Hara Y, Ikeda M, Tomita T 2001. Tea catechins prevent the development of atherosclerosis in apoprotein E-deficient mice. J Nutr, 131: 27-32. Nabavi SM, Nabavi SF, Eslami S, Moghaddam AH 2012. In vivo protective effects of quercetin against sodium fluoride-induced oxidative stress in the hepatic tissue. Food Chem, 132:931-935. Önenç SS, Açıkgöz Z, Akkan S β006. Yeşil çayın (Camellia Sinensis) hayvan beslemede kullanım olanakları. Türkiye λ. Gıda Kongresi, β4-β6 Mayıs, Bolu. Şahin H, Özdemir F β006. Yeşil çayın sağlık üzerine etkisi. Türkiye λ. Gıda Kongresi, β4-β6 Mayıs, Bolu. Tipoe GL, Leunga TM, Lionga EC, Yue T, Lauc H, Fung ML, Nanji AA 2010. Epigallocatechin-3-gallate (EGCG) reduces liver inflammation, oxidative stress and fibrosis in carbon tetrachloride (CCl4)-induced liver injury in mice. Toxicology, 273:45-52 Tuzcu M, Sahin N, Karatepe M, Cikim G, Kilinc U, Sahin K 2008. Epigallocatechin-γ-gallate supplementation can improve antioxidant status in stressed quail. Br Poult Sci, 49 (5):643-648. Vani ML, Reddy KP 2000. Effects of fluoride accumulation on some enzymes of brain and gastrocnemius muscle of mice. Fluoride, 33:17-26. Wang YN, Xiao KQ, Liu JL, Dallner G, Guan ZZ 2000. Effect of long term fluoride exposure on lipid composition in rat liver. Toxicology, 146:161-169. Whitford GM 1983. Fluorides: metabolism, mechanisms action and safety. Dent Hyg (Chic), 57:16-8. Zhen MC, Wang Q, Huang XH, Cao LQ, Chen XL, Sun K, Liu YL, Li W, Zhang LJ 2007. Green tea polyphenol epigallocatechin-3-gallate inhibits oxidative damage and preventive effects on carbon tetrachloride–induced hepatic fibrosis. J Nutr Biochem, 18:795-805. Zhou BH, Zhao J, Liu J, Zhang JL, Wang HW 2015. Fluoride-induced oxidative stress is involved in the morphological damage and dysfunction of liver in female mice. Chemosphere, 139:504-511. POSTER PRESENTATION 258 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Fluorimetric determination of cefotaxime sodium in pharmaceuticals preparation via the quenching of the continuous fluorescence of calcein using a homemade ISNAG-continuous flow injection analyser Hayder Q. Munshid1*, Nagam S. Turkie 2 *1 2 Department of Pharmacy, Al-esraa University College, Baghdad, Iraq, Department of Chemistry, College of Science, University of Baghdad, Baghdad, Iraq. Corresponding author e-mail: Haider.qais1989@gmail.com Abstract A newly developed analytical method for the determination of Cefotaxime sodium (CTX) in pure and pharmaceuticals preparation via fluorescence measurements at ± λ0◦ via β×4 solar cell of a new homemade ISNAG fluorimeter. The method was based on the quenching of the continuous fluorescence of calcein. The calibration graph was linear in the range of 10-50 mmol/L, with correlation coefficient r = 0.9820 and the limit of detection 501.γ14 µg/sample from the step wise dilution for the minimum concentration in the linear dynamic ranged of the calibration graph. The method was successfully applied to the determination of cefotaxime sodium in two pharmaceutical drugs. A comparison was made between the newly developed method analysis and the classical method using the standard addition method via the use of t-test. It was noticed that there was no significant difference between two methods at 95 % confidence level. Keywords: Fluorescence – Cefotaxime sodium – Calcein – Flow injection. 1. INTRODUCTION Cefotaxime sodium (CTX) is a potent third-generation cephalosporin with a 2-amino-4-thiazolyl side chain and a syn α-methoxyimino group at position 7. Also known as sodium [6(R)-[6α,7ί(Z)]]-3-[(acetyloxy)methyl]-7-[[(2-amino-4-thiazolyl) (methoxyimino)acetyl]-8-oxo-5-thia-1-azabicyclo[4.2.0] oct-2-ene-2carboxylate] (Figure 1) and is a kind of white or light-yellow crystalline powder that is soluble in water. This antibiotic, which was developed by Hoechst, is highly effective against a broad antibacterial spectrum of microorganisms, specially Gram-negative aerobes, it is clinically available for the treatment of various infections (Sun, Cui et al. 2017). the empirical formula for CTX is C 16H17N5NaO7S2 and the molecular weight is 477.468 g/mol. CTX contains approximately 50.5 mg (2.2 mEq) of Na per g of CTX. (Arafat, Kon et al. 2015). Many analytical methods have been reported for the determination of CTX in pure form and pharmaceutical preparations, these methods includes spectrophotometry (Bushra, Akter et al. 2014, Ali Ahmed, Elbashir et al. 2015, Adegoke and Quadri 2016), fluorometry (Omar, Abdelmageed et al. 2009, Elbashir, Ahmed et al. 2012, Stirbet, Vasilescu et al. 2014), chemiluminescence (Du and Li 2010, Chen, Wang et al. 2011), HPLC (Arafat, Kon et al. 2015, Legrand, Vodovar et al. 2016), capillary electrophoresis (Gáspár, Andrási et al. β00β, Andrási, Gáspár et al. β007), and electrochemical (Xu, Wu et al. 2016, Dehdashtian, Behbahani et al. 2017) methods. The aim of this work was to develop a new fluorometric flow injection method for the determination of cefotaxime sodium using ISNAG fluorimeter. The method is based on the quenching of the continuous fluorescence of calcein. Calcein (CAL), fluorescein-complexone, is a fluorescence dye, which has proven as a rapid, accurate, and dependable for the determination of calcium (Hill 1965). Calcein give a continuous fluorescence using homemade ISNAG fluorimeter at pH5, the emitted fluorescence was measured at ± λ0◦ via β×4 solar cell to detect any of the reflected emission. Figure 1. Chemical structure of Cefotaxime sodium (CTX) POSTER PRESENTATION 259 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS AND METHODS 2.1 Apparatus and Reagents A homemade ISNAG fluorimeter was used with 4-channels peristaltic pump (Ismatec, Switzerland) and Sixport medium pressure injection valve (I D E X corporation, USA) with sample loop (1 mm i.d. Teflon, variable length). Potentiometric recorder to estimate the output signals (Siemens, Germany (1- 5 V)). Spectrophotometer (UV-1800, shimadzu, Japan) was also used for classical spectrofluorometric methods. All chemicals were used of analytical-reagent and distilled water was use to prepare all the solutions. A standard solutions of 1 mmol/L and 50 mmol/L of CAL and CTX, molecular weight 622.539 and 477.442 g/mole respectively, were prepared by dissolving 0.3113 g of CAL in 500 mL and 2.3872 g of CTX in 100 mL of distilled water. A pH range of 2.2–8.0 buffers were prepared according to citric acid–phosphate buffer systems (McIlvaine 1921). A series of sodium hydroxide solutions were prepared from the dilution of standardized stock solution (0.1 mol/L) with distilled water. 2.2 Methodology Single line manifold design (Figure 2) for the flow injection system of CAL used to determine the CTX using ISNAG fluorimeter with experimental parameters of β.75 mL/min flowrate and β50 µL volume of CTX injected via the flow system. These parameters will be investigated to enhance the quenching of fluorescence of CAL, the study of effect of CAL concentration on the sensitivity of quenching was carried out using different concentration of CAL (0.01-0.1 mmol/L) as a carrier stream with flow rate of 2.75 mL/min and 250 µL of 30 mmol/L of CTX injected in an open valve mode. The physical parameters were studied by investigate the effect of the flow rate of CAL as a carrier stream by changing their flow rate from 0.575 to 4.γ mL/min, using β50 µL of CTX (30 mmol/L) as the injected sample volume using open valve mode. Using these parameters variable sample loop (50-β50 µL) were used in an open valve mode for the optimization of sample volume, and the purged time were studied at (2-25 sec). Figure 2. Manifold system design of quenching system of CAL fluorescence via CTX. A series of CTX concentration having the range of (1-50) mmol/L were papered using all achieved parameters in previous sections for the study of calibration graph. The method achieved in this work was compared by classical method (Spectrophotometric methods) via the measurement of absorbance spectrum at ζmax = 240 nm. The developed method was used for the determination of CTX in two different pharmaceutical preparations from two different well known manufacturers (Bilim Turkey, 1g and LDP Spain, 1g), using the total quenching of fluorescence of CAL-CTX system. The standard addition method was applied by preparing a series of solutions from each pharmaceutical drug via transferring 5 mL (50 mmol/L) to five volumetric flasks (10 mL), followed by the addition of (0, 1, 2, 3 and 4 mL) from 50 mmol/L standard solution of CTX. For the classical spectrophotometric method comparison, a series of solutions from each pharmaceutical drug via transferring 5 mL (0.02 mmol/L) to five volumetric flasks (10 mL), followed by the addition of (0, 1, 2, 3 and 4 mL) from 0.04 mmol/L standard solution of CTX. 3. RESULTS AND DISCUSSION The study of this quenching system with expected mechanism for quenching was illustrated in scheme 1. The obtained results for concentration study were tabulated in table 1. The results show an increased in the total quenching of fluorescence. While the blank response increased with the increased of CAL POSTER PRESENTATION 260 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org concentration, therefore, the variation of quenching of CTX effected and the remained fluorescence increased. The optimum concentration of CAL that gave maximum quenching and minimum blank response is 1 mmol/L, higher concentration of CAL di not included in this study due to the self-quenching of CAL. Scheme 1. Schematic of quenching of CAL via CTX. Concentration of CAL mmol/L 0.01 0.03 0.05 0.07 0.1 Table 1. Variation of CAL concentration using β50 µL of γ0 mmol/L of CTX. Total Total Confidence Quenching continuous quenching of interval of the of CAL fluorescence CAL RSD average response fluorescence of CAL fluorescence % (at 95% ȳiQ (mV) ȳi (mV) ȳiQ (mV) confidence level) Expressed as an average peak heights (n=3) ȳiQ±t0.05/2, n-1 σn-1/√ 98 221 298 375 405 84 134 160 263 263 42 36 37 67 101 0.57 0.67 1.86 1.24 0.95 4β ± 0.5λ6β γ6 ± 0.5λ6β γ7 ± 1.714β 67 ± β.06β0 101 ± β.γ850 Remained of fluorescence ȳiR (mV) 14 87 138 112 142 The response profile obtained for the flow rate effect study shown in Figure 3,A. and the results tabulated in table β. It was noticed that there was an increased in peak base width (Δtb) at low flow rate which might cause by dilution and dispersion, while at higher flow rate (>1.7 mL/min), a regular and sharp response was obtained as shown in Figure 3,B. The optimum chosen flow rate was 2.2 mL/min, as a clear peak profile response, narrow Δtb and easy measurable peak. Using optimum concentration of CAL 0.1 mmol/L (intensity of the continuous fluorescence 412 mV) at flow rate 2.2 mL/min for the optimization of sample volume. The data obtained were plotted as shown in Figure 4, A&B. which reveals that the optimum sample volume is 150 µL that gave a regular and highest clear response with minimum response of distilled water. More than 150 µL there were an increase in the response of distilled water (negative response), therefore 150 µL was found to the best sample volume that gave a sharp regular response. The purge time was studied, the optimum mode with the highest response is the open valve mode. The obtained results were tabulated in table 2. which shows the average of total quenching of three successive measurement expressed in mV, relative standard deviation, the confidence interval of average response at 95% confidence level, quenching of the fluorescence and remained of the fluorescence. Figure 3. Variation of flow rate A: Response profile-time, B: Effect of quenching of fluorescence, remained of fluorescence and peak base width. POSTER PRESENTATION 261 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 4. Variation of sample volume A: Response profile-time, B: Effect of quenching of fluorescence, remained of fluorescence and peak base width. Table 2. Purge time effect using 0.1 mmol/L of CAL and 150 µL of γ0 mmol/L of CTX. Total quenching Quenching Confidence interval of CAL of CAL of the average Remained of fluorescence fluorescence ȳiQ RSD Purge time response (at 95% fluorescence ȳiQ (mV) (mV) (sec) % confidence level) ȳiR (mV) Expressed as an average peak ȳiQ±t0.05/2, n-1 σn-1/√ heights (n=3) 2 5 10 15 20 Open valve (25) 171 209 206 208 210 213 66 104 101 103 105 108 0.77 0.51 0.61 0.82 0.89 0.85 66 ± 1.β670 104 ± 1.γ167 101 ± 1.540γ 10γ ± β.0868 105 ± β.γ104 108 ± β.β856 235 197 200 198 196 193 Response of continuous fluorescence: 406 mV. The responses profile for calibration graph was obtained as shown in Figure 5. Total quenching of fluorescence, quenching of fluorescence and remained of fluorescence (mV) was plotted against the concentration CTX, the straight line equation for these types of measurements shows a linear calibration graph range for the variation with CTX concentration, which was ranging from (10-50) mmol/L with correlation coefficient r: 0.9820 and the calculated t-value at 95% confidence level of 16.431 which is larger than the tabulated t-value indicating clearly that the linearity against non-linearity is accepted. The method achieved in this work was compared by classical method (Spectrophotometric methods) via the measurement of absorbance spectrum at ζmax = 240 nm Figure 6, calibration graph was obtained for classical spectrophotometric method and Table 3 sum up all the results obtained using linear regression analysis for both methods. The limit of detection was calculated for the developed method and the reality and repeatability was studied for eight repeated injections for (15 and 40 mmol/L) of CTX. Figure 5. Responses profile for calibration graph of CTX. POSTER PRESENTATION 262 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 6. Absorbance spectrum of CTX . Table 2. Summary of calibration graph results for CTX at 95% confidence level. Classical Developed Range of calibration Type of method curve (mmol/L), (n) Equation of calibration curve ̂� = � ± �+ ± �[� ] /� at confidence level 95%, n-2 Total quenching of fluorescence 10-50 (12) ̂� mV = � Quenching of fluorescence 10-50 (12) Remained of fluorescence 10-50 (12) ̂� mV = − . 6 ± . + . � [CTX] � /� ̂� mV = � ζmax = 240 0.0001-0.04 nm (11) Practical based on the gradual dilution for the minimum concentration (7 mmol/L) 3.342 g/L 501.314 µg/sample ̂� = . � . ± [CTX] . 6± [CTX] ± . [CTX] . + . � /� ± . ± . . − . � /� + . � /� ± . ± . Limit of detection Theoretical based on the value of slope X=3SB/slope 0.263 g/L γλ.4ββ µg/sample Repeatability [CTX] mmol/L Fluorescence Intensity expressed as an average peak heights (n=8) ȳi (mV) RSD% 15 40 148 239 0.55 0.47 r r2 R2 % 0.9820 0.9643 96.43 0.9820 0.9643 96.43 0.9820 0.9643 96.43 0.9890 0.9781 ttab = t0.025 ,n-2 tcal = |�|√ − √ −� 2.228<<16.431 2.228<<16.431 2.228<<16.431 2.262<<20.057 97.81 Theoretical (linear equation) based on the value of ̂= + 3.802 g/L 570.γ0β µg/sample Confidence interval of the average response (at 95% confidence level) ȳi±t0.05/2, n-1 σn-1/√ 148 ± 0.677γ βγλ ± 0.λγ65 n: No. of measurements in calibration curve, �̂� : in mV for developed method, r: correlation coefficient, r 2: coefficient of determination, R2%(Percentage capital R-squared): explained variation as a percentage total variation. X: value of L.O.D based on slope, SB: Standard deviation of blank repeated for 13 times, Yb: average response for blank = intercept, Sb: standard deviation equal to Sy/x (residual), t 0.025,7 = 2.365. The analysis of pharmaceutical preparation was applied using the standard addition method for two different pharmaceutical preparations from two different well known manufacturers (Bilim Turkey, 1g and LDP Spain, 1g). The results were mathematically treated and tabulated in Table 3 at confidence level of 95%. Two paths of t-test were applied for the assessments of the newly developed method; the first path is the individual t-test for each sample of CTX using both methods (classical and developed methodology), and the second path is the paired t-test in order to compare between the two methods. Since all values obtained Table POSTER PRESENTATION 263 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4. (tcal) less than (ttab) for the both two paths; these means that there is no significant difference between the measurements of the mean of the samples using two methods and there is no significant difference between the two methods. Cefotaxime Sefagen Commercial name Table 3. Standard addition results for the determination of CTX in two different pharmaceuticals preparation using two methods. Developed method using ISNAG fluorimeter (mV) UV- spectrophotometric classical method absorbance measurement at ζmax = 276 nm Confidence interval for the average Weight of tablet ̅̅̅� ± . � − ⁄√ Theoretical Weight of sample content for the active equivalent to 2.3872 g (50 mmol/L) ingredient of active ingredient at 95% (g) 1.0β7λ ± 0.01β5 1 ± 0.0122 1.05γ4 ± 0.0β08 ̂� � 2.4538 = ̂� = . � 1 ± 0.01λ7 ̂� � 2.5147 = ̂� = . � 24.732 49.464 Practical weight of CTX (g) ̅̅̅� � ± . � − ⁄√ 0.00987 49.383 24.804 0.00969 Practical concentration (mmol/L) in 10 mL * Cefotaxime Sefagen Equation of standard addition at 95% for n̂� = ± � + ± � 2� [� ] /� Practical concentration (mmol/L) in 100 mL β.γ616 ± 0.ββ11 . ± [� ] . . ± [� ] . ± . + [� ] + . /� ± . + . /� ± . . ± /� ± . + [� ] . . ± /� Weight of CTX in vial ̅̅̅� � ± . � − ⁄√ . r r2 R2 % 0.9820 0.9643 96.43% 0.9805 0.9614 96.14% 0.9881 0.9764 97.64% 0.9720 0.9448 94.48% Efficiency of determination Recovery % 0.λ8λγ ± 0.0926 98.93 % β.γ577 ± 0.β45λ 0.λ877 ± 0.1030 98.77 % 49.608 β.γ685 ± 0.β06β 0.λλββ ± 0.0864 99.22 % 48.476 β.γ144 ± 0.β4γ5 0.λ6λ5 ± 0.10β0 96.95 % �̂� : in mV for developed method and absorbance for classical method, r: correlation coefficient, r2: coefficient of determination, R2%: explained variation as a percentage total variation, t0.025,∞ = . 6 �� % , W̅i :Mean of weight for n=4. µμ quoted value (g). * Practical concentration (mmol/L) in 10 mL: In classical method the concentration diluted to 0.02 mmol/L before the addition. Table 4. Statistical treatments of newly developed method. Developed method using ISNAG fluorimeter (mV) UV- spectrophotometric classical method Commercial name, Company Sefagen, Bilim Cefotaxime, LDP Weight of CTX in vial ̅̅̅� � ± . � − ⁄√ 0.λ8λγ ± 0.0926 0.λ877 ± 0.1030 0.λλββ ± 0.0864 0.λ6λ5 ± 0.10β0 4. CONCLUSION Individual t-test for compared between quoted value & practical value ̅̅̅� − � √ ⁄� − |− . |− . |≪ . |≪ . Paired t –test compared between two methods � = ̅ √ ⁄� − �� at 95% confidence level (n-1) X̅dμ 0.01β15 σn-1: 0.01492 . ≪ . 6 The suggested methods are simple, sensitivities and rapid. The comparison between finally arrived ISNAG procedure with classical spectrophotometric method was shown that with no doubt that newly developed method is a good as the classical method. An alternative analytical method is found through this research work, which based on simple parameter conditions. POSTER PRESENTATION 264 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org REFERENCES Adegoke, O. A. and M. O. Quadri (2016). "Novel spectrophotometric determinations of some cephalosporins following azo dye formation with p-dimethylaminobenzaldehyde." Arabian Journal of Chemistry 9: S1272-S1282. Ali Ahmed, S. M., A. A. Elbashir and H. Y. Aboul-Enein (2015). "New spectrophotometric method for determination of cephalosporins in pharmaceutical formulations." Arabian Journal of Chemistry 8(2): 233-239. Andrási, M., A. Gáspár and A. Klekner (β007). "Analysis of cephalosporins in bronchial secretions by capillary electrophoresis after simple pretreatment." Journal of chromatography. B, Analytical technologies in the biomedical and life sciences 846(1-2): 355-358. Arafat, M., S. Kon and M. Mikov (2015). "The measurement of cefotaxime sodium in rat plasma after oral administration: a sensitive HPLC-UV method." Int J Pharm Pharm Sci 7(4): 343-346. Bushra, M. U., N. Akter, M. R. Hassan, A. Islam and M. R. Hossain (2014). "Development and validation of a simple UV spectrophotometric method for the determination of cefotaxime sodium in bulk and pharmaceutical formulation." IOSR Journal of Pharmacy 4(1): 74-77. Chen, D., H. Wang, Z. Zhang, L. Ci and X. Zhang (2011). "Chemiluminescence determination of cefotaxime sodium with flow-injection analysis of cerium (IV)–rhodamine 6G system and its application to the binding study of cefotaxime sodium to protein with on-line microdialysis sampling." Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 78(1): 553-557. Dehdashtian, S., M. Behbahani and A. Noghrehabadi (2017). "Fabrication of a novel, sensitive and selective electrochemical sensor for antibiotic cefotaxime based on sodium montmorillonite nonoclay/electroreduced graphene oxide composite modified carbon paste electrode." Journal of Electroanalytical Chemistry 801: 450-458. Du, J. and H. Li (2010). "Sensitive Chemiluminescence Determination of Thirteen Cephalosporin Antibiotics with Luminol—Copper(II) Reaction." Applied Spectroscopy 64(10): 1154-1159. Elbashir, A. A., S. M. A. Ahmed and H. Y. Aboul-Enein (2012). "New spectrofluorimetric method for determination of cephalosporins in pharmaceutical formulations." Journal of fluorescence 22(3): 857-864. Gáspár, A., M. Andrási and S. Kardos (β00β). "Application of capillary zone electrophoresis to the analysis and to a stability study of cephalosporins." Journal of chromatography. B, Analytical technologies in the biomedical and life sciences 775(2): 239-246. Hill, J. B. (1965). "Automated fluorometric method for determination of serum calcium." Clinical chemistry 11(2): 122-130. Legrand, T., D. Vodovar, N. Tournier, N. Khoudour and A. Hulin (2016). "Simultaneous Determination of Eight ί-Lactam Antibiotics, Amoxicillin, Cefazolin, Cefepime, Cefotaxime, Ceftazidime, Cloxacillin, Oxacillin, and Piperacillin, in Human Plasma by Using Ultra-High-Performance Liquid Chromatography with Ultraviolet Detection." Antimicrobial agents and chemotherapy 60(8): 4734-4742. McIlvaine, T. (1921). "A buffer solution for colorimetric comparison." J Biol Chem 49: 183–186. Omar, M. A., O. H. Abdelmageed and T. Z. Attia (2009). "Kinetic spectrofluorimetric determination of certain cephalosporins in human plasma." Talanta 77(4): 1394-1404. Stirbet, D., I. Vasilescu and G.-L. Radu (2014). "SPECTROFLUORIMETRIC ANALYSIS OF CEFOTAXIME SODIUM BY USING 4-FLUORO-7-NITROBENZOFURAZAN AS DERIVATIZATION AGENT." Sun, H., X. Cui, B. Liu and J. Zhang (2017). "Relationship between the color stability and impurity profile of cefotaxime sodium." J Chromatogr B Analyt Technol Biomed Life Sci 1063: 235-244. Xu, F., F. Wu, L. Chen, Z. Cai and X. Wei (2016). "Electrochemical Determination of Cefotaxime Using Nafion-Graphene Oxide Modified Electrode." Asian Journal of Chemistry 28(1): 111. POSTER PRESENTATION 265 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org LiCH3COO Modifiye Sepiyolit Nanokompozit Yapının Sentezi, Karakterizasyonu ve Heterojen Katalizör Olarak Biyodizel Üretiminde Kullanabilirliğinin Araştırılması Sema Aslan1*, Necdet Aka1, M. Hamdi Karaoğlu1 *1 Muğla Sıtkı Koçman Üniversitesi, Fen Fakültesi, Kimya Bölümü, Muğla, Türkiye Sorumlu yazar e-posta: semaaslan@mu.edu.tr Özet Biyodizel üretiminde değişik metotlar kullanılmaktadır. Destekli katalizörler ile biyodizel üretimi çalışmaları son yıllarda daha da önemli hale gelmiştir. Bu katalizörlerin tekrar kullanabilirliği, prosesi daha da ekonomik yapmakta ve ürün kalitesini artırmaktadır. Yapılan çalışmada, öncelikle gözenekli sepiyolit kil mineraline optimum şartlarda LiCH3COO yüklenmiştir. Elde edilen destekli nanokompozit katalizörün yapısal karakterizasyonları FT-IR, XRD, SEM ve TEM ölçümleri ile gerçekleştirilmiştir. Daha sonra bu LiCH3COO/sep. nanokompozit heterojen katalizörü kullanılarak, kanola yağından biyodizel üretiminde reaksiyon sıcaklığı, değişik yağ/alkol oranı, karıştırma hızı, katalizör miktarının etkisi ve reaksiyon süresi parametre olarak incelenmiştir. Bu kapsamda sentezlenen bu heterojen katalizörün yenilenebilir bir yakıt olan biyodizel üretimi için çevreye duyarlı bir çalışma olduğu düşünülmektedir. Anahtar Kelimeler: Transesterifikasyon. Yenilenebilir Enerji, Biyodizel, Heterojen Katalizör, Sepiyolit, 1. GİRİŞ Biyodizel yenilenebilir ve çevre dostu bir yakıt olduğu için en potansiyel bir alternatif enerji kaynağıdır (Suryaputra vd., β01γ). Biyodizel bir katalizör varlığında, trigliseritlerin kısa zincirli alkoller ile transesterifikasyon reaksiyonu sonucunda üretilir (Sun vd., β010). Katalizörlü transesterifikasyon reaksiyonları daha çok alkali, asidik ve enzimatik katalizör kullanılarak gerçekleşmektedir. Son zamanlarda yapılan çalışmalarda mikroporoz zirkonyum, sülfatlı zirkonyum ve titanyum temelli zeolit gibi heterojen katalizörlerde kullanılmaya başlanmıştır (Prakash, β006). Transesterifikasyon reaksiyonu katalizörsüz ortamda β50 0C ve üstünde gerçekleşirken asidik, alkali veya heterojen katalizör kullanımı sayesinde daha düşük sıcaklıklarda gerçekleşmektedir (Demirci ve Alpaslan, 1993; Richarda ve Vogel,1999 ). Son yıllarda biyodizel üretiminde kullanmak üzere heterojen katalizör geliştirme çabaları hız kazanmıştır. Proses sonrası ayırma, saflaştırma işlemlerinin olmaması, serbest yağ asitlerinin nötralizasyon adımını elimine etmesi, trigliseritlerin sabunlaşmasının görülmemesi, metil ester ve gliserinde katalitik artık bırakmaması ve üretimi daha ekonomik hale getiriyor olması, bu artışın en önemli sebepleridir. Aynı zamanda heterojen katalizörlerde yüksek ürün dönüşümü elde edilebilir ve çevre dostu bu katalizörler rejenere edilebilir özelliklere sahip katalizörlerdir (Marchetti vd., β007 ). Bu çalışmada bir tür kil olan sepiyolit ile LiCH3COO birleştirilerek LiCH3COO/sep. nanokompozit heterojen katalizörü sentezlenmiş ve yapısal karakterizasyonları gerçekleştirilmiştir. Sentezlenen katalizör kanola yağından transesterifikasyon yöntemi ile biyodizel üretiminde kullanılmıştır. Bu amaçla biyodizel üretiminde önemli parametreler olan metanol/yağ oranı, sıcaklık ve katalizörün dozajı etkileri incelenmiştir. 2. MATERYAL VE METOD 2.1. Katalizörün Hazırlanması İki boyunlu balon içerisinde 5,87λ g CH 3COOLi 500 mL deiyonize saf suda çözüldükten sonra, çözelti içerisine β0 g termal aktif sepiyolit ilave edilip, 60 °C de sabit tutularak β4 saat karıştırılmıştır. Karışım süzülerek etüvde 110 °C sıcaklıkta β4 saat kurutulmuştur. Kurutma işleminden sonra, karışım 500 °C sıcaklıkta 5 saat kalsine edilmiştir. Üretilen nanokompozit katalizör biyodizel deneylerinde kullanılmak üzere desikatörde saklanmıştır. POSTER PRESENTATION 266 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2.2. LiCH3COO/sep. Katalizörünün Yüzey ve Yapı Karakterizasyonu Sentezlenen katalizörün yüzeysel ve yapısal özelliklerinin belirlenmesinde FT-IR, SEM, TEM ve XRD cihazları kullanılmıştır FT-IR analizleri Perkin Elmer, SEM görüntüsü JEOL marka JSM-7600F model SEM (Scanning Electron Microscope), TEM görüntüsü JEOL marka JEM 2100F HRTEM model TEM (Transmission Electron Microscope) ve XRD analizi Rigaku marka Smart Lab model XRD (X-Ray Diffractometer) cihazı ile karakterize edilmiştir. 2.3. Biyodizel Üretimi, Optimizasyonu ve Karakterizasyonuna Ait Deneylerin Yapılışı Biyodizel üretimi, Şekil β.1’de gösterilen geri soğutucu, termometre ve manyetik karıştırıcı ile donatılmış yuvarlak dipli (500 mL) üç boyunlu bir balon düzeneğinde gerçekleştirilmiştir. Üretime dair önemli parametreler olan, katalizör miktarı, reaksiyon sıcaklığı, yağ/alkol oranı optimize edilmiştir. %3 ila %9 aralığında değişen miktarlarda belirlenen katalizörler, CH3OH ile birlikte reaktöre eklenerek 60 oC’de 1 saat ısıtılmıştır. Daha sonra farklı yağ/alkol oranları kullanılarak değişen miktarlarda kanola yağı da karışıma eklenerek γ saat karıştırılmıştır. Reaksiyon tamamlandıktan sonra, ele geçen ürün santrifüj edilerek üstte kalan biyodizel fazı iki kez saf su ile yıkanmıştır. Ortamda reaksiyona girmeden kalan CH3OH, karışımın 105 oC’de ısıtılması yoluyla uzaklaştırılmıştır ve su içeriği de karışıma Na2SO4 ilave edilerek kurutulmuştur. Tüm deneysel çalışmalar en az iki tekrarlı yapılmıştır. Sunulan veriler bu sonuçların ortalaması alınarak oluşturulmuştur. Şekil 2.1. Biyodizel üretiminde kullanılan reaktör Üretilen biyodizelin bileşimi GC-MASS analizi sonrasında belirlenmiştir, analiz sonucunda elde edilen % pik alanlarından faydalanılarak % verim hesabı yapılmıştır. Taşıyıcı gaz olarak helyum, iç standart olarak metil heptadekanoat kullanılmıştır. Aşağıdaki formül kullanılarak % verim hesaplanmıştır. % Verim = [(GC-MASS’den okunan % pik alanı x Biyodizel ağırlığı)/Yağ ağırlığı]x100 3. BULGULAR VE İRDELEME 3.1 LiCH3COO/sep. Katalizörün Karakterizasyon Çalışmaları 3.1.1. FT-IR ölçümleri Ham sepiyolit ve LiCH3COO/sep. materyallerine ait 4000- 490 cm-1 aralığında elde edilen FT-IR spektrumları Şekil γ.1.a ve Şekil γ.1.b’de gösterilmektedir. Ham sepiyolite ait spektrumda (Şekil 3.1.a) bulunan 3451,62 cm-1 bandındaki geniş pik, sepiyolitin yapısındaki OH- grubuna aittir. 1644.83 cm−1 piki sepiyolitin yapısında bulunan zeolitik suyun titreşimine işaret etmektedir. Ayrıca, 14β6,17 ve 1000 cm-1 deki geniş pikler sırasıyla yapıya bağlı OH- gerilmelerini ve Si-O titreşimini göstermektedir (Alkan vd., β005). Ham sepiyolitin yüzeyi Li2O ile kaplandığında yukarıda bahsi geçen karakteristik piklerde kaymalar gözlenmiştir. Bu durum bağlanmanın sağlıklı bir şekilde gerçekleştiğinin göstergesidir. POSTER PRESENTATION 267 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 3.1. a) Ham Sepiyolitin FT-IR spektrumu, b) LiCH3COO/sep. katalizörüne ait FT-IR spektrumları 3.1.2. XRD ölçümleri Ham sepiyolit ve LiCH3COO/sep. katalizörlerine ait XRD spektrumları Şekil γ.2.a ve Şekil γ.2.b’de sunulmuştur. XRD sonuçlarına göre LiCH3COO/sep. katalizörünün kalsinasyon işleminden sonra ham sepiyolit üzerine LiCH3COO adsorpsiyonu başarıyla gerçekleşmiştir. Şekil γ.β.a ve b’de görülen XRD piklerinden ham sepiyolit yapısının değişmediği (βθ=7.16) fakat kalsinasyon sonrasında elde edilen Şekil γ.β.b’deki XRD spektrumundaki pik şiddetlerinde önemli azalmaların veya bazı piklerde kaybolmaların olduğu görülmüştür. 3.1.3. SEM ve TEM analizleri LiCH3COO/sep. katalizörlerine ait SEM ve TEM görüntüleri Şekil γ.3.a ve Şekil γ.γ.b’de sunulmuştur. Şekil 3.3.a incelendiğinde, kalsinasyondan sonra sepiyolit örneklerinde lifsi ve pürüzlü yapının belirgin bir şekilde korunduğu, fakat üzerindeki heterojen olarak dağınık olan beyaz yapıların metal oksitlerden kaynaklandığı tahmin edilmektedir. Şekil 3.3.b’de LiCH3COO/sep. katalizörüne ait TEM görüntüsü sunulmuştur. TEM görüntüsü incelendiğinde, daha düzlemsel olan sepiyolit tabakaları yüzeyinde metal oksit tabakalarının oluştuğu ve üç boyutlu lifli yapı katmanlarının daha da belirginleştiği görülmektedir. POSTER PRESENTATION 268 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 3.2. a) Ham sepiyolite ait XRD pikleri, b) LiCH3COO/sep. katalizörüne ait XRD pikleri POSTER PRESENTATION 269 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 3.3. LiCH3COO/sep. katalizörüne ait a) SEM ve b) TEM görüntüleri. 3.2. Deneysel Çalışmalardan Elde Edilen Bulgular Transestirifikasyon deneysel çalışmalarında parametre olarak seçilen reaksiyon sıcaklığı, alkol/yağ oranı ve katalizör miktarına ait % biyodizel verimleri hesaplanmış ve ilgili grafikler oluşturulmuştur. Heterojen katalizör ile kanola yağı arasında gerçekleşen transesterifikasyon reaksiyonu Şekil γ.4.’de gösterilmiştir. Şekil 3.4. Heterojen katalizör ile kanola yağı arasında gerçekleşen transesterifikasyon reaksiyonu 3.2.1. LiCH3COO/sep. katalizörünün aktivite testleri Kanola yağının transesterifikasyon reaksiyonlarında LiCH 3COO/sep. katalizörünün aktivitesini araştırmak için bir seri deney yapılmıştır. 3.2.1.1. Katalizör yükleme etkisi Biyodizel üretimi üzerinde katalizör dozajı etkisi Şekil γ.5.a’da verilen grafikte gösterilmiştir. Metanol/yağ oranı λ/1, sıcaklık 60 oC ve 180 dakika reaksiyon süresinde deneyler gerçekleştirilmiştir. LiCH3COO/sep. katalizörünün miktarı %1.5’den %γ.0’a artırıldığında biyodizel üretim veriminin %45.11’den % 45.46’ya yükseldiği, katalizör miktarı % 6.0’ya yükseldiğinde ise biyodizel veriminde %45.0γ değerine düşüş görülmektedir. Bu durum LiCH3COO/sep. temelli biyodizel üretiminde uygulanabilecek en iyi katalizör miktarının %γ.0 olduğunu göstermektedir. 3.2.1.2. Metanol/yağ oranı Etkisi Biyodizel deneylerinde metanol/yağ oranı etkisi 3:1, 6:1, 9:1 ve 12:1 molar oranlarında çalışılarak belirlenmiştir. LiCH3COO/sep. katalizöründe metanol oranı γμ1’den λμ1 molar oranına artırıldığında biyodizel verimi %γ6.18’den %45.46’ya arttığı Şekil 3.5.b’de görülmektedir. Biyodizel üretiminde, kütle transferi ve reaktantın katalizör yüzeyindeki adsorpsiyonu önemli rol oynamaktadır (Dehkordi ve Ghasemi, β01β). Düşük metanol oranında, reaksiyon çözeltisi düşük süspansiyon oluşturur ve yağda iyi karışmamış veya çözünmemiş metanol düşük biyodizel verimine neden olur. Metanol oranı düşük tutulduğunda, bu durum kütle transferini sınırlar ve bu nedenle transesterifikasyon reaksiyonunu sürükleme gücü yeterli POSTER PRESENTATION 270 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org gelmez. Yüksek metanol oranında ise (λμ1) metanolün yağda çözünmesi kolaylaştırılmış olur ve katı katalizör süspansiyonunun kütle transfer problemini ortadan kaldırır (Olutoye ve Hammeed, 2013). 3.2.1.3. Biyodizel Verimi Üzerine Sıcaklığın Etkisi Reaksiyon sıcaklığı heterojen katalizli transesterifikasyon prosesinde önemli bir etkiye sahiptir. Farklı fazlar arasında difüzyon direnci var olduğundan, reaksiyon sisteminde yer alan yağ-metanol-heterojen katalizör üç fazını içeren heterojen katalizör reaksiyonu yavaş olabilmektedir (Mohammed Takase, β014). LiCH3COO/sep. katalizörü üzerinde sıcaklığın etkisi 50, 60 ve 70 oC değerleri için incelenmiş ve reaksiyon veriminin sıcaklık artışıyla orantılı olarak arttığı görülmüştür (Şekil 3.5.c). Şekil 3.5. LiCH3COO/sep. katalizörü kullanılarak üretilen biyodizellerin verimleri üzerinde a) LiCH3COO/sep. katalizör miktarının etkisi, b) Metanol/yağ oranının etkisi, c) Reaksiyon sıcaklığının etkisi. 4.YORUM LiCH3COO/sep. katalizörü sentezlenerek yüzey karekterizasyonu ve kimyasal yapısı FT-IR, XRD, SEM ve TEM cihazları kullanılarak başarılı bir şekilde aydınlatılmıştır. Üretilen nanokompozit yapılı katalizörün transesterifikasyon yöntemi ile biyodizel üretiminde alternatif olarak kullanılabilme potansiyelinin oldukça yüksek olduğu deneysel çalışmalar neticesinde görülmektedir. Mevcut katalizörün yenilenebilirlik ve tekrar kullanılabilirlik özelliği üzerinde çalışılarak, çözelti fazından ayrılması ve tekrar tekrar kullanımının sağlanmasının ekonomik açıdan biyodizel üretim maliyeti üzerine oldukça büyük katkı sağlayacağı düşüncesindeyiz. TEŞEKKÜR Bu çalışmayı 1γ/1β5 numaralı Bireysel Araştırma Projesiyle desteklediği için Muğla Sıtkı Koçman Üniversitesi Bilimsel Araştırma Projeleri Koordinasyon Birimine teşekkür ederiz. KAYNAKLAR Alkan M, Tekin G, Namli H 2005. FT-IR and zeta potential measurements of sepiolite treated with some organosilanes. Microporous and Mesoporous Materials, 84: 75–83. Dehkordi AM, Ghasemi M 2012. Transesterification of waste cooking oil to biodiesel using Ca and Zr mixed oxides as heterogeneous base catalysts. Fuel Processing Technology, 97: 45–51. Demirci M, Alparslan M 1993. Bitkisel Yağ Teknolojisi, Trakya Üniversitesi Ziraat Fakültesi Basımevi, s 125. Karmakar A, Karmakar S, Mukherjee S 2010. Properties of various plants and feedstocks for biodiesel production. Biosource Technology, 101: 7201-7210. POSTER PRESENTATION 271 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Madhuvilakku R, Piraman S 2013. Biodiesel synthesis by TiO2–ZnO mixed oxide nanocatalyst catalyzed palm oil transesterification process. Bioresource Technology, 150: 55–59. Marchetti JM, Miguel VU, Errazu AF 2007. Possible methods for biodiesel production. Renewable and Sustainable Energy Reviews, 11: 1300-1311. Olutoye MA, Hameed BH 2013. A highly active clay-based catalyst for the synthesis of fatty acid methyl ester from waste cooking palm oil. Applied Catalysis A: General, 450: 57– 62. Prakash N, Arul Jose A, Devanesan MGT 2006. Optimization of Karanja oil transesterification. 13: 505-509. Richarda JY, Vogel TM 1999. Characterization of a soil bacterial consortium capable of degrading diesel fuel. International Biodeterioration & Biodegradation, 44: 93-100. Sun H, Ding Y, Duan J, Zhang Q, Wang Z, Lou H, Zheng X 2010. Transesterification of sunflower oil to bodiesel on ZrO2 supported La2O3 catalyst. Bioresource Technology, 101: 953–958. Suryaputra W, Winata I, Indraswati N, Ismadji S 2013. Waste capiz (Amusium cristatum) shell as a new heterogeneous catalyst for biodiesel production. Renewable Energy, 50: 795-799. Takase M, Chen Y, Liu H, Zhao T, Yang L, Wu X 2014. Biodiesel production from non-edible Silybum marianum oil using heterogeneous solid base catalyst under ultrasonication. Ultrasonics Sonochemistry, 21: 1752–1762. POSTER PRESENTATION 272 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Rational Formation of Peptides Hybrid Nanoflower With Its Enzyme-Mimic and Antimicrobial Activities Didar Tasdemir1, Cagla Celik1, Sadi Yusufbeyoglu1, Nilay Ildiz2, Ilker Avan3, Vedat Yilmaz1,* and Ismail Ocsoy1,* 1 Department of Analytical Chemistry, Faculty of Pharmacy, Erciyes University, 38039, Kayseri, Turkey 2 Department of Pharmaceutical Microbiology, Faculty of Pharmacy, Erciyes University, 38039 Kayseri, Turkey 3 Department of Chemistry, Faculty of Science, Anadolu University, 26470, Eskisehir, Turkey Corresponding author e-mail:ismailocsoy@erciyes.edu.tr Corresponding author e-mail: vyilmaz@erciyes.edu.tr Abstract In this study, we develop, for the first time, the synthesis of novel peptide-inorganic hybrid nanoflowers (HNFs) formed of tripeptide as an organic component and copper (II) ion as an inorganic component in phosphate buffer saline (PBS) solution and to cast light on their peroxidase mimic and antimicrobial activities. The peptide used in the HNF was synthesized from three nonpolar and hydrophobic amino acids (glycine, leucine and phenylalanine). The presence of abundantly nonpolar R groups, Cu2+ ions and pores in the HNFs are relatively responsible in performing their peroxidase mimic activity by oxidation of guaiacol to colored 3,3-dimethoxy-4,4-diphenoquinone in the presence of hydrogen peroxide (H2O2) based on mechanism of Fenton-like reaction. The number of hydrophobic sites in the the HNFs and aforementioned factors above may play roles in denaturing bacterial cell membrane and lead to eventual cell death. Keywords: Amino acids, Peptide, Nanoflower, Peroxidase like Activity and Antimicrobial Activity 1. INTRODUCTION In recent years, researchers have put much effort into developing the strategies for synthesis of functional bio-materials for benefiting from their enhanced properties [Yao et al., 2011, Ye et al., 2016]. For instance, in 2012, Zare and co-workers discovered an encouraging breakthrough in fabrication of immobilized enzymes with greatly enhanced activity and stability. They reported the synthesis of flower shaped organicinorganic hybrid nanostructures consisting of protein and salt nanocrystals (copper phosphate) by selfassembly strategy [Gu et al., 2012]. Due to this inspirational work, several researchers have used various biomolecules (protein, enzyme and amino acids) and metal-phosphate nanocomplexes for underlying principles of organic-inorganic hybrid nanostructures formation and enhancement in catalytic activity and stability [Altinkaynak et al., 2016, Lin et al., 2014, Yu et al., 2015, Somturk et al., 2015, Ocsoy et al., 2015, Somturk et al., 2016, Altinkaynak et al., 2016, Zhu et al., 2013, Ildiz et al., 2017 and Baldemir et al., 2017]. In this study, we develop, for the first time, the synthesis of novel peptide-inorganic hybrid nanoflowers (HNFs) formed of tripeptide as an organic component and copper (II) ion as an inorganic component in phosphate buffer saline (PBS) solution and to cast light on their peroxidase mimic and antimicrobial activities with Fenton like reaction. The peptide used in the HNF was synthesized from three nonpolar and hydrophobic amino acids (glycine, leucine, and phenylalanine). Although amino acids (AAs), peptides and proteins act as biocides against various pathogens including bacteria, fungi and viruses, however, their poor bio-stability due to rapid degradation by proteases, tedious synthesis procedures and difficulty to react with cell membranes strictly limits their use in biomedical applications [Wu et al., 2016, Avan et al., 2016, Avan et al., 2014]. POSTER PRESENTATION 273 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS AND METHODS 2.1.Chemicals and Instrumentation Glycine, leucine, phenylalanine, bovine serum albumin (BSA), copper sulfate pentahydrate, phosphate buffered saline, guaiacol, hydrogen peroxide and Coomassie brilliant blue G-250 were purchased from Sigma-Aldrich. Deionized water (18.βMΩν MilliporeCo., USA) was used in all experiments. UV–vis spectrophotometry, scanning electron microscopy (SEM) and Energy-dispersive X-rays pectroscopy (EDX) were used to characterize the HNFs. 2.2. Preparation of Tripeptides HNFs Tripeptide and tripeptide HNFs were synthesized using reported methods. 0.02 mg mL −1 tripeptide powder was dissolved in 10 mM phosphate buffered saline (PBS) solution (pH 7.4) and certain volume of CuSO 4 solution was added to the mixture (final concentration of CuSO 4 solution was fixed to 0.8 mM. After addition of CuSO4 solution, the final mixture was vigorously and was then left undisturbed for incubation room temperature (RT = β5°C) for γ days. In general, a blue-colored precipitate at the bottom of reaction tube can be considered as indication of HNF formation). After 3 days, the mixture was centrifuged at 12 000 rpm for 20 min in order to collect the HNF powder and discarded unreacted components. The HNF precipitates were dried under vacuum at room temperature and stored for futher characterization and use. The glycine, leucine, phenylalanine HNFs were synthesized following the same procedure. 2.3. Peroxidase-Like and Antimicrobial Activites The tripeptide HNF powder was dissolved in 1 mL of PBS and then 1 mL of 22.5 mM hydrogen peroxide (H2O2) and 1 mL of 45 mM guaiacol were added to the mixture. The oxidation of guaiacol to colored 3,3dimethoxy-4,4-diphenoquinone was spectrophotometrically observed with the changes in the absorbance at 470 nm. Antimicrobial activities of free tripeptide and HNFs were tested using in vitro microdilution method based Clinical and Laboratory Standards Institute. The 1×10 8 CFU/ml concentration of bacterial and 1x10 6 CFU/ml concentration of fungal cells (adjusted in 1 mL of NB and YEPDB) were separately mixed with free tripeptide and HNF solutions. The each mixture was incubated for 24 hours for activation at 0.5 McFarland standard turbidity. The Minimum inhibitory concentrations (MIC) with a µg/mL were spectrometrically for each bacterial and fungal strain. All experiments were set up in two parallels and repeated four times. 2.4 Figures Figure 1. Time dependent HNF formation with various incubation times. A) in one day, B) in two days and C) in three days. D) High magnification SEM image of HNF. POSTER PRESENTATION 274 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org A B C D Figure 2. The SEM images of A) glycine, B) leucine, C) phenylalanine and D) peptide HNFs Figure 3. A) No peptide based HNFs formed at pH A) 10 and B) 4. Figure 4. A) XRD patterns of the HNF (black line). The peak position of the Cu3(PO4)2·γHβO (red line, JCPDS card (00-022-0548) located for comparison. B) EDX analysis of the HNF. POSTER PRESENTATION 275 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 5. Addition of A) formaldehyde and B) EDTA. Fig. 6. A) The absorbance changes of product with AAs and peptide HNFs. B) The antimicrobial activities of AAs and peptide HNFs. POSTER PRESENTATION 276 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3. RESULTS In typical synthesis strategy based on the coordination chemistry, Cu 2+ ions react with amine and carboxyl groups of the peptide to form hybrid nanoflowers in 10 mM PBS solution at pH 7.4. The HNFs are hierarchically and kinetically formed in incubation of three days in 10 mM PBS solution at pH 7.4. The small size petals on primary nanocrystals appear in Figure 1A with 1 day incubation. The incorporation of the petals for procreation of the HNFs is observed in Figure 1B at the second incubation days. The whole HNF formation was completed, as seen in Figure 1C. The high magnification image shows the petals assembly and porous structure of a HNF in Fig. 1D. The AAs HNFs were also produced to compare their morphologies with the peptide HNFs, as shown in Figure 2. While the each AA-incorporated HNF is sphere and has almost the same size (∼14 ηm) (Figure 2A, 2B and 2C), the peptide based HNF resulted in more blooming structures with diameters ∼λ.5 ηm in size (Figure 2D). We claim that using peptides somehow restrict the growth of HNF and lead the more compact morphology due to tight binding between peptides molecules and copper phosphate nanocrystals. Synthesis of the HNFs were achieved at PBS pH values pH 5 thru 10. Although all AAs HNFs were not formed at pH 9 and above and pH 5 and below, peptide HNFs were obtained at both pH 5 and 9 (data not shown). In addition to that, while the precipitates even were not observed at pH 10 and pH 4 when AAs used, the peptides give blue colored precipitates at those pH values but the peptide HNFs were not formed due to incompletion the growth process (Figure 3A and 3B). The structure of primary crystal in the all HNFs was analyzed by XRD. The most of the diffraction peaks of primary crystal pertaining to the Cu 3(PO4)2, which was quite consistent with that of JCPDS card (00-022-0548) (Figure 4A). The presence of Cu in the HNF powder was indicated with EDX analysis (Figure 4B). We further examined the effect of formaldehyde on morphology of the HNFs (Figure 5A). It is known that ethylenediaminetetraacetic acid (EDTA) strongly attack to most of the metal ions for formation of EDTA-metal ions complexes. Addition of EDTA to the nanoflower solution caused the loss of the flower structure due to removal of the Cu 2+ ions, which are indispensable component for nanoflower formation (Figure 5B). We demonstrated that the formaldehyde was not able to completely remove the Cu2+ ions but may weaken bond strength between amines groups and Cu2+ ions or partially break bond presented between Cu2+ ions and amine groups, both of which distort the morphology of the HNFs (Figure 5). In our work, plenty of nonpolar R groups, Cu2+ ions and pores, much highly enhance catalytic performance of the peptide HNFs compared to the AAs HNFs. The peptide HNFs consisting of abundant nonpolar aliphatic and aromatic R groups lead to produce Cu1+ ions in the HNFs, which may oxidize the guaiacol. The peroxidase-like activities of AAs and peptide HNFs are given on Table 1. Several metal compounds including copper show intrinsic peroxidase-like activity in the presence of H2O2 based on Fenton-like reaction mechanism. The enzyme mimic activity of AAs and peptide HNFs was systematically studied towards guaiacol in the presence of H 2O2 and the absorbance changes of the product were measured at 470 nm as shown in Figure 6A. Qu and co-workers commentate that protein-incorporated nanoflowers exhibited peroxidase-like activity depending on the reaction mechanism of Fenton-like reaction. In addition to that Dr. Li and co-workers speculate that the electronegativity of R groups of amino acids play a role in comparison of peroxidase-like activity performance of amino acid NFs [Vlieghe et al., 2010 and Tsai et al., 2015]. We also tested the antimicrobial activities of the HNFs. Although, free amino acids and tripeptides showed no antimicrobial activity, the HNFs exhibited mid antimicrobial activity against Enterococcus faecium (E. faecium) and Enterococcus faecalis (E. faecalis) as Gram-positive bacteria. The AAs HNFs caused ∼20% of E. faecium and E. faecalis cell inactivations however over ∼50% of cell death for both E. faecium and E. faecalis bacteria was observed when peptide HNF was used (Figure 6B). We assume that HNFs may electrostatically and hydroponically interact the bacterial membrane consisting of plenty of negatively charged and hydrophobic phospholipids and kill the bacterial cells by denaturing the membrane structure. We also consider that the bacteria can be entrapped into the pores the peptide HNFs, thus almost the entire cell surface is influenced by the HNFs. It is worthy to mention that in Fenton chemistry, metal and metal ions act Fenton’s reagent to produce various radicals, which result in the cell inactivation [Lloyd et al., 1997 and Sutton et al., 1989]. 4. DISCUSSION Flower shaped morphology was obtained in three successive steps. In first step, Cu2+ ions react with phospate ions (PO4)3-) to form Cu3(PO4)2 primary nanocrystals as seed. In secend step, the amine and POSTER PRESENTATION 277 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org carboxyl groups of AA and peptide bind to nanocrystals to initiate the formation of petal. In the final step, AA and peptide act as a glue to combine petal together to generate flower like structures. , It is worthy to mention that copper compounds exhibit peroxidase type activity in the presence of hydrogen peroxide (H2O2). The mechanism for this reaction called “fenton-like reaction” as shown in Figure 7. The HNFs were considered as Fenton agent by reacting of Cu2+ ions in i HNFs with H2O2 to form Cu1+ ions. The reaction of Cu1+ with H2O2 results in a highly reactive hydroxyl radical. This free hydroxyl radical initiates the oxidation of the substrate and formation of product proceeds through this mechanism. Peroxidase-like activities of the HNFs are significantly increased by increasing H2O2 and catalyst concentration. Figure 7. mechanism of Fenton-like reaction. 5. CONCLUSION In conclusion, the HNFs composed of amino acids and tripeptides and Cu 2+ in PBS were synthesized and their peroxidase-mimic activity against guaiacol and antimicrobial activity towards E. faecium and E. faecalis were investigated. We concluded that although all HNFs showed peroxidase like activity through Fenton like reaction, peptide HNF exhibited higher catalytic activity than AAs HNFs due to its highly porous structure and the high surface area. Moreover, peptide HNF showed much inhibition for the bacterial cell growth compared to AAs HNFs. This encouraging breakthrough in immobilization and structural and functional properties of the HNFs have a great potential to vary type of biomolecules and inorganic salt for producing new hybrid nanostructures and widen their use in various scientific and technical fields. ACKNOWLEDGEMENTS This work was supported by grants from the Erciyes University Scientific Research Office (FBA-20166899). REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. Altinkaynak C, Tavlasoglu S, Ozdemir N, Ocsoy I 2016. A new generation approach in enzyme immobilization: Organic-inorganic hybrid nanoflowers with enhanced catalytic activity and stability, Enzyme and Microbial Technology, 93–94:105–112. Altinkaynak C, Yilmaz I, Koksal Z, Ozdemir H, Ocsoy I, Ozdemir N 2016. Preparation of lactoperoxidase incorporated hybrid nanoflower and its excellent activity and stability, International Journal of Biological Macromolecules, 84:402–409. Avan I 2016. Microwave-assisted synthesis of β,β′-azopyridine-labeled amines, amino acids, and peptides, Synthesis 48:365–378. Avan I, Hall C.D, Katritzky A.R, 2014. Peptidomime-tics via modifications of amino acids and peptide bonds, Chemical Society Reviews, 43:3575-3594. Baldemir A, Köse B, Ildız N, İlgün S, Yusufbeyoğlu S, Yilmaz Y, Ismail O 2017. Synthesis and characterization of green tea (Camellia sinensis (L.) Kuntze) extract and its major components-based nanoflowers: a new strategy to enhance antimicrobial activity. RSC Advances, 7: 44303-44308. Ge J, Lei J, Zare R.N 2012. Protein–inorganic hybrid nanoflowers, Nature Nanotechnolog 7:428– 432. Ildiz N, Baldemir A, Altinkaynak C, Özdemir N, Yilmaz V and Ismail O 2017. Self-assembled snowballlike hybrid nanostructures comprising Viburnum opulus L. extract and metal ions for antimicrobial and catalytic applications, Enzyme and Microbial Technology, 102:60–66. Lin Z, Xiao Y, Wang L, Yin Y, Zheng J, Yang H, Chen G 2014. Facile synthesis of enzyme-inorganic hybrid nanoflowers and their applica-tion as an immobilized trypsin reactor for higly efficient protein digestion, RSC Advances, 4:13888. Lloyd R.V, Hanna P.M, Mason R.P 1997. The origin of the hydroxyl radical oxygen in the Fenton reaction, Free Radical Biology and Medicine, 22:885–888. POSTER PRESENTATION 278 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. Ocsoy I, Dogru E, Usta S 2015. A new generation of flowerlike horseradish peroxides as a nanobiocatalyst for superior enzymatic activity, Enzyme and Microbial Technology, 75–76:25–29. Somturk B, Hancer H, Ocsoy I, Özdemir N 2015. Synthesis of copper ion incorporated horseradish peroxidase-based hybrid nanoflowers for enhanced catalytic activity and stability, Dalton Transactions, 44:13845–13852. Somturk B, Yilmaz I, Altinkaynak C, Karatepe A, Özdemir N, Ocsoy I 2016. Synthesis of urease hybrid nanoflowers and their enhanced cataly-tic properties, Enzyme and Microbial Technology, 86:134–142. Sutton H.C, Winterbourn C.C 1989. On the participation of higher oxidation states of iron and copper in Fenton reactions. Free Radical Biology and Medicine, 6:53–60. Tsai C.Y, Chen Y.J, Fu Y.S, Chang L.S 2015. Antibacterial and membrane-damaging activities of mannosylated bovine serum albümin, Archives of Biochemistry and Biophysics, 573:14–22. Vlieghe P, Lisowski V, Martinez J, Khrestchatisky M 2010. Synthetic therapeutic peptides: science and market, Drug Discovery Today, 15:15-40. Wu Z.F, Wang Z, Zhang Y, Ma Y.L, He C.Y, Li H, Chen L, Huo Q. S, Wang L, Li Z.Q 2016. Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity, Scientific Reports, 6:1- 7. Yao H.B, Fang H.Y, Wang X.H, Yu S.H 2011. Hierarchical assembly of micro-/nano-building blocks: bio-inspired rigid structural functional materials, Chemical Society Reviews, 40:3764–3785. Ye R, Zhu C, Song Y, Lu Q, Ge X, Yang X, Zhu M.J, Du D, Li H, Lin Y 2016. Bioinspired synthesis of All-in-one organic–inorganic hybrid nanoflowers combined with a handheld pH meter for on-site detection of food pathogen, Small, 12:3094–3100. Yu Y, Fei X, Tian J, Xu L, Wang X, Wang Y 2015. Self-assembled enzyme-inorganic hybrid nanoflowers and their applicaiton to enzyme purification, Colloids and Surfaces B: Biointerfaces, 130:299–304. Zhu L, Gong L, Zhang Y, Wang R, Ge J, Liu Z, Zare R.N 2013. Rapid detection of phenol using a membrane containing laccase nanof-lowers, Chemistry – An Asian Journal, 8:2358–60. POSTER PRESENTATION 279 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Chemical Treatability of Olive Oil Mill Wastewater (OMW) Ezgi Oktav Akdemir1* *1 Dokuz Eylul University, Engineering Faculty, Environmental Engineering Department, İzmir, Turkey ezgi.oktav@deu.edu.tr Abstract Olive oil production is one of the most important agricultural activities in the Mediterranean area and it is economically important for several countries. Olive mill wastewater (OMW) is a major waste stream resulting from numerous operations that occur during the production stages of olive oil. The disposal of OMW is a serious environmental problem in particular in the Mediterranean Sea region with its high organic matter, suspended solid, phenolic compound content and acidic pH. In this study, chemical treatability of OMW with ferric trichloride (FeCl3) was investigated. In experimental studies, jar test experiments were carried out with different concentrations of FeCl3 (100-500 mg/l) with rapid mixing, slow mixing and precipitation processes. Chemical treatment with FeCl 3 was applied to raw OMW and filtered OMW, separately. The maximum COD removal efficiency was achived at high FeCl 3 concentration and filtered OMW. COD removal efficiency was 32% when 500 mg/l FeCl3 was added to raw OMW, but this efficiency increased to 50% when FeCl 3 was added to the filtered OMW at the same concentration. Keywords: Olive oil industry, olive mill wastewater, FeCl3. 1. INTRODUCTION Olive oil extraction produces vast amount of liquid and solid wastes, which are called as olive mill wastewater (OMW), and olive mill residue (OMR). Although olive oil is an exceptional nutritional value, a high amount of OMW is produced during production, which in turn affects the environment negatively. Approximately 30 million m3 of OMW is produced annually in the Mediterranean region. A high pollutant load also occurs in this case (Chiavola et al., 2014). Particularly Mediterranean countries face serious problems in the management of OMW. The chemical composition of OMW varies considerably depending on various factors such as olive type, tree age, cultivation system, fruit maturity level, geographical and climatic conditions, type of oil extraction process applied, use of pesticides and fertilizers, etc. (Yay et al., 2012). OMW is characterized by dark brown color, characteristic unpleasant odor, low pH, a high suspended solids content, high turbidity and high organic load (Amor et al. 2015). Several investigative projects have been carried out in order to create an appropriate and effective treatment method for the produced olive mill wastewaters (OMW). Some of the proposed methods are direct application on soil or evaporation in lagoons. Biological methods contain several methods of OMW management, such as microbiological treatment, composting, aerobic digestion, anaerobic digestion (Paraskeva and Diamaduopulos, 2006). Advanced oxidation processes includes the Fenton reaction, photo– Fenton reaction and ozonation are the other treatment processes for OMW (Mantzavinos, 2005; Giannis et.al., 2007). Furthermore, the physico‐ chemical treatment methods such as membrane filtration, coagulation/flocculation and electro‐ coagulation are very prevalent (Iakovides et.al.,2016). There are many studies that OMW has been purified by coagulation and flocculation. Curi et al. (1980) have tested the treatment of OMW with a mixture of aluminum sulfate and ferric chloride, calcium hydroxyde solution and also acidifying of the waste with hydrochloride acid solution. They have determined the claryfying percent of the wastewater. Calcium hydroxide and aluminium sulfate has also been used besides magnesium sulfate in another study (Tsonis et.al., 1989). The values of pH, fixed solids, total solids, volatile solids and COD have been determined after the treatment of OMW with the chemicals. They have reported that COD value dropped to 20 –30% with calcium hydroxide, when it was added until the pH of the waste POSTER PRESENTATION 280 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org reached 11. Sarika et.al. (2005) studied coaulation and flocculation of OMW with cationic and anionic polyelectrolytes, lime and FeCl3. They found minimum coagulant dosage to attain solid-liquid seperation was 2.5-3 g/l. 40% COD removal and 45%BOD removal efficiencies were obtained in their work. Alver et.al. (2015) investigated coagulation with FeSO 4 and Fenton reaction. They obtained higher removal effficiency, such as 65.5 % COD removal by sequantial coagulation and Fenton process. In the content of this study FeCl3 was used as a coagulant for chemical treatment of olive mill wastewater. Different concentration of FeCl3 was added to raw and filtered OMW and chemical treatability of OMW was investigated in term of COD removal efficiency. 2. MATERIALS AND METHODS 2.1. Sample Collection Olive oil mill wastewater was taken from a 3-phase continuous olive oil mill plant located in Izmir-Turkey. Samples were collected in December from the effluent of the horizontal decanter. Fresh sample was kept in dark at 4C. 2.2. Coagulation-Flocculation Experiments Coagulation and flocculation experiments were performed using Jar-test equipment (VelpScientifica Flocculation Test Unit) given in Figure 1. pH value of wastewater was increased from 5.5 to 9 with the addition of 10 % Ca(OH)2 solution. Ca(OH)2 consumption was 300 ml/L of wastewater. Then jar tests were carried out. Desired concentration of FeCl3 (100-500 mg/l) and 300 ml of OMW were added to beaker each containing 500 ml volume. First, three minutes rapid mixing at 225 rpm for 3 minutes and then 45 minutes slow mixing at 45 rpm were applied. Subsequently, the stirring was stopped and 120 minute settling time was applied. Following the settling time, samples were collected from clear supernatant using a syringe. Figure 1. Jar Test Equipment 2.3. Analytical Methods COD, TOC, pH, SS, oil and grease measurements were carried out on the influent and COD measurements was applied on effluent samples for the characterization and treatment studies. COD, SS, oil and grease analyses carried out according to Standard Methods (APHA, AWWA). Dohrmann DC-190 High POSTER PRESENTATION 281 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Temperature TOC Analyzer was used for TOC measurements. pH measurement was done by using 890 MD pH meter. 3. RESULTS AND DISCUSSIONS 3.1. Characterization of Olive Oil Mill Wastewater Fresh OMW used in this work was obtained from three phase continuous plant. The main physicochemical characteristics of the used OMW are given in Table 1. OMW has dark brown color and characteristic smell. Table 1. The Main Characteristics of OMWW Used in this Study Parameter unit value pH - 5.5 COD mg/l 108000 TOC mg/l 48580 TS mg/l 65120 TSS mg/l 12310 Oil and grease mg/l 2720 3.2. Chemical Treatability Studies with FeCl3 In the first part of experiments, FeCl3 was added to raw OMW sample in different doses between 100-500 mg/l. pH value of wastewater was increased from 3.5 to 9 with the addition of 10 % Ca(OH) 2 solution, then jar tests were carried out. Results of this experiment are given in Table 2. The removal efficiency of FeCl3 was increased with increasing FeCl3 doses. Initial COD concentration was 108000 mg/l for raw OMW sample. COD concentration of wastewater after adding 300 mg/l FeCl3 was 95000 mg/l. It decreased to 86000 mg/l and 73000 mg/l by adding 400 mg FeCl3/l and 500 mg FeCl3/l, respectively. The results indicated that FeCl3 is an effective coagulant for COD removal from olive mill wastewater at high doses. Table 2. COD Removal Efficiency of Coagulation Experiments with FeCl3 Dosage of FeCl3 (mg/l) COD (mg/l) COD (mg/l) COD removal efficiency (%) before treatment after treatment 100 108000 100000 7 200 108000 97000 10 300 108000 95000 12 400 108000 86000 20 500 108000 73000 32 In the second part of experiments, raw OMW sample was filtered from filter paper in 0.80 mm pore diameter. In this case, COD concentration of raw OMW decreased from 108000 mg/l to 88000 mg/l with 18% COD removal efficiency. pH value was increased to around pH=6-7 with the addition of 10 % Ca(OH)2 solution in order to reach neutral pH. Then different dosage of FeCl 3 (100-500 mg/l) was added to wastewater and jar test was carried out. After settlement, supernatant was taken and COD concentration was measured. All results are given in Table 3. As it can be seen from table, filtration positively affected COD removal efficiency. Also, COD removal efficiency was increased by increasing the FeCl3 concentration. POSTER PRESENTATION 282 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 3. COD Removal Efficiency of Coagulation Experiments with FeCl3 on Filtrated Wastewater COD (mg/l) COD (mg/l) Dosage of FeCl3 (mg/l) COD (mg/l) raw OMW after filtration 108000 88000 100 81000 25 108000 88000 200 78000 28 108000 88000 300 72000 33 108000 88000 400 63000 42 108000 88000 500 54000 50 after treatment COD removal efficiency (%) 4. CONCLUSION The aim of this study was to investigate the characterization and treatability of the olive mill wastewater with FeCl3 coagulation. 32% COD removal efficiency was achieved by chemical coagulation-flocculation experiment with FeCl3 with raw OMW. When the filtered OMW was coagulated with FeCl3, COD removal efficiency reached 50%. However, the COD concentration of OMW in the wastewater is still as high as 54000 mg/l. As a result of all experimental studies, it was impossible to achieve the discharge standards with these methods, since the discharge standard is 250 mg COD/l for olive oil industry. Therefore, further treatment is needed to reduce the COD concentration. When chemical treatment methods were applied alone, significant improvement in COD reduction was not observed. Physical, chemical, and biological treatment alternatives should be applied sequentially for achieving wastewater discharge standards for olive mill wastewaters. REFERENCES Alver A, Bastürk E, Kılıc A, Karatas M 2015. Use of advance oxidation process to improve the biodegradability of olive oil mill effluents., Process Safety and Environmental Protection, 98: 319–324. Amor C, Lucas MS, García J, Dominguez JR, De Heredia JB, Peres JA 2015. Combined treatment of olive mill wastewater by Fenton's reagent and anaerobic biological process. Journal of Environmental Science and Healt: Part A, 50: 161-168. APHA, AWWA Standard Methods for the Examination of Water and Wastewater (twentieth ed.), American Public Health Association, Washington, DC, USA 1998. Chiavola A, Farabegoli G, Antonetti F 2014. Biological treatment of olive mill wastewater in a sequencing batch reactor. Biochemical Engineering Journal, 85: 71-78. Curi K, Velioğlu S, Diyamandoğlu V 1980.Treatment of olive oil production wastes in:Treatment and disposal liquid and solid industrial wastes ,ed. K. Curi, Pergamon Press,Oxford, 1980, pp.189 –205. Giannis A, Kalaitzakis M and Diamadopoulos E 2007. Electrochemical treatment of olive mill wastewater. Journal of Chemical Technology and Biotechnology, 82:663–671. Iakovides, I C, Pantziaros, A G, Zagklis, D P, Paraskeva CA 2016. Effect of electrolytes/polyelectrolytes on the removal of solids and organics from olive mill wastewater, Journal of Chemıcal Technology and Bıotechnology, λ1 (1) β04-211. Mantzavinos D and Kalogerakis N 2005. Treatment of olive mill effluents: Part I. Organic matter degradation by chemical and biological processes: An overview, Environmental International, 31:289– 295. Paraskeva P and Diamadopoulos E 2006. Technologies for olive mill wastewater (OMW) treatment: A review. Journal of Chemical Technology and Biotechnology, 81:1475–1485. Sarika R, Kalogerakis N, Mantzavinos D 2005. Treatment of olive mill effluents. Part II. Complete removal of solids by direct flocculation with polyelectrolytes, Environmental International 31: 297–304. Tsonis SP, Tsola VP, Grigoropoulos SG 1989. Systematic characterization and chemical treatment of olive oil mill wastewater, Toxicological & Environmental Chemistry, 20-21: 437 –457. Yay ASE, Oral HV, Onay TT, Yenigün O 2012. A study on olive oil mill wastewater management in Turkey: a questionnaire and experimental approach. Resource Conservation Recycling 60: 64-71. POSTER PRESENTATION 283 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Biyoçeşitliliğin İzlenmesi ve Korunmasında Coğrafi Bilgi Sistemlerinin (CBS) Kullanımı Salih Doğan1, Meryem Bingül Türk1*, Sibel Doğan1, Ozan Arif Kesik2 Erzincan Üniversitesi, Fen Edebiyat Fakültesi, Biyoloji Bölümü, Erzincan, Türkiye Erzincan Üniversitesi, Fen Edebiyat Fakültesi, Coğrafya Bölümü, Erzincan, Türkiye 1 2 * Sorumlu yazar e-mail: mbingul@erzincan.edu.tr Özet Mekânsal teknolojilerin kullanımı günümüzde hayatımızı etkileyen ve yönlendiren boyuta gelmiştir. Bu teknolojilerin kullanımı bilgi karmaşasını azaltmakta ve yapılan Coğrafi Bilgi Sistemlerine (CBS) dayalı analizler sonucu yöneticiler, idareciler ve bilim için yeni bir bakış açısı ortaya çıkarmaktadır. CBS’nin genel bir tanımı bulunmamakla birlikte en genel anlamdaν konuma dayalı gözlemlerle elde edilen verilerin toplanması, veri tabanında saklanması, analiz edilmesi ve sunulmasını bir bütünlük içerisinde gerçekleştiren bir bilişim teknolojisidir. Günümüzde mekânın bütün boyutları CBS ile analiz edilebildiği için CBS’nin kullanım alanı her geçen gün artmaktadır. Biyolojik varlığa ilişkin verilerin saptanması ve doğru bir şekilde analizi önem arz etmektedir. Bu çalışmada, literatür taramasıyla ulaşılan verilere dayalı olarak biyoçeşitliliğin izlenmesi ve korunmasında CBS’nin kullanıldığı uygulamalara değinilmiştir. Konuyla ilgili çalışmalar incelendiğinde, CBS teknolojisi kullanarak biyoçeşitlilik hakkında yapılan araştırmaların 1λλ0’lı yıllarda başlandığı söylenebilir. Türkiye’de ise CBS kullanarak yapılan biyoçeşitlilik çalışmaların son yıllarda gerçekleştirildiği ve genellikle bitkilerin dağılımı ve korunmasıyla alakalı olduğu gözlenmektedir. Fauna elemanlarının dağılımıyla ilgili CBS çalışmaları ise oldukça sınırlı olduğu anlaşılmaktadır. Biyolojik çeşitliliğin korunması, sürdürülebilirlik ilkelerine bağlı kalınarak doğanın korunması ve çevre kalitesinin artırılmasıyla birlikte gerçekleşecektir. CBS analizleri günümüzde özellikle türün bulunduğu yerin tespitinde, korunmasında bilim insanlarını yönlendirmekte ve yeni bir bakış açısı ortaya çıkarmaktadır. Anahtar Kelimeler: Coğrafi Bilgi Sistemleri, Biyoçeşitlilik, Mekânsal Teknolojiler 1. GİRİŞ Biyolojik çeşitliliğin kısaltılmasından türetilen “biyoçeşitlilik” terimi, 1λ80’lerin ortalarında tropik yağmur ormanları gibi doğal ortamların hızlı bir biçimde ortadan kalkmasından kaygı duyan ve bu ortak mirasın korunması için toplumun önlem almasını da talep eden doğaseverler tarafından ortaya atılmıştır. Başlangıçta doğanın korunması ile sınırlı olan bu kavram giderek sosyal, ekonomik ve etik boyutlarla derinlik kazanmıştır (Lévêque ve Mounolou, β008). Bir bölgedeki organizmaların gösterdiği farklılıklar ile tür ve sayı bakımından büyüklüğü biyoçeşitlilik olarak tanımlanabilir. Bu çeşitlilik, doğal bir zenginlik olmasının yanında her ekosistem kendi biyoçeşitliliğini oluşturur. Ayrıca bir bölgedeki biyoçeşitlilik hem kendi ülkesinin hem de dünyanın zenginliğidir. Farklı özelliklere, unsurlara ve canlı çeşidine sahip olan bir doğa parçası, tekdüze yapıda bir doğa parçasına göre daha zengin, daha dirençli ve daha kararlıdır. Diğer taraftan, bir ekosistemin biyolojik çeşitliliğinin fazla olması diğer ekosistemlere göre üstünlüğünün kanıtı değildir (Erten, 2004ν Doğan ve ark., 2010). Coğrafi Bilgi Sistemleri (CBS), konuma dayalı gözlemlerle elde edilen grafik ve grafik olmayan bilgilerin toplanması, veri tabanında saklanması, analizi ve sunumu işlevlerini bir bütünlük içerisinde gerçekleştiren etkin bir bilişim teknolojisidir (Yomralıoğlu, β000ν Bingül ve ark., β016). CBS ilk olarak Coğrafya bilimi içerisinde ortaya çıkmasına ve büyümesine rağmen, farklı disiplinlerle de bütünleşme ve kendi gelişim dinamiklerini oluşturma ihtiyacı ortaya çıkmıştır (Şeremet ve Alaeddinoğlu, β017). CBS mekânın çok farklı yönlerden araştırılması, anlaşılması ve analiz edilmesine imkân sağladığı için mekânla ilgili tüm alanlarda kullanılmaktadır (Bingül ve ark., β016). Biyoçeşitlilik Çalışmalarında CBS Kullanımı CBS biyoçeşitliliğin izlenmesi ve denetlemesinde çok fazla kullanılmaktadır (Per ve ark., β015). Özellikle UNEP (United Nations Environment Program) ve IUCN (International Union for the Conservation of POSTER PRESENTATION 284 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Nature) gibi birçok kurum bu konular hakkında detaylı incelemeler ve çalışmalar gerçekleştirmektedir (McNeely, 1993). UNEP ve Dünya Koruma İzleme Sistemi (World Conservation Monitoring System) ile beraber yapılan “Biodiversity data management capacitation in developing countries and networking biodiversity information (BDM)” başlıklı proje ile biyoçeşitliliğin korunmasında bilgi sistemlerinden yararlanılması fikri ortaya atılmıştır. Buna göre bilgi sistemi kurularak türlerin ve habitatların tespiti, riskli olan türlerin belirlenmesi, arazi kullanım rehberleri ve alternatif koruma yasaları yapılmalı ve bunun sayesinde izleme ve yönetme gerçekleştirilmelidir (National Biodiversity Institutions/Units, 1994). Biyolojik çeşitliliğin korunması, sürdürülebilirlik ilkelerine bağlı kalınarak doğanın korunması ve çevre kalitesinin artırılmasıyla birlikte gerçekleşecektir. Buna ek olarak CBS analizleri günümüzde özellikle türün bulunduğu yerin tespitinde, korunmasında bilim insanlarını yönlendirmekte ve yeni bir bakış açısı ortaya çıkarmaktadır. Ayrıca CBS analizlerinde elde edilen verilerin kalitesi ve hangi analiz metodunun kullanılacağını belirlemek doğru sonuca ulaşmak için çok önemlidir. Günümüzde biyolojik çeşitlilik çalışmalarında genellikle verilerin toplanmasında küresel yer belirleme (The Global Positioning System GPS) teknolojisi kullanılmaktadır. Elde edilen veriler sayısallaştırılıp, veri tabanının oluşturulduktan sonra mekânsal teknolojilerinin kullanılmasına hazır hale getirilir. Veri tabanından oluşturulmasından sonra biyolojik varlığın zamansal ve mekânsal dağılımı tespit edilip üzerinde çok farklı analizler gerçekleştirilebilir. Böylece CBS sayesinde yerel yöneticilere biyolojik çeşitliliğin korunmasında yönlendirici bilgiler verilebilmesine imkân sağlanır (Bingül ve ark., β016). Çevresel ve ekolojik verilen toplanması yönetilmesi analizinin yapılmasında coğrafi bilgi sistemleri kullanılır (Aspinall, 1λλ5). Çeşitli zamanlarda alınan veriler ve türlerin konumlarındaki yer değişimi CBS sayesinde tespit edilebilir ve ölçümler yapılabilir. Bu sayede potansiyel veriler elde edilebilir (Maguire ve ark., 1991). Davis ve ark. (1λλ0) bilgi sistemleri ölçeğinde taksonomik, ekolojik ve kültürel değişkenlerin biyolojik çeşitliliğe etkisini araştırmışlardır. Walker ve Faith (1λλ4) biyoçeşitliliğin belirlenmesinde CBS tabanlı uygulama geliştirmişlerdir. Bu uygulamada türlerin dağılımı verilerek coğrafi değişkenlerin bu türlerin dağılımına etkisini araştırılmıştır. Masoud ve Miller (β005) toprak içesindeki bütün organizmaların dağılımını etkileyen zararlı maddeleri CBS kullanarak çalışmışlardır. Smith-Ramirez ve ark. (2007) CBS kullanarak Şili yağmur ormanlarının flora ve fauna dağılımının değişimlerini hangi faktörlerin etkilediğini belirlemişlerdir. Salem (β00γ) biyoçeşitliliğin izlenmesinde ve yönetilmesinde CBS analizlerini kullanmıştır. Bu çalışmada Mısır çalışma alanı seçilerek Overlay (bindirme) analizleri kullanılmış ve biyoçeşitlilik türlerine göre gruplara ağırlık verilmiştir. En son olarak ise bu ağırlığa göre mekânsal analizlerin sonuçları haritalarla gösterilmiştir. Vásquez ve Parsa (β014) “A geographic distribution database of Mononychellus mites (Acari, Tetranychidae) on cassava (Manihot esculenta)” isimli çalışmasında akarların dağılımı konusunda CBS veri tabanı oluşturmuştur. Bunnell ve ark. (2003) ABD’nin Orta Atlantik Bölgesinde CBS yardımıyla Ixodes scapularis (Acariμ Ixodidae) erginlerinin mekânsal dağılımına bakmışlardır. Yine Almanya’da başka bir kene türünün (Ixodes ricinus) CBS yardımıyla dağılım analizi gerçekleştirilmiştir (Schwarz ve ark., 2009). Ülkemizde CBS, türlerin ve yaşam alanlarının belirlenmesi, korunması, izlenmesi ve biyolojik çeşitlilikle ilgili bazı çalışmalarda kullanılmıştır. Kargıoğlu ve ark. (β008) Akarçay Havzası (Afyonkarahisar) vasküler endemik bitkilerinin, rekabet ve yayılış durumlarına göre, ekolojik isteklerini mukayese etmek ve bu türlerinin situ korunması için öncü bir envanter oluşturmasını amaçlamıştır. Sivrikaya ve ark. (β004) tarafından yaşlı ormanların korunması ve yaşlı orman değerinin hesaplamasında CBS kullanılmıştır. Ayrıca Selim ve Sönmez (β015) tarafından sığla ağacının (Liquidambar orientalis) Köyceğiz-Dalyan Havzasındaki doğal yayılış alanı ve peyzaj yapısı CBS teknolojisi kullanılarak incelenmiştir. Kandemir (β01β) tarafından Erzincan iline özgü bitki türlerine ait popülâsyonların CBS ile analizini gerçekleştirmiş ve analiz sonucunda türlerin dağılımlarının büyük oranda jeolojik yapıya bağımlı olduğu ortaya konmuştur. Peşkircioğlu (β016) CBS yazılımlarının verileri görsel hale getirerek biyolojik olguların daha rahat anlaşılması sağladığını belirterek, Tarla Bitkileri Merkez Araştırma Enstitüsü web sayfasında CBS yardımıyla hazırlanan çeşitli haritaların bulunduğunu ve bunların biyoloji alanındaki çalışmalara ışık tutacağını bildirmektedir. Şenol ve Eroğlu (β017) tarafından bildirilen bir proje çalışması kapsamında Seferihisar’da yayılış gösteren 551 çiçekli bitki taksonu tespit edilmiş ve elde edilen veriler coğrafi bilgi sistemi veri tabanında depolanarak Seferihisar Doğa Mirası CBS Veri Tabanı oluşturulmuştur. Ülkemizde flora çalışmalarının yanı sıra fauna elemanlarının dağılımında da CBS ile alakalı çalışmalar bulunmaktadır. Bahadır ve Emet (β01γ) CBS’de yüzey sorgulama analizleri kullanarak omurgalı endemik fauna elemanlarının Anadolu ve Trakya’daki yayılış alanlarını haritalamışlardır. CBS ayrıca türlerin korunması ve takibinde kullanılmaktadır. Onmuş (β006) önemli kuş alanlarından birisi olan Gediz POSTER PRESENTATION 285 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Deltasında CBS analiz yöntemleriyle kuş alanları incelenmiştir. Demirel ve ark. (β010) tarafından yapılan çalışmada Göksu Deltası’nın çok amaçlı ve dinamik bir coğrafi bilgi sisteminin oluşturulması hedeflenmiş ve tematik haritalar oluşturulmuştur. Per ve ark. (β015) bir kuş türü olan Karabaşlı çinte (Emberiza melanocephala)’nin iklimsel parametrelerden yararlanarak ve CBS kullanarak Türkiye’deki potansiyel dağılım alanlarını ve sınırlarını belirlemiştir. Mert ve Kıraç (β017) tarafından CBS yazılım ile Sütçüler (Isparta) yöresinde endemik bir kertenkele türü olan Anatololacerta danfordi için uygun habitatlar belirlenerek haritalandırılmış ve hedef organizmanın dağılımını etkileyen çevresel değişkenler ortaya konmuştur. Denizhan ve ark. (β00λ), Google Earth tabanlı CBS’yi kullanarak gal akarlarının (Acariμ Eriophyoidea) popülasyon gelişimleri, dağılımları, konakçı tercihleri ve doğal doğal düşmanlarını belirlemeye çalışmışlardır. Bingül ve ark. (β016) ve Doğan ve ark. (β016) Erzincan il merkezindeki bazı akar (Acari) türlerini belirleyerek, kent yaşamına uyum sağlamış olan akarları CBS ile analiz etmiş, konuma dayalı analiz tekniklerini kullanarak kent merkezindeki familya ve tür seviyesindeki dağılışlarını dijital haritalar üzerinde göstermiş ve farklı habitatların barındırdığı akar çeşitliliğini ortaya çıkarmıştır. Adil ve ark. (2016) ve Sevsay ve ark. (2017) CBS’yi trombidioid akarların (Acari) dağılımı ve haritalanmasında kullanmıştır. Sarı ve Ceylan (β017) tarafından Konya ili Beyşehir ilçesinde en uygun arıcılık yerlerinin belirlenmesi amacı ile CBS yardımıyla arıcılık için gerekli şartlar, kısıtlamalar ve gereksinimler göz önüne alınarak bir uygulama gerçekleştirilmiştir. Çalışma kapsamında eğim, yükseklik, su kaynakları, yerleşim, yollar, bakı, flora ve yağış gibi kriterler için en uygun aralıklar uzman görüşleri ile belirlenerek haritalandırılmış, analitik hiyerarşi yöntemi ile en uygun arıcılık yerleri belirlenmiştir. 2. SONUÇ CBS teknolojileri coğrafi olan (Geographic) ya da olmayan bilgilerin (Spatial) toplanması, yönetilmesi, analiz edilerek topluma sunulmasına imkân sağlar (Çağatay ve ark., β01β). Günümüz bilgi iletişim teknolojilerinin gelişimine bakıldığında bu teknolojilerin kullanımı artık zorunlu hale gelmiş ve günlük hayatın vazgeçilmez bir aracı olmuştur (Kapluhan, β014). Buna ek olarak sağladığı birçok imkân ve kolaylık sayesinde, CBS teknolojileri günümüzde yerel yönetimleri yönlendiren bir teknolojidir (Çabuk, β015). CBS artık mekanla ilgili bütün alanda kullanılmakta bu teknolojinin kullanılması günlük hayatımızı kolaylaştırmada ve hayatımıza yön vermektedir (Koçak, β00λν Bingül ve ark., β016ν Azizoğlu ve Adızel, 2017). Şehir planı, arazi kullanımı, hukuk, tıp, diş hekimliği mühendislik, savunma, tarım, sağlık, su kaynakları turizm ve ormancılık gibi alanlar başta olmak üzere yaklaşık 100’den fazla disiplinde CBS kullanılmakta ve son yıllarda birçok üniversite ve kurumda CBS üzerine yoğun çalışmalar yapılmaktadır (Phoenix, β000ν Bingül ve ark., β016). Biyoçeşitliliğin korunması ve bununla ilgili faaliyetlere yönelik ilgi dünya genelinde hızla artmaktadır. Biyoçeşitliliğin sürdürülebilir kullanımı için çeşitlilik unsurlarının rolü iyi tespit edilerek, uzun vadede bu unsurların ve fırsatların biyoçeşitliliğin azalmasına yol açmayacak ölçüde kullanımı gerekmektedir (Aslan ve ark., β008). Avrupa’da CBS kullanarak biyoçeşitlilik hakkında yapılan araştırmaların 1λλ0’lı yıllarda başlandığı söylenebilir (Davis ve ark., 1λλ0ν Walker ve Faith, 1λλ4ν Bingül ve ark., β016). Türkiye’de ise CBS teknolojisi kullanarak yapılan biyoçeşitlilik çalışmaların ancak son yıllarda ve genellikle endemik bitkilerin dağılımı ve korunmasıyla alakalı olduğu gözlenmektedir (Sivrikaya ve ark., β004ν Kargıoğlu ve ark., β008ν Kandemir, β01βν Selim ve Sönmez, β015). Fauna elemanlarının dağılımıyla ilgili CBS çalışmaları ise oldukça sınırlıdır (Onmuş, β006ν Demirel ve ark., β010ν Bahadır ve Emet, β01γν Per ve ark., β015ν Mert ve Kıraç, β017). Buna ek olarak konuyla ilgili yurtiçi ve yurtdışı çalışmalar incelendiğinde CBS kullanımına yönelik akarlar gibi eklembacaklı canlılarla ilgili bazı çalışmaların da olduğu anlaşılmaktadır (Bunnell ve ark., 2003; Schwarz ve ark., β00λν Vásquez ve Parsa, β014ν Denizhan ve ark., β00λν Bingül ve ark., β016ν Doğan ve ark., β016ν Adil ve ark., β016ν Sevsay ve ark., 2017). KAYNAKLAR Adil S, Sevsay S, Kesik OA 2016. Coğrafik Bilgi Sistemi (CBS) kullanılarak Ergan Dağı trombidioid akarlarının haritalanması. 23. Ulusal Biyoloji Kongresi, 5-λ Eylül, Gaziantep, 46γ. Aslan B, Aslan EG, Karaca İ, Kaya M β008. Kasnak meşesi tabiatı koruma alanında (Isparta) farklı habitatlarda çukur tuzak yöntemi ile yakalanan Carabidae ve Tenebrionidae (Coleoptera) türleri ile biyolojik çeşitlilik parametrelerinin karşılaştırması. SDÜ Fen Edebiyat Fakültesi Fen Dergisi, γ (β)μ 1ββ132. Aspinall R 1995. Geographic information systems: their use for environmental management. Parks, 20-31. POSTER PRESENTATION 286 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Azizoğlu E, Adızel Ö β017. Yüksekova Nehil Sazlığı (Hakkâri-Türkiye) ve çevresinde tespit edilen kuş türlerinin mevsimsel habitat kullanımı ve populasyon dağılımlarının belirlenmesi. ADYÜTAYAM, 5 (1)μ 10-19. Bahadır M, Emet K β01γ. Anadolu’da yayılış gösteren omurgalı endemik fauna elemanlarının CBS ile dağılış alanlarının haritalanması. Uluslararası Sosyal Araştırmalar Dergisi, 34-50. Bingül M, Doğan S, Dilkaraoğlu S, Kesik OA β016. Kent akarlarının (Acari) belirlenmesi ve Coğrafi Bilgi Sistemi (CBS) kullanılarak haritalandırılmasıμ Erzincan Örneği. Uluslararası Erzincan Sempozyumu, 28 Eylül-01 Ekim, Erzincan, 3: 943-954. Bunnell JE, Price SD, Das A, Shields TM, Glass GE 2003. Geographic information systems and spatial analysis of adult Ixodes scapularis (Acari: Ixodiae) in the middle atlantic region of the U.S.A. Journal of Medical Entomololgy, 40 (4): 570-576. Çabuk SN β015. CBS’nin yerel yönetimlerde kullanımı ve kent bilgi sistemleri. Harita Teknolojileri Elektronik Dergisi, 7 (3): 69-87. Çağatay A, Terzioğlu E, Ekmen Zİ, Erdoğan E β01β. Biyolojik çeşitliliği izleme ve değerlendirme raporu. T.C. Orman ve Su İşleri Bakanlığı Doğa Koruma ve Milli Parklar Genel Müdürlüğü, Lazer Ofset Matbaa Tes. Ltd. Şti., Ankara. Davis F, Storms D, Estes J, Scepan J, Scott J 1990. An information systems bapproach to the preservation of biological diversity. International Journal of Geographic Information, 55-78. Demirel Z, Özer O, Dabanlı S β010. Göksu Deltası’nın tarım, hayvancılık, arazi kullanımı ile ilgili γ boyutlu haritalarının ve CBS’nin oluşturulması. Biyoloji Bilimleri Araştırma Dergisi, 3 (2): 175-179. Denizhan E, Çobanoğlu S, Kotaoğlu Ç β00λ. One example about using geographic information system’s studies in Acarology: Google Earth. 1st International Workshop in Taxonomic Acarology, 3-5 June, Ankara, 28. Doğan S, Bingül M, Ayyıldız N, Kesik OA β016. An evaluation in terms of urban mite (Acari) diversity: some mites in peridomestic habitats of Erzincan city (Turkey). 8th Symposium of the European Association of Acarologists (EURAAC-2016), 11-15 July, Valencia, Spain, 40-41. Doğan S, Özçelik S, Dolu Ö, Erman O β010. Küresel ısınma ve biyolojik çeşitlilik. İklim Değişikliği ve Çevre γμ 6γ-88. Erten S β004. Uluslararası düzeyde yükselen bir değer olarak biyolojik çeşitlilik. Hacettepe Üniversitesi Eğitim Fakültesi Dergisi, β7μ λ8-105. Kandemir A 2012. Erzincan ili endemik bitkilerin CBS ile tespiti. Erzincan: Tubitak. Kapluhan E β014. Coğrafi Bilgi Sistemleri’nin (CBS) Coğrafya öğretiminde kullanımının önemi ve gerekliliği. Marmara Coğrafya Dergisi, βλμ γ4-59. Kargıoğlu M, Serteser A, Şenkul Ç, Özdemir MA β008. Akarçay havzası (Afyonkarahisar)’ındaki tehlike altındaki (CR, EN, VU) endemik bitkilerin Coğrafi bilgi sistemleri (CBS) ile haritalandırılması ve koruma statüleri. Biyoloji Bilimleri Araştırma Dergisi, 1 (2): 33-36. Koçak H β00λ. Coğrafi bilgi sistemlerinin kentsel yaşam kalitesinin yükseltilmesine etkileri üzerine bir değerlendirme. Dumlupınar Üniversitesi Sosyal Bilimler Dergisi, 25: 141-148. Lévêque C, Mounolou JC β008. Biyoçeşitlilik. Biyolojik devinimler ve koruma. Başıbüyük, HH, Yılmaz A, Kılınç S (Eds), Palme Yayıncılık, β01γ, 1-259. Maguire DJ, Goodchild M, Rhind D 1991. Geographic information systems. Longman, Londra. Masoud S, Miller WM 2005. Precision application technology for monitoring soil applied pesticides in Florida citrus production. FRUTIC 05, Information and Technology for Sustainable Fruit and Vegetable Production, Montpellier, France, 633-641. McNeely JA 1993. Parks for Life: Report of the IVth world congress on national parks and protected areas, IUCN, 1-252. Mert A, Kıraç A β017. Isparta-Sütçüler yöresinde Anatololacerta danfordi (Günter, 1876)’nin habitat uygunluk haritalaması. Bilge Uluslararası Fen ve Teknoloji Araştırmaları Dergisi, 1 (1)μ 16-22. National Biodiversity Institutions/Units 1994. Biodiversity data management capacitation in developing countries and networking biodiversity information. Global: National Biodiversity Institutions/Units. Onmuş O β006. Göksu deltası’nın tarım, hayvancılık, arazi kullanımı ile ilgili γ boyutlu haritalarının ve Cbs’nin oluşturulması. 4. Cografi bilgi sistemleri bilisim günleri, İstanbulμ Fatih Üniversitesi, 1-8. POSTER PRESENTATION 287 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Peşkircioğlu M β016. Coğrafi Bilgi Sistemi ve Biyoloji. 23. Ulusal Biyoloji Kongresi, 5-λ Eylül, Gaziantep, 40. Per E, Erciyas Yavuz K, Demirtaş S β015. Karabaşlı çinte (Emberiza melanocephala Scopoli, 176λ)’nin ekolojik niş modeli ve Türkiye’deki durumu. Erciyes Üniversitesi Fen Bilimleri Enstitüsü Dergisi, γ1 (β)μ 89-96. Phoenix M 2000. Learning with GIS. Arcuser Online, 6-24. Salem B 2003. Application of GIS to biodiversity monitoring. Journal of Arid Environments, 54: 91-114. Sarı F, Ceylan DA β017 Beyşehir ilçesi için coğrafi bilgi sistemleri yardımıyla en uygun arıcılık yerlerinin bulunması. II. Uluslararası Beyşehir ve Yöresi Kongresi, 06-08 Ekim, Konya, 107. Schwarz A, Maier WA, Kistemann T, Kampen H 2009. Analysis of the distribution of the tick Ixodes ricinus L. (Acari: Ixodidae) in a nature reserve of western Germany using Geographic Information Systems. International Journal of Hygiene and Environmental Health, 212: 87-96. Selim S, Sönmez NK β015. Sığla (Liquidambar orientalis Miller) popülasyonları dağılımının CBS ile belirlenmesi ve habitat kalitesinin peyzaj metrikleri kullanılarak değerlendirilmesiν Muğla Köyceğiz Örneği. Tekirdağ Ziraat Fakültesi Dergisi, 12 (1): 30-38. Sevsay S, Kesik OA, Adil S. 2017. Akarların dağılımı ve haritalanmasında coğrafi bilgi sistemlerinin kullanılması. XIII. Uluslararası Katılımlı Ekoloji ve Çevre Kongresi (UKECEK), 1β-15 Eylül, Edirne, 409. Sivrikaya F, Yolasığmaz HA, Başkent EZ β004. Doğal yaşlı ormanlar ve coğrafi bilgi sistemleri yardımıyla belirlenmesi. KSÜ Fen ve Mühendislik Dergisi, 7 (1): 45-52. Smith-Ramirez C, Diaz I, Pliscoff P, Valdovinos C, Méndez MA, Larrain J, Horacio S β007. Distribution patterns of flora and fauna in southern Chilean Coastal rain forests: Integrating Natural History. Biodiversity and conservation, 16: 2627-2648. Şenol SG, Eroğlu V β017. Seferihisar Doğa Mirası Projesi (Flora). XIII. Uluslararası Katılımlı Ekoloji ve Çevre Kongresi (UKECEK), 1β-15 Eylül, Edirne, 186. Şeremet M, Alaeddinoğlu F β017. Coğrafi Bilgi Sistemlerinde (CBS) farklı bir perspektifμ Eleştirel CBS’ye yönelik bir literatür analizi. Batman Üniversitesi Yaşam Bilimleri Dergisi, 7μ 187-194. Vásquez-Ordóñez AA, Parsa S β014. A geographic distribution database of Mononychellus mites (Acari, Tetranychidae) on cassava (Manihot esculenta). ZooKeys, 407: 1-8. Walker P, Faith DP 1994. Diversity: a software package for sampling phylogenetic and environmental diversity. version 2.1. CSIRO, Division of Wildlife and Ecology, 1-52. Yomralıoğlu T 2000. Coğrafi bilgi sistemleri, İstanbulμ Seçil Ofset. POSTER PRESENTATION 288 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The solution and extractant properties of metal-free and metallophthalocyanines substituted by four macrocycles containing piperazinedion moiety Yaşar Gök, Halil Zeki Gök* Department of Biomedical Engineering, Faculty of Technology, Mehmet Akif Ersoy University, 15030 Bucak/Burdur, Turkey halilzekigok@gmail.com Abstract Metal-free phthalocyanine 3 and metallophthalocyanines 4 and 5 substituted in peripheral position with macrocycles containing piperazine moiety have been synthesized by cyclotetramerization of the phthalonitrile precursor. Electronic absorption properties for all phthalocyanines were studied in various organic solvents. The liquid-liquid extraction of metal picrates such as Ag(I), Hg(II), Cd(II), Zn(II), Cu(II), Ni(II), Pb(II), Co(II), K(I), and Na(I) from aqueous phase to the organic phase was carried out using 2 and 4. The highest extractability from aqueous phase to organic phase was found for Hg(II) cation over the other metal cations with zinc(II) phthalocyanine 4. Keywords: Macrocyclization, Mixed-donor macrocycle, Phthalocyanine, Aggregation, Metal picrates, Solvent extraction 1. INTRODUCTION Since their first synthesis and cation complexing characteristic was reported by Pedersen (Pedersen, 1967), hundreds of macrocycle have been synthesized in order to investigate the unusual properties of these cyclic ligands such as their metal-ion chemistry, spectral, electrochemical, structural, kinetic and thermodynamic stabilities (Izatt et al., 1985). The understanding of principles of metal-ion chemistry of macrocycles has important because the macrocyclic ligand and their complexes play critical roles in a number of biological systems such as biological cation transport system, transport of oxygen in mammalian and mechanism of photosynthesis (An et al., 1992; Lindoy, 1989). Designing of macrocycle ligand is a key step for selective complexation of metal ion. Selection of donor atoms in macrocycle is of primary importance. The hard-soft acid-base concept provides preliminary guide for donor atom selection (Hancock and Martell, 1989). Macrocycles with “hard” ether-oxygen are selective against alkali and alkaline earth metal cation whereas the “soft” sulfur containing macrocycles show a binding preference toward “soft” transition metal cation (Chartes et al., 2006). To enhance the coordination properties of macrocycles, different parameters have been modified such as the ring size, the nature of substituents, and the type of donor atoms present (An et al., 1992; Qui et al., 2009; Banfi et al., 2007). The chemistry of phthalocyanines has developed rapidly since Linstead reported their first synthesis (Byrne et al., 1934). The synthesis and subsequent study of a large number of phthalocyanines have presented due to their high potential applications in several areas such as photodynamic reagent for cancer theraphy (Master et al., 2010), optical read-write discs (Luo et al., 2007), gas sensor (Sizun et al., 2011), corrosion inhibitors (Zhao et al., 2005) and electrochromic displays (Mortimer et al., 2006). The first introduction of crown ether into a phthalocyanine was reported in 1986 (Koray et al., 1986) and the ability of this molecule to bind alkali metal cations was investigated (Musluoğlu et al., 1λλ1). The synthesis of phthalocyanine-bearing macrocycles has found potential applications in biochemistry and materials science (Bekaroğlu, 1λλ6). Particularly, the attachment of a macrocycle containing nitrogen and sulphur donor atoms to phthalocyanines increases their selectivity towards alkaline-earth and soft transition metal cations (Ertem et al., 2008). The synthesis of phthalocyanines containing a macrocycle unit usually needs a multi-step reaction sequence (Gök et al., β007a). Especially, the macrocyclization step requires high dilution techniques (Gokel and Korzeniowski, 1982) or template effect (Cook et al., 1974). We have described the synthesis and characterization of metal-free and metallophthalocyanines substituted by four macrocycles containing piperazine moiety on peripheral positions (Gök and Gök, β014). We have also investigated the solvent extraction properties of macrocyclic ligand 2 and zinc(II) phthalocyanine 4 for metal cations such as Ag(I), Hg(II), Cd(II), Zn(II), Cu(II), Ni(II), Pb(II), Co(II), K(I), and Na(I) from aqueous phase to the organic phase. POSTER PRESENTATION 289 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATERIALS AND METHODS 2.1. Materials N,N'-(2,2'-(4,5-dicyano-1,2-phenylene)bis(sulfanediyl)bis(2,1-phenylene))bis(2-chloroacet-amide) 1 was prepared according to the literature report (Gök and Farsak, β01γ). All reagents and solvents were reagent grade quality and were obtained from commercial suppliers. All solvents were dried and purified as described by Perrin and Armarego (Perrin and Armarego, 1989). 2.2. Equipment FTIR spectra were measured on a Perkin Elmer Spectrum 65 spectrometer in KBr pellets. 1H and 13C NMR spectra were recorded on a Varian Mercury 400 MHz spectrometer in CDCl 3 and DMSO-d6 (99.9%). Mass spectra were measured on a Micromass Quatro LC/ULTIMA LC-MS/MS and a Bruker Daltonics MALDITOF spectrometer. Optical spectra were recorded in the UV-Vis region with a PG-T80+ spectrophotometer in 1 cm path length cuvettes at room temperature. The elemental analyses were obtained with a LECO Elemental Analyzer (CHNS 0932) spectrophotometer. The melting points were determined with an electrothermal apparatus and are reported without correction. In solvent extraction experiment Selecta type shaker with thermostat was used. 2.3. Synthesis 2.3.1. 1,4-bis(2-(4,5-dicyano-1,2-pheylene)sulfanediyl)piperazine-2,5-dione (2) A mixture of 1 (β.5 g, 47.5 mmol) and NaOH (4 g, 104 mmol) in 100 ml of DMF were heated to 65 °C for 16 h under nitrogen atmosphere. The reaction was monitored by thin layer chromatography using ethyl acetate-hexane (4:6) as the solvent system. At the end of this period, the mixture was filtered and the filtrate was evaporated to dryness under reduced pressure. The yellowish oil was dissolved in CH 2Cl2. The organic layer was washed twice with 100 ml portions of a 5% NaCl solution and then twice with water. The combined organic layer was dried over anhydrous Na2SO4 and the solvent was evaporated under reduced pressure to give a crude product that was purified by silica gel chromatography. The elution was carried out with hexane-ethyl acetate (7:3). The product was obtained as pale yellow solid and then dried in vacuum. The yield was 1.5 g (70%). Mp 251-252 oC. Anal. calcd for C24H14N4O2S2: C, 63.42; H, 3.10; N, 12.33%. Foundμ Cμ 6γ.64ν Hμ γ.λ4ν Nμ 11.β8%. IR (KBr disc) θ max/cm-1: 3046 (CHAr), 2922 (CH3), 2235 (CN), 1692 (C=O), 1583, 1475, 1443, 1320, 1260, 1134, 1039, 897, 744, 657, 583, 530. 1H NMR (CDCl3) : 7.43 (d, J = 7.78 Hz, 2H, ArH), 7.38 (t, J = 7.65 Hz, 2H, ArH), 6.90-6.84 (m, 6H, ArH), 4.31(s, 4H, O=CCH 2N). 13C NMR (CDCl3) : 164.84 (C=O), 140.49, 138.23, 137.68, 128.83, 127.32, 125.28, 123.60, 118.94, 115.75, 114.21 (ArC), 31.28. MS (LC-MS/MS) m/z: 455.26 [M+H]+, 477.29 [M+Na]+. 2.3.2. Metal-free phthalocyanine (3) A mixture of 2 (0.3 g, 0.660 mmol) and a few drops of 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in dry npentanol (1.5 ml) were placed under a nitrogen atmosphere in a standard Schlenk tube. The reaction mixture was heated and stirred under nitrogen at 145 ºC for β4 h. After cooling to room temperature, the mixture was diluted with ethanol (10 ml) until the product precipitated. The precipitated crude product was filtered. The crude product was refluxed with ethanol (25 ml) in a Soxhlet extractor for 4 h. The product was then filtered and washed with ethanol and diethyl ether and then dried under vacuum. Finally, pure metal-free phthalocyanine was obtained by silica gel column chromatography using dichloromethane : methanol solvent systems in different ratios ranging from (99:1) to (95:5). The yield was 0.075 g (25%). Mp > 300 0C. Anal. calcd. for C96H58N16O8S8: C, 63.35; H, 3.21; N, 12.31%. Found: C, 61.15; H, 3.15; N, 11.33%. IR (KBr disc) θmax/cm-1: 3296 (NH), 3058 (CHAr), 2925 (CH3), 1729 (C=O), 1584, 1499, 1439, 1349, 1299, 1229, 1095, 1019, 870, 746. 1H NMR (DMSO-d6) : 7.54-6.82 (m, 40H, ArH), 3.70 (br, s, 16H, O=CCH2N). UVVis (DMF): max, nm (log ): 733 (4.97), 701 (4.84), 688 (4.63), 640 (4.40), 554 (4.66), 370 (5.04). MS (MALDI-TOF) m/z: 1823.18 [M+5H]+, 1914.09 [M+4Na+4H]+, 1957.69 [M+6Na+H]+, 2028.18 [M+9Na+3H]+. POSTER PRESENTATION 290 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2.3.3. Zinc(II) phthalocyanine (4) A mixture of 2 (0.3 g, 0.660 mmol), anhydrous anhydrous Zn(CH 3CO2)2 (0.035 g, 0.200 mmol) and quinoline (2 ml) was placed in a well-stoppered schlenk tube under an argon atmosphere. The mixture was heated and stirred gently to °C and then refluxed at this temperature for 7 h. The crude product was cooled to room temperature and ethanol (10 ml) was added to this mixture. The resulting dark green precipitate was filtered off. The crude product was refluxed with ethanol (25 ml) in a Soxhlet extractor for 4 h. The product was then filtered and washed with ethanol and diethyl ether and then dried under vacuum. Finally, pure zinc(II) phthalocyanine was obtained by silica gel column chromatography using dichloromethane:methanol solvent systems in different ratios ranging from (99:1) to (95:5). The yield was 0.070 g (23%). Mp > 300 0C. Anal. calcd. for C96H56N16O8S8Zn: C, 61.22; H, 3.00; N, 11.90%. Found: C, 58.01; H, 3.17; N, 10.87%. IR (KBr disc) θmax/cm-1: 3064 (CHAr), 2925 (CH3), 1727, 1688 (C=O), 1613, 1583, 1476, 1442, 1325, 1258, 1134, 1097,746. 1H NMR (DMSO-d6) : 9.62 (m, 4H, O=CCH2N), 9.13 (m, 4H, O=CCH2N), 7.76-6.39 (m, 40H, ArH), 3.80 (m, 4H, O=CCH2N), 3.29 (m, 4H, O=CCH2N). 13C NMR (DMSO-d6) : 165.46 (C=O), 153.55, 139.35, 137.41, 137.07, 129.01, 127.18, 126.62, 123.38, 122.91, 119.58 (ArC), 30.74 (O=CCH 2N). UV-Vis (DMF): max, nm (log ): 688(4.83), 620 (4.02), 360 (4.42). MS (MALDI-TOF) m/z: 1881.68 [M+H]+, 1902.99 [M+Na]+. 2.3.4. Cobalt(II) phthalocyanine (5) The procedure is the same as above with 0.035 g (0.200 mmol) of anhydrous Co(CH3CO2)2 (instead of Zn(CH3CO2)2). Yield was 0.050 g (18%). Mp > 300 0C. Anal. calcd. for C96H56N16O8S8Co: C, 61.43; H, 3.01; N, 11.94%. Found: C, 60.25; H, 3.24; N, 10.97 %. IR (KBr disc) θmax/cm-1: 3060 (CHAr), 2916 (CH3), 1688 (C=O), 1583, 1519, 1475, 1442, 1327, 1259, 1225, 1103,748. UV-Vis (DMF): max, nm (log ): 679 (4.86), 335 (4.87). MS (MALDI-TOF) m/z: 1876.80 [M+H]+. 2.4. Extraction method The metal ion binding properties of macrocycle 2 and zinc(II) phthalocyanine 4 were investigated by liquidliquid solvent extraction method. Picrate extraction experiments were performed following published procedures (Gök et al., β007b) Solvent extraction experiments were carried out using the aqueous metal picrate solutions, which were prepared from a mixture of the metal nitrates (KNO 3, NaNO3, Pb(NO3)2, Co(NO3)2.6H2O, Cu(NO3)2.3H2O, Zn(NO3)2.6H2O, Ni(NO3)2.6H2O, Cd(NO3)2.4H2O, AgNO3, Hg(NO3)2.H2O) and picric acid in deionized water. Dichloromethane and chloroform were tested as organic solvents in extraction experiments. An organic solution (10 mL) of ligand (1.25 x 10 -4 M) and an aqueous solution (10 mL) containing 1.25 x 10 -5 M picric acid and 1 x 10-2 M metal nitrate were placed in stoppered flask and shaken for 2 h at 25 ± 0.1 °C. Then, the resulting mixtures were allowed to stand for least β h at that temperature in order to complete the phase separation. The concentration of the picrate ion remaining in the aqueous phase was then determined by UV-Vis spectrophotometer at 355 nm. Blank experiment was performed in the absence of host and showed that no picrate extraction occurred. The extractability (E%) was determined based on absorbance of picrate in aqueous solutions. The extractability was calculated from the following equation: E(%) = [(A0-A)/A0] x 100 Where A0 is the absorbance in the absence of ligand and A the absorbance in the aqueous phase after extraction. 3. RESULTS AND DISCUSSION 3.1. Synthesis and Characterization The synthetic pathway for the preparation of the target metal-free phthalocyanine 3 and metallophthalocyanines 4 and 5 is summarized in Scheme 1. The structures of novel compounds were characterized by a combination of elemental analysis and 1H NMR, 13C NMR, IR, UV-vis and MS spectral data. N,N'-(2,2'-(4,5-dicyano-1,2-phenylene)bis(sulfanediyl)bis(2,1-phenylene))bis(2-chloroacet-amide) 1 was prepared according to the literature report (Gök and Farsak, β01γ). POSTER PRESENTATION 291 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Scheme 1. Synthetis of phthalocyanines 3-5. 3.2. Absorption spectra The phthalocyanines show typical electronic spectra with two absorption bands. One of them is in UV region at about 300-500 nm (B band) and the other one is in the visible region at 600-800 nm (Q band) (Leznoff and Lever, 1989). In the case of metal-free phthalocyanine, the Q band splits into two bands in the visible region as a result of D2h symmetry (Hanack et al., 1998). Metal complexes of substituted and unsubstituted phthalocyanines with D4h symmetry show an intense single Q band in the visible region (Hanack et al., 1998). The electronic absorption spectra of the studied phthalocyanine were recorded in different solvents. The results are summarized in Table 1. Electronic absorption spectrum of metal-free phthalocyanine 3 is shown in Fig. 1a. The characteristic split Q band for metal-free phthalocyanine 3 was observed at max = 733 and 701 nm in DMF. In addition of that, the broad absorption at max = 554 nm can be attributed to the (S) -* transition of the non-bonding electrons associated with the peripheral sulfur atoms (Kabay et al., 2011). B band absorption of the metal-free phthalocyanine 3 was observed at max = 366 nm. 0,8 0,8 0,5 b 0,4 0,4 0,3 Diethylether DCM DMF THF EtOH 0,6 Diethylether DCM DMF THF EtOH Absorbance Absorbance Absorbance a DMF THF DCM 0,6 0,2 c 0,4 0,2 0,2 0,1 0,0 0,0 0,0 300 400 500 600 700 800 300 400 Wavelength (nm) 500 600 700 800 300 400 500 600 700 800 Wavelength (nm) Wavelength (nm) Figure 1. UV-Vis spectrum of phthalocyanines 3 (Fig 1a), 4 (Fig 1b) and 5 (Fig 1c) in different solvents Table 1. Location of the Q bands and B bands (in nm) of metal-free phthalocyanines 3 and metallophthalocyanines 4 and 5 in various solvents at concentration of 8 x 10 -6 mol.dm-3. Solvent Pcs DMF THF DCM DMF THF DCM DMF THF DCM 3 3 3 4 4 4 5 5 5 POSTER PRESENTATION Q band, max, (nm) 733, 701, 688, 640 734, 704, 634 734, 707 688, 620 688, 644, 617, 590 686, 646, 618, 590 679 675, 639 680, 644 log  4.97, 4.84, 4.63, 4.40 4.69, 4.58, 4.24 4.79, 4.68 4.83, 4.02 4.53, 4.54, 3.96, 3.60 4.70, 4.58, 4.09, 3.72 4.86 4.82, 4.86 4.80, 4.87 B band, max, (nm) 370 366 366 360 350 350 335 329 335 log  5.04 4.83 4.98 4.42 4.45 4.58 4.87 4.92 4.82 292 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The metallophthalocyanine compounds 4 and 5 show solvent-dependent spectra. The recorded UV-Vis spectra of metallophthalocyanine 4 and 5 in different solvents are illustrated in Fig.1b and Fig.1c, respectively. In DMF, phthalocyanine complexes showed the expected absorptions with the main peaks of the Q and B bands, appearing a strong band at max = 688 nm for 4 and 679 nm for 5 with a shoulder at max = 620 nm and 615 nm, respectively. Appearance of single intense Q band is characteristic for metallophthalocyanines with D4h symmetry (Takahashi et al., 1995). B band absorptions of metallophthalocyanines 4 and 5 were observed at max = 360 and 335 nm, respectively. In the UV-Vis spectra of 4 and 5 in diethyl ether, ethanol, dichloromethane and tetrahydrofuran solvents, new strong bands at max = 644 nm for 4 and 635 nm for 5 appeared in addition to the main Q bands at max = 688 nm and 680 nm, respectively. The effects of solvents on the state of aggregation of soluble phthalocyanines have been studied by several groups and reported in numerous papers (Palewska and Sworakowski, 2012; Ogunsipe et al., β004ν Durmuş and Nyokong, β007). Phthalocyanines are known to exist in solutions in the form of monomers, dimers, trimers and oligomers. Dimerization/oligomerization of symmetrical phthalocyanines results in spectral effects that extend from band broadening, to a blue-shift of the Q band, to an observed splitting of the Q band (Leznoff and Lever, 1986). It has been shown that the tendency of the phthalocyanine to dimerize is greater in solvents of low dielectric constant (Allcock and Neenan, 1986). Changes in the solvent from diethylether to DMF (thereby raising the dielectric constant of the medium) moved the monomer-dimer equilibrium toward higher monomer ratios. The bands at around 690 nm and 640 nm can be attributed to monomeric and oligomeric phthalocyanine species for 4 and 5. 3.3. Extractability and selectivity The metal ion-binding properties of macrocycle 2 and zinc(II) phthalocyanine 4 was performed by using solvent extraction experiments in order to estimate the extractability of metal ions such as Ag+, Hg2+, Cd2+, Zn2+, Cu2+, Ni2+, Pb2+, Co2+, K+, and Na+ from aqueous phase to the organic phase. Two different organic solvents were tested to reveal extraction efficiency. The organic solvents are dichloromethane and chloroform. The results related to the extractability of above metal picrates from aqueous phase to organic phases are given in Table 2 and Fig.4. Table 2. The extractability of aqueous metal picrates for compounds 2 and 4 into organic phasea Metal ion Na+ K+ Nı2+ Cu2+ Hg2+ Zn2+ Ag+ Cd2+ Pb2+ Co2+ Extractabilityb (%) (2) (4) β.1 ± 0.γ 5.0 ± 0.γ γ.λ ± 0.γ 0 6.7 ± 0.5 8.7 ± 0.γ λ.4 ± 0.γ ββ.β ± 0.8 17.1± 0.8 71.5 ± 0.5 0 γ0.7 ± 1.7 0 44.7 ± 0.5 1.7 ± 0.5 8.5 ± 0.γ 0 β4.γ ± 0.7 1.γ ± 0.5 6.0 ± 0.7 Extractabilityc (%) (2) (4) 4.7 ± 0.γ 0 0 0 0 γ.0 ± 0.β 0 1β.γ ± 0.β γ.5 ± 0.6 67.λ ± 0.6 4.1 ± 0.λ βγ.β ± 0.8 λ.6 ± 0.γ γ1.6 ±0.5 0 1.1 0.1 5.1 ± 0.7 5.1 ± 0.γ 0 0 Temperatureμ β5.0±0.1 oC; aqueous phase (10 ml); [pic-] = 1.25 x 10-5 M, organic phase (10 ml); [L] = 1.25 x 10-4 M; The values calculated from three independent extraction experiments. b Organic solvent: dichloromethane. c Organic solvent: chloroform. a POSTER PRESENTATION 293 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org (a) Extractibility into dichloromethane phase 100 50 Macrocycle (2) 0 (b) Extractibility into chloroform phase 100 80 60 40 20 0 Macrocycle (2) (c) Fig. 4. Extraction of 2 and 4 towards metal picrate salts. (a) organic phase, dichloromethane. (b) organic phase, chloroform. (c) comparison of extraction of 4 toward metal cations in dichloromethane and chloroform. As seen from Table 2, macrocyclic ligand 2 exhibited the lowest extraction efficiency for all the metal ions in both solvents. The best extractability belongs to Hg2+ ion in dichloromethane and Ag+ ion in chloroform, but they were only 17.1% and 9.6%, respectively. The cation binding properties of the macrocycles depend upon different factors such as macrocylic effect, cavity size, and the type and number of donor atoms (Izatt et al., 1985; Hancock and Martell, 1989). As seen from Scheme 1, the zinc(II) phthalocyanine 4 contains four macrocycle bearing piperazine unit and it is expected to transport metal cations more effectively with respect to macrocycle 2 for the same conditions. In addition to that, the zinc(II) phthalocyanines has a planar structure. The E% values obtained for zinc(II) phthalocyanine 4 was higher than those of macrocycle 2 in both organic solvents. The obtained extraction values in the presence of zinc(II) phthalocyanine 4 for Ag+, Hg2+, Pb2+ and Cu2+ in both organic solvents were high when compared to other metal cations. The highest extractability belongs to Hg2+ and Ag+ cations with zinc(II) phthalocyanine 4 in both organic solvents. The values of extractability belonging to Hg2+ and Ag+ are 71.5% and 44.7% in dichloromethane and 67.9% and 31.6% in chloroform, respectively. The percentage of extractability of Hg 2+ ion to the dichloromethane and chloroform for compound 4 is almost equal. However, compound 4 extracted Ag+ ion 44.7% to the POSTER PRESENTATION 294 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org dichloromethane phase. This value was higher than that of chloroform. In the case of zinc(II) phthalocyanine 4, increasing in extraction capability may be due to the result of planarity of zinc(II) phthalocyanine 4 or the number of donor atoms in compound 4. From the experimental results, we can conclude that the zinc(II) phthalocyanine is much more effective than macrocyclic ligand 2 in the extractability of metal cations from aqueous phase to organic phase under these conditions. 4. Conclusions In conclusion, the synthesis of a macrocycle containing piperazine moiety and its metal-free and metallophthalocyanine derivatives has been described. The metal ion binding properties of 2 and 4 were evaluated using the liquid-liquid extraction technique. Ligand 2 has low cation binding capacity for all metal cations tested. The extraction percentage for all metal cations with zinc(II) phthalocyanine 4 is higher than those of macrocyclic ligand 2. The cation-binding avidity of 4 for Hg2+ over other cations in both organic solvents was found to be the highest. Zinc(II) phthalocyanine 4 extracts Hg2+ ion to dichloromethane phase with 71.5% and chloroform phase with 67.9%. Acknowledgements We would like to thank Dr. Hasan Demir from Department of Chemical Engineering in Osmaniye Korkut Ata University for his technical assistance with extraction studies. References Allcock HR, Neenan TX 1986. Synthesis of polyphosphazenes bearing covalently linked copper phthalocyanine units. Macromolecules, 19:1495-1501. Alp H, Bıyıklıoğlu Z, Ocak M, Ocak Ü, Kantekin H, Dilber G β007. New Heavy Metal Ion‐Selective Macrocyclic Ligands with Nitrogen and Sulfur Donor Atoms and their Extractant Properties. Separation Science and Technology, 42 835-845. An H, Bradshaw JS, Izatt RM 1992. Macropolycyclic polyethers and related compounds. Chemical Reviews, 92:543-572. Banfi S, Carous E, Buccafurni L 2007. Zinc phthalocyanines-mediated photodynamic therapy induces cell death in adenocarcinoma cells. Journal of Organometallic Chemistry, 692:1269–1276. Bekaroğlu Ö 1996. Phthalocyanines Containing Macrocycles. Applied Organometallic Chemistry, 10: 605622. Byrne GT, Linstead RP, Lowe AR 1934. The preparation of phthalocyanine and some metallic derivatives from o-cyanobenzamide and phthalimide. Journal of Chemical Society, 1017-1022. Chartres JD, Davies MS, Lindoy LF, Meehan GV, Wei G 2006. Macrocyclic ligand design, the interaction of selected transition and post-transition metal ions with a 14 membered N2S2-donor macrocycle. Inorganic Chemistry Communications, 9:751-754. Cook FL, Caruso TC, Byrne MP, Bowers CW, Speck DH, Liotta CL 1974. Facile syntheses of 12-crown-4 and 15-crown-5. Tetrahedron Letters, 46:4029-4032. Durmuş M, Nyokong T 2007. Synthesis and solvent effects on the electronic. absorption and fluorescence spectral properties of substituted zinc phthalocyanines. Polyhedron, 26:2767–2776. Ertem B, Bilgin A, Kantekin H, Gök Y β008. Synthesis and characterization of new soluble phthalocyanines containing macrocycle units. Polyhedron, 27:2186-2192. Gök HZ, Farsak B β01γ. Synthesis, characterisation and aggregation properties of novel metal-free and metallophthalocyanines containing four 21-membered oxatetrathiadiaza macrocycles. Journal of Organometallic Chemistry, 735:65-71. Gök HZ, Gök Y 2014. Synthesis and characterization of new organosoluble metal-free and metallophthalocyanines substituted by four macrocycles containing piperazine moiety. Inorganic Chemistry Communications, 40:164-167. Gök HZ, Kantekin H, Gök Y, Herman G. β007a. The synthesis and characterization of novel metal-free and metallo-phthalocyanines bearing four 27-membered dioxadiazapentathia macrocycles. Dyes and Pigments 74:699-705. Gök HZ, Ocak Ü, Kantekin H, Alp H β007b. The synthesis and characterization of ββ-membered diazapentathia macrocycles and investigation of their ion extraction capability from aqueous media. Transition Metal Chemistry, 323:1073-1078. POSTER PRESENTATION 295 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Gokel GW, Korzeniowski SH 1982. Macrocyclic polyether syntheses. Vol 13. In: Hafner K. et al. eds. Reactivity and structure concepts in organic chemistry, Berlin: Springer-Verlag. Hanack M, Heckman H, Polley R 1998. In: Methods of organic chemistry: additional supplementary volume. Stutgard: Georg Thieme Verlag. Hancock RD, Martell AE 1989. Ligand design for selective complexetion of metal ions in aqueous solution. Chemical Reviews, 89:1875-1914. Izatt RM, Bradshaw JS, Nielsen SA, Lamb JD, Christensen JJ 1985. Thermodynamic and kinetic data for cation-macrocycle interaction. Chemical Reviews, 85:271-339. Kabay N, Karadeniz H, Demirayak N, Gök Y β011. Synthesis and characterization of new metallo and metal-free porphyrazines containing dioxadithia (O2S2) and tetrathia (S4) macrocyclic moieties. Inorganic Chemistry Communications, 14:641-644. Koray AR, Ahsen V, Bekaroğlu Ö 1λ86. Preparation of a novel, soluble copper phthalocyanine with crown ether moieties. Chemical Communications, 932-933. Leznoff CC, Lever ABP 1986-1989.Phthalocyanines: properties and applications. vol. 1–4. Weinheim: VCH. Lindoy LF 1989. The chemistry of macrocyclic ligand complexes. Cambridge: Cambridge University Press. Luo Q, Tian H, Chen B, Huang W 2007. Effective non-destructive readout of photochromic bisthienylethene–phthalocyanine hybrid. Dyes and Pigments, 73:118-120. Master AM, Rodriguez ME, Kenney ME, Oleinick NL, Gupta AS 2010. Delivery of the photosensitizer Pc 4 in PEG–PCL micelles for in vitro PDT studies. Journal of Pharmaceutical Sciences, 99:2386-2398. Mortimer RJ, Dyer AL, Reynolds JR 2006. Electrochromic organic and polymeric materials for display applications. Displays 27:2-18. Musluoğlu E. Ahsen V, Gül A, Bekaroğlu Ö 1λλ1. Water-Soluble Phtalocyanines Containing Aza-Crown Ether Substituents. Chemische Berichte, 124:2531-2536. Ogunsipe A, Chao JY, Nyokong T 2004. Photophysical and photochemical studies of zinc(II) phthalocyanine derivatives—effects of substituents and solvents. New Journal of Chemistry, 28:822– 827. Palewska K, Sworakowski J, Lipiński J β01β. Molecular aggregation in soluble phthalocyanines - Chemical interactions vs. π-stacking. Optical Materials, 34:1717–1724. Pedersen CJ 1967. Cyclic polyethers and their complexes with metal salts. Journal of American Chemical Society, 89: 7017-7065 Perrin DD, Armarego WL 1989. Purification of laboratory chemicals. 2nd ed. Oxford: Pergamon Press. Qiu T, Xu X, Liu J, Qian X 2009. Chemical Probes for Molecular Imaging and Detection of Hydrogen Sulfide and Reactive Sulfur Species in Biological Systems. Dyes and Pigments, 83:127–133. Sizun T, Bouvet M, Chen Y, Suisse JM, Barochi G, Rossignol J 2011. Differential study of substituted and unsubstituted cobalt phthalocyanines for gas sensor applications. Sensors and Actuators B: Chemical, 159:163-170 Takahashi K, Kawashima M, Tomita Y, Itoh M 1995. Synthesis and spectral and electrochemical properties of 2,3,9,10,16,17,23,24-octabutylthiophthalocyaninatozinc(II). Inorganica Chimica Acta, 232:69-73. Zhao P, Liang Q, Li Y 2005. Electrochemical, SEM/EDS and quantum chemical study of phthalocyanines as corrosion inhibitors for mild steel in 1 mol/l HCl. Applied Surface Science, 252:1596-1607. POSTER PRESENTATION 296 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org New Locality Records of Oribatid Mites (Acari) from Balıkesir province of Turkey Şule BARAN Sakarya University, Arts and Sciences Faculty, Biology Department, Sakarya, Turkey. Corresponding author e-mail: sbaran@sakarya.edu.tr Abstract New locality records for the two species of oribatid mites Carabodes (C.) pirinensis Kunst, 1961 and Passalozetes (P.) inlenticulatus Mihelčič, 1λ5λ were given from Balıkesir province. The mite materials were collected from soil and litter samples taken from Balıkesir province and extracted using a Berlese funnel apparatus. Mites were fixed and stored in 75% ethanol. The compound microscopic examinations of specimens were made in lactic acid, mounted in temporary cavity slides. The light and scanning electron microscopes were used to examine mites. For each species, morphological features and distributions were given. Previously any study was done on the oribatid mites of Balıkesir province. Keywords: Acari, Oribatida, New Locality, Balıkesir, Turkey. 1. INTRODUCTION Oribatid mites are among the most important decomposer microarthropods in soil ecosystems. Oribatid mites can be found in very different microhabitats such as litter and humus layers, dead woods, bark of trees and mosses (Aoki 1967, Hammer 1972, Wunderle 1992, Hansen 2000). Their densities in forest floors of the temperate region range between 20,000 and 400,000 ind per m2. While the number of species known all over the World is about 11.000 (Subias 2004), aproximately 250 of these known from Turkey (Baran et al., 2018). This is a very restrictive number, in order to record the real number of oribatid mite species found in Turkey much more study is to be required. Balıkesir province is in the midwestern Turkey, having coastlines on both the Sea of Marmara and the Aegean and there isn't any study on oribatid mites in this province up tu date. The main goal of this study is to contribute to the knowledge of the Turkish oribatid fauna from Balıkesir province. New locality records for the two species of oribatid mites Carabodes (C.) pirinensis Kunst, 1961 and Passalozetes inlenticulatus Mihelčič, 1λ5λ were given from this province. 2. MATERIALS AND METHODS Soil samples taken from Balıkesir were placed on the Berlese funnel and the light source were opened for seven days. The samples were stored in 70% ethanol bottle at the bottom of Berlese funnel. Mites were sorted from the samples under a stereomicroscope and mounted on slides in modified Hoyer’s medium or 35% lactic acid. The light and scanning electron microscopes were used to examine mites. 3. RESULTS Carabodidae Koch, 1837 Carabodes (Carabodes) Koch, 1835 Carabodes (C.) pirinensis Kunst, 1961 Body darkbrown in color. Rostrum board. Lamellar setae strong, rough, inwardly curved. Interlamellar setae long and sickle-shaped. İnterlamellar region with broad, roughly sculpted and leaf-shaped longitudinal grooves (Figure 1B). Bothridia strong, cup-shaped and placed on the outer sides of the lamellae. Sensilli short, strong and with fine trichomes (Figure 1C). POSTER PRESENTATION 297 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Notogaster oval (Figure 1A), ten pairs of leaf-shaped notogastral setae with dentate margins; bases are narrow, wider at the apices (Figure 1D). Epimeral formula: 3-1-3-3. Distributionμ Bulgaria and Turkey (Kunst 1λ61, Toluk and Ayyıldız β016) Figure1. Carabodes (C.) pirinensis A- dorsal view, B- prodorsum, C- sensillus, D- Notogastral setae Passalozetidae Grandjean, 1954 Passalozetes Grandjean, 1932 Passalozetes inlenticulatus Mihelčič, 1λ5λ Body brown in color. Sensilli filiform with small barb. The surface of prodorsum and notogaster with three or four branched linear ridges (Figure 2). Ten pairs of notogastral setae. Distribution: Mediterranean Figure 2. Passalozetes inlenticulatus dorsal view POSTER PRESENTATION 298 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4. DISCUSSION The length and shape of interlamellar setae and the leaf-shaped longitudinal formations on the prodrum are the distinctive features of the species Carabodes (C.) pirinensis. This species only recorded from Bulgaria and Turkey. The species Carabodes (C.) piri was previously recorded in Turkey only from the Bolu province (Toluk and Ayyıldız, β016). This study comprises a new locality record of the species from Balıkesir province. The filiform sensillus and small humeral projection of notogaster are are the distinctive features of the species Passalozetes inlenticulatus. This species previously recorded from Mediterranean region and was previously recorded in Turkey only from the Sivas province (Toluk and Akin, 2017). This study comprises a new locality record of the species from Balıkesir province. ACKNOWLEDGEMENTS I wish to thank Department of Metallurgical and Materials Engineering and Thermal Spray Covering and Research Laboratory (SAÜ-TESLAB) for the Scanning Electron Microscopy investigations. REFERENCES Aoki J, 1967. A preliminary revision of the family Otocepheidae (Acari, Cryptostigmata). II. Subfamily Tetracondylinae. Bulletin of the National Museum of Natural Science, Tokyo, 10(3), 297–359. Baran Ş, Bezci T, Ayyıldız N β018. Supplementary checklist of oribatid mites (Acari) from Turkey. Mun. Ent. Zool. Vol. 13(1):91-97. Hammer M (1972) Investigations on the oribatid fauna of Tahiti, and some oribatids found on the Atoll Rangiroa. Det Kong. Dansk. Vidensk. Selsk. Biol. Skr. 19 (3): 1-66. Hansen RA (2000) Effects of litter habitat complexity and composition on a diverse litter microarthropod assemblage. Ecology 81, 11201132. Kunst, M., 1961. Bulgarische Oribatiden IV. (Acari: Oribatei). Acta Universitatis Carolinae – Biologia, 8: 151–183. Subías LS β004. Listado sistemático, sinonímico y biogeográfico de los ácaros oribátidos (Acariformesμ Oribatida) del mundo (excepto fósiles). Available atμ httpμ//bba.bioucm.es/cont/docs/RO_1.pdf [Erişim 15.02.18] Toluk A and Ayyıldız N β016. New records of the genus Carabodes (Acari, Oribatida, Carabodidae) from Turkey. 8th Symposium of the European Association of Acarologists (EURAAC), 11-15 July 2016, Spain. Toluk A and Akin AT 2017. Oribatid mite fauna (Acari) of Cat Forest, Sivas Province, Turkey. Turk. entomol. derg., 2017, 41 (3): 293-307. Wunderle I (1992) Die baum- und bodenbewohnenden Oribatiden (Acari) im Tieflandregenwald von Panguana, Peru. Amazoniana 12(1): 119–142. POSTER PRESENTATION 299 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Bazı Oribatid Akar Türlerinin Trichobothrium Setalarının Taramalı Elektron Mikroskobu ile İncelenmesi Merve YAŞA1*, Şule BARAN1 1* Sakarya Üniversitesi, Fen Edebiyat Fakültesi, Biyoloji Bölümü, Sakarya, Türkiye. Sorumlu Yazar e-mail: merve.yasa1@ogr.sakarya.edu.tr Özet Oribatid akarların teşhisinde morfolojik özellikler kullanılmaktadır. Trichobothrium kıllarının yapı ve dizilişi oribatid akarların sistematiğinde önemlidir. Bu çalışmada oribatid akarlarda trichobothrium kılları taramalı elektron mikroskobu ile incelenmiş ve bazı örnekler verilmiştir. Anahtar Kelimeler: Acari, Oribatida, SEM, Trichobothrium, Seta. 1. GİRİŞ Oribatid akarlar, bugüne kadar tanımlanmış yaklaşık 11.000’in üzerinde türü ile akarların en zengin gruplarından birini oluşturmaktadır ( Subías, 2018 ). Kolaylıkla görülebilen daha büyük arthropodlarla karşılaştırıldıklarında çok küçük olan oribatid akarlar mezofaunada en çok bulunan ve en fazla çeşit içeren gruplardan olmasına rağmen hala çok az bilinmektedirler ( Schantz ve Behan, 2007 ). Oribatid akarların morfolojik tanımlamasında sırttan ve karından görünüşü ile bacaklar esas alınır. Sırt bölgesinde prodorsum ve notogaster olmak üzere iki bölgeye ayrılır. Notogasterde kılların sayısı ve yapısı, prodorsumda trichobothrium yapısının şekli morfolojik tanımlamada önem taşımaktadır ( Balogh ve Balogh, 1992 ). 2. MATERYAL VE METOD Çeşitli toprak örnekleri poşetlere konularak etiketlendi. Berlese hunilerine örnekler yerleştirildi. Hunilerin dip kısmında % 70’lik etil alkol çözeltisi olan şişelere akarlar düştü. Örnekler, lambaların altında bir hafta bekletildi. Şişelerdeki akarlar, petri kaplarına boşaltılıp stereo mikroskop altında ayıklandı. Örnekler ışık mikroskobunda incelenmesi için % 50’lik laktik asitle ağartıldı. SEM incelemesi için örnekler 6 ile 1β saat arasında toprak kalıntısı temizleyen deterjanda bekletilip, 1-2 saniye ultrasonic banyoda işlem gördü. Kuruma noktasına dikkat edilen örnekler, stublara yerleştirildi ve altın tozu ile kaplanıp SEM’de resimler çekildi. Teşhisleri yapılan örnekler, muhafaza altına alındı. 3. SONUÇ İncelediğimiz türlerde 1.Carabodes sp. Silli, 2. Suctobelba sp. Uzun fusiform, 3. Platyliodes sp. Ensiform, 4.Ctenobelba sp. Tarak şeklinde, 5. Berniniella sp. Radiate, 6. Licnobelba sp. Clavate- verrucose, 7. Zetorchestes sp. Auriculate- spiculate, 8. Zetorchestes sp. Auriculate- spiculate, 9. Gymnodamaeus sp. Uzun clavate- iğneli, 10. Adrodamaeus sp. İnce uzun- yoğun dikenli, 11. Zygoribatula sp. İnce- fusiform başlısilli, 12. Liacarus sp. Spiniform, 13. Scheloribates sp. Uzun ince- fusiform başlı- silli, 14. Sphaerochthonius sp. Auriculate- spiculate, 15. Cymbaeremaeus sp. Topuz şeklinde, 16. Porobelba sp. Setiform- kerotegüment kaplı, 17. Epilohmannia sp. Setiform- dikenli, 18. Licnodamaeus sp. Kısa saplı clavate- verrucose, 19. Chamobates sp. Kısa saplı clavat, β0. Tectocepheus sp. Geniş clavat- granüllü. POSTER PRESENTATION 300 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org POSTER PRESENTATION 301 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org POSTER PRESENTATION 302 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 1. Bazı oribatid akarların trichobotrium yapısı 1.Carabodes sp. 2. Suctobelba sp. 3. Platyliodes sp. 4.Ctenobelba sp. 5. Berniniella sp. 6. Licnobelba sp. 7. Zetorchestes sp. 8. Zetorchestes sp. 9. Gymnodamaeus sp. 10. Adrodamaeus sp. 11. Zygoribatula sp. 12. Liacarus sp. 13. Scheloribates sp. 14. Sphaerochthonius sp. 15. Cymbaeremaeus sp. 16. Porobelba sp. 17. Epilohmannia sp. 18. Licnodamaeus sp. 19. Chamobates sp. 20. Tectocepheus sp. 4. TARTIŞMA Oribatid akarlarda trichobothrium kutikuladan oluşan, bothridium adı verilen boşluktan çıkan reseptör organdır ( Alberti, 1998 ). Bu yapının en iyi oribatidlerde bulunduğu bilinmektedir. Işık, dokunma, işitme ve solunum ile ilişkili olduğu düşünülmektedir. Bu yapılar ilkel ve gelişmiş oribatidlerde farklılık gösterir. Gelişmiş oribatidlerde trichobothrium daha fazla pteromorfun içine yerleşmiştir. Böylece daha rahat hareket ettiği varsayılmaktadır ( Alberti ve ark., 1λλ4 ). Sensillus yapısı basit, tüylü, testere dişli, diken şeklinde, iki tarafı tarak şeklinde, spatül şeklinde, oraksı, mızraksı, mızraksı testere dişli, kama şeklinde görülebilir ( Mahunka ve Zombori, 1985 ). KAYNAKLAR Alberti G 1998. Fine Structure of Receptor Organs in Oribatid Mites (Acari). Arthropod Biology: Contributions to Morphology, Ecology and Systematics.- Biosystematics and Ecology Series 14: 27-77. Alberti G, Moreno A, Kratzmann M, 1994. The Fine Structure of Trichobotria in Moss Mites with Special Emphasis on Acrogalumna longipluma. Acta Zoologıca Vol.75, No. 1, pp. 57- 74. Balogh J, Balogh P, 1992. The Oribatid Mites Genera of the World. Vol. I. Hungarian Natural History Museum, Budapest, 263 pp. Mahunka S, Zombori L 1985. The variability of some morphological features in Oribatid mites. Folia Entomologica Hungarica Vol.46, pp. 115- 128. Schantz H., Behan-Pelletier V. Global Diversity of Oribatids (Oribatida:Acari: Arachnida) Hydrobiologia, Volume 5958 (1)., 323-328. Subías S β018. Listado Sistemático, Sinonímico y Biogeográfico de los. Ácaros Oribátidos (Acariformesμ Oribatida) Del Mundo. http://bba.bioucm.es/cont/docs/RO_1.pdf POSTER PRESENTATION 303 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Walter DE, Latonas S 2011. Almanac of Alberta Acari Part I. Ver. 2.1. The Royal Alberta Museum, Edmonton, AB:http://www.royalalbertamuseum.ca/natural/insects/research/research.htm. Walter DE, Latonas S 2011. Almanac of Alberta Acari Part II. Ver. 2.1. The Royal Alberta Museum, Edmonton, AB:http://www.royalalbertamuseum.ca/natural/insects/research/research.htm. POSTER PRESENTATION 304 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Newly Synthesized Thiazolidinones and Evaluation of their Genotoxic Potential by the E. coli WP2 Bacterial Reverse Mutation Assay Kadir Turhan1, Fatma Tülay Tuğcu1, Mehmet Karadayı2*, Medine Güllüce2 1 Yildiz Technical University, Faculty of Science and Art, Department of Chemistry, İstanbul, Turkey *2 Atatürk University, Faculty of Science, Department of Biology, Erzurum, Turkey Corresponding author e-mail: mkaradayi@atauni.edu.tr Abstract The thiazolidinone ring system has been widely employed in the investigation of pharmacologically active heterocyclic compounds. These heterocycles display diverse biological activities, which make them valuable for industrial applications. Although each newly synthesized molecule in this group appears to be an important drug candidate due to these valuable properties, it is necessary to determine the genotoxic properties of these molecules before conducting more complex pharmacological studies. Thus, the current study was designated to synthesize new thiazolidinone derivatives and assess their hazardous potentials by using the E. coli WP2 bacterial reverse mutation assay. Mutagenicity assays were performed without metabolic activation system to check the directly gene mutation causing capabilities, and with metabolic activation system to check the indirectly gene mutation causing capabilities of the test materials. According to the results, the synthesized thiazolidinone derivatives did not show any mutagenic effect on the tester strain with or without metabolic activation system at any tested concentrations up to 1 mM/plate. The highest revertant colony count was observed as 46 ± 1.7 for C2 (0.8 mM/plate – with metabolic activation), insignificant when compared to the control groups. In conclusion, the test compounds newly synthesized in the present study can be considered as genotoxically safe at the tested concentrations and the findings reported here are valuable for further new drug development studies. Keywords: Genotoxicity, Thiazolidinone derivatives, WP2 Assay. 1. INTRODUCTION Synthetic chemicals have the most important role in meeting the rising raw material demands of the modern world. Uses of these raw materials include many industrial fields such as agriculture, health-care, paint, cosmetics, energy, and environmental management (Gosh 2015). Among them, synthetic pharmaceuticals constitute the most interesting group as a result of having a wide range of usage in both medicine and pharmacy. One of the strongest features of these materials is their cheaper and more stable production processes than their natural counterparts. In addition, the formation of derivatives of these molecules by various methods creates an infinite number of potentials to gain them various biological activities (Trosset and Carbonell 2015). In this regard, the thiazolidinones are one of the useful scaffolds in medicinal chemistry. Their derivatives can be found as a pharmacophore in a wide variety of biologically active compounds, such as antitumorals, antibacterials, antivirals, anticonvulsant, anti-inflammatory, antidiabetic, anti-HIV and many other therapeutic agents (Barecca et al. β001ν Küçükgüzel et al. β00βν Pawar and Mulwad β004ν Rahman et al. 2005). As a result of these beneficial properties, the number of studies to develop new thiazolidinone derivatives is increasing day by day. On the other hand, the recent studies that certain derivatives of these substances may have adverse effects on human health and the environment and the lack of work to determine their harmful effects raise public concern. Hence, determination of the hazardous potential of newly synthesized chemicals remains a challenge against their commercialization (Tugcu et al. 2017; Turhan et al. 2012). Today, as the number of synthesized derivatives rapidly grows, short-term toxicology test systems play a key role in determining the potential hazards of these chemical substances and contribute to the elimination of the existing concerns. In this context, the E. coli WP2 bacterial reverse mutation assay is widely accepted because it gives accurate and reproducible results. Another important advantage of this assay is that it is POSTER PRESENTATION 305 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org compatible with the metabolic activation system, which allows the understanding of the possible effects of test chemicals on the human body (Baris et al. 2011). Thus, the present study was designed to synthesize new derivatives of thiazolidinones that can be used in the pharmaceutical industry in the future, and assess their potential hazardous effects by using E. coli WP2 assay with or without metabolic activation system. 2. MATERIALS AND METHODS 2.1 Synthesis of Thiazolidinone Derivatives To synthesize thioureas, a mixture of the appropriate amine (1 mmol) and substitue phenylisothiocyanate (1.2 mmol) was stirred in CH2Cl2 at room temperature for 24 h. The crude product was concentrated under vacuum and recrystallized from ethanol. Then, to synthesize the test compounds (C1-C4), the appropriate thiourea (1 mmol), chloroacetic acid (1.2 mmol) and thiophene-2-carbaldehyde (1 mmol) was stirred with a magnetic stirrer at 40 °C for 24 h. The crude product was purified by column chromatography (CHCl 3 or CH2Cl2) (Kasmi-Mir et al. 2006). This method is summarized in Figure 1. R R S R1 HN R1 S S H + HN HO O + O S N 24 h, 40 oC Cl solvent free O N R2 R2 R = H, CH3, Cl (C1-C4) R1, R2= H, CH3 Figure 1. Synthesis of thiazolidinone derivatives 2.2 The E. coli WP2 Bacterial Reverse Mutation Assay Chemicals: Direct acting mutagen N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) was purchased from ABCR GmbH & Co. KG and indirect acting mutagen 2-aminofluorene (2-AF) from Sigma-Aldrich. Other solvents and pure chemicals, including magnesium sulfate (MgSO 4), sodium ammonium phosphate (Na2NH2PO4), D-glucose, sodium chloride (NaCl), L-tryptophane, sodium phosphate-dibasic (Na2HPO4), citric acid monohydrate, potassium phosphate-dibasic (K2HPO4), and sodium phosphate-monobasic (NaH2PO4) were purchased from Sigma-Aldrich. S9 metabolic activation system was purchased from MOLTOX. Tester Strain: E. coli WP2uvrA (ATCC® Number: 49979) strain was purchased from LGC Standards Middlesex, UK. The tester strain was stored at -80 ºC as stock cultures. The working cultures were prepared by inoculating nutrient broth with the frozen cultures followed by an overnight incubation at γ7 ºC with gentle agitation (Ozturkcan et al. 2012). Determination of Test Concentrations: The toxicity of test materials toward the E. coli WP2uvrA tester strain was determined as described by Mortelmans and Zeiger (2000). These tests confirmed that there was normal growth of the background lawn, spontaneous colony numbers within the regular range, and no significant reduction in cell survival. Thus, for the concentrations and conditions reported here, no toxicity or other adverse effects were observed. Bacterial Reverse Mutation Assay: The mutagenicity assay was performed according to the procedure described by Mortelmans and Riccio (β000). MNNG (1 µg/plate for the assay without Sλ) and β-AF (600 µg/plate for the assay with Sλ) were used as positive controls. 10% Dimethyl sulfoxide (DMSO) was also used as negative control. In the mutagenicity test performed with E. coli WP2uvrA without S9 metabolic activation, 100 µL of the overnight bacterial culture, 50 µL of test compound solution at different concentrations (0.β, 0.4, 0.6, 0.8 and 1 mM/plate in 10% DMSO), and 500 µL of phosphate buffer were added to β mL of the top agar containing POSTER PRESENTATION 306 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 0.05 mM L-tryptophan. The mixture was poured onto minimal glucose agar plates. Tryptophan independent revertant colonies and viable cells were scored on the plates after incubation at γ7ºC for 48 h. This procedure was all applicable to the mutagenicity assay performed with S9 metabolic activation. Two procedural differences were the addition of S9 mix instead of phosphate buffer and 2-AF instead of direct acting mutagen MNNG (Mortelmans and Zeiger 2000). The plate incorporation method was used to assess the results (Maron and Ames 1983). The mutagenic index was calculated for each concentration, which is the average number of revertants per plate divided by the average number of revertants per plate with the negative (solvent) control. A sample was considered as mutagenic when observed a dose-response relationship and a two-fold increase in the number of mutants with at least one concentration was observed (Vargas et al. 1993; Varella et al. 2004; Evandri et al. 2005; Santos et al. 2008). The results were presented as the mean and standard deviation of three experiments with duplicate plates/dose experiment. 3. RESULTS The synthesis studies gave four thiazolidinone derivatives (C1-C4). The structures and purities of these compounds were elucidated based on the analysis of their physical and spectroscopic data. Chemical properties of these newly synthesized compounds are summarized in Table 1. Table 1. Chemical properties of the newly synthesized thiazolidinone derivatives. Formula Name FW Structure S S C21H16N2OS2 3-(3-methylphenyl)-2-(phenylimino)-5-(thiophen2-yl methylidene)-1,3-thiazolidin-4-one 376.494 g/mol C21H16N2OS2 2-[(3-methylphenyl)imino]-3-phenyl-5-(thiophen2-yl methylidene)-1,3-thiazolidin-4-one 376.494 g/mol C21H15ClN2OS2 2-[(4-chlorophenyl)imino]-3-(3-methylphenyl)-5(thiophen-2-yl methylidene)-1,3-thiazolidin-4-one 410.940 g/mol C22H18N2OS2 3-(3-methylphenyl)-2-[(4-methylphenyl)imino]-5(thiophen-2-yl methylidene)-1,3-thiazolidin-4-one 390.521 g/mol N N O CH3 (C1) S CH3 S N N O (C2) Cl S S N N O CH3 (C3) CH3 S S N O N CH3 (C4) POSTER PRESENTATION 307 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3-(3-Methylphenyl)-2-(phenylimino)-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C-1): Yellow layer crystal, m.p. 165-6 0C; FTIR (near) max/cm-1: 3083, 2956, 2919, 1709, 1629, 1592, 1367, 1355, 1267, 1152, 1138, 854, 786; 1H NMR (500MHz, CDCl3): δ (ppm) 2.47 (3H, s), 7.02 (2H, d), 7.17 (1H, dd), 7.21 (1H, dt), 7.30 (4H, brd), 7.38 (1H, d), 7.54 (2H, brd), 7.59 (1H, d), 8.02 (1H, s); 13C NMR (100MHz, CDCl3): δ (ppm) 21.98, 119.51, 120.96, 122.15, 128.19, 128.42, 129.53, 130.52, 131.65, 132.77, 133.98, 135.76, 137.84 138.38, 139.68, 143.74, 149.02, 159.92, 166.23; MS (m/z): 378 (M+2), 377(M+1), 376(M+), 208, 140, 104, 96, 77. 2-[(3-Methylphenyl)imino]-3-phenyl-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C-2): Yellow powder, m.p. 186-7 0C; FTIR (near) max/cm-1: 3086, 2919, 2852, 1707, 1635, 1591, 1369, 1356, 1287, 1149, 1136, 851, 787; 1H NMR (500MHz, CDCl3): δ (ppm) 2.37 (3H, s), 6.83 (1H, d), 7.02 (1H, d), 7.18 (1H, dd), 7.29 (1H, t), 7.38 (1H, d), 7.47 (2H, brd), 7.56 (4H, m), 7.59 (1H, d), 8.03 (1H, s); 13C NMR (100MHz, CDCl3): δ (ppm) 21.68, 119.07, 121.04, 122.15, 123.19, 128.42, 129.03, 130.52, 131.65, 132.77, 133.98, 135.76, 137.84 138.38, 139.68, 143.74, 148.92, 158.34, 169.93; MS (m/z): 378 (M+2), 377(M+1), 376(M+), 208, 140, 104, 96, 77. 2-[(4-Chlorophenyl)imino]-3-(3-methylphenyl)-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C3): Yellow needle crystal, m.p. 151-2 0C; FTIR (near) max/cm-1: 3060, 2932, 2846, 1705, 1621, 1589, 1364, 1352, 1277, 1145, 1138, 861, 798; 1H NMR (500MHz, CDCl3): δ (ppm) 2.41 (3H, s), 6.88 (1H, brs), 7.02 (2H, d), 7.17 (1H, dd), 7.24 (1H, brd), 7.31 (1H, brd), 7.38 (1H, d), 7.49 (2H, brd), 7.59 (1H, d), 8.00 (1H, s); 13 C NMR (100MHz, CDCl3): δ (ppm) 21.82, 120.51, 122.96, 124.15, 125.19, 128.32, 128.83, 129.02, 129.65, 130.18, 130.56, 132.67, 132.84, 137.83, 138.62, 143.31, 147.12, 158.30, 167.34; MS (m/z): 412 (M+2), 411 (M+1), 410 (M+), 242, 140, 96, 65. 3-(3-Methylphenyl)-2-[(4-methylphenyl)imino]-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C4): Yellow layer crystal, m.p. 148-9 0C; FTIR (near) max/cm-1: 3065, 2917, 2842, 1703, 1634, 1595, 1505, 1353, 1152, 863; 1H NMR (500MHz, CDCl3): δ (ppm) 2.35 ve 2.41 (3H, s), 6.87 (2H, brd), 7.13 (1H, dd), 7.15 (2H, brd), 7.33 (1H, brd), 7.34 (4H, brd), 7.54 (1H, brd), 7.99 (1H, s); 13C NMR (100MHz, CDCl3): δ (ppm) 21.03, 21.35, 119.63, 120.10, 121.54, 125.38, 127.22, 127.57, 129.01, 130.07, 131.43, 131.92, 134.57, 137.74, 139.45, 151.08, 155.34, 166.02; MS (m/z): 392 (M+2), 391 (M+1), 390 (M+), 222, 140, 96, 91, 65. The E. coli WP2 assay results showed that none of the test compounds has mutagenic potential at the tested concentrations (0.2, 0.4, 0.6, 0.8 and 1 mM/plate) with or without metabolic activation (Figure 2 and Figure 3). N.C. C1 C2 C3 C4 28 29 30 30 31 28 29 30 0.2 0.4 0.6 0.8 33 32 33 32 25 29 30 26 CONTROLS 27 34 31 27 355 29 COUNT OF REVERTANTS P.C. 1 CONCENTRATIONS (MILLIMOLAR/PLATE) Figure 2. Mutagenicity assay results of the newly synthesized thiazolidinone derivatives, performed without metabolic activation system. POSTER PRESENTATION 308 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org N.C. C1 C2 C3 C4 43 40 39 37 44 46 37 36 0.2 0.4 0.6 0.8 41 45 39 44 43 44 40 44 CONTROLS 39 45 40 41 40 COUNT OF REVERTANTS 397,16 P.C. 1 CONCENTRATIONS (MILLIMOLAR/PLATE) Figure 3. Mutagenicity assay results of the newly synthesized thiazolidinone derivatives, performed with metabolic activation system. 4. DISCUSSION Synthetic thiazolidinone derivatives possess important biochemical and pharmacological properties such as antitumorals, antibacterials, antivirals, anticonvulsant, anti-inflammatory, antidiabetic and anti-HIV activities (Barecca et al. β001ν Küçükgüzel et al. 2002; Pawar and Mulwad 2004; Rahman et al. 2005). These beneficial effects cause them to be synthesized in large quantities and their use spread. However, the lack of adequate knowledge of the true toxic potential of these synthesized chemicals raises concerns in social and scientific communities. In the middle of this dilemma, determination of toxicological properties of newly synthesized derivatives has become a very important strategy for the improvement of their human healthcare applications (Tugcu et al. 2017; Turhan et al. 2012). In the present study, four thiazolidinone derivatives were newly synthesized, purified and characterized to serve the pharmaceutical industry as useful raw materials for drug development studies. On the other hand, their hazardous potential was assessed by using the E. coli WP2 bacterial reverse mutation assay with or without metabolic activation system. The tester strain was E. coli WP2uvrA with a single base substitution mutation (A=T). In the assays performed without metabolic activation system, the tester strain determines directly gene mutation causing capabilities of the test materials. In these studies, MNNG, a well-known mutagen and carcinogen, was chosen as positive control. It is known that its mutagenic and lethal effects closely related to methylation of DNA. Earlier studies showed that formation of O6-methylguanine, which is one of its important products, appears to be responsible for its mutagenic activity (Kumaresan et al. 1995). In this study, contrary to the MNNG, none of the derivatives showed any mutagenic potential at tested concentrations. These results demonstrate that these newly synthesized derivatives are lack of the 2-AF like mutation mechanism In the assays performed with metabolic activation system, the tester strain determines indirectly gene mutation causing capabilities of the test materials. In these studies, 2-AF, a synthetic arylamine and widely used in laboratory researches as a model compound for studying the relationships among metabolic activation requirements, DNA adduct structure, mutagenesis and carcinogenesis, was chosen as positive control. In biological systems, it is known that 2-AF can be converted its metabolite acetylaminofluorene (2AAF) through acetylation and electrophiles that can react with DNA and form adducts. It is thought that 2AAF and 2-AF-DNA adduct formation leads to mutation, and eventually tumor formation (Garner et al. 1984; Novak and Rangappa 1992; Heflich and Neft 1994). In the present study, contrary to the 2-AF, the derivatives did not show any mutagenic potential at the tested concentrations. These results demonstrate that the test compounds are also lack of the 2-AF like mutation mechanism. 5. CONCLUSION In conclusion, newly four thiazolidinone derivatives were synthesized in the present study. Besides, hazardous potential of these compounds was determined by using the E. coli WP2 bacterial reverse mutation POSTER PRESENTATION 309 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org assay with or without metabolic activation system. According to the genotoxicity assay results, these derivatives can be considered as genotoxically safe at the tested concentrations and the findings reported here are valuable for further new drug development studies. ACKNOWLEDGEMENTS Thanks for Yıldız Technical University Scientific Research Projects Coordination's support in this study. Project No: 2010-01-02-GEP01. REFERENCES Baris O, Karadayi M, Yanmis D, Guvenalp Z, Bal T, Gulluce M 2011. Isolation of 3 Flavonoids from Mentha longifolia (L.) Hudson subsp. longifolia and Determination of their genotoxic potentials by using the E. coli WP2 test system. Journal of Food Science, 76(9): 212-217. Barreca M, Chimirri A, Luca L, Monforte A, Monforte P, Rao A, Zappala M, Balzarini J, Clercq E, Pannecouquec C, Witvrouwc M 2001. Discovery of 2,3-diaryl-1,3-thiazolidin-4-ones as potent anti-HIV1 agents. Bioorganic & Medicinal Chemistry Letters, 11: 1793-1796. Evandri MG, Battinelli L, Daniele C, Mastrangelo S, Bolle P, Mazzanti G 2005. The antimutagenic activity of Lavandula angustifolia (lavender) essential oil in the bacterial reverse mutation assay. Food and Chemical Toxicology, 43: 1381-1387. Garner RC, Martin CN, Clayson DB 1984. Carcinogenic aromatic amines and related compounds. In: Searle CE (ed), Chemical carcinogens Vol. I, Washington DC; American Chemical Society, pp. 175-276. Gosh SK 2015. Application of synthetic chemicals in agriculture and their toxic effect on the environment. Bulletin of Environment, Pharmacology and Life Sciences, 4(9): 1-6. Heflich RH, Neft RE 1994. Genetic toxicity of 2-acetylaminofluorene, 2-aminofluorene and some of their metabolites and model metabolites. Mutation Research, 318(2): 73-114. Kasmi-Mir S, Djafri A, Paquin L, Hamelin J, Rahmouni M 2006. One-pot synthesis of 5-arylidene-2-imino4-thiazolidinones under microwave irradiation. Molecules, 11: 597-602. Kumaresan KR, Springhorn SS, Lacks SA 1995. Lethal and mutagenic actions of N-methyl-N’-nitro-Nnitrosoguanidine potentiated by oxidized glutathione, a seemingly harmless substance in the cellular environment. Journal of Bacteriology, 177: 3641-3646. Küçükgüzel SG, Oruç EE, Rollas S, Şahin F, Ozbek A β00β. Synthesis, characterization and biological activity of novel 4-thiazolidinones, 1,3,4-oxadiazoles and some related compounds. European Journal of Medicinal Chemistry, 37: 197-206. Maron DM, Ames BN 1983. Revised methods for the Salmonella mutagenicity test. Mutation Research, 113: 173-215. Mortelmans K, Riccio ES 2000. The bacterial tryptophan reverse mutation assay with Escherichia coli WP2. Mutation Research, 455: 61-69. Mortelmans K, Zeiger E 2000. The Ames Salmonella/microsome mutagenicity assay. Mutation Research, 455: 29-60. Novak M, Rangappa KS 1992. Nucleophilic substitution on the ultimate hepatocarcinogen N-(sulfonatooxy)2-(acetylamino)fluorene by aromatic amines. Journal of Organic Chemistry, 57: 1285-1298. Ozturkcan SA, Turhan K, Turgut Z, Karadayi M, Gulluce M 2012. Antigenotoxic properties of two newly synthesized ί-aminoketones against N-methyl-N′-nitro-N-nitrosoguanidine and 9-aminoacridine-induced mutagenesis. Journal of Biochemical and Molecular Toxicology, 26: 258-263. Pawar RB, Mulwad VV 2004. Synthesis of some biologically active pyrazole, thiazolidinone, and azetidinone derivatives. Chemistry of Heterocyclic Compounds, 40: 219-226. Rahman VPM, Mukhtar S, Ansari WH, Lemiere G 2005. Synthesis, stereochemistry and biological activity of some novel long alkyl substituted thiazolidin-4-ones and thiazan-4-one from 10-undecenoic acid hydrazide. European Journal of Medicinal Chemistry, 40: 173-184. Santos FV, Tubaldini FR, Cólus IMS, Andréo MA, Bauab TM, Leite CQF, Vilegas W, Varanda EA β008. Mutagenicity of Mouriri pusa Gardner and Mouriri elliptica Martius. Food and Chemical Toxicology, 46: 2721-2727. POSTER PRESENTATION 310 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Trosset JY, Carbonell P 2015. Synthetic biology for pharmaceutical drug discovery. Drug Design, Development and Therapy, 9: 6285-6302. Tugcu FT, Turhan K, Karadayi M, Gulluce M 2017. Genotoxic evaluation of newly synthesized iminothiazolidinones, Toxicology and Industrial Health, 33(11): 811-820. Turhan K, Ozturkcan SA, Turgut Z, Karadayi M, Gulluce M 2012. Protective properties of five newly synthesized cyclic compounds against sodium azide and N-methyl-N’-nitro-N-nitrosoguanidine genotoxicity. Toxicology and Industrial Health, 28: 605-613. Varella SD, Pozetti GL, Vilegas W, Varanda EA 2004. Mutagenic activity in waste from an aluminum products factory in Salmonella/microsome assay. Toxicology In Vitro, 18: 895-900. Vargas VMF, Motta VEP, Henriques JAP 1993. Mutagenic activity detected by the Ames test in river water the influence of petrochemical industries. Mutation Research, 319: 31-45. POSTER PRESENTATION 311 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Mechanical Properties of Polycarbonate (PC)/Acrylonitrile-Butadiene-Styrene (ABS)/Waste Urea Formaldehyde (WUF) Polymer Blends Sena YUCE*, Nevriye Seyma AKYOL, Ezgi TASDEMIR, Munir TASDEMIR Marmara University, Technology Faculty, Metallurgy and Materials Eng. Dep., Istanbul, 34722, Turkey * yuccesena@gmail.com Abstract In this study, polycarbonate/acrylonitrile butadiene styrene polymer blend matrix contributes to ground urea formaldehyde powder is handled as 0, 5, 10, 20 and 30 wt% ratio will be mixed in the extruder. Mixture obtained from the extruder to be granulated and then the granules will be obtained as appropriate standard test sample of the injection molding machine. Mechanical and morphological tests will be applied such as elasticity modulus, tensile strength at break, % elongation, Izod impact strength, hardness, density. Also, SEM examination will be conducted to evaluate the microstructure of urea formaldehyde particles as well as material distribution in these experiments. Key words: polycarbonate, acrylonitrile butadiene styrene, urea formaldehyde, mechanical properties, polymer blends. 1 INTRODUCTION Polymer alloys and blends are studied extensively in recent years. In a various polymers, it is desired to establish a good balance between hardness and toughness. Hardness of most of the synthetetic polymers is characterized with brittleness and crack growth on a sudden loading. Therefore, wide research is being conducted around the world to toughen brittle materials [1]. Recycled plastic are potentially the most inexpensive polymer materials. However, the recycled plastics in general do not perform at sufficient level. Blending of polymers is a common technology often used to develop a product with superior mechanical properties from inexpensive polymer material with small amount of compatibilizers [2]. The increased amount of polymer waste has become a serious issue globally and also caused depletion of petroleum resources without which the modern life become impossible for mankind. In many applications thermosets are the materials of choice for long-term use because they are insoluble and infusible high-density networks. Recycling of thermosetting polymers is regarded as one of the urgent problems to be settled because of its technological difficulty. The increased production of thermoset blends and composites in recent years has greatly increased the amount of waste materials [3]. PC/ABS blends have been investigated with respect to compatibility and mechanical behavior aspects [4-7]. Urea-formaldehyde (UF) accounts for about 15% of the total thermoset resin production. Currently, one of its major applications is in molded products, including electrical equipment, dinner ware, buttons, cosmetic caps, and bottles. However, the same factors that make UF a good choice for many applications, namely its chemical, thermal, and mechanical stability, are also what make recycling such a big challenge [8]. In this study, PC/ABS matrix contributes to ground urea formaldehyde powder is handled as 5, 10, 20 and 30 % ratio will be mixed in the extruder. Mixture obtained from the extruder to be granulated and then the granules will be obtained as appropriate standard test sample of the injection molding machine. 2 EXPERIMENTAL 2.1 Compositions and Materials Five different polymer blends were prepared. Compositions of PC/ABS/waste urea formaldehyde (WUF) polymer blends that were formed are given in Table 1. POSTER PRESENTATION 312 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 1. Composition of the PC/ABS/WUF Polymer Blends Formulations Groups 1 2 3 4 5 PC(wt %) 50 47.5 45 40 35 ABS (wt %) 50 47.5 45 40 35 WUF (wt %) 5 10 20 30 PC used in this study was obtained from GE (USA), with the trade name Lexan and the code number 144 R. MFI value is 1λ g/10 min (ββ0°C, 10 kg), vicat softening point is 14β°C. ABS is also a GE (USA) product with 750 SW code number. Melting point is 230–β60°C. Waste urea formaldehyde was supplied Viko by Panasonic Company (Istanbul-Turkey). 2.2 Sample Preparation UF was dried in a Yamato vacuum oven ADP-31 (Yamato/VWR Scientific Products, Japan) at 105 oC for 24 hours before being blended with PC/ABS. Mechanical premixing of solid compositions was done using a LB-5601 liquid-solids blender (The Patterson-Kelley Co., Inc. east Stroudsburg, PA-USA) brand batch blender for 25 min. Samples with various proportions of PC/ABS/WUF polymer blends were produced between 250-300 oC at 25-35 bar pressure, and a rotation rate of 25 rpm, with a Microsan co-rotating twinscrew extruder (Microsan Instrument Inc. Kocaeli - Turkey). PC/ABS/WUF polymer blends were also dried in vacuum oven at 105 oC for 24 hours after extrusion. Subsequently, test samples were molded in injection molding machine. Extrusion and injection conditions are given in Table 2. Table 2. Extrusion and Injection Conditions of the PC/ABS/WUF Polymer Blends Process Temperature (o C) Pressure (bar) Waiting time in mold (s) Screw speed (rpm) Mould temperature (oC ) Extrusion 250–300 25-35 25 - Injection 250–300 110–130 20 25 40 Waste urea formaldehyde dry grinded with Siemens simatic C7-621 control system device to obtain unsegregated powders. The size of urea formaldehyde particles varied between 10–80µm. Powder preparations steps are given in Figure 1. WUF granulation powder Figure 1 Waste Urea Formaldehyde Powder Preparation Steps 2.3 Test Procedure Tensile tests were performed according to ASTM D638 specification. They were carried out using a Zwick Z010 (Germany) testing machine with a load cell capacity of 10 kN at a cross-head speed of 50 mm/min. The elastic modulus, strength at break and percent elongation was determined from the stress–strain curves. Seven samples were tested in each set and the average value was reported. The hardness test was done POSTER PRESENTATION 313 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org according to the ASTM D2240 method with Zwick hardness measurement equipment. To investigate fracture behavior, Izod impact test (notched) was done at room temperature according to the ASTM D256 method with Zwick B5113 impact test device. Determination of density was done according to ISO 2781 test standard. The fractured surfaces of the PC/ABS/WUF polymer blends were coated to thickness of β0 Å of a gold (Au) to prevent electrical charging by Polaron SC7640 (high resolution sputter coater) (United Kingdom). The surfaces of the prepared samples were observed by the FEI Sirion XL30 FEG (Nederland) scanning electron microscopy (SEM) at an acceleration voltage of 20 kV. 3. RESULT and DISCUSSION 3.1 Mechanical properties of PC/ABS /WUF blends The relationship between the elasticity modulus and the percentage of the waste urea formaldehyde powder of PC/ABS blend is shown in the Figure 2-A. The elasticity modulus of PC/ABS/WUF blend increases as the urea formaldehyde concentration increases from 0 to 30 wt %. The maximum elasticity modulus is observed at the 30 wt % WUF concentration for PC/ABS. In comparison with the elasticity modulus of PC/ABS, the elasticity modulus increased by 130% for the composites with a 30 wt % UF concentration. The relationship between the ratio percentage of the waste urea formaldehyde and tensile strength at break of PC/ABS blends is shown in the Figure 2-B. Tensile strength at break of blends shows an decrement as the waste urea formaldehyde concentration increases from 0 to 30 wt %. The minimum tensile strength at break is observed at the 30 wt % waste urea formaldehyde concentration for PC/ABS. In comparison with the tensile strength at break of PC/ABS, the tensile strength at break decreased by 64 % for the composites with a 30 wt % urea formaldehyde concentration. The elongation at break of waste urea formaldehyde filled blends was measured, as shown in Figure 2-C. With increased loading, the elongation at break of blends filled with waste urea formaldehyde is decreased. The minimum elongation at break is observed at the 30 wt % waste urea formaldehyde concentration for PC/ABS. In comparison with the elongation at break of virgin PC/ABS, the elongation at break decreased by 63 % for the blends with a 30 wt % waste urea formaldehyde concentration. Group 1 PC/ABS (50/50) Group 2 PC/ABS/WUF (47,5/47,5/5) Group 3 PC/ABS/WUF (45/45/10) Group 4 PC/ABS/WUF (40/40/20) Group 5 PC/ABS/WUF (35/35/30) Elasticity Modulus (MPa) 2400 50 Tensile strength at break (MPa) 2800 2348 2000 1600 1355 1463 1214 1200 1021 Grup 1 PC/ABS (50/50) Grup 2 PC/ABS/WUF (47,5/47,5/5) Grup 3 PC/ABS/WUF (45/45/10) Grup 4 PC/ABS/WUF (40/40/20) Grup 5 PC/ABS/WUF (35/35/30) 40 30 25 20 17 12 10 0 10 20 Ureaformaldehyde (wt%) 0 30 10 20 Ureaformaldehyde (wt%) A 4 Hardness (Shore D) 2 1,3 1 Group 1 PC/ABS (100) Group 2 PC/ABS/WUF (47,5/47,5/5) Group 3 PC/ABS/WUF (45/45/10) Group 4 PC/ABS/WUF (40/40/20) Group 5 PC/ABS/WUF (35/35/30) 72 2,7 1,4 30 B 74 Group 1 PC/ABS (50/50) Group 2 PC/ABS/WUF (47,5/47,5/5) Group 3 PC/ABS/WUF (45/45/10) Group 4 PC/ABS/WUF (40/40/20) Group 5 PC/ABS/WUF (35/35/30) 3 % Elongation 9 0 800 2 11 1 0 70 69,2 68,2 69,5 68,2 68 67,3 66 64 0 10 20 Ureaformaldehyde (wt%) C POSTER PRESENTATION 30 0 10 20 Ureaformaldehyde (wt%) 30 D 314 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 1,60 Group 1 PC/ABS (100) Group 2 PC/ABS/WUF (47,5/47,5/5) Group 3 PC/ABS/WUF (45/45/10) Group 4 PC/ABS/WUF (40/40/20) Group 5 PC/ABS/WUF (35/35/30) 9 8 7,8 7 6 6 5 5 Group 1 PC/ABS (100) Group 2 PC/ABS/WUF (47,5/47,5/5) Group 3 PC/ABS/WUF (45/45/10) Group 4 PC/ABS/WUF(40/40/20) Group 5 PC/ABS/WUF (35/35/30) 1,40 Density (g/cm3) Izod impavt strength (kJ/m2) 10 5,4 1,2419 1,20 1,1045 1,1176 1,1246 1,0692 1,00 4,6 0,80 4 0 10 20 Ureaformaldehyde (wt%) 30 0 10 20 Ureaformaldehyde (wt%) 30 E F Figure 2. Mechanical Properties of the PC/ABS/WUF Polymer Blends The relationship between the waste urea formaldehyde content and the hardness of the polymer blends is shown in Figure 2-D. The hardness of the blends increased (from 0 to 30wt %) with an increase weight percentage of urea formaldehyde powder. The maximum hardness is observed at the 30 wt % urea formaldehyde concentration for PC/ABS. In comparison with the hardness of virgin PC/ABS, the hardness increased by 3% for the composites at a 30 wt % urea formaldehyde concentration. Figure 2-E illustrates the effect of urea formaldehyde on the Izod impact strength (notched) of PC/ABS blends. The Izod impact strength decreased as the urea formaldehyde particle concentration increased from 0 to 30 wt %. In comparison with the Izod impact strength of virgin PC/ABS, the Izod impact strength decreased by 23% for the composites at a 30 wt % urea formaldehyde concentration. Figure 1-F illustrates the effect of urea formaldehyde on the density of PC/ABS blends. The density increased as the urea formaldehyde particle concentration increased from 0 to 30 wt %. In comparison with the density of virgin PC/ABS, the density increased by 16% for the composites at a 30 wt % urea formaldehyde concentration. 3.2 Morphological properties of PC/ABS /UF polymer blends The SEM study was carried out to study the dispersion of waste urea formaldehyde in the PC/ABS matrix. The boundaries and the contrast can be obviously seen between the urea formaldehyde and PC/ABS matrix on the fractured surfaces of polymer matrix (Figure 3). The micrographs indicate that the UF particulates are homogeneously dispersed on the fractured surfaces of PC/ABS polymer matrix. Urea formaldehyde powder Group 3ABS/PC/WUF (45/45/10) Group 1 PC/ABS (50/50) Group 2 ABS/PC/WUF (47.5/47.5/5) Group 4ABS/PC/WUF (40/40/20) Group 5 ABS/PC/WUF (35/35/30) Figure 3. SEM Micrographs of the PC/ABS/WUF Polymer Blends POSTER PRESENTATION 315 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 4 CONCLUSION The effects of waste urea formaldehyde on the mechanical properties, such as elastic modulus, tensile strength at break, % elongation, hardness, Izod impact strength, and density of PC/ABS/UF blends were investigated. The following results were obtained: Elastic modulus, hardness and density increased gradually as the waste urea formaldehyde content increased. Tensile strength at break, % elongation and Izod impact strength decreased gradually as the waste urea formaldehyde content increased. The micrographs indicate that the urea formaldehyde particulates are homogeneously dispersed on the fractured surfaces of PC/ABS polymer matrix. Acknowledgement: This work has been supported by the Scientific Research Project Program of Marmara University References [1] Tasdemir, M., Karatop, S., Journal of Applied Polymer Science 2006. Effect of styrene– isopren–styrene addition on the recycled polycarbonate/acrylonitrile–butadiene–styrene polymer blends, 101, 559–566. [2] Tasdemir, M., Miskioglu, I., Int. J. Of Mat. And Manufacturing 2016. Friction and wear behaviors of HIPS/SBS polymer blends, Vol. 4/2, 95-99. [3] Thomas, R., Vijayan, P., Thomas, S., Recent Developments in Polymer Recycling 2011. Recycling of thermosetting polymers: their blends and composites: 121-153. [4]W.N. Kim and C.M. Burns, Polym. Eng. Sci., 1988. Thermal behavior, morphology, and some melt properties of blends of polycarbonate with poly(styrene-co-acrylonitrile) and poly(acrylonitrile-butadiene-styrene), 28, 1115. [5] T. A. Callaghan, K. Takakuwa, and D.R. Paul, Polymer, 1993. Polycarbonate-SAN copolymer interaction. 34, 3796. [6] J.D. Keitz, J.W. Barlow, and D.R. Paul, J. Appl. Poly. Sci. 1984. Polycarbonate blends with styrene/acrylonitrile copolymers, 29, 313. [7] H. Suarez, J. W. Barlow, and D.R. Paul, J. Appl. Poly. Sci. 1984. Mechanical Properties of ABS/polycarbonate blends, 29, 3253. [8] Evelin, D. B., Chris, C. W., Montgomery, T. S., Journal of Applied Polymer Science, Mechanical properties of blends of HDPE and recycled urea-formaldehyde resin, 2000. 77, 3220. POSTER PRESENTATION 316 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Birincil ve İkincil Arıtma Çamurlarının Mezofilik Sıcaklıkta Ayrı Anaerobik Çürütme Potansiyeli ve Stabilize Çamur Kalitesinin Araştırılması Cansu Bayhan, Dilek Erdirençelebi* Selçuk Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Konya, TR *dbaktil@hotmail.com Özet Bu çalışmada kentsel atıksu arıtma tesislerinde (AAT) oluşan birincil (ön çöktürme) ve ikincil (fazla biyolojik) çamur fraksiyonlarının ayrı anaerobik stabilizasyonu laboratuvar ölçekli yarı-kesikli anaerobik reaktörlerde mezofilik sıcaklıkta (γ5 oC) farklı yükleme hızlarında çalışılmış ve proses performans parametreleri (metan üretim ve dönüşüm oranı, yağ-gres ve uçucu katı madde (UKM) giderimi, susuzlaşma) incelenmiştir. Birincil çamur (BÇ) beslenen ardışık kesikli reaktörde (AKR) hidrolik bekletme süreleri (HBS) γ0 ve β5 gün, UKM yüklemeleri 1.1 ve 1.γ kg UKM/m 3.g değerlerinde çalışılmıştır. İkincil çamur (İÇ) beslenen reaktör için HBS β8 ve β4 gün, UKM yükleme hızları 0.γ ve 0.γγ kg UKM/m 3.g olarak çalışılmıştır. Çalışmanın amacı arıtma çamuru fraksiyonlarının ayrı anaerobik stabilizasyonunun farklı bekletme sürelerinde hem biyogaz üretimine hem de son ürün stabilize çamurun kalitesine yönelik iyileşme sağlaması ile mevcut AAT çamur hattı işletimine yeni bir model ortaya koymaktır. Artan yükleme ile her iki çamur fraksiyonu için de metan dönüşüm oranında artış ve BÇ için UKM gideriminde düşüş ve susuzlaşma özelliğinde artış, İÇ için UKM gideriminde artış ve susuzlaşma kabiliyetinde düşüş trendi, her iki çamur fraksiyonu için ayrı stabilizasyon modelinin yüksek yükleme ve düşük HBS/hacimde uygulanabilirliğini göstermiştir. Ayrıca BÇ’un yoğunlaşma ihtiyacının olmadığı ve çamur hattı geri devir probleminin ayrı sistemle ortadan kaldırılabileceği belirlenmiştir. Anahtar Kelimelerμ Arıtma çamurları, anaerobik, stabilizasyon. 1.GİRİŞ Arıtma çamurlarının artması, atık biyolojik çamurun ön arıtım yöntemleri, birincil çamurun diğer organik atıklar ile birlikte çürütülmesi ve tek veya çok kademeli termofilik+mezofilik anaerobik stabilizasyon çalışmaları ile çamur çürütme prosesinin enerji eldesi ve stabilizasyon derecesinin iyileştirilmesi çalışmalarına önem kazandırırken yaygınlaştırmaktadır. Uluslararası çalışmalarda farklı sistemlerin fizibilitesi lab ölçekli çalışmalarla yürütülmekte ise de gerçek ölçekli uygulamalar için maliyet-enerji etkinliği henüz uygulanabilir seviyede olmamaktadır. A.B.D. kaynaklı gerçek ölçekli tesislerde termofilik sıcaklık veya kademeli termofilik-mezofilik uygulaması ile çıkış biyokatı kalitesinin yükseltilmesi tercih edilmektedir (Iranpour ve ark., β004ν Shao ve ark., β00βν Krugel ve ark. 1λλ8). Literatürde ise termofilik çürütücülerin kararsız işletim özelliği nedeniyle farklı sonuçlar elde edilmiştir. Ulusal ölçekte ise mevcut anaerobik çürütücüler için öncelikli olarak orta ve üst mezofilik sıcaklık seviyesinde birincil ve ikincil çamur fraksiyonların ayrı çürütülmesinin sağlayacağı faydaların araştırılması gerekmektedir. Atıksu arıtma tesislerinin (AAT) sayısındaki artış ve üretilen atık çamur için gereken kalite, çamurun anaerobik çürütme verimliliğini arttırmayı gerekli kılmaktadır. İkincil çamurun (İÇ) ön işlemleri, çamurdan uçucu katıların ve patojen mikroorganizmaların giderilmesinde önemli avantajlar göstermiş ve biyogaz üretimi üzerinde de olumlu bir etkisi olmuşturν 55°C’de, 1β ve β4 sa süre ile işlem sonucunda çamur yapısının hidrolizi % 40, metan verimliliği %βγ oranında ve çamur akışkanlığında genel bir iyileşme olmuştur (Carvajal ve ark., β01γ). Biyokimyasal metan potansiyeli deneyleri, ikincil çamurun metan üretim potansiyelinin hafif termal ön işlemle büyük ölçüde arttırılabileceğini, ön işlem sıcaklığı 100°C ve çürütme süresi β0 gün ile metan veriminin 14β.6 ± β.5 mL/g uçucu katı maddeye kadar yükselebileceğini göstermiştir (Yan ve ark., β01γ). İki kademeli anaerobik çürütme işleminde karışık çamur (KÇ) için termofilik + mezofilik sistemde sırasıyla 2-3 ve 10-1γ g’lük çamur bekletme sürelerinde tek kademeli klasik anaerobik çürütme işlemine göre patojen gideriminde A sınıfı biyokatı eldesinin mümkün olabileceği gösterilmiştir (Rubio-Loza ve ark,, 2010). POSTER PRESENTATION 317 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org BÇ’nin anaerobik çözünürlüğü üzerine pH’ın etkisi kesikli anaerobik reaktörlerde β0 g ve γ5°C’de incelendiğinde pH’nın kontrol edilmediği işletimde toplam katı madde (TKM) ve uçucu askıda katı madde (UAKM) giderimi beklendiğinden daha yüksek gerçekleşmiştir (Gomec ve Speece β00γ). Buna karşın İÇ’un pH kontrollü çürütülmesinde daha yüksek TKM ve uçucu katı madde (UKM) giderimi elde edilmiştir. pH kontrolü altında BÇ’un hidroliz ve asitlenme periyodunda azalma gözlenmiştir. İÇ için ise asidojenik safha, pH korunumu ve uçucu yağ asiti (UYA) oluşumu gözlenmemiştir. Sonuçlar BÇ ve İÇ’un yapısal farkının farklı anaerobik stabilizasyon özellikleri gerektirdiğini göstermektedir. Yağ-gres ve lipid (YGL) içeriği arıtma çamurlarının susuzlaşma kabiliyetini düşürmektedir. Bu tip çamurların ilave katkı maddeleriyle susuzlaşma seviyesinin arttırılması birçok farklı madde ile literatürde çalışılmıştır (Ziels ve Karlsson, β016). Yapısı ve debisi oldukça farklı BÇ ve İÇ fraksiyonlarının çamur hattında birleştirilerek yoğunlaştırma ve ardından anaerobik çürütme prosesine tabi tutulması AAT işletiminde ciddi problemlere yol açmaktadır (Tomei ve ark., β016). Yapılan çalışmanın amacı, ayrık stabilizasyon modelinin potansiyel avantaj ve kısıtlamalarını belirlemektir. 2. MATERYAL VE METOT Laboratuvar ölçekli gaz ve numune çıkışları olan β000 mL paralel reaktörler, 1500 mL aktif hacimde BÇ ve İÇ ile günlük olarak beslenerek mezofilik (35oC) sıcaklık seviyesinde inkübe edilmiştir. Hidrolik bekletme süresi (HBS) sırasıyla BÇ ve İÇ için γ0, β5 ve β8, β4 g olarak çalışılmıştır. UKM yüklenme hızı sırasıyla BÇ ve İÇ için 1.1, 1.γ ve 0.γ, 0.33 kg UKM/m3.g olarak uygulanmıştır. Karıştırma, besleme ve gaz ölçümleri günlük olarak gerçekleştirildi. Metan, sıvı yer değiştirme yöntemi ile günde iki kez doğrudan ölçülmüştür. Her UKM yüklenme hızında kararlı halee ulaşıldığında UKM, yağ-gres ve çamur susuzlaşma analizleri yapılmıştır. Bikarbonat, UYA, pH ve çözünmüş sülfür günlük olarak belirlenmiştir. TKM (2540-B), UKM (2540-C), yağ-gres (55β0 E), çözünmüş sülfür (4500 Sβ- F) ve susuzlaşma (β710 H) standart metotlara göre belirlenmiştir (APHA, β005). Yağ-gres UKM’nin %’si olarak hesaplanmıştır. Çalışma kapsamında 15 günlük periyotlarla KOSKİ AAT ön çöktürme çıkışından alınan BÇ ve biyolojik arıtım geri devir hattından alınan İÇ ham çamur numunelerinin karakterizasyonu TKM/ UKM, yağ-gres, pH ve susuzlaşma parametreleri ile belirlenmiştir. Anaerobik aşı çamuru KOSKİ ATT dekantör girişinden alınmıştır. BÇ, İÇ’a göre daha geniş bir aralıkta salınım, yüksek UKM içeriği ve düşük susuzlaşma kabiliyeti göstermiştir. Çökelme deneylerinde BÇ’un çökmediği ve İÇ’un 400-500 mL/L değerine kadar çökelme kabiliyeti gösterdiği belirlenmiştir. Ham Çamur BÇ İÇ Aşı pH 6.3-7.0 7.2-8.0 8.2-8.4 Tablo 1. Ham Çamur Özellikleri TKM UKM (mg/l) (mg/l) 30000-50000 20000-35000 7000-11000 5000-7000 17720-19000 10900-12000 Susuzlaşma Süresi (dk) 5-10 1.67-2.5 3.SONUÇ Adaptasyon döneminde BÇ ve İÇ için sırasıyla 0.57 ve 0.β6 kg UKM/m 3.g yükleme hızlarında çalışılmıştır (Şekil 1-a). Ortalama metan dönüşüm oranı BÇ ve İÇ için sırasıyla β00-400 ve 84-494 ml metan/g UKMbeslenen olarak gerçekleşmiştir (Şekil 1-b). İlk yükleme hızında (1.1λ ve 0.γ kg UKM/m 3.g UKMbeslenen) ise bu değerler BÇ için 400-640 ml metan/g UKMbeslenen aralığına artarken, İÇ için β00 ml metan/g UKMbeslenen‘nin altında gerçekleşmiştir. Bu reaktöre aşı takviyesi yapılarak bakteriyel bozulma iyileştirilmiştir. Sonraki dönemde yükleme hızında BÇ için 1.64 kg UKM/m 3.g’e artış ve İÇ için 0.2 kg UKM/m3.g UKMbeslenen’a düşüş gerçekleşmiştir. Bu dönemde BÇ için metan dönüşümü 640-740 seviyesinden 540 ml metan/g UKMbeslenen seviyesine düşmüştür. Bu düşüşte toksisite etkisi oluştuğu kabul edilerek yükleme değeri 1.γ’e düşürülmüştür. İÇ için performans 390(+/-)50 ml metan/g UKMbeslenen seviyesine yükselmiştir. Sonraki yükleme hızında ise İÇ için 0.γ5 kg UKM/m 3.g olarak gerçekleşirken elde edilen metan dönüşüm oranı 500’den 8β4 ml metan/g UKM beslenen‘e kadar yükselmiştir (Şekil 1-b). Artan yükleme ile metan dönüşümünde artış, özellikle İÇ için oldukça yüksek gerçekleşmiştir. Bunda da İÇ’un düşük hidroliz hızı sebebiyle besin içeriğinin anaerobik biyokütle için düşük yüklemelerde yetersiz kaldığı POSTER PRESENTATION 318 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org kabul edilebilir. İÇ’un UKM konsantrasyonundaki değişimin genel olarak düşük gerçekleşmesi AAT biyolojik arıtım hattının tasarım değerlerinin kararlı şekilde sağlanmasının sonucudur ve bu çamur fraksiyonunun etkin metan üretimi sağlaması için yüksek yükleme/düşük HBS ile mümkün olabilir. Susuzlaşma değeri (Time-to-filter (TTF)) çıkış numuneleri için BÇ ve İÇ için sırasıyla 5-5.3 ve 2.45-3.45 dk olarak gerçekleşmiştir (Şekil 1-a). BÇ’un anaerobik stabilizasyonla susuzlaşma özelliği artarken, İÇ’un susuzlaşma özelliği düşmüştür. Reaktörlerdeki çözünmüş sülfür ise metan üretimine ters yönde değişim göstermiştir. Özellikle besleme çamurunun değişmesi ile değişkenlik göstermiştir. Adaptasyon sürecinde çözünmüş sülfür BÇ ve İÇ için 5 mg/L’nin altında oluşurken, yükleme hızının artması ile BÇ için β0-25 mg/L ve İÇ için 10-15 mg/L seviyesine yükselmesini sonraki yüklemede γ6-51 ve 55-62 mg/L seviyeleri takip etmiştir. Çözünmüş sülfürün toksik etki oluşturduğu aynı dönemde metan dönüşüm oranındaki azalma ile belirlenmiştir. Bu durum demir klorür tuzu ilavesi ile kontrol edilmeye başlanmıştır. Reaktörlerden çıkış çamur UKM konsantrasyonları BÇ ve İÇ için sırasıyla 16000 mg/L’ye artış ve 4000 mg/L seviyesine düşüş şeklinde gerçekleşmiştir (Şekil β-a). Bu sonuçta BÇ’un besi içeriğinin yüksek ve İÇ’un yetersiz kaldığı veya düşük hidroliz seviyesinin etkisi gözlenmektedir. UKM giderimi BÇ için artan yükleme ile %60’dan %γ5-40 seviyesine düşüş göstermiştir (Şekil β-b). İÇ için %5γ(+/-)10 seviyesinde gerçekleşmiştir. Ham İÇ’un UKM değeri reaktördeki çamurun UKM değerinden daha düşük olduğu için İÇ için ilk süreçte giderim hesaplanamamıştır. Yağ gres içeriği BÇ beslenen reaktör için yükleme arttıkça %7.6’dan β4’e yükselmiş, gelen çamurun UKM değerindeki artış ile paralellik göstermiştir. İÇ beslenen çürütücüde yağ gres içeriği daha düşük seviyede artışla %10’dan %14.5’a yükselmiştir. Çıkış numunelerinin pH aralığı ise BÇ için 7.4-8.0 ve İÇ için 7.λ-8.4 aralığında gerçekleşmiştir. 4. TARTIŞMA Çalışmada her iki çamur fraksiyonu için aynı HBS fakat farklı yükleme değerlerinde çalışılmış, reaktörler stabil hale ulaştığında yeni yüklemeye geçilmiştir. BÇ, İÇ’a göre oldukça yüksek UKM içeriği ile yüksek besleyici yapısından dolayı daha stabil işletim sağlamış, yükselen yükleme hızı ile artan metan üretimi sağlarken UKM gideriminde düşüş göstermiştir. Bunda BÇ için hidroliz hızının çürütme hızına kısıtlayıcı etkisi ve/veya artan reaktör biyokütle konsantrasyonunun etkisi belirtilebilir. Bunun yanı sıra ham çamur daha geniş bir aralıkta değişim göstermiştir. İÇ’un anaerobik stabilizasyonu BÇ ile karşılaştırıldığında artan yüklemelerin metan dönüşüm oranında daha etkin olduğunu ve oldukça yüksek değerler elde edilebileceğini göstermiştir. Her iki fraksiyonun da yakın metanlaşma oranı ayrışabilirlik olarak çok farklı olmadıklarını ortaya koymuştur. Bu da İÇ’un düşük UKM içeriği ve yüksek susuzlaşma kabiliyeti gözönüne alındığında ayrı mekanik yoğunlaştırma sonrası anaerobik stabilizasyonunun düşük HBS değerlerinde oldukça verimli bir çürütme reaksiyonu sağlayacağını göstermektedir. Bu sonuca göre BÇ’un yüksek UKM içeriğinden dolayı yoğunlaştırma tankına alınmadan doğrudan çürütücülere beslenmesi ile yoğunlaştırılarda yaşanan çökelme problemi ve taşkanla tesis girişine çamur geri devrinin önüne geçilmiş olacaktır. POSTER PRESENTATION 319 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org UKM YH (kg UKM/m3.g) 1,80 (a) 1,60 1,40 1,20 1,00 TTF (BÇ)μ5.15 dk TTF (İÇ)μβ.45 dk 0,80 BÇ TTF (BÇ)μ5.08 dk TTF (İÇ)μγ.45 dk İÇ 0,60 0,40 0,20 0,00 21.12 26.12 31.12 5.1 10.1 15.1 20.1 25.1 30.1 4.2 9.2 14.2 19.2 24.2 1.3 6.3 1400 (b) Metan Üretimi (mL/g UKMeklenen) 1200 1000 800 BÇ İÇ 600 400 200 0 21.12 31.12 10.1 20.1 30.1 9.2 19.2 1.3 11.3 Çözünmüş Sülfür (mg S2-/L) 80 (c) 70 60 50 40 BÇ 30 İÇ 20 10 0 21.12 31.12 10.1 20.1 30.1 9.2 19.2 1.3 Tarih Şekil 1. (a) UKM yükleme hızı, (b) metan dönüşüm oranı, (c) çözünmüş sülfür konsantrasyonu POSTER PRESENTATION 320 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 18000 (a) 16000 Çıkış UKM mg/L 14000 12000 10000 BÇ 8000 İÇ 6000 4000 2000 % UKM GİDERİMİ 0 31.12 100 90 80 70 60 50 40 30 20 10 0 31.12 10.1 20.1 30.1 9.2 19.2 1.3 11.3 (b) BÇ İÇ 10.1 20.1 30.1 Tarih 9.2 19.2 1.3 11.3 Şekil 2. (a) Çıkış çamur UKM konsantrasyonu, (b) % UKM giderimi KAYNAKLAR Anderson GK, Yang, G 1992. Determination of bicarbonate and total volatile acid concentration in anaerobic digesters using a simple titration. Water Environment Research, 64:53–59. APHA 2005. Standard Methods for the Examination of Water and Wastewater, American Public Health Association (APHA), American Water Works Association (AWWA) and Water Environment Federation (WEF), 21st Edition, Washington, USA. Carvajal A, Pena M, Pérez-Elvira S 2013. Autohydrolysis pretreatment of secondary sludge for anaerobic Digestion, Biochemical Engineering Journal, 75: 21– 31. Gomec CY, Speece RE 2002. Organic material solubilization of domestic sludge in anaerobic digestion of domestic primary sludge in anaerobic digestion at controlled pH. Water Science and Technology, 49(4): 195-198. Iranpour R, Cox HHJ, Fan S, Mundine JE 2004. Full-scale conversion of Hyperion Treatment Plant to thermophilic anaerobic digestion for Class A biosolids by several alternatives. Proceedings 10th World Congress on Anaerobic Digestion; Aug 29–Sep 2, Montreal, Canada; International Water Association: London, UK. Krugel S, Nemeth L, Peddie C 1998. Extending thermophilic anaerobic digestion for producing Class A biosolids at the greater Vancouver regional districts annacis island wastewater plant. Water Science Technology, 38(8–9): 409–416. Rubio-Loza LA, Noyola A 2010. Two-phase (acidogenic–methanogenic) anaerobic thermophilic/mesophilic digestion system for producing Class A biosolids from municipal sludge, Bioresource Technology, 101: 576–585. POSTER PRESENTATION 321 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Shao YJ, Kim HS, Seung O, Iranpour R, Jenkins D 2002. Full-scale sequencing batch thermophilic anaerobic sludge digestion to meet epa class a biosolids requirements. Proceedings of the Water Environment Federation, WEFTEC 2002: Session 21-30, pp. 573-591. Tomei MC, Bertanza G, Canato M, Heimersson S, Laera G, Svanstrom M 2016. Techno-economic and environmental assessment of upgrading alternatives for sludge stabilization in municipal wastewater treatment plants. Journal of Cleaner Production, 112: 3106-3115. Yan Y, Chen H, Xu W, He Q, Zhou Q 2013. Enhancement of biochemical methane potential from excess sludge with low organic content by mild thermal pretreatment. Biochemical Engineering Journal, 70: 127-134. Ziels RM, Karlsson A, David AC, Ejlertsson B, Yekta S, Bjorn A, Stensel H, Svensson A 2016. Microbial community adaptation influences long-chain fatty acid conversion during anaerobic codigestion of fats, oils, and grease with municipal sludge. Water Research, 103: 372-382. POSTER PRESENTATION 322 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Synthesis and Characterization of Poly(Vinyl Chloride)/Organozeolite Composite Ceyda Bilgiç1, Bengi Bozkır2 1,2 Eskişehir Osmangazi University, Engineering and Architecture Faculty, Department of Chemical Engineering, , β6480 Eskişehir, Turkey Corresponding author e-mail: bozkirbengi@gmail.com, ceydabilgic@gmail.com Abstract Polymer/clay nanocomposites are a class of hybrid materials composed of organic polymer matrix in which inorganic particles with nanoscale dimension are embodied. The natural zeolite (clinoptilolite) of Gördes–Manisa (in Western Anatolia of Turkey) used in this work. The O-zeolite was obtained through the purification of zeolite and was organically modified by hexadecyltrimethyl ammonium bromide (HTAB) with certain surfactant concentration. Poly(vinyl chloride)/O-zeolite composites were prepared using the solution blending method with the application of ultrasound and using trichloromethane as solvent. Ultrasonic waves were used to enhance the nanoscale dispersion of the silicate. Polymer composite of a poly(vinyl chloride) (PVC) matrix containing 5% Organozeolite (OZ) by mass was investigated using X-ray diffraction (XRD) Scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Polymer nanocomposites of a PVC matrix containing 5% organozeolite (OZ) by mass was investigated using inverse gas chromatography (IGC). IGC was applied to characterize the surface of PVC/OZ composite. Keywords: Poly(vinyl chloride); Nanocomposites; Characterization, TEM, SEM, XRD,IGC 1. INTRODUCTION The synthesis and development of polymer/silicate composites have attracted considerable attention from both basic research and commercial applications, as they often exhibit remarkable improvements in the mechanical properties, thermal stability, gas barrier properties, enhanced ionic conductivity, reduced flammability and biodegradation, etc., as compared with the pure polymers or conventional micro- and macro-composites (Giannelis et al., 1999; Gilman et al., 2000; Alexandre and Dubois, 2000; AnnabiBergaya, 2008; Pavlidou, 2008). These improvements in the properties are the result of the nanometer scale dispersion of silicate in the polymer matrix. The dispersion of zeolite layers in a monomer or polymer matrix can result in the formation of three types of composite materials. The first type is a intercalated, that can be formed if the interlayer distance increases but the layer morphology remains unchanged, an intercalated nanocomposite structure is obtained. The other type is intercalated-and-flocculated conceptually the same as intercalated nanocomposites. However, silicate layers are sometimes flocculated due to hydroxylated edge– edge interaction of the silicate layer. The last type is the exfoliated structure, which can only be obtained if the silicate layers totally disperse in the polymer matrix. Exfoliated polymer–silicate nanocomposites are especially desirable for improved properties because of the homogeneous dispersion of clay and huge interfacial area between polymer and silicate (Balazs et al., 1999; Kim et al., 2002; Zhang et al., 2006; Pavia et al., 2008). Poly(vinyl chloride) (PVC), as an important commercial polymer, has been studied and used widely in industrial fields for many years. However, due to its inherent disadvantages, such as low thermal stability and brittleness, PVC and its composites are subject to some limitations in certain applications (Dietrich, 2001). Therefore, it is necessary to develop new PVC products with altered properties in order broaden PVC applications. Recently, the development of PVC/layered silicate nanocomposites presents a new way to prepare high performance PVC composites. Wang et al., 2001; Wang et al., 2002, reported the preparation and characterization of PVC-clay nanocomposites formed by both melt and solution blending. The effects of the clay loading level, the presence and amount of plasticizer, melt blending time and annealing time, etc., on the structure of the nanocomposite and the thermal and mechanical properties have also been investigated. Trilica et al., 2001, took dioctylphthalate (DOP) as cointercalater for organic montmorillonite (MMT) and PVC because they found alkylammonium salts between the interlayers of organic MMT, could catalyze PVC degradation. Although DOP prevented the degradation of PVC, the MMT only acted as a plasticizer carrier POSTER PRESENTATION 323 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org and the mechanical properties of the composites were not enhanced significantly. Du et al., 2003, reported more information concerning the thermal degradation and charring of PVC/MMT nanocomposite in the presence of DOP by the use of X-ray photoelectron spectroscopy and the acquisition of the carbon (C1s), chlorine (Cl2p), and oxygen (O1s) spectra. For PVC–clay nanocomposites the surface at high temperatures is dominated by carbon, and not the oxygen of the clay. The presence of the clay does retard the chain-stripping degradation of the PVC and the enhanced char formation accounts for the observation of enrichment of carbon. Wan at al., 2003, investigated the effect of silicate modification and MMT content on the morphology development, relaxation behavior, optical clarity and mechanical properties of the PVC/MMT nanocomposites. Despite the widespread use of the clays for preparations of composites, has not done much work on zeolites in the literature. In the present work, Polymer nanocomposites of a PVC matrix containing 5% organozeolite (OZ) by mass were prepared using the solution blending method with sonication. Hexadecyl trimethyl ammonium bromide was used to modify the montmorillonite after its surface was saturated with Na + ions. X-ray diffraction and transmission electron microscopy revealed the mixed morphology of composites. The majority of O-Zeolite is dispersed in the polymer matrix in the form of an ordered tactoid (multilayer particles) structure consisting of few silicate layers and intercalated-and-flocculated structure was achieved. Characterization studies were performed by use of XRD, TEM, SEM and IGC. Inverse gas chromatography (IGC) method at infinite dilution is applied for dispersive component of the surface free energy (  Sd )of PVC nanocomposites containing 5 wt. % OZ. 2. MATERIALS AND METHODS PVC was provided by Sigma–Aldrich. Hexadecyltrimethylammonium bromide (HTAB,C 19H42BrN, Purity %98) and sodium chloride (NaCl, Purity %99.5) were provided by Merck and used as received. Tetrahydrofuran (THF, Purity %99.8) was purchased from Sigma–Aldrich. The natural zeolite (clinoptilolite) of Gördes–Manisa (in Western Anatolia of Turkey) used in this work was supplied from Rota Mining Corporation. Because it was received as it was taken out of the ground, without having been processed, it contained many impurities. In order to purify it and also increase its zeolite content, a decantation process was applied. Following this process, the clay had been dried in an oven at 90 oC and it was ground. 2.1. Preparation of organo-zeolite and composite In order to prepare the organic-intercalated zeolite firstly, 1l of 2M NaCl solution was added to 20g of purified clay and was mixed at 500rpm with a Heidolph magnetic stirrer for 24h at room temperature. Then the mixture was centrifuged and rinsed three times with distilled water. The obtained Na-zeolite was dried at 110 oC. Na- zeolite aqueous suspension and a certain amount of HTAB were mixed for 24h by adding distilled water heated at 60 oC. Next, th e mixture was centrifuged and the obtained white solid was dried in an oven after being rinsed with distilled water. After being ground, it was sieved to pass through a λ0 ηm sieve. Organo zeolite /PVC nanocomposites were prepared by the solution blending method. The organo zeolite was dissolved in tetrahydrofuran (THF) and the solution was magnetically stirred until all the clay appeared to be completely dispersed at 50 °C. After stirring, the mixture was placed in an ultrasonic bath for sonication at room temperature, for 1 h. PVC was dissolved in toluene at room temperature. Zeolite solution was added slowly to PVC solution and then it was stirred until the solution became homogeneous. Ozeolite/PVC mixture was placed in an ultrasonic bath, for 20 min. After sonication it was poured in glass moulds and toluene was then evaporated which was performed by two consecutive steps: air drying for 12 h, and in an oven at 60 °C, for γ h. For comparison, polystyrene was dissolved in toluene, then sonicated and dried using the same procedure described above, obviously without adding O-zeolite. Finally, samples were cryo-milled using a Retsch cryogenic jar mill. The samples were labelled to describe the amount of OZ and PVC 5 mean, PVC contained and 5 wt. % of OZ, respectively. 2.2 Characterization techniques The XRD patterns were recorded between 5° and β0° (βθ) at a scanning speed of 0.0β° min−1 using a Rigaku Ultima-IV diffractometer (Akishima, Japan) with CuKα radiation (40 kV/γ0 mA). Scanning electron microscopy (SEM) observation of the sample was done by a Jeol JSM-5600 LV (Tokyo, Japan). Prior to POSTER PRESENTATION 324 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org SEM observation, sample was coated with a thin layer of gold using a Polaron SC7620 (Quorum Technologies Ltd., East Sussex, UK). For transmission electron microscopy (TEM), a single drop of dilute solution of sample was deposited on a copper TEM grid and dried overnight at room temperature, and examined by a Jeol JEM-1220 Electron Microscopy (Tokyo, Japan, at an accelerating voltage of 80 kV). The chromatographic experiments were performed with Agilent 7890 gas chromatography equipped with a flame ionization detector (FID). Nitrogen with high purity was used as the carrier gas with a flow rate of 40 ml min-1. IGC measurements were carried out in the temperature range of 30–60 °C. About 3 g of sample particles of 150-β00 µm was filled into the stainless steel column (2.00 m long, 5.35 mm I.D.) via the aid of vacuum. Stainless steel column washed with methanol and acetone before packing with powders. The adsorbents were conditioned at the highest temperatures in the nitrogen gas flow for 4 h before the measurements. Methane is used for determining the dead volume. At least four determinations were used in averaging the net retention volume (VN). 2.3 IGC theory Inverse gas chromatography (IGC) is a derivation of conventional gas chromatography. However, unlike analytical chromatography, the material being investigated is the solid in the gas chromatography column. The retention volume of the mobile phase (probe) indicates the interaction between the probe and the surface of the material in the column (Cordeiro et al., 2011; Matsushita et al., 2006). IGC provides an excellent method to measure the surface energy of rough and porous powders (Hole et al., 2006). The surface energy is the result of the unbalanced molecular forces at the surface of the solid. It can be considered to be formed by two different contributions: dispersive and specific. The retention time of a series of homologous n-alkanes is used to determine the dispersive component of the surface free energy ( γ dS ) of PVC/OZ. In IGC literature, γ dS is commonly determined from the following equation, which was introduced by Lavielle and Schultz, 1991: RTLnVN  2 N .( Sd )1/ 2 .a.( Ld )1/ 2  C (2.1) Here, R is the gas constant, T is the absolute column temperature, a is the molecular surface area coated with a kind of adsorbed alkane, N is the Avogadro’s number,  Ld is the dispersive component of the surface free energy of the probe, C is a constant, and VN is the net retention volume of the n-alkane probe. The net retention volume (VN) is calculated using the equation below (Thielmann, 2004): 2 T 3   Pi Po  -1  (2.2) VN =Fo    t A -t 0  To 2   Pi Po 3 -1  Here, tA is the retention time of the probe, while t0 is the retention time of the probe which has no interaction with the solid in the column (marker). Pi and Po are, respectively, the inlet and outlet pressures of the carrier gas, while the T/To ratio is used in order to get the value of the flow rate at the column temperature (T) from the measurement of the flow rate at ambient temperature (To). The flow rate of the carrier gas which is measured at the column outlet and at ambient temperature is expressed as Fo. 3. RESULTS and DISCUSSION The adsorption runs were performed at infinite dilution conditions. The chromatographic peaks of n-alkanes on PVC/OZ were symmetrical. So retention time is independent of the amount of injected. The value of γ dS represents the interaction of the surface with n-alkanes and hence is a measure of how easily the surface can d polarize the probe (Price and Ansari, 2003). The dispersive component of the surface free energy,  S , was determined by injection of a homologous series of n-alkanes having between 8 and 10 carbon atoms. One of the most commonly measured parameters for the description of the energy situation on the surface of a solid is the surface energy. The surface energy can affect, e.g. catalytic activity or the strength of particle-particle interaction. The dispersive components of PVC/OZ at experimental temperatures were calculated from Eq. (2.1). Plotting RTlnVN against a. Ld  1/ 2 yields a straight line with the slope of γ S , which can be seen for d PVC/OZ in Figure 1. Table 1 shows the dispersive component of the surface free energy, γ S , of PVC/OZ. It d was observed that γ dS values decrease with increasing temperature. POSTER PRESENTATION 325 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 1. Values of Dispersive Component of the Surface Energy Measured on %5OZ-PVC at Various Temperatures T (°C) γ 30 40 d S 27,264 26,478 50 60 22,816 17,825 2 (mJ/m ) 8 6 4 2 0 250 270 290 310   Figure 1. The RT ln(VN ) – a.  Ld 1/ 2 330 350 370 graphs for %5OZ-PVC Complementary to XRD, TEM is the most popularly employed technique to determine composite morphology, using TEM one can image the composite structure. In general, one collects several images at high and low magnification and at several positions in the nanocomposite sample. Both a low magnification image, to show the global dispersion of the additives in the polymer, and a higher magnification image, to evaluate the registry of additives are needed. The ordered intercalates exhibit microstructures very similar to the unintercalated organically modified layered silicate. Polymer intercalation occurs as a front which penetrates the primary organically modified layered silicate particle from the external edge. The disordered composites exhibit heterogeneous microstructures with increased layer disorder and spacing towards the polymer-primary particle boundary. In these hybrids, individual silicate layers are observed near the edge whereas small coherent layer packets separated by polymer-filled gaps are prevalent toward the interior of the primary particle. The heterogeneous microstructure indicates that the formation of these disordered composites occurs by a more complex process than simple sequential separation of individual layers starting from the surface of the crystallites and primary particles. In general, the features of the local microstructure from TEM give useful detail to the overall picture that can be drawn from the XRD results and enhance the understanding of various thermodynamic and kinetic issues surrounding composite formation (Pourabas et al., 2005; Wang et al., 2009; Morgan et al., 2004). 40000 Zeolite 30000 Intensity cps %5OZ-PVC 20000 10000 0 5 7 9 11 13 2-theta (deg) 15 17 19 Fig. 3. X-ray diffraction patterns of %5OZ-PVC and Zeolite POSTER PRESENTATION 326 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org It is well known that only materials ordered enough to diffract X-ray can be detected; disordered materials will show no pattern with the X-ray technique. Generally, the formation of an intercalated nanocomposite results in an increase in basal spacing in the XRD pattern, while the formation of an exfoliated nanocomposite leads to the complete loss of registry between the layers and therefore no peak can be observed (Pourabas et al., 2005). Figure 3 shows the XRD patterns of zeolite, and PVC/Ozeolite. Dispersion of the zeolite particles in the polymer matrix is very important because the filler dispersion has a main effect on the final morphology and properties of the polymer nanocomposites. In study, the XRD peak of PVC-OZ composites appeared at the βθ . However, the OZ/PVC composites, prepared using 5wt% of OZ, did not showed any noticeable diffraction peak at the βθ values from 1 to β0°. This result suggests that the zeolite platelets was able to intercalated and-flocculated dispersed in the PVC matrix. Because the peak intensity is very low; indicating that an insignificant amount of agglomeration was present, probably due to zeolite platelet reorganization during ring-opening polymerization in the absence of shear flow. The XRD patterns suggest that the strongly hydrophobic PVC was inserted into the galleries of the hydrophilic zeolite through emulsion polymerization (Noh and Lee; 1999; Pan et. al., 2004). Figure 4. SEM images of 5% O-zeolite/PVC nanocomposites at magnifications of a) ×100 and b) x500 The morphology of the composites is evaluated by using SEM and TEM. The images of SEM give information about the reinforcement aggregates, adhesive failures and phase boundaries in composites, surface roughness, and fractured surfaces. The roughness like recesses and protrusions on the surface is very important because it intensively affects the wettability property. This property is known as the tendency of fluids to stick to the surface and can be determined by the characteristics of the surface structure (Sayyad Amin et al., 2009, Sajini et al., 2011). In this study, SEM analysis is performed to display the surface of materials and the distribution of reinforcement in polymer matrix. The SEM images of composites are given at magnifications of ×100 and ×500 in Figure 4. SEM images of composite exhibit quite well dispersion. Some bridges within the polymer matrix and dangling structures are also observed. These results may be attributed to the good dispersion of the zeolite and the compounding ratio seems not to be a prominent parameter within this phenomena. Figure 5. TEM micrographs of 5% O-Zeolite/PVC nanocomposites (a) at low magnification (b) at higher magnification. POSTER PRESENTATION 327 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The dispersion microstructure of the intercalated and-flocculated zeolite layers was also examined by means of TEM. Direct evidence for the dispersion of the O-zeolite in the final polymer composites can be obtained from TEM. The intercalated and flocculated trend of the zeolite in the PVC/zeolite nanocomposites was confirmed by TEM, as shown in Fig. 5. Figure 5 shows the TEM image of 5% O-zeolite/PVC, which demonstrates that the zeolite layers are structured in good order and are well, dispersed in the polymer matrix (Kim et al., 2003; Karayıldırım et al., β006ν Hoffman et al., 2000). The image confirms that the synthesized composite is a nanoscale material and no delamination of the O-zeolite layers took place during intercalation. 5. CONCLUSION The composite’s surface usually has different chemical and physical properties from both matrix and filler, probably due to changing surface roughness and chemical heterogeneity. It is important to understand the zeolite-filled polymer surfaces to control adhesion, wettability, and printability properties of these nanocomposites. In this study, O-zeolite/PVC composites were prepared by solution blending method using TCM as solvent. Solution blending is widely used in composite preparation. It is a simple way to obtain silicate/polymer composites if both the polymer and the nanoparticles are dissolved or dispersed in solution. The toxic solvent in the process could be recycled. In solution blending method, it is easy to control the concentrations of the polymer and inorganic components. In the present work, ultrasonication is applied to further improve the exfoliation of the O-zeolite. It is important to understand the zeolite-filled polymer surfaces to control adhesion, wettability, and printability properties of these composites. IGC is a very sensitive and reliable technique for distinguishing nanocomposite surfaces. IGC at infinite dilution was used to find how PVC/OZ would change the dispersive component of the composite. The experimental results indicate that γ S values of studied materials gradually decreased with increasing column temperature which is consistent with the fundamental concept of Gibbs free energy. d A combination of XRD, SEM and TEM studies showed that the nanocomposites obtained have a mixed nanomorphology. From SEM, TEM and XRD results, the PVC was intercalated and-flocculated into the zeolite layers, and had fine dispersion in the PVC matrix. HTAB-zeolite in the PVC/O-zeolite nanocomposite indicates that the zeolite was transformed into fine particles and dispersed homogeneously in the PVC matrix after polymerization. SEM, TEM and XRD analyses provided a high depth of focus to the morphology and the quite well dispersions are observed. This will provide the necessary flexibility for the potential applications of these new composites. ACKNOWLEDGEMENTS This study is the part of a project (2017-1426) supported by the Research Fund of Eskişehir Osmangazi University. REFERENCES Alexandre M, Dubois, P, 2000, Polymer-Layered Silicate Nanocomposites: Preparation, Properties and Uses of a New Class of Materials, Materials Science and Engineering R Reports, 28, 1-63. Annabi-Bergaya F, 2008, Layered clay minerals. Basic research and innovative composite applications. Microporous Mesoporous Material, 107:141–8. Balazs AC, Singh C, Zhulina E, Lyatskaya Y, 1999, Modeling the Phase Behavior of Polymer/Clay Nanocomposites, Accounts of Chemical Research, 32, 651-657. Cava D, Gavara R, Lagaron JM, 2007, Surface characterization of poly(lactic acid) and polycaprolactone by inverse gas chromatography. J. Chromatogr. A., 1148:86–91. Cordeiro N, Gouveia C, John MJ, 2011, Investigation of Surface Properties of Physico-Chemically Modified Natural Fibres Using Inverse Gas Chromatography, Industrial Crops and Products, 33, 108-115. Dietrich B, 2001, PVC -Origin, Growth, And Future, Journal of Vinyl & Additive Technologyvinyl And Addit. Technol., 7 (4 ), 168-176. Du J, Wang D, Wilkie CA, Wang J, 2003, An XPS investigation of thermal degradation and charring on poly(vinyl chloride)–clay nanocomposites, Journal Polymer Degradation and Stability, 79, 319-324. Giannelis EP, Krishnamoorti R, Manias E, 1999 Polymer-Silicate Nanocomposites: Model Systems for Confined Polymers and Polymer Brushes, Advances in Polymer Science, 138, 107-147. POSTER PRESENTATION 328 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Gilman JW, Jackson CL, Morgan AB, Harris, RH, Manias E, Giannelis EP, Wuthenow M, Hilton D, Phillips S, 2000, Flammability Properties of Polymer-Layered-Silicate Nanocomposites, Polypropylene and Polystyrene Nanocomposites. Chemistry of Materials, 12, 1866-1873. Hoffman B, Dietrich C, Thomann R, Friedrich C, Mülhaupt R, β000, Morphology and rheology of polystyrene nanocomposites based upon organoclay, Macromol Rapid Commun, 21(1):57–61. Karayıldırım T, Yanık J, Yuksel M, Sağlam M, Vasile C, Bockhorn H, β006, The effect of some fillers on PVC degradation, Journal of Analytical and Applied Pyrolysis, 75:112–119. Kim TH, Jang, LW, Lee DC, Choi HJ, Jhon MS, 2002, Synthesis and Rheology of Intercalated Polystyrene/Na+-Montmorillonite Nanocomposites, Macromolecular Rapid Communications, Macromol Rapid Commun, 23, 191-196. Kim TH, Lim ST, Lee CH, Choi HJ, Jhon MS, 2003, Preparation and rheological characterization of intercalated polystyrene/organophilic montmorillonite nanocomposite, Journal of Applied Polymer Science, 87, 2106-2112. Lazarevic S, Radovanovic Z, Veljovic Dj, Onjia A, Janackovic Dj, Petrovic R, 2009, Characterization of sepiolite by inverse gas chromatography at infinite and finite surface coverage. Applied Clay Science, 43, 41–48. Lavielle L, Schultz J, 1991, Surface properties of carbon fibers determined by inverse gas chromatography: role of pretreatment. Langmuir, 7:978–981. Matsushita Y, Wada S, Fukushima K, 2006, Surface characteristics of phenol–formaldehyde–lignin resin determined by contact angle measurement and inverse gas chromatography. Ind. Crop. Prod., 23:115– 121. Morgan AB, Harris JD, 2004, Exfoliated polystyrene–clay nanocomposites synthesized by solvent blending with sonication. Polymer, 45:8695–8703. Noh, MW, Lee, DC, 1999, Synthesis and characterization of PS-clay nanocomposite by emulsion polymerization, Polymer Bulletin (Berlin), 42, 619–626. Pan M, Shi X, Li X, Hu H, Zhang L, 2004, Morphology and properties of pvc/clay nanocomposites via in situ emulsion polymerization. Journal of Applied Polymer Science, 94:277–86. Pavia LB de, Morales AR, Díaz FRV. Organoclaysμ Properties, preparation and applications. Applied Clay Science, 2008;42:8–24. Pavlidou S, Papaspyrides CD, 2008, A review on polymer-layered silicate nanocom-posites. Progress Polymer Science, 33:1119–98. Price GJ, Ansari DM, 2003, An inverse gas chromatography study of calcination and surface modification of kaolinite clays. Phys. Chem. Chem. Phys., 5:5552–5557. Pourabas B, Raeesi V, 2005, Preparation of ABS/montmorillonite nanocomposite using a solvent/nonsolvent method., Polymer, 46, 5533-5540. Sajini V, Paul J, Mahanta N, Valiyaveettil S, 2011, Flexible conductive graphene/poly(vinyl chloride) composite thin films with high mechanical strength and thermal stability. Carbon. 49: 198–205. Sayyad Amin J, Ayatollahi SH, Alamdari A, 2009, Fractal characteristics of an asphaltene deposited heterogeneous surface. Applied Surface Science, 256:67–75. Thielmann F, 2004, Introduction into the characterisation of porous materials by inverse gas chromatography. J. Chromatogr. A., 1037:115–123. Trillica J, Kalendova A, Malac Z, Simonik J, 2001, in: Proc. of SPE ANTEC, Dallas, Texas, May 6– 10, p. 2162. Wan C, Qiao X, Zhang Y, Zhang YX, 2003, Effect of different clay treatment on morphology and mechanical properties of PVC-clay nanocomposites, Polymer Testing, 22, 446–453. Wang D, Parlow D, Yao Q, Wilkie CA, 2001, PVC-Clay Nanocomposites: Preparation, Thermal and Mechanical Properties, J. Vinyl and Addit. Technol., 7, 203-213. Wang D, Parlow D, Yao Q, Wilkie CA, 2002, Melt Blending Preparation of PVC-Sodium Clay Nanocomposites, J. Vinyl and Addit. Technol., 8, 139. Wang LJ, Su SP, Chen D, Wilkie CA, 2009, Variation of anions in layered double hydroxides: effects on dispersion and fire properties, Journal Polymer Degradation and Stability, 94, 770-781. Zhang J, Jiang DD, Wang D, Wilkie CA, 2006, Styrenic polymer nanocomposites based on an oligomerically-modified clay with high inorganic content, Polymer Degradation and Stability, 91, 26652674. POSTER PRESENTATION 329 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org ACKNOWLEDGEMENTS This work was funded by FRGS under vote USIM/FRGS-FST-32-51312. The authors would like to thank Faculty of Science and Technology, Universiti Sains Islam Malaysia for the facilities provided. REFERENCES Ariffin N. A., A. S. A. Khiar. 2015. Effect of BMITFSI to the Electrical Properties of Methylcellulose/ Chitosan/ NH4TF Based Polymer Electrolyte. Proc. of SPIE.9668. Buraidah, M. H., A. K. Arof. 2011. Characterization of Chitosan/PVA Blended Electrolyte Doped with NH4I. Journal of Non-Crystalline Solids, 357:3261-3266. Buraidah, M. H., L.P. Teo, S.R. Majid, A.K. Arof. 2009. Ionic Conductivity by Correlated Barrier Hopping of NH4I Doped Chitosan Solid Electrolyte. Physica B, 404:1373-1379. Hafiza, M. N., & Isa, M.I.N., Solid polymer electrolyte production from 2-hydroxyethyl cellulose: Effect of NH4NO3 composition on its structural properties. Carbohydrate Polymers http://dx.doi.org/10.1016/j.carbpol.2017.02.03. Hamdan K Z, A. S A Khiar. 2014. Conductivity and Dielectric Studies of Methylcellulose/ChitosanNH4CF3SO3 Polymer Electrolyte. Key Engineering Materials, 594-595: 818-822. Ibrahim S., S.M. Mohd Yasin, N.M. Nee, R. Ahmad, M.R. Johan. 2011. Conductivity and dielectric behaviour of PEO-based solid nanocomposite polymer electrolytes. Solid State Communications, doi:10.1016/j.ssc.2011.11.037. Kadir M. F. Z., L.P. Teo, S.R. Majid, A.K. Arof. 2009. Conductivity studies on plasticized PEO/chitosan proton conducting polymer electrolyte, Materials Research Innovations, 13:191-194. Kaith Balbir S., Reena Sharma, Susheel Kalia and Manpreet S. Bhatti. 2014 Response surface methodology and optimized synthesis of guar gum-based hydrogels with enhanced swelling capacity. Royal Society of Chemistry Advanced 4: 40339. Khiar, A.S.A., R.Puteh, A.K. Arof. 2006. Conductivity Studies of a Chitosan-Based Polymer Physica B. 373:23-27. Electrolyte. Nik Aziz N.A, N. K. Idris, & M. I. N. Isa. 2010. Solid polymer electrolytes based on methylcellulose: FTIR and ionic conductivity studies. International Journal of Polymer Analysis and Characterization, 15(5): 319-327. Pinotti A, M A Garcia, M N Martino, N E Zarithzky. 2007. Study on microstructure and physical properties of composite films based on chitosan and methylcellulose. Food Hydrocolloids, 21:66-72. Sahli N. and A. M. M. Ali. 2012. Effect of Lithium Triflate Salt Concentration in Methyl Cellulose based Solid Polymer Electrolytes. IEEE Colloquium on Humanities, Science & Engineering Research. Salleh N. S., Shujahadeen B. Aziz, Z. Aspanut, M. F. Z. Kadir. 2016 .Electrical impedance and conduction mechanism analysis of biopolymer electrolytes based on methyl cellulose doped with ammonium iodide.Ionics. DOI 10.1007/s11581-016-1731-0. Shanti, R. 2011. Invstigation on the Effects of Ionic Liquid and Ionic Mixture in Biodegradable Polymer Electrolytes. Master of Science Thesis. University Tunku Abdul Rahman. Shuhaimi N. E. A., L.P. Teo, S.R. Majid, A.K. Arof. 2010. Transport studies of NH 4NO3 doped methyl cellulose electrolyte. Synthetic Metals, 160: 1040–1044. Vincent C. A. 1987. Polymer Electrolytes. Progress in Solid State Chemistry, 17:145-261. POSTER PRESENTATION 330 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Cr(VI) removal from aqueous solutions using native and triethylenetetramine modified biomasses of Lentinus edodes: Isotherms and kinetics studies Ilhan Dorukhan Coker, Gulay Bayramoglu, Merve Oztekin*, M. Yakup Arica* Gazi University, Faculty of Science, Biochemical Processing and Biomaterial Research Laboratory, 06500 Teknikokullar Ankara, Turkey merve.oztekin2012@gazi.edu.tr; yakuparica@gmail.com Abstract Heavy metals such as lead, cadmium, arsenic, and chromium are continuously discharged into the environment, and these metals are stable and can survive for long time periods in the environment. Among them, chromium(VI) has high toxicity to living organisms. The potential use of the native and triethylenetetramine (TETA) modified biomasses of Lentinus edodes to remove Cr(VI) ions from aqueous solutions was studies in a batch system. Experimental parameters affecting the adsorption process such as pH, contact time, adsorbent dosage, ionic strength and temperature were studied. SEM, FTIR, and BET were used to assess the physical properties the adsorbents. The surface area of the native and TETA modified fungal biomass was found to be 18.6 and 14.3 m 2/g, respectively. The FTIR studies show that the functional groups involved for adsorption of Cr(VI) are -OH, -COO-, -NH2, C=O, -C-N, and S=O. The adsorption of Cr(VI) ions on the native and TETA modified adsorbents showed a highest value at around pH 2.0-3.0. The amount of adsorbed Cr(VI) on both native and modified biomasses of L. edodes (mg/g) was increased as the initial concentration of Cr(VI) ions increased in adsorption medium. Adsorption equilibrium was established in about 60 min. The determined maximum adsorption capacities of the native and modified biomasses were found to be 34.7 and 92.4 mg/g dry weight, respectively. The Langmuir, and Freundlich, isotherm models were applied to describe the adsorption of Cr(VI) onto native and modified L.edodes biomasses. According to the RL and n parameters of the studied isotherms, the Cr(VI) adsorption process was physical and desirable. The adsorption of Cr(VI) on these biomasses follows pseudo-second-order kinetics. The calculated thermodynamic parameters (ΔG°, ΔHº, and ΔS°) indicated that the adsorption of Cr(VI) onto native and modified fungal biomasses were feasible, spontaneous, and exothermic under given experimental conditions. Keywords: Fungal biomass, Modification, Adsorption, Cr(VI), Isotherms, Kinetics. 1. INTRODUCTION The toxic heavy metals like cadmium, lead, nickel, mercury and chromium can cause serious impact on the living organisms. The later and its compounds are widely used in plating, leather tanning, dye, cement, and photography industries producing large quantities of toxic pollutants (Foroutan et al., 2018). Like all transition metals, chromium can exist in the form of several oxidation states. Chromium (VI) can diffuse as CrO4−2 or HCrO4− through cell membranes and oxidize biological molecules resulting toxicity (Chen et al., 2006). The Cr(VI) species are approximately 100 times more toxic and 1000 times more mutagenic and cytotoxic than Cr(III). For removal of heavy metal ions like Cr(VI) from solutions, several methods have been proposed such as precipitation, ion exchange, reverse osmosis, electro-dialysis, coagulation, electrolysis, and adsorption. Among them, the adsorption method has been largely used for the removal of heavy metals from water and wastewater. This method, compared with other physical and chemical methods, is facile, low-cost, efficient, and easy-design (Arica and Bayramoglu, 2005). In the adsorption process a variety of adsorbent can be used, because the efficiency and effectiveness of the adsorption process is dependent on the nature and characteristics of the adsorbent. Therefore, the removal of Cr(VI) from wastewater before discharge is necessary and vital. In recent years, biomasses of bacteria, fungi, yeast, algae (Arica and Bayramoglu, 2005) have been used to remove heavy metals from aqueous solutions by adsorption. The use of these microbial biomasses for removal of toxic heavy metals from aqueous solution has emerged as an alternative to the existing methods as a result of the search for low cost, innovative methods. In case of adsorption, several chemical processes POSTER PRESENTATION 331 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org can be involved with the adsorptive sites of the microbial biomass surface including carboxyl, hydroxyl, sulfhydryl, amino and phosphate groups (Bayramoglu and Arica MY, 2008). Fungi are abundant in natural environments and important industrial processes. Their most important roles are as decomposers of organic macromolecules, with concomitant nutrient cycling as pathogens and symbiotic with animals and plants, and as spoilage organisms of natural and synthetic materials (Bayramoglu and Arica 2008a). Among the fungi species, the white rot fungi are highly specialized groups of organisms. They are Basidomycetes, which include all the higher fungi that are characterized by their sexual fruiting bodies. The fungi subspecies Lentinus edodes is a well-known white rot fungus whereas a little attention has been paid to the ability of its potential for the removal of mixed pollutants from environment. The fungus is an edible mushroom native to East Asia, which is cultivated and consumed in many Asian countries. It is considered a medicinal mushroom in some forms of traditional medicine. Triethylenetetramine (TETA) is a cationic molecule containing four amino groups on the linear molecular chain, can be a promising ligand for Cr(VI) removal. For this, the TETA ligand can be used for modification of adsorbents to increase the adsorption capacity and reusable. In this work, to remove Cr(VI) ions from an aqueous solution, the biomass of L. edodes a white rot fungus which chemically modified with TETA ligand. The polyamine TETA ligand was chosen as fungal biomass modifier as it can increase the adsorption capacity of adsorbent and increase the stability of the adsorbent material after glutaraldehyde cross-linking for ligand immobilization. To evaluate the adsorption process of Cr(VI) by the adsorbents, the effects of parameters such as initial pH, ionic strength, adsorbent dosage, temperature, initial Cr(VI) concentration, and contact time were evaluated. The kinetic of the adsorption process was studied by pseudo-first order and -second order kinetics models. To define the adsorption isotherm of Cr(VI) by native and modified biomasses, Langmuir, and Freundlich models were verified. Further, the thermodynamic parameters such as enthalpy (ΔHº), entropy (ΔSº), the Gibbs free energy (ΔGº), and the activation energy (Ea) were studied for determining the reaction mechanism of Cr(VI) adsorption. 2. MATERIALS AND METHODS 2.1 Microorganism and media Triethylenetetramine and glutaraldehyde (25% in water) was purchased from Sigma-Aldrich Chemical Co. Potassium dichromate (K2Cr2O7) and 1,5 diphenyl carbazide were obtained from Sigma-Aldrich. All of the other chemicals used in this study were of analytical grade and obtained from Merck AG. Pure culture of Lentinus edodes (MAFF 430012) was obtained from MAFF GENE BANK Culture Collection (Kannondai, Tsukuba, Ibaraki, Japan), and was maintained by subculturing on malt dextrose agar slants. The growth medium and growth conditions for white rot fungi were previously described elsewhere (Arica MY, Bayramoglu G 2005.). The cultivated fungus pellets of L. edodes were washed with sterile physiological saline solution several times to remove dirt particles. The resulting product was directly used as native fungal biomass. 2.2 Modification of fungal biomass In order to prepare TETA modified fungal biomass following procedure was applied. The L. edodes biomass was dried in a vacuum oven at 45 ºC until constant weight, and then the fungal biomass was used for activation with glutaraldehyde as reported earlier (Arica MY, Bayramoglu G 2005). After the reaction, the activated biomass with glutaraldehyde (about 5.0 g, dry weight) was transferred in a solution (200 mL, pH 10) containing TETA ligand (β.0 g), and the reaction was carried out at 50 ºC shaking for 6 h. After this period, the TETA modified fungal biomass was removed from the medium by simple filtration and washed with 1.0 M NaCl and purified water and then dried in the oven at 50 ºC under reduced pressure for 24 h. The leakage of the TETA from the fungal biomass was followed by incubating the fully wetted biomass preparation with 10 mL of HCl solution (10 mM) for 24 h at room temperature. The leakage experiment was carried out at room temperature while continuous stirring at 50 rpm. The TETA released in the liquid phase after this incubation was measured spectrophotometrically at 230 nm. 2.3 Adsorption studies A stock solution (1000 mg/L) of Cr(VI) was prepared from K 2Cr2O7. Experimental solutions of the desired concentration were obtained by further dilution. The batch adsorption experiments were undertaken in a series of Erlenmeyer flasks (100 mL). A predefined amount of fungal biomass (1.0-5.0 g) was placed into 1.0 POSTER PRESENTATION 332 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org L Cr(VI) solution at 400 mg/L initial concentration. The solution was rotated in an orbital shaker at 150 rpm for different time (5-1β0 min) at given temperature (15, β5, γ5 and 45 °C). The pH of solutions was adjusted between 2.0 and 10 using 1.0 mol/L NaOH or 1.0 mol/L HCl solutions. After adsorption period, the adsorbent was separated by filtration. The remaining Cr(VI) in the solutions were measured at 540 nm using a double-beam UV–vis spectrophotometer (Model T80+; PG Instrument Ltd., PRC) after complexation with 1,5 diphenyl carbazide. Before determination of the total quantity of chromium Cr(VI) in the adsorption medium, Cr(III) and Cr(II) were converted to Cr(VI) using KMnO 4. The amount of Cr(VI) adsorbed per unit mass of adsorbent (mg metal ions/g beads) and the percentage removal of chromium were calculated by using the determination data in described earlier (Arica MY, Bayramoglu G 2005). 2.4 Characterization of the adsorbents The surface morphology of the fungal biomasses was examined using scanning electron microscope (SEM/EDX) (JEOL, JMS 5600, Tokyo, Japan) after coating with thin layer gold under reduced pressure. The samples were scanned at a desired magnification to study the morphology of the native and modified fungal biomasses. To evaluate the degree of TETA incorporation on the modified fungal biomass was analyzed using the native biomass as a control system, it was subjected to elemental analysis using a Leco Elemental Analyzer (Model CHNS-932). The FTIR spectra of the native and modified fungal biomasses particles were obtained using a FTIR spectrophotometer (Shimadzu, FTIR 8000 Series, Japan). The specific surface areas of the native and modified fungal biomasses were determined by N 2 adsorption isotherm and application of the Brunauer–Emmer–Teller (BET) method. During the zeta potential measurement, 0.1 g of the samples was transferred in purified water (100 mL), and mixed for about 1.0 h. The solution pH was adjusted with either NaOH or HCl. The suspension of adsorbents was used to conduct potential measurement with a Zetasizer instrument (NanoZS, Malvern Instruments Ltd., Malvern, UK). The samples were dispersed in solutions and sonicated in a sonic water-bath for 10 min at room temperature. For each set of data, the arithmetic mean values and standard deviations were calculated and the margin of error for each data set was determined according to a confidence interval of 95% using the statistical package under Excel for Windows. A value of P < 0.05 was considered to be statistically significant. 2.5 Tables and Figures Table 2. Isotherm models constants and correlation coefficients for adsorption of Cr(VI) by the native and TETA modified fungal biomass. Experimental Langmuir Freundlich Biomass T qexp qm bx102 R2 RL* KF n R2 (K) (mg/g) (mg/g) (L/mg) Native 298 261.4 36.4 0.49 0.998 0.362 0.19 1.09 0.993 TETA modified 298 487.9 88.5 6.67 0.989 0.119 6.90 1.41 0.886 *Initial concentrations (C0) of Cr(VI) ions, 500 mg/L Figure 1. FTIR spectra of the native (A) and TETA modified (B) fungal biomasses. POSTER PRESENTATION 333 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 2. The adsorption capacities of the native and TETA modified fungal biomasses for Cr(VI) onto the native and TETA modified fungal biomasses (A); The effect of the ionic strength on Cr(VI) ions adsorption onto the native and TETA modified fungal biomasses (B). 2.3 Equations Two isotherm equations have been tested in the present study, namely Langmuir and Freundlich. The mathematical expression of Langmuir (Eq. 1), and Freundlich (Eq. 1) equations are: qe = qmCe / (b + C) (1) where qe is the amount of adsorbed metal ions at time t (mg/g), Ce is the equilibrium concentration (mg/L). qm (mg/g) and b (L/mg) are the maximum adsorption capacity and energy of adsorption, respectively. qe = KF (Ce)1/n (2) KF (mg/g) and n (g/L) are the equilibrium constants indicative of adsorption capacity and adsorption intensity. The separation factor called RL value, which is used to predict if an adsorption system is “favorable” or “unfavorable. It is by the following relationshipμ RL = (1/1 + bCe) (3) where RL and Ce are the dimensionless constant separation factor or equilibrium parameter and initial metal ions concentration, respectively. The value of RL indicates the shape of isotherm to be either unfavorable (RL > 1) or linear (RL = 1) or favorable (0 < RL < 1) or irreversible (RL = 0). The first-order rate equation of Lagergren is one of the most widely used for the sorption of solute from a liquid solution. It may be represented as follows: log (qe-qt) = logqe – (k1t/2.303 ) (4) where k1 is the rate constant of first-order adsorption (min−1) and qe and qt denote the amounts of adsorption at equilibrium and at time t (mg/g), respectively. In a true first-order process log qe should be equal to the intercept of a plot of log(qe −qt) against t. Ritchie proposed a second-order rate equation for the kinetic adsorption of gases on solids (Bayramoglu and Arıca, β008a). 1/qt=1/(k2 qe t) + 1/qe (5) where k2 (g/(mg min)) is the rate constant of the second-order adsorption. The rate constant (k2) and adsorption at equilibrium (qe) can be obtained from the intercept and slope, respectively, and there is no need to know any parameter beforehand. 3. RESULTS 3.1. Characterization of the native and modified fungal biomasses The mechanism of Cr(VI) ions adsorption by the native and TETA modified fungus biomass was explained using FT-IR, SEM and BET methods. The surface morphology of the native L. edodes biomass was studied by the scanning electron micrograph. As can be seen from SEM micrograph, the fungal biomasses have rough and porous surface. The porous surface structure of the fungal biomass should be considered as a POSTER PRESENTATION 334 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org factor providing an increase surface area. In addition, these pores reduce the mass transfer resistance and facilitate the diffusion of Cr(VI) ions because of high internal surface area with low diffusional resistance in the biomass. The native and modified fungal biomasses can have different functional groups where coordination complexes and/or ion exchange with metal ions can be formed. In order to confirm the presence of these functional groups such as amino (-NH2), carboxyl (-COO-), thiol (-SH), hydroxy (-OH) and phosphate (-PO42 ) on the native and modified fungal biomasses, the FT-IR spectra of both fungal biomasses were obtained. In general, the FT-IR spectra of the native, and TETA modified fungal biomasses have intense peaks at a frequency level of 3267 and 1548 cm−1 representing amino groups stretching vibrations. The strong peaks at around 1635, 1405 and 1238 cm−1 are caused by the C=O stretching band of carbonyl groups. The phosphate groups show some characteristic adsorption peaks around 1152 and 1025 cm −1 representing P=O and P–OH stretching, respectively. The band at around 598 cm −1 for the fungal biomasses C–N–C scissoring and it is only found in protein structure. After covalent attachment of TETA ligand via glutaraldehyde coupling reaction, the spectrum of the modified fungal biomass exhibits some changes. Four peaks were observed at 3450, and 3300 cm-1 due to the incorporation of TETA ligand. The peaks at 1665 and 1584 cm -1 are attributed to the -NH2 scissoring and C–C- stretching, respectively. These peaks show the involvement of amine, hydroxyl and carboxyl groups in the binding of Cr(VI) ions. In a comparison of the spectra of fungal biomass preparation with that contacted with Cr(VI) ions, some shift in peak position was observed. These changes were due to the binding of Cr(VI) ions with amino and hydroxyl groups of the fungal biomasses. The most remarkable difference in these spectra is at an intensity of 3450–3300 cm-1 representing amine and hydroxyl stretching, and the band at around 1655 cm -1 represents carbonyl (C-O) stretching (data not shown). The studies for the determination of the average particle size of the native and modified fungal biomass were realized by using a Zeta-Sizer instrument. The average particle size of the particles was β45 and 465 ηm, respectively. The BET surface area of the native and modified fungal biomass was calculated by the nitrogen adsorption/desorption isotherms. The pore size of the synthesized the native and modified fungal biomass was found to be 45 and 24 nm, respectively. The total surface area and total pore volume of the native fungal biomass were found to be 19.8 m2 g-1 and 2.1 cm3 g-1, and after modification with TETA, the apparent surface area and pore volume were significantly reduced to 12.4 m 2 g-1 and 1.33 cm3 g-1, respectively. The reduction in surface area and pore volume of TETA modified fungal biomass may be due to the presence of grafted TETA ligand in the vicinity of the pores near the surface of the fungal biomass. The total available surface amino group contents of the native and modified fungal biomasses were found to be 0.17 and 3.21 mmol g-1 dry fungal biomass. After TETA ligand attachment, the available amine group content of the fungal biomass increased about 18.9-folds compared to the native counterpart. To investigate the change of L. Edodes biomass surface charge before and after the TETA ligand attachment, the zeta potentials as a function of solution pH (i.e. between 2.0 and 11.0) were measured. As observed in the figure, the zeta potential values for the native and modified fungal biomasses decrease with increasing solution pH. The zero potential point value for the native algal biomass was found to be at around pH 4.5; on the other hand, the zero potential values for TETA modified algal biomass were observed at around pH 8.5. The positive charge density on the TETA modified fungal biomass surface significantly decreased with increasing medium pH due to the deprotonation of the amine groups on the ligand molecules. The charge density in this pH range changed from -26.4 to 5.7 mV for the native fungal biomass. On the other hand, for the TETA modified fungal biomass changed from -11.2 to 37.4 mV. Thus, the medium pH is an important parameter to control in the adsorption of Cr(VI) ions. 3.2. Effect of contact time and adsorbent concentration on adsorption The effect of contact time on the adsorption of Cr(VI) on the native and TETA modified fungal biomasses was studied and it was quick and, after 60 min, the complete adsorption equilibrium. The amount of Cr(VI) ion removal efficiency reached a maximum of 62%, and 97%, respectively. The effect of adsorbent dose on Cr(VI) removal efficiency as well as the adsorption capacity was determined. The Cr(VI) removal efficiency was increased from 45 to 97 % with increasing of the adsorbent dose from 1.0 to 5.0 g/L, while the adsorbent capacity declined from 180.0 to 77.6 mg/g. The elevation of removal efficiency with increasing of the adsorbent dose is a result of the number of available active sites on the adsorbent surface (Hassanpour et al., 2018). POSTER PRESENTATION 335 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3.3 Effect of pH and ionic strength There was maximum adsorption of Cr(VI) on the native and modified adsorbents at pH 2.0, but above this, Cr(VI) removal declined. At pH 2.0, protonation of amino groups on the native and modified fungal biomass increase the net positive charge and enhances the adsorption of negatively charged Cr(VI) anions by electrostatic binding (Bayramoglu and Arica 2009). The adsorbed amount of Cr(VI) ions decreased with increasing ionic strength. The Cr(VI) ions adsorption capacity of the native and modified fungal biomass decreased by about 49% and 58%, respectively, when the NaCl concentration in the adsorption medium was 1.0 mol/L. 3.4 Effect of initial Cr(VI) concentration on the adsorption capacity In order to investigate the effect of initial Cr(VI) concentration on the adsorption capacity of the native and modified fungal biomasses, this work was carried out in the initial Cr(VI) concentration range 10-500 mg/L at a pH of β.0 and a temperature of β5 °C. The adsorption capacity of both adsorbent increased with increase of initial Cr(VI) concentration, and the plateau values of the native and modified fungal biomasses were obtained at the Cr(VI) concentration of 400 mg/L, respectively. The maximum adsorption capacity of the native and modified fungal biomasses reached 261.4 and 487.9 mg/g, respectively. 4. DISCUSSION Removal of Cr(VI) anions by fungal based adsorbent has been found to vary as a function of pH of the solution. The Cr(VI) adsorption depends on protonation or un-protonation of various functional groups on the surface of the native and modified biomass. The protonation of certain functional groups of the tested adsorbents and the presence of hydronium ions around the binding sites can cause an enhanced attraction of Cr(VI) ions to adsorbents surface at this acidic pH. As the solution pH increases, the surface of the adsorbents becomes negatively charged due to functional groups, which repulse negatively charged chromate ions (HCrO4−, Cr2O7β−, and Cr4O13β−). The involvement of amino group in the adsorption of Cr(VI) ions also confirmed these adsorbents by the FTIR analysis as presented above. As the pH increased, the overall surface charge on the cell walls became negative, and adsorption decreased. Finally, the removal efficiency of all the tested adsorbents remained at a low level through the tested pH range; all subsequent adsorption experiments were conducted at pH 2.0, the optimum pH for adsorption of Cr(VI) ions on the tested adsorbents. The presence of other competing ions in the adsorption medium can reduce the adsorption efficiency of the adsorbent for the target metal ions. The Cr(VI) ions adsorption capacity of the native and modified fungal biomass decreased by about 49% and 58%, respectively, when NaCl concentration in the adsorption medium was 1.0 mol/L. The lower adsorption capacity at higher ionic strength may be explained by the competition between Cr(VI) ions and chloride ions (Cl -) for the same binding sites present on the adsorbent surface. This behavior indicated that the ion exchange could be responsible for the Cr(VI) removal process. Another way to explain it is that the adverse effect of ionic strength may change the activity coefficient of chromium on species and thus would limit their transfer to the adsorbent surface (Arica and Bayramoglu, 2005 ). Another effective parameter for evaluation of adsorption processes is equilibrium adsorption. The equilibrium adsorption is stated when the concentration of metal ions in the aqueous solution is in a dynamic equilibrium with the amount of metal ion connected to the adsorbent surface (Arica and Bayramoglu, 2008). With increase the initial chromium concentration from 10 to 500 mg/L, the adsorption capacity increased from 51.3 to 487.9 mg/g. The reduction of removal efficiency and the elevation of adsorption capacity with increasing the initial chromium concentration can be explained by the limitation of active sites available on the adsorbent surface and completion of all active sites, respectively (Arica and Bayramoglu, 2005). The Langmuir and Freundlich adsorption constants calculated from the corresponding isotherms with the correlation coefficients are presented above. The correlation coefficients show that the adsorption process could be described by the Langmuir equation. The Langmuir constant (qm) values were fit the experimental values. On the other hand, the magnitudes of KF and n show easy separation of Cr(VI) ions from aqueous medium and indicate favorable adsorption. The intercept KF value is an indication of the adsorption capacity of the adsorbent; the slope 1/n indicates the effect of concentration on the adsorption capacity and represent adsorption intensity (Mullick et al., 2018). All experimentally tested biosorbents, n values were found high enough for separation. POSTER PRESENTATION 336 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Comparing the equilibrium capacities (qeq) of the kinetic models “namely first and second order” with the experimental equilibrium capacities of the adsorbents, the calculated maximum capacities from second-order equation seems to describe best he experimental data (data not shown). 5. CONCLUSION To investigate the characteristics of the adsorbent, FTIR, SEM, and specific surface analysis were studied. The removal efficiency increased with increase in the initial Cr(VI) concentration. Pseudo-second order kinetic was well fitted with a higher correlation coefficient compared to other kinetic models. The adsorption capacity of TETA modified fungal biomass was found to be 487.9 mg/g. Hereby, considering the abundance and availability as well as based on the obtained results, it can be concluded that the modified L. edodes biomass can be used as an inexpensive, facile, and suitable sorbent for removing Cr(VI) ions from aqueous media. The proposed modified fungal biomass can be recycled and finally the used adsorbent can be disposed in a secure landfill. REFERENCES Arica MY, Bayramoglu G 2005. Cr(VI) biosorption from aqueous solutions using free and immobilized biomass of Lentinus sajor-caju: preparation and kinetic characterization Colloids and Surfaces A: Physicochemical. Engineering Aspects, 253:203–211. Bayramoglu G, Arica MY 2008. Adsorption of Cr(VI) onto PEI immobilized acrylate-based magnetic beads: Isotherms, kinetics and thermodynamics study. Chemical Engineering Journal, 139:20-28. Bayramoglu G, Arıca MY β008. Removal of heavy mercury(II), cadmium(II) and zinc(II) metal ions by live and heat inactivated Lentinus edodes pellets. Chemical Engineering Journal. 143:133–140. Foroutan R, Mohammadi R, Ramavandi B 2018. Treatment of chromium-laden aqueous solution using CaCl2-modified Sargassum oligocystum biomass: Characteristics, equilibrium, kinetic, and thermodynamic studies. Korean Journal Chemical Engineering 35:234-245. Gui-Qiu Chen, Guang-Ming Zeng, Xiang Tu, Cheng-Gang Niu,Guo-He Huang, Wen Jiang Application of a by-product of Lentinus edodes to the bioremediation of chromate contaminated water Journal of Hazardous Materials B135 (2006) 249–255 Hassanpour S, Taghizadeh M, Yamini Y 2018. Magnetic Cr(VI) ion imprinted polymer for the fast selective adsorption of Cr(VI) from aqueous solution Journal of Polymer Environment, 26:101–115. Mullick A, Moulik S, Bhattacharjee S 2018. Removal of hexavalent chromium from aqueous solutions by low-cost rice husk-based activated carbon: Kinetic and thermodynamic studies. Indian Chemical Engineering, 60:58-71. POSTER PRESENTATION 337 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Yenidoğan Hiperbilirubinemi Otizm Spektrum Bozukluğu ile İlişkili midir? Başak Özlem PERK1*, Naile Merve GÜVEN1, Benay CAN EKE1 *1 Ankara Üniversitesi, Eczacılık Fakültesi, Farmasötik Toksikoloji ABD, Ankara, Türkiye *perk@ankara.edu.tr Özet Yenidoğanların yaklaşık %50’sinde görülen hiperbilirubinemi, çoğunlukla reversible olmakla birlikte bazı durumlarda kan-beyin engelini geçebilecek yüksek düzeye ulaşabilmektedir. Bu durumda kısa veya uzun dönem devam eden akut/kronik bilirubin ensefalopatisi, bilirubinle indüklenen nörolojik disfonksiyon gibi nörogelişimsel yetersizliklere neden olabilmektedir. Nörodejeneratif bir rahatsızlık olan Otizm Spektrum Bozukluğu’nun (OSB) da yenidoğan hiperbilirubinemi ile ilişkili olduğu düşünülmektedir. Genetik yatkınlık ve çevresel faktörlerin OSB gelişimindeki rolünün yanı sıra hiperbilirubinemi düzeyi ile olan ilişkisinin belirlenmesi, hastalığın etiyolojisinin netleştirilmesinde önemli bir basamak olacaktır. Anahtar Kelimeler: Otizm, Yenidoğan Sarılığı, Hiperbilirubinemi Amerikalı çocuk psikiyatristi Leo Kanner, 1λ4γ yılında ‘yalnızlık için güçlü bir istek’ duyan ve ‘sürekli tekdüzelik üzerine takıntılı’ davranış sergileyen 11 çocuk ile yaptığı çalışmada ilk defa otizmi tanımlamıştır (Kanner, 1λ4γ). Kanner otizmin soğuk ve ilgisiz ebeveynlerin çocuk yetiştirme tarzından kaynaklandığını savunmuştur. Yıllar içerisinde bu sav çürütülmüş, otizmli çocukların kendilerini çevreden bilinçli olarak soyutladıkları inanışı hakim olmuştur. 1λ80’li yıllarda ise otizmin genetik ve nörobiyolojik bir bozukluk olduğu kabul edilmeye başlanmıştır (Petaş, β016). β01γ yılına kadar Amerikan Psikiyatri Derneği otizmi Yaygın Gelişimsel Bozukluklar çatısı altında değerlendirmiş, mayıs β01γ’te yayımladıkları Ruhsal Bozuklukların Tanısal ve Sayımsal Elkitabı, Beşinci Basımında (DSM-5) Otizm Spektrum Bozukluğu (OSB) tanısı kullanılacağını duyurmuştur (Özkaya, 2013). OSB’li çocuğu olan ailelerde OSB yıkıcı etkilere ve zorluklara kaynaklık etmektedir (Meral ve Cavkaytar, β014). Amerika’da bir OSB’li bireyin ömür boyu maliyeti 1.4- β.4 dolardır (Wu ve ark., 2016). Tedavisi henüz mümkün olmayan ve kesin nedeni bilinmeyen OSB’nin erken teşhis ve müdahale ile çocukların gelişim kaydetmeleri mümkün olmaktadır (Koçbeker ve Saban, β005). Bu kısa derlemedeν patogenezi genetik, immünolojik, çevresel ve enfeksiyöz ajanlar gibi pek çok nedenle açıklanmaya çalışılan OSB’nin Yenidoğan Hiperbilirubinemi ile ilişkisi değerlendirilmiştir (Esnafoğlu ve ark., 2017). OSBν tekrarlayan davranışlar, iletişim ve sosyal etkileşim bozukluklarıyla karakterize nörodejeneratif bir rahatsızlıktır (Amin ve ark., β011ν McElhanon ve ark., β014ν Rubenstein ve ark., β018). Sınırlı ve yineleyici ilgi, davranış ve etkinlikler ile sosyal etkileşim/iletişim eksiklikleri OSB’nin temel özelliklerinden olmasına rağmen bu probleme neden olan faktörler yeterince anlaşılabilmiş değildir (Özdemir ve ark., β017ν Özkaya, 2013). OSB risk faktörleri epidemiyolojik araştırmalarla aydınlatılmaya çalışılmıştır. Anne ve babanın yaşı, annenin gebelik öncesi ve/veya sırasında geçirdiği enfeksiyonlar, folik asit eksikliği, ilaç kullanımı gibi çevresel etkenler ile diyabet, preeklempsi gibi rahatsızlıklar ve erken doğum gibi pek çok faktörün OSB için risk teşkil edebileceği gösterilmiştir (Fernell ve ark., β015). Tek yumurta ikizlerinde her iki kardeşte OSB görülme olasılığı %60-90 iken tek yumurta ikizlerinde bu oran %0-10 olarak bulunmuştur. Bu bakımdan OSB’nin genetik kökenli olduğu gösterilmiş, ancak genetik yatkınlığın çevresel faktörler ile etkileşimi sonucu ortaya çıktığı saptanmıştır (Gardener ve ark., β011) (Şekil 1). POSTER PRESENTATION 338 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 1. Hallmayer ve ark.nın OSB’li ikizler üzerinde yaptıkları çalışmada otizm risk faktörleri oranı (Hallmayer ve ark., 2011) Nörobiyolojik bir sendrom olan OSB’nin etiyolojisinin anlaşılabilmesi için nöropatolojik mekanizmaları üzerine çeşitli çalışmalar yapılmıştır (Korkmaz, β010). OSB’li bebeklerde görülen en yaygın nöropatolojik bulgu çeşitli ajanlara maruziyetle oluşan serebellar hasar olduğu gösterilmiştir. Otopsilerden elde edilen bulgular OSB’li çocukların beyinlerinde serebellar displazi geliştiğini ortaya koymuştur. Ayrıca otistik çocuklarda serebellar displazi in vivo nörogörüntüleme çalışmaları ile de kanıtlanmıştır. Bu nedenle perinatal ve/veya postnatal dönemde serebellar hasara neden olan risk faktörleri OSB ile ilişkili olabileceği düşünülmüştür. Yapılan meta-analizlerle çevresel ve genetik faktörler dışlandığında serebellar hasara neden olabilen yenidoğan hiperbilirubineminin bireyde OSB oluşumuna zemin hazırlayabileceği gösterilmiştir (Amin ve ark., β011) (Şekil β). Yenidoğan Hiperbilirubinemi (YH) yaşamın ilk β haftası içerisinde görülen deri ve mukozada bilirubin birikmesiyle ortaya çıkan bir durumdur. Bilirubin hem katabolizması sonucu meydana gelmektedir. Hem hemoksijenaz enzimi ile biliverdine oksitlenir ve bu sırada karbonmonoksit ve Fe +3 açığa çıkar. Biliverdin de biliverdin redüktaz ile indirekt bilirubine dönüşür. Oluşan indirekt bilirubin dolaşımda albümine bağlanarak taşınır ve karaciğere getirilir. Karaciğerden safra aracılığıyla glukuronik asitle konjuge halde direkt bilirubin olarak duodenuma boşaltılır. Barsaklarda direkt bilirubini indirekt bilirubine çeviren mukozal betaglukuronidaz enzimi mevcuttur. Yenidoğanda bu enzim erişkinlerin aksine yüksek konsantrasyonlarda bulunur ve direkt bilirubini tekrar indirekt bilirubine dönüştürür. Barsaktan portal dolaşıma geçen bu indirekt bilirubin tekrar karaciğere gelir. Barsak lümeninde kalan diğer indirekt bilirubinler, bakteriler tarafından barsaklardan geri emilmeyen sterkobiline dönüştürülür. Yenidoğan barsağında yararlı bakterilerin yeterince kolonize olmaması nedeniyle bu dönüşüm gecikir ve dolaşımda indirekt bilirubin düzeyi artar. İndirekt bilirubin kan-beyin engelini aşar ve beyinde ganglionlar, globus pallidus, hipokampus, serebellum ve subtalamik çekirdeklerde birikerek geçici veya kalıcı nöronal hasarlara neden olabilir (Sivaslı β00λ, Brites 2012). POSTER PRESENTATION 339 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 1. Bilirubin metabolizması ve otizme neden olduğu düşünülen sarılığın patogenezine genel bir bakış (Amin ve ark., 2011). Bilirubinle indüklenen nörolojik disfonksiyon (BIND) ile OSB’nin benzer klinik özellikleri bulunmaktadır. Her iki rahatsızlıkta da davranış bozuklukları, nöromotor, konuşma ve dil anomalileri görülmektedir (Lozada ve ark., β015). Araştırmalar yüksek bilirubin düzeyinin OSB’nin karakteristik özelliği olan sosyal ve iletişim eksikliğine neden olabileceğini göstermektedir. YH ile OSB arasındaki ilişkiyi araştıran metaanaliz sonuçlarına göre hiperbilirubinemi OSB riskini %4γ arttırmaktadır (Wu ve ark., 2016). OSB ile YH arasındaki ilişkiyi araştıran pek az çalışma mevcuttur. Üstelik bu çalışmaların oldukça önemli kısıtlılıkları bulunmaktadır. Bu kısıtlılıklar arasında kontrol grubunun olmaması, OSB’li çocukların yenidoğan bilirubin düzeyleri hakkındaki bilgilerin sadece ebeveyn görüşmelerinden sağlanması ve küçük gruplarda (n<200) yapılan çalışmaların populasyonu yansıtmaması sayılabilir. Bunun yanısıra YH tedavisinde standart olarak kullanılan fototerapinin de DNA hasarına, sitokin seviyelerinde değişikliğe ve oksidatif stres artışına bağlı olarak OSB’nin tetiklenmiş olabileceğini gösteren çalışmalar mevcuttur (Wu ve ark., 2016). OSB’nin YH ile ilişkisinin kanıtlanması amacıyla yenidoğan kan bilirubin düzeyi ile buna bağlı yapılan tedavi şekilleri ve maternale ait faktörler göz önüne alınarak daha geniş populasyonlarda yapılacak çalışmalar OSB prevelansının azaltılmasına önemli katkı sağlayacaktır (Amin, 2011). Kaynaklar Amin SB, Smith T, Wang H 2011. Is Neonatal Jaundice Associated with Autism Spectrum Disorders: A Systematic Review. J Autism Dev Disord, 41: 1455-1463. Brites D 2012. The Evolving Landscape of Neurotoxicity by Unconjugated Bilirubin: Role of Glial Cells and Inflammation. Front Pharmacol., 3:88. POSTER PRESENTATION 340 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Esnafoğlu E, Demir EY, Çetinkol Y, Çalgın MK, Erdil A, Ertürk EY, Dağlı A β017. Otizmli çocuklarda Toxoplasma gondii antikorlarının seroprevalansı. Dusunen Adam The Journal of Psychiatry and Neurological Sciences, 30:309-315. Fernell E, Bejerot S, Westerlund J, Miniscalco C, Simila H, Eyles D, Gillberg C, Humble MB 2015. Autism spectrum disorder and low vitamin D at birth: a sibling control study. Molecular Autism, 6:3. Gardener H, Spiegelman D, Buka SL 2011. Perinatal and neonatal risk factors for autism: a comprehensive meta-analysis. Pediatrics, 128:2. Hallmayer J, Cleveland S, Torres A, Phillips J, Cohen B, Torigoe T, Miller J, Fedele A, Collins J, Smith K, Lotspeich L, Croen LA, Ozonoff S, Lajonchere C, Grether JK, Risch N 2011. Genetic heritability and shared environmental factors among twin pairs with autism. Archives of general psychiatry, 68(11), 10951102. İnce G β017. Otizm Spektrum Bozukluğu Olan Çocuğa Sahip Ebeveynlerin Spor İle İlgili Görüşleri. Ankara Üniversitesi Eğitim Bilimleri Fakültesi Özel Eğitim Dergisi, 18(1)μ 10λ-124. Kanner L 1943. Autistic disturbances of affective contact. The Nervous Child, 2: 217-250. Korkmaz B 2010. Otizmμ Klinik ve nörobiyolojik özellikleri, erken tanı, tedavi ve bazı güncel gelişmeler. Türk Ped Arş, 45μ 80. Yılμ γ7-44. Lozada LE, Nylund CM, Gorman GH, Hisle-Gorman E, Erdie-Lalena CR, Kuehn D 2015. Association of Autism Spectrum Disorders With Neonatal Hyperbilirubinemia. Global Pediatric Health,2: 1–5. McElhanon BO, McCracken C, Karpen S, Sharp WG 2014. Gastrointestinal Symptoms in Autism Spectrum Disorder: A Meta-analysis. Pediatrics, 133( 5). Meral BF, Cavkaytar A 2014. Otizmli Çocuk Ailelerinin Aile Yaşam Kalitesi Algıları. K. Ü. Kastamonu Eğitim Dergisi, βγ (γ), 1γ6γ-1380. Özdemir S, Selimoğlu ÖG, Töret G, Suna HE β017. Otizm Spektrum Bozukluğu Olan Çocuklar ve Normal Gelişim Gösteren Çocukların Statik ve Hareketli Materyallerde Yüz İşlemelerinin Karşılaştırılması. Ankara Üniversitesi Eğitim Bilimleri Fakültesi Özel Eğitim Dergisi, 18( β)μβ71-290. Özkaya B. T., Yaygın Gelişimsel Bozukluklardan Otizm Spektrum Bozukluğuna Geçişμ DSM-5’te Karşımıza Çıkacak Değişiklikler, Psikiyatride Güncel Yaklaşımlar-Current Approaches in Psychiatry 2013;5(2):127-139 Pektaş S., Otizm Spektrum Bozukluğu Tanısı Almış Çocuklarda Müzik Eğitiminin Önemi, sed, β016, Cilt 4, Sayı 1, Volume 4, Issue 1 Rubenstein E., Wiggins L.D., Schieve L.A., Bradley C., DiGuiseppi C., Moody E., Pandey J., Pretzel R.E., Howard A.G., Olshan A.F., Pence B.W., Daniels J., Associations between parental broader autism phenotype and child autism spectrum disorder phenotype in the Study to Explore Early Development, Autism. 2018 Sivaslı E β00λ. Yenidoğan Bebeklerde Uzamış Sarılık. Gaziantep Tıp Dergisi, 15(β)μ4λ-55. Wu YW, Kuzniewicz MW, Croen L, Walsh EM, McCulloch CE, Newman TB 2016. Risk of Autism Associated With Hyperbilirubinemia and Phototherapy. Pediatrics, 138(4). Koçbeker BN, Saban A β005. Otistik Bir Çocuğun Yabanci Dil Öğrenimine İlişkin Örnek Olay İncelemesi. Selçuk Üniversitesi Sosyal Bilimler Enstitüsü Dergisi, (14), 401-427. POSTER PRESENTATION 341 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Catalytic enzyme-reactor operated with immobilized-laccase for oxidative degradation of microorganic pollutants Gulay Bayramoglu1,2*, Meltem Yilmaz3* and M. Yakup Arica2 1 Gazi University, Biochemical Processing and Biomaterial Research Laboratory, Ankara, Turkey 2 Gazi University, Faculty of Science, Department of Chemistry, Ankara, Turkey 3 Gazi University, Polatlı Faculty of Sciences and Arts, Department of Biology, Ankara Turkey Corresponding author e-mail: g_bayramoglu@hotmail.com; meltemalev@gmail.com Abstract The uncontrolled discharge of micro-pollutant containing effluents is considered to be one of the biggest threats to the human health and natural environments. The presence of aryl groups in the hydrocarbon molecular structure makes it an environmentally persistent and mutagenic substance affecting a wide range of organisms (Majeau et al., 2010.). Currently, the removal methods of micro-pollutants are conventional physical and chemical treatment modes such as adsorption, photodegradation, ozonation, precipitation and electrochemical. Alternatively, enzyme mediated biodegradation of aromatic micropollutant by oxidoreductase enzymes such as laccase, lignin peroxidases and manganese peroxidases can involve in the catalytic reduction of synthetic organic pollutants with a low energy requirement, a wide range of pH, temperature and ionic strength. In the presented study, poly(styrene-co-divinylbenzene)-g-poly(cyclic carbonate-methacrylate), p(SDVB)-g-CCMA), microbeads were prepared as described previously. Laccase enzyme was covalently immobilized using cyclic carbonate groups of the beads. The immobilized enzyme was investigated for the degradation of the ί-skatole in a batch system. The degradation studies were realized in the presence and absence a laccase-mediator system. In the presence of acetosyringone mediator the immobilized laccase was actively removed skatole from the reaction medium compared to the mediator free system. This can be due to the presence of the relatively strong withdrawing electron groups such aryl, –NH, and CH3 in the chemical structure of skatole. The removal performance of the skatole by the immobilized laccase was increased from 0.28 to 1.33 mg/g enzyme-microbeads. Increasing the skatol concentration from 5 ppm to 50 ppm increased the removal efficiency and reached a plateau value at around 40 ppm skatole concentration. The pH value and temperatures during skatole degradation had not a significant effect on of the immobilized laccase, activity. This study showed that laccase-mediator systems could effectively enhance the degradation rate of skatole. Keywords: Biocatalytic microbeads; Laccase; Enzyme immobilization; Micro-pollutant. 1. INTRODUCTION Several methods have been proposed for removal of the organic pollutants from disposed wastes such as microbial and enzymatic degradation, adsorption, and chemical processes (Barrios-Estrada et al.,2018; Bayramoglu et al., 2018). For oxidative degradations of organic pollutants several oxidative enzymes have been used such as laccase, tyrosinase, manganese peroxidase, horseradish peroxidase etc. Among them, laccase can oxidase a wide spectrum of aromatic organic compounds in the presence of molecular oxygen (Celikbicak et al., 2014; Bayramoglu et al., 2010). An addition, the laccase based enzymatic reactions can be realized with the high concentrations of substrates with low energy requirements, a wide range of pH, temperature and ionic strength, which are considered as green chemistry approach via the reduction of molecular oxygen to water, and this process can be further extended and improved by the addition of redox mediators (Bayramoglu et al., 2018). The enzyme “laccase” is belonging to the multi-copper oxidases family commonly found in plants, insects, fungi and bacteria. The most known laccase producers are nearly all wood-rotting fungi, such as Trametes versicolor, Phanerochaete chrysosporium, and Bjerkandera adusta. Therefore, laccase has many possible applications, including textile effluent discoloration, and the detoxification of different xenobiotics (Karagoz et al., 2011; Fernandez-Fernandez et al., 2013). ί-skatole is a toxic pollutant produced by bacteria as a degradation product of the amino acid tryptophan. It occurs naturally in human feces and has an intense fecal odor. It is a toxic white crystalline organic compound. It causes a bad smelling around the summery home where sewer storage. The bad odor of skatole can be POSTER PRESENTATION 342 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org removed using immobilized laccase from the summery home sewer storage On the other hand, in low concentrations; skatole has a flowery smell and is found in several flowers and essential oils, including those of orange blossoms, and jasmine. Immobilization of enzymes and microorganism on insoluble support materials is accepted as useful approach for improvement of their reusability and stability. Various inorganic and organic support materials for immobilization of enzyme have been used such as polymeric microbeads, magnetic nano-particles, silica nanoparticles, zeolite/polymer etc. Whereas comb type polymer grafted support materials may be more effective matrixes for enzyme immobilization, because of having large surface areas and permitting large amount of enzyme attachment. An addition, the fixed enzyme on the fibrous polymer can be dispersed in the reaction medium likes a free enzyme. Therefore, immobilization of enzyme on fibrous polymer grafted support can provide high retained enzyme activity, high enzyme loading and fast enzymatic reaction kinetics compared with other supports. The fibrous polymer on the shell can be functionalized with different reactive groups, such as epoxy, hydroxyl, amine, thiol, carboxyl, chloride, bromide and cyclic carbonate (Rahmani et al 2015; Teerpatsakul et al., 2017; Zhang et al., 2014). Among them, the cyclic carbonate carrying support materials are the most suitable support materials for large scale enzyme immobilization. The immobilized laccases have been used in the several studies to remove aromatic organic pollutants from wastes. T. versicolor laccase was used for covalent immobilization via the cyclic carbonate coupling reaction on the [PS-co-DVB-g-P(CCMA)] microbeads. The cyclic carbonate group of the [PS-co-DVB-g-P(CCMA)] microbeads was used for covalent immobilization of laccase. The immobilized laccase was used for removal of two skatole in aqueous medium. The complete degradation time of the skatole was determined using UV–vis spectrophotometer. 2. MATERIALS AND METHODS 2.1 Materials Laccase (EC 1.10.3.2): (T. versicolor about 20 U/mg), syringaldazine, CuBr, bromoacetyl bromide, triethylamine, tetrahydrofuran, aqueous ammonia, ί-skatole, and - azobisizobutyronitrile (AIBN) were obtained from Sigma-Aldrich Chem. Co. The monomers, divinylbenzene (DVB), styrene (S) and glycidylmethacrylate (GMA)), were supplied from Sigma-Aldrich Co. All other chemicals were of analytical grade and supplied from Merck (Darmstadt, Germany) and all these chemicals were used as purchased. 2.2 Immobilization of laccase Polystyrene-divinyl benzene, PS-co-DVB, as the starting polymeric microbeads was synthesized by suspension polymerization using styrene and divinyl-benzene monomers as described in the previous work (Bayramoglu et al., 2018). The synthesized microbeads were dried and sieved, and the 210– 422 mm size fraction was used in further reactions. ATRP initiator sites, bromoacetyl groups were then tethered to the surface of the PS-co-DVB microspheres by acetoxy mercury method as reported previous (Bayramoglu et al., 2018). The P(GMA) grafted microbeads were dried in an oven for 24 h. Then, epoxy groups of the P(GMA) chains on the PS-co-DVB microbeads were converted into cyclic carbonate groups according to a procedure described in the literature (Bayramoglu et al., 2018). The immobilization of laccase using the cyclic groups of PS-co-DVB-g-P(CCMA) microbeads, was studied under different experimental conditions as described previously (Bayramoglu et al., 2018). The activity of free and immobilized laccase was determined spectroscopically by standard assay method of the Ride (1983) based on the increase in absorbance at 530 nm from the oxidation of syringaldazine. 2.3 Degradation studies of skatole Degradation of skatole was studied with the immobilized laccase on the [PS-co-DVB-g-P(CCMA)] microbeads in acetate buffer (50 mMν pH 5.0) at β5 °C with continuous stirring. Before the reaction initiation, skatole solutions were saturated with oxygen for 10 min. The amount of degraded skatole was determined by removing samples at different time intervals. The initial concentration of skatole was 5 ppm. Before and after enzymatic degradation, the spectra of skatole was obtained by UV–vis spectrophotometer, and the percentages of degradation of skatole were calculated. Under the same experimental conditions, the free enzyme was used as blank control system for skatole. The reaction mixture containing of skatole (50 ppm) in acetate buffer solution (pH 5.0, 50 mmol/L, 5.0 mL) or same buffer solution containing 50 mmol/L POSTER PRESENTATION 343 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org acetosyringone (as a mediator) was incubated with the free enzyme solution (0.2 mL) or laccase immobilized [PS-co-DVB-g-P(CCMA)] microbeads (0.2 g). The free and immobilized enzymes solutions containing skatole solutions were placed on an orbital shaker, and shaken 150 rpm, at β5 °C, and for 1β0 min. 2.2 Figures Figure 1. ί-skatole synthesis pathway Figure 2. SEM photos of the microbeads Figure 3. Covalent immobilization of laccase on cyclic carbonate group containing PS-coDVB-g-P(CCMA) microbeads POSTER PRESENTATION 344 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 1,5 60 1 40 0,5 20 Degradation (%) q (mg/g) Figure 4. ί-skatole degradation spectra with PS-co-DVB-g-P(CCMA) microbeads after 60 min incubation period. (Skatole concentration: 5 ppm; pH: 5,0; Enzyme-support: 50 mg; Solution volume: 5 mL) 0 0 0 10 20 30 40 50 60 Skatole concentration (ppm) Figure 5. Effect of ί-skatole concentration on the percent degradation and removal performance of the laccase immobilized on PS-co-DVB-g-P(CCMA) microbeads POSTER PRESENTATION 345 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 6. Effect of medium temperature on ί-skatole degradation (A); Effect of pH on skatole degradation (B) of immobilized laccase on PS-co-DVB-g-P(CCMA) microbeads 2.3 Equations ί-skatole, and their stock solutions were prepared at pH 5.0, and calibration curves were obtained using UV– vis spectrophotometer at maximum wavelengths 280 nm. The amount of skatole remaining in the solution before and after enzymatic treatment was calculated according to the following equation: Q = [(C0 - C) V]/m (1) where Q is the amount of skatole (mg/g); C0 and C are skatole concentration (mg/mL) in solution before and after enzymatic treatment, respectively; V is the solution volume (mL), and m indicates the amount of enzyme immobilized microbeads (g). As noted above, calibration curves were obtained using stock solution of skatole (solutions prepared from 5 to 50 ppm of skatole). 3. RESULTS and DISCUSSION 3.1. Characterization of the PS-co-DVB microbeads The PS-co-DVB microbeads with a size distribution of 210– 422 mm and a specific surface area of 32.4 m2/g were used for immobilization of laccase. The surface of PS-co-DVB was grafted with polymer chains of P(GMA) via SI-ATRP. Firstly, the surface of the PS-co-DVB microbeads modified with acetoxy mercury groups followed by reaction with bromoacetyl bromide. The attached bromo-acetyl group was used as the SI-ATRP initiating point. The P(GMA) grafting efficiency was found to be about 168% on the surface of the PS-co-DVB microspheres when the polymerization time was 6.0 h. It was found to be 173% for 12.0 h polymerization time (Bayramoglu et al., 2018). This comb type pGMA grafted polymer was modified in to cyclic carbonate groups and then used for the covalent immobilization of laccase. Finally, the microbeads were well characterized by using FTIR, BET, SEM and analytical methods and presented in the previous work (Bayramoglu et al., 2018). 3.2 Degradation studies of skatole Degradation of ί-skatole was investigated by the immobilized laccase on the cyclic carbonate groups carrying microspheres. The degradation rates of skatole by the free and immobilized laccase preparations were followed by taking samples at different time intervals and analysed as described above. As a control the heat-treated immobilized laccase did not show any decomposition of skatole, but in the presence of active POSTER PRESENTATION 346 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org immobilized laccase, significant changes observed in the UV–vis absorbance spectra of skatole. ί-skatole showed two major absorbance peaks at 210 and 280 nm. After 120 min incubation period, approximately 61% of the spectra areas decreased after degradation of skatole with the immobilized enzyme compared to initial spectrum. 3.3 Effect of initial skatole concentration on the degradation efficiency of immobilized laccase The effect of initial ί-skatole concentration on degradation rate was studied using the laccase immobilized PS-DVB-g-pGMA-SC microbeads. The initial skatole concentration was varied between 5 and 50 ppm. The variation in the starting skatole concentration resulted in a reduction in the percent removal efficiency from 49.8 to 28, 3, respectively. It should be noted that the removal performance of the immobilized laccase for the model substrate increased from 0.28 to 1.33 mg/g enzyme immobilized microbeads. Increasing the skatole concentration from 5 ppm to 50 ppm increased the removal capacity and reached a plateau value at around 40 ppm skatole concentration. 3.4 Effect of temperature and pH on skatole degradation by immobilized laccase The degradation rates of ί-skatole in the presence of a mediator compound with the laccase immobilized on the [PS-co-DVB-g-P(CCMA)] microbeads were studied at different pH and temperature. The degradation rate of the laccase immobilized on the [PS-co-DVB-g-P(CCMA)] microbeads for skatole was highly efficient in the presence of a mediator compared with the mediator-free system (data not shown). When the enzyme-immobilized [PS-co-DVB-g-P(CCMA)] microbeads were used for scatole degradation in a batch system, it was observed that more than 45% removal could be achieved after the first 2.0 h and it was determined that the skatole degradation was not highly dependent on the medium pH. It should be stated that the skatole degradation percentage did not change with increasing temperature using laccase immobilized [PS-co-DVB-g-P(CCMA)] microbeads. 3.2 Degradation studies of β-skatole For large scale applications, the advantage of immobilized enzyme over its free counterpart is its capacity to be reused in the operation. Therefore, the reusability of the immobilized enzyme should be determined. In the presented work, the activity of the immobilized laccase was stable over 10 repeated uses for ί-skatole degradation. After four cycles, the relative activity of immobilized laccase was 96%. After ten repeated uses, the retained activity of the immobilized enzyme was found to be 63%. The immobilized enzyme gradually lost its activity with increased use. Such loss in activity could be attributed to the natural lost its activity, conformational changes, and denaturation of enzyme. 5. CONCLUSION The comb type p(GMA) grafted PS-co-DVB microbeads were prepared via SI-ATRP method, and the epoxy groups of the grafted pGMA converted in to cyclic carbonate group under CO 2 atmosphere. The immobilized laccase was proved to be an effective enzyme in degradation of ί-skatole compared to the free enzyme. For example, in the presence of acetosyringone mediator, the free and immobilized laccase degraded about 45% scatole within 1β0 min at β5 °C. Thus, the presented work provides a promising way for large scale production of reactive microbeads, which, are good candidate as supports for enzyme immobilization. The immobilized laccase can be used as a reusable reactive enzyme support for various micro-pollutant degradation. ACKNOWLEDGEMENTS This work was supported by a project grant number 113Z427 from The Scientific and Technological Research Council of Turkey. POSTER PRESENTATION 347 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org REFERENCES Barrios-Estrada C, Rostro-Alanis M.J, Munoz-Gutierrez BD, Iqbal HMN, Kannan S, Parra-Saldivar R 2018. Emergent contaminants: Endocrine disruptors and their laccase-assisted degradation– A review. Science of the Total Environment, 612:1516–1531. Bayramoglu G, Karagoz B, Arica MY 2018. Cyclic-carbonate functionalized polymer brushes on polymeric microspheres: Immobilized laccase for degradation of endocrine disturbing compounds. Journal of Industrial and Engineering Chemistry, 60:407–417. Bayramoglu G, Yilmaz M, Arica MY 2010. Reversible immobilization of laccase to poly(4-vinylpyridine) grafted and Cu(II) chelated magnetic beads: Biodegradation of reactive dyes. Bioresource Technology, 101:6615–6621. Celikbicak O, Bayramoglu G, Yılmaz M, Ersoy G, Bicak N, Salih B, Arica MY β014. Immobilization of laccase on hairy polymer grafted zeolite particles: Degradation of a model dye and product analysis with MALDI–ToF-MS. Microporous and Mesoporous Materials, 199:57–65. Fernandez-Fernandez M, Sanroman MA, Moldes D 2013. Recent developments and applications of immobilized laccase. Biotechnology Advances, 31:1808–1825. Karagoz B, Bayramoglu G, Altintas B, Bicak N, Arica MY 2011. Amine functional monodisperse microbeads via precipitation polymerization of N-vinyl formamide: Immobilized laccase for benzidine based dyes degradation. Bioresource Technology, 102:6783–6790. Majeau JA, Brar SK, Tyagi RD 2010. Laccases for removal of recalcitrant and emerging pollutants. Bioresource Technology 101: 2331–2350. Rahmani K, Faramarzi MA, Mahvi AH, Gholami M, Esrafili A, Forootanfar H, Farzadkia M 2015. Elimination and detoxification of sulfathiazole and sulfamethoxazole assisted by laccase immobilized on porous silica beads. International Biodeterioration & Biodegradation, 97:107-114. Ride JP, 1983. Cell walls and other structural barriers in defence. In: Callow, J.A. (Ed.), Biochemical Plant Pathology. John Wiley and Sons, New York, pp. 215– 236. Teerapatsakul C, Parra R, Keshavarz T, Chitradon L 2017. Repeated batch for dye degradation in an airlift bioreactor by laccase entrapped in copper alginate. International Biodeterioration & Biodegradation, 120 52-57. Zhang X, Pan B, Wu B, Zhang W, Lu L 2014. A new polymer-based laccase for decolorization of AO7: Long-term storage and mediator reuse. Bioresource Technology, 164:248–253. POSTER PRESENTATION 348 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Characterization of some food legumes' water-soluble proteins Bouakkadia Hayette 1*, Chentouh Mouhamed Mounir2, Boutebba Aissa2 1 2 Department of Biology, Badji Mokhtar University, Faculty of sciences, Annaba, Algeria. Department of Biochemistry, Badji Mokhtar University, Faculty of sciences, Annaba, Algeria. e- mail: hayett_biotech@yahoo.fr Abstract 1 Water-soluble proteins fraction of peanut, soybean, sesame and lens seeds are characterized. The Kjedahl method is used to determine the proteins content. The characterization of the physicochemical properties of the proteins is carried out using the electrophoretic migration of proteins in One-dimensional SDS-polyacrylamide gel and the isoelectric focusing under native conditions. The total protein level of peanut, soybean, sesame and lens are 45.50%, 25.37%, 20.65% and 23.86 % respectively. Electrophoresis and isoelectric focusing, two techniques for protein analysis, revealed a number of protein fractions of varying intensity, relative molecular masses (Mr) and isoelectric points (pI). The seed proteins of these legumes are of low molecular weight. As for pI, for peanut, soy and lentil, they are acidic. For sesame they varied from acidic to basic. 2 Key words: Food legumes, water-soluble proteins, one-dimensional electrophoresis, isoelectric focusing 1. INTRODUCTION Food legumes are grown for human and animal consumption. They are particularly rich in starch and have low lipid content. They are characterized by high protein content. They contain globulins and albumins. Globulins are the dominant proteins and constitute 50 to 90% of the seed's proteins. Albumin is a watersoluble protein. It is distinguished albumines 2S, 11S and rarely 7S. Protein content is one of the main criteria for the quality of these foods. Legumes such as peanut, soy, sesame, green pea, chickpea, lupine, bean, bean, etc. are consumed worldwide and constitute a substantial part of protein intake. The peanut Arachis hypogaea is an herbaceous legume native to Brazil belonging to the papilionaceae subfamily (Guerin et al., 1995). The peanut seed contains 23-27% protein (Souci, 1994). Peanut proteins are thermostable (Dubuisson et al., 2002). 10% of the proteins are of albumin type and the remaining 90% contain two major globulins, arachine and conarachine as well as minor components such as lectins and oleosins (Guéant et al., 1λλ5). Soybean, an annual legume, native to China is widely used around the world because of its nutritional quality (Cucu et al., 2012). The protein content of this seed varies between 30% and 50%. The proteins extracted by solubilization in alkaline medium and then purified by pH-precipitation at 4.5 are richer in sulfur amino acids than those of other legumes. They represent 90% of globulins and 10% of albumins (Patricia, 2008). Sesame, Sesamum indicum L or Oriental Sesamum L, belongs to the Pedaliaceae family (Agne et al., 2003). It is probably the oldest oilseed crop grown by humans (Johnson et al. 1979). It is native to India. Today, it is exploited in many countries (Wolff et al., 2003). Its protein content is 22 to 25%. The amino acid composition is unique and rare because of its high sulfur content. It contains methionine and cysteine. Its lysine content is low (Johansson and Bennich 1λ67, Orruño and Morgan β007). The levels of albumin, globulin, prolamins and glutelins are successively 8.9%, 67.3%, 1.3% and 6.9% (Rivas et al., 1981). They have a pI between 4.9 and 6.4 (Fremont et al., 2002). Lens Culinaris is an annual herbaceous legume belonging to the Papilionaceae family. It is Mediterranean specie. It is also grown in Algeria (Baba Aissa, 2000). It is one of the important sources of vegetable protein and has a protein content of 21 to 31% (Urbano et al., 2007, Joshi et al., 2011). The amino acid composition is characterized by a high content of lysine, arginine, glutamine, aspartic acid and leucine. It is characterized by low levels of methionine, cysteine and tryptophan (Swason, 1990). The lentil reserve proteins are mainly globulins (Osborne et al, 1898, Joshi et al., 2011, Joshi et al., 2012). Legume proteins are studied, but little work is done on the proteins of the water-soluble fraction. It is in this context that our work devoted to the caractirization of the water-soluble proteins of certain food legumes by electrophorisis and Isoelectric focusing. POSTER PRESENTATION 349 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2. MATRIALS AND METHODS a. Preparation and delipidation of samples: The peanut, soybean, sesame and lentil seeds studied are purchased from the local market. Using a mill (Analytical Mill 11A, Ika, USA) each legumes seeds are ground finely. 50g of the flours of arachis, soya, sesame defatted at hot with hexane using soxhlet extractor for 8, 12, 16 hour. Same quantity the flour of lens defatted with acetone for 1 hour at 4°C until they are used. b. Determination of protein levels : The total protein level is determined by multiplying the nitrogen content by the coefficient 6.25 according to the Kjeldhal nitrogen determination method (A.O.A.C., Official Methods of Analysis, 1984). c. Water-solubles protein extraction: 2g of flour are suspended in 15 ml of distilled water. After stirring for 20 hours at room temperature and centrifugation at 18000 g at 4 ° C for β0 min, the separated supernatant is stored at -β0 ° C. The pellet is subjected to 4 successive extractions during 2h. The optical density (OD) of each extract is measured at = 280 n.m using a spectrophotometer (UV-Visible) to record the extraction of all the proteins. 3.3. One-dimensional electrophorisis (1-DE) and Isoelectric focusing (IEF) : Protein extracts are diluted 1/γ0 and 1/β70. 1 µl of each protein solution and 1µl of the mixture of control protein macromolecules is used. Monodimensional electrophoresis of proteins is carried out under denaturing conditions on Gradient 8-18% polyacrylamide gel [ExcelGelTM SDS GE Healthcare]. Molecular weights markers cover a range of Mr ranging from 14.4 kDa to 97 kDa are used as reference. The revelation of the electrophoretic bands is obtained by staining with blue of comassie R.250 or with a silver nitrate solution. The bleaching is done overnight with a solution composed of 30% ethanol and 10% acetic acid. The IEF separation performed in native condition on a flat bed electrophoretic chambre, Multiphor G.E Helthcare (repsale Sweden) in a polyacrylamide gel 4% hydrated in a solution containing urea 4M, 2% to 5% thiourea and 125ml of ampholytes. Isoelectric point (pI) standards from 4,25 to 9,6 are used as references. The migration is conducted at a voltage of 53V and at a current intensity of 4 mA for 4 hours at 18 ° C (Bouakkadia et al,β015). 3. RESULTS AND DISCUSSION Figure 1, shows the total protein levels of the delipidated flours of the legumes studied. The total protein contents of soybean, peanut, sesame and lentil flours are respectively 45.50%, 25.37%, 20.65% and 23.86%. These results are comparable to those obtained by (Souci, 1994, Johnson et al., 1979, Urbano et al., 2007, Joshi et al., 2011). They go down from the richest soybean to peanut and sesame, and then to the lentil. The analysis of the electrophoretic diagrams of the total proteins of delipidated flours obtained by onedimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of the 1/10 and 1/30 diluted protein extracts revealed distinct fractions for peanut, soy and sesame (Figure 2). POSTER PRESENTATION 350 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 50 45 40 35 30 25 Seri 1 20 15 10 5 0 Peanut Soybean Sesame Lentil Figure 2 : Total protein levels of Peanut, Soybean, Sesame and Lentil flours Figure 3 : Electrophoretic Diagrams of protein extracts diluted 1/10 and 1/30, with proteins markers, stained by comassie blue R-250 1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers. Compared to the lentil protein extract, band detection required 1/270 dilution and staining with silver nitrate solution (Figure 3). The molecular weights of the highlighted peanut, soybean, sesame and lentil protein macromolecules are successively located between 14 and 67 kDa, 14 and 50 kDa, 14 and 76 kDa and 14 and 43 kDa respectively. POSTER PRESENTATION 351 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 4. Electrophoretic Diagrams of protein extracts diluted 1/270 with proteins markers, stained by silver nitrate 1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers. The analysis of the water-soluble protein diagrams of the delipidated flours of these products, for the protein extracts diluted 1/10 , strips for sesame, soybean and peanut are detected of 14 at 30. kDa, 14 at 67 kDa and 14 at 67 kDa respectively. The fractions are well resolved. They are of different intensities compared to the results obtained with the sample concerning the water-soluble proteins undiluted. Regarding the lens, according to the profile made with the undiluted protein extract, it is localized 3 electrophoretic bands of Mr ranging from 14 kDa to 30 kDa (Figure 4). Figure 5. Electrophoretic Diagrams of water-soluble protein extracts not diluted and diluted 1/10, with proteins markers, stained by comassie bleu R-250 1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers. POSTER PRESENTATION 352 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3 According to the isoelectric focusing diagrams (Figure 5) the extracts of the water-soluble proteins diluted 1/10 revealed with a silver nitrate solution, distinct fractions of pHi located between 4.25 and 6.5 in the soybean lentil and peanut are visualized. Protein macromolecules with pHi between 4.25 and 9.6 are found in sesame. The exploration of the water-soluble fraction by sodium dodecyl sulfate polyacrylamide gel electrophoresis and isoelectric focusing under native conditions revealed a number of protein fractions of varying intensity, Mr and pI. the seed proteins of these legumes have low molecular weight. As for pI, for peanut, soybean and lentil, they are acidic. For sesame they varied from acidic to basic. Figure 6. isoelectric focusing diagrams of water-soluble protein extracts with pI markers, stained by silver nitrate 1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers. 4 Conclusion: Legumes (Fabaceae family) such as peanut, soybean, sesame and lentil are consumed worldwide and constitute a substantial part of the protein intake. The total protein levels of peanut, soy, Sesame and lentil are 45.50%, 25.37%, 20.65% and 23.86% respectively. The water-soluble protein entities detected by electrophoresis (1-D) and IEF are characterized by low relative molecular weights ranging from 14-94 kDa. The pI of the determined proteins differs from one food to another. For soy, peanut and lentil, they are acidic from 4.25 to 6.5. For sesame they vary from acid to basic (4.25 to 9.6). Acknowledgement Authors express sincere thanks to Pascal Poncet and Hélène Sénéchal (Institut Pasteur, Paris, France, Laboratoire de Biochimie, Equipe de Recherche “Allergie & Environnement”, Hôpital Armand Trousseau, Paris, France) for the assistance in electrophoresis analysis. REFERENCES Agne PSE, Rancé F, Bidat, E β00γ. Allergie au sésame. Revue française d’allergologie et d’immunologie clinique, 4γ : 507–516. Baba Aissa F 2000. Encyclopédie des plante utilesμ Flore d’Algérie et du Maghreb, substances végétales d’Afrique d’Orient et d’Occident. Ed. Librairie Moderne Rouiba, Edas.Alger, 368 pp. POSTER PRESENTATION 353 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Bouakkadia H, Boutebba A, Haddad I, Vinh J, Guilloux l, Sutra JP, Sénéchal H,Poncet P β015. Analyse immunoprotéomique des allergènes non-hydrosolubles de farines de quatre légumineuses μ arachide, soja, sésame et lentille. Ann Biol Clin β015 ν 7γ (6) μ 6λ0-704 Cucu T, De Meulenaer B, Devreese B 2012. MALDI based identification of soybean protein markers – Possible analytical targets for allergen detection in processed foods.Peptides; 33 :187–196. Dubuisson C, La Vieille, S,Martin A 2002 .Allergies alimentaires :Etat des lieux et propositions d’orientations. Nutrition humaine. Paris (FR) : AFSSA, 104 pp. Guéant JL, Moutété F, Olszewski A, Pons L, Gastin I, Moneret-Vautrin DA 1995. Allergie à l'arachide et à l'huile d'arachide. Rev. ft. Allergol ; 35 : 312-319. Guerin B, Guerin L 1995.L'arachide.L'une des principales sources d'allergénes alimentaires. Rev. fr. Allergol ; 35 : 39-43. Fremont S, Zitouni N, Kanny G, Veneri V, Metche M, Moneret-Vautrin DA, Nicolas JP 2002. Allergenicity of some isoforms of white sesame proteins. Clin.Exper.Allergy. 32:1211-1215. Joshi M, Adhikari B, Aldred P, Panozzo JF, Kasapis S, Barrow CJ 2012. Interfacial and emulsifying properties of lentil protein isolate. Food Chemistry;134:1343–1353. Joshi M, Adhikari B, Aldred P, Panozzo JF, Kasapis S 2011.Physicochemical and functional properties of lentil protein isolates prepared by different drying methods. Food Chemistry;129:1513–1522. Johansson SG, Bennich H 1967.Immunological studies of an atypical (myeloma) immunoglobulin. Immunology.13:381-394. Johnson LA, Suleiman TM, Lusas EW 1979. Sesame protein: a review and prospectus. Journal of the American Oil Chemists Society ; 56 :463–468. Patricia F 2008 .Influence de procédés industriels sur l'allergénicitédes aliments. Thèse de doctoratμ Biologie cellulaire et Nutrition. Nancyμ Université Henti Poincaré-Nancy I,157 pp. Orruño E, Morgan MR 2007. Purification and characterisation of the 7S globulin storage protein from sesame (Sesamum indicumL). Food Chemistry; 100: 926–934. Osborne TB, Campbell GF 1898. Proteins of lentils. Journal of the American Chemical Society. 20- 362. Rivas NR, Dench JE, Caygill JC 1981. Nitrogen extractability of sesame (Sesamum indicumL.) seed and the preparation of two protein isolates. Journal of the Science of Food and Agricultur. 32:565–571. Souci S W 1994. Food composition and nutrition table. Medpharm Scientific publications Ref Type: Journal (Full). Swason BG 1990. Pea and lentil protein extraction and functionality. Journal. American.Oil Chemists.Society; 67:276-280. Urbano G, Porres JM, Frias J, Vidal-Valverde C 2007. Lentil: An ancient crop for modern times. Nutritional value. In S. S. Yadav, D. L. McNeil, & P. C. Stevenson (Eds.).47–93. Wolff N, Cogan U, Admon A, Dalal I, Katz Y, Hodos N, and al 2003. Allergy to sesame in humans is associated primarily with IgE antibody to a 14 kDa 2S albumin precursor. Food and Chemical Toxicology. 41: 1165–1174. POSTER PRESENTATION 354 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Surface Properties of Perlite and Perlite/ Polystyrene Composite by Inverse Gas Chromatography Ceyda Bilgiç1, Özge Kanık2, Naile Karakehya3 Eskişehir Osmangazi University, Engineering and Architecture Faculty, Department of Chemical Engineering, , β6480 Eskişehir, Turkey 3 Eskişehir Osmangazi University, Environmental Control and Protection Programme, Eskişehir Vocational School, β6480 Eskişehir,Turkey Corresponding author e-mail: ozgedgnknk@gmail.com, ceydabilgic@gmail.com 1,2 Abstract Polystyrene (PS) is a commercialized and mass productive polymer and PS/clay nanocomposites may have wide applications. Polystyrene (PS) /Perlite composite was prepared using the solution blending method with the application of ultrasound and using chloroform as solvent. Ultrasonic waves were used to enhance the nanoscale dispersion of the perlite. Polymer nanocomposite of a PS matrix containing 2% perlite (P) by mass was investigated using inverse gas chromatography (IGC). IGC was applied to characterize the surface of P/PS composite. The dispersive component of the surface energy (  Sd ), and the acid/base character of composite surface were estimated by using the retention time of different non-polar and polar probes at infinite dilution region. The specific free energy of adsorption ( G sp ), the specific enthalpy of adsorption ( H sp ), and the specific entropy of adsorption ( S sp ) of polar probes on PS/P were determined. G sp were correlated with the donor and acceptor numbers of the probes to quantify the acidic K A and the basic KD parameters of the P/PS surface. The values obtained for the parameters KA and KD indicated a basic character for perlite surface and the values obtained for the parameters KA and KD indicated a basic character for P/PS surface. Keywords: Polystyrene (PS); perlite; nanocomposites; inverse gas chromatography 1. INTRODUCTION Perlite is a glassy volcanic rock, commonly light gray, with a rhyolitic composition and 2 to 5% combined water. Chemically, perlite ore consists of SiO 2, Al2O3, and lesser amounts of several metal oxides (sodium, potassium, iron, calcium, and magnesium). It contains 70-75% SiO2 which chemically inert in many environments and hence are excellent filter aids and fillers in various processes and materials. Perlite is basically the mineral obsidian. Perlite mineral deposits exist in many countries of the world, but the expanded product is only available in countries which have commercial expanding plants. The production of perlite around the world is that in descending order of production, Turkey, Greece, and The United States, 41%, 26%, %18, respectively. When looked around the world, the reserve of perlite is more in Turkey. The amount of perlite reserve is considerably higher than the world; show us that it can contribute substantially to the economy of Turkey. World perlite reserves are estimated to be around 8 billion tons and 5.7 billion tons of it exist in Turkey corresponding to more than about 70% of the world reserves (Saad et al., 2010, Bolen, 2011). Polystyrene (PS) is one the most widely used plastics due to its superior thermal and electrical properties, low moisture absorption, being easy to produce, formability, and high stiffness and roughness. PS is preferred in many fields, such as the automotive industry, electronics, food packaging, domestic appliances, and toys due to its low cost (Fu et al., 2008) In recent years, clay/PS nanocomposites have received much attention in both academia and in industry (Akbari and Tehrani, 2014). Zhong et al., 2005 synthesized exfoliated organo-montmorillonite (OMt)/PS nanocomposites via in situ free radical bulk polymerization and found that OMt/PS nanocomposites exhibit a higher decomposition temperature, higher dynamic modulus, stronger shear-thinning behavior, and a smaller die swell ratio compared with pure PS. Remili et al., 2011 studied the effect of repeated extrusion cycles on the structure and properties of Cloisite 15A (commercial OMt modified by dimethyl dihydrogenated tallow)/PS nanocomposite. Fu et al., 2008 synthesized layered silicate/PS nanocomposites from three new organically modified clays using the emulsion polymerization method. Morgan and Harris, 2004 investigated solvent blending, which is facilitated by high-power POSTER PRESENTATION 355 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org sonication to prepare an exfoliated clay/PS nanocomposite. They reported that the clay type and energy of mixing play a key role in clay exfoliation when using solvent blending. Yang et al., 2014 and Zhao and Samulski, 2006 used supercritical carbon dioxide to improve clay dispersion in OMt/PS nanocomposites. Zhang et al., 2003 investigated the effects of reactive intercalating agents with different lengths of alkyl chains on the morphology and properties of clay/PS nanocomposites obtained by in situ bulk polymerization initiated via γ-ray irradiation. Noh and Lee, 1999 reported X-ray diffraction (XRD) pattern, infrared spectra, and differential scanning calorimetry, and thermogravimetric analysis thermograms, and mechanical properties of Na+-Mt/PS nanocomposites prepared by emulsion polymerization. To understand the characteristics and composition of the solid surface, the surface characterization tools are required. Many techniques such as, X-ray photoelectron spectroscopy (XPS), zeta potential measurements, microcalorimetry, titration, contact angle and inverse gas chromatography (IGC) have been used to obtain detailed information on solid surfaces. IGC has frequently been applied for surface characterization of solids, in particular, for their thermodynamic behavior, surface energy and their Lewis acidic–basic character. Knowledge of the surface free energy at a given temperature and surface enthalpy of a solid has recently allowed significant progress in the fields of adsorption, wettability, catalysis, friction, and adhesion. The surface energy can be obtained by, liquid adsorption measurements, flow microcalorimetry or contact angle measurements, but these methods are not easily and widely applicable and are difficult to use for finely powder solids. IGC method is based on the study of physical adsorption of appropriate molecular probes by means of chromatographic (dynamic) experiments. In contrast to static methods, dynamic systems utilize a flowing gas system. The most common flow methods are IGC, gravimetric instruments, and permeability measurement systems. The principle of dynamic gravimetric systems is the measurement of the amount of solute adsorbed from a flowing gas stream using a microbalance. In comparison to static sorption equipment, the main benefits of the dynamic sorption technique are shorter measurement time and a wider range of experimental possibilities. Compared to other techniques (static measurements), IGC has attracted a lot of attention because of its simplicity and the rich information provided (Mohammadi-Jam and Waters, 2014). In the present work, polymer nanocomposites of a Polystyrene (PS) matrix containing 2% perlite (P) by mass were prepared using the solution blending method with sonication. Composites prepared via solvent solution blending method, by mixing PS and perlite in chloroform. Inverse gas chromatography (IGC) method at infinite dilution is applied for dispersive component of the surface free energy (  Sd ) and the acid/base character of perlite and PS nanocomposites containing 2 wt. % P. The specific free energy of adsorption ( G sp ), the specific enthalpy of adsorption ( H sp ), and the specific entropy of adsorption ( S sp ) of polar probes on composite were determined. G sp were correlated with the donor and modified acceptor numbers of the probes to quantify the acidic K A and the basic KD parameters of the composite surface. The values obtained for the parameters K A and KD indicated a basic character for perlite surface. The values obtained for the parameters K A and KD indicated a basic character for P/PS surface. 2. MATERIALS AND METHODS 2.1. Materials PS with a low molecular weight was provided by Sigma-Aldrich (MW=280,000 by GPC). The perlite sample were obtained from Cumaovası Processing Plants Perlite of Etibank (İzmir, Turkey). Because it was received as it was taken out of the ground, without having been processed, it contained many impurities. In order to purify it and also increase its content, a decantation process was applied. Following this process, the perlite had been dried in an oven at 90 oC and it was ground. For the IGC analysis, the polar probes used were heptane, octane, nonane and decane. The polar probes used were tetrahydrofuran (THF), acetone (AC), diethyleter (DEE), trichloromethane (TCM), and ethyl acetate (Et.Ac.). All of these chemicals were analytical reagent grade and used without further purification. Properties were taken from literature of the probes (Cordeiro et al., 2011). These probes are commonly used for solid surface characterizations by IGC method. The chromatographic experiments were performed with Agilent 7890 gas chromatography equipped with a flame ionization detector (FID). Nitrogen with high purity was used as the carrier gas with a flow rate of 40 ml min-1. IGC measurements were carried out in the temperature range of 60–λ0 °C for perlite and in the temperature range of 40–70 °C for P/ PS. About γ g of sample particles of 150- POSTER PRESENTATION 356 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org β00 µm was filled into the stainless steel column (2.00 m long, 5.35 mm I.D.) via the aid of vacuum. Stainless steel column washed with methanol and acetone before packing with powders. The adsorbents were conditioned at the highest temperatures in the nitrogen gas flow for 4 h before the measurements. Methane is used for determining the dead volume. At least four determinations were used in averaging the net retention volume (VN). 2.2. Preparation of composite PS/P composite were prepared by the solution blending method. The perlite was dissolved in chloroform and the solution was magnetically stirred until all the perlite appeared to be completely dispersed at 50 °C. After stirring, the mixture was placed in an ultrasonic bath for sonication at room temperature, for 1 h. PS was dissolved in chloroform at room temperature. Perlite solution was added slowly to PS solution and then it was stirred until the solution became homogeneous. PS/P mixture was placed in an ultrasonic bath, for 20 min. After sonication it was poured in glass moulds and chloroform was then evaporated which was performed by two consecutive stepsμ air drying for 1β h, and in an oven at 60 °C, for γ h. Finally, samples were cryo-milled using a Retsch cryogenic jar mill. The samples were labelled to describe the amount of P and PS2 mean, perlite and PS contained 2 wt.% of perlite, respectively. 2.3 IGC theory Inverse gas chromatography (IGC) is a derivation of conventional gas chromatography. However, unlike analytical chromatography, the material being investigated is the solid in the gas chromatography column. The retention volume of the mobile phase (probe) indicates the interaction between the probe and the surface of the material in the column (Cordeiro et al., 2011; Santos et al., 2002; Matsushita et al., 2006). IGC provides an excellent method to measure the surface energy of rough and porous powders (Hole et al., 2006). The surface energy is the result of the unbalanced molecular forces at the surface of the solid. It can be considered to be formed by two different contributions: dispersive and specific. The retention time of a series of homologous n-alkanes is used to determine the dispersive component of the surface free energy ( γ dS ) of P /PS. In IGC literature, γ dS is commonly determined from the following equation, which was introduced by Lavielle and Schultz, 1991: RTLnVN  2 N .( Sd )1/ 2 .a.( Ld )1/ 2  C (2.1) Here, R is the gas constant, T is the absolute column temperature, a is the molecular surface area coated with a kind of adsorbed alkane, N is the Avogadro’s number,  Ld is the dispersive component of the surface free energy of the probe, C is a constant, and VN is the net retention volume of the n-alkane probe. The net retention volume (VN) is calculated using the equation below (Thielmann, 2004): 2 T 3   Pi Po  -1  (2.2) VN =Fo    t A -t 0  To 2   Pi Po 3 -1  Here, tA is the retention time of the probe, while t0 is the retention time of the probe which has no interaction with the solid in the column (marker). Pi and Po are, respectively, the inlet and outlet pressures of the carrier gas, while the T/To ratio is used in order to get the value of the flow rate at the column temperature (T) from the measurement of the flow rate at ambient temperature (To). The flow rate of the carrier gas which is measured at the column outlet and at ambient temperature is expressed as Fo. According to the following equation, specific components of the adsorption enthalpy ( H sp ) and entropy ( S sp ) can be determined from G sp 's relationship with the temperature: G sp H sp  S sp  T T (2.3) A plot of G sp / T versus 1/T should yield a straight line with slope H sp and intercept S sp . The acidic– basic parameters can be obtained from the calculated H sp values using the following equation ( Lazarevic et al., 2009) The values of KA and KD were calculated using Equation (2.4): POSTER PRESENTATION 357 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org  H sp DN  KA  KD  AN AN  (2.4) Here, ΔHsp is the specific component of the adsorption enthalpy and the KA and KD parameters define acid and base constants of the analyzed surface, respectively, AN* shows the acceptor number of the adsorbed probe while DN shows the donor number. The KA and KD values can be calculated with the aid of probes which have acidic, basic, and amphoteric properties. According to the above equation, representing the (ΔHsp/AN*) versus (DN/AN*), one gets KA as the slope and KD as the intercept. Finally, KD/KA is known as SC. According to the values obtained from these parameters, it is accepted that SC ≤ 0.λ means the surface is acidic, SC ≥ 1.1 means basic, and if it is between 0.9 and 1.1, the surface is amphoteric (Cava et al., 2007). 3. RESULTS and DISCUSSION IGC experiments can be conducted under two chromatographic conditions: infinite dilution and finite concentration. Infinite dilution, also called zero surface coverage, was found to be suitable for evaluating the surface energy and heat of sorption of particulates. Infinite dilution refers to very low concentrations of probe and is obtained by introducing a very small quantity of the probe molecule into the system. Since the amount of probe molecule or adsorbate is limited, it is assumed that interactions occur only with the highenergy sites on the surface and therefore interactions with the lower energy sites are negligible. This mode has the benefit of high sensitivity, which makes it an excellent method for determining thermodynamic parameters and most of the IGC experiments are carried out under this condition. In ideal conditions, no probe-probe interactions are considered and Henry’s Law is obeyed. Hence, a linear adsorption isotherm and a symmetrical (Gaussian) chromatographic peak are expected (Thielmann, 2004). A chromatographic diagram of symmetrical peaks for interaction of alkanes with the stationary phase is generated. The measured parameter in this method is net retention time and it has been successfully used to determine the dispersive components of surface free energy, acid-base properties of surfaces. The basic value in IGC is the net retention volume. The net retention volume is the volume of carrier gas required to elute a given probe. The net retention volume (VN) is calculated using the following equation: The adsorption runs were performed at infinite dilution conditions. The chromatographic peaks of n-alkanes on P/PS were symmetrical. So retention time is independent of the amount of injected. The value of γ dS represents the interaction of the surface with n-alkanes and hence is a measure of how easily the surface can d polarize the probe. The dispersive component of the surface free energy,  S , was determined by injection of a homologous series of n-alkanes having between 7 and 10 carbon atoms. One of the most commonly measured parameters for the description of the energy situation on the surface of a solid is the surface energy. The surface energy can affect, e.g. catalytic activity or the strength of particle-particle interaction. The dispersive components of perlite and P/PS at experimental temperatures were calculated from Eq. (2.1). Plotting RTlnVN against a. Ld  1/ 2 yields a straight line with the slope of γ S , which can be seen for perlite d and P/PS in Figure 1 and Figure 2. Table 1 shows the dispersive component of the surface free energy, γ dS , of perlite and 2% P/PS. The γ dS values of PS0 ranged from 40 mJ m−2 at 40 °C to 35.3 mJ m−2 at 70 °C. A comprehensive insight into the Lewis acid-base surface interactions provides a better understanding of the influence of the catalytic and sorption capabilities of P/PS, as well as their ability to change via chemical modifications, which is of great importance for their applications. The application of the Schultz’s method to sp our experimental results, gave us the value of G sp , H and S sp . The variation of free energy of specific interactions, G sp , perlite and polar probes for different temperatures is given Table 2. The variation of free energy of specific interactions, G sp , P/PS and polar probes for different temperatures is sp given Table 3. The average  G values of polar probes on P/PS in the following order: Acetone < Et. Ac< THF< TCM < DEE. The values of K A and K D were calculated using Eq. (2.4). Representing  H sp / AN  versus DN / AN  , one gets K A as the slope and K D as the intercept (Fig. 3 and Fig. 4). The values of K A and K D for P/PS found to be 0.049 and 0.528 with the correlation coefficient of 0.8803. The overall acid-base character of POSTER PRESENTATION 358 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org perlite can be evaluated from K D / K A ratio. According to the values obtained for of K A and K D , the surface of exhibits basic character with the ratio of K D / K A = 10.78 . From the values obtained for KA and KD (Table 4), the surfaces of perlite, PS0 and PS2 are shown to be a basic character (KD > KA). Table 1. Values of dispersive component of the surface energy measured on Perlite, PS and 2%P/PS PS5 at various temperatures d Dispersive component of the surface free energy, γ S (mJ/m2) Sampl e a 40 ºC 50 ºC 60 ºC 70 ºC Perlite 40_ºC _ 34.21 30.89 PS0a 33.71 30.78 27.78 25.09 PS2 40 37.75 40.13 35.29 Bilgiç and Karakehya, β016 10 RTlnVN 8 6 y = 0,069x - 15,91 R² = 0,λλλ y = 0,066x - 15,91 R² = 0,λλλ (a) y = 0,063x - 15,72 R² = 0,λλ8 y = 0,060x - 15,59 R² = 0,λλ7 70 ºC 60 ºC 50 ºC 40 ºC 4 2 0 170 220   RTlnVN Figure 1. The RT ln(VN ) – a.  Ld 16 14 12 10 8 6 4 2 0 a( 1/ 2 270 320 370 d 0.5 2 0.5 -1 L ) (Å mJ m ) graphs for Perlite (a) y = 0,069x - 15,91 R² = 0,λλλ y = 0,063x - 15,72 R² = 0,λλ8 y = 0,066x - 15,91 R² = 0,λλλ y = 0,060x - 15,59 R² = 0,λλ7 70 ºC 60 ºC 50 ºC 40 ºC 170 220   Figure 2. The RT ln(VN ) – a.  L d 1/ 2 POSTER PRESENTATION a( 270 320 370 d 0.5 2 0.5 -1 L ) (Å mJ m ) graphs for 2% P/PS 359 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Table 2. The variation of ΔGsp with temperature, and ΔHsp and ΔSsp values of polar probes on Perlite -Gsp (kJ mol-1) -H sp -Ssp103 Adsorbent Polar probes 60 oC 70 oC 80 oC 90 oC (kJ mol-1) (kJ mol-1K-1) Perlite TCM 0.58 0.52 0.47 0.40 2.58 5.99 DEE 10.50 10.50 10.43 10.38 12.01 4.48 Acetone 12.46 12.53 12.57 12.52 11.64 2.52 THF 11.18 11.18 11.18 11.14 11.51 0.99 Et. Ac 11.04 11.00 11.06 10.97 11.54 1.49 Table 3. The variation of ΔGsp with temperature, and ΔHsp and ΔSsp values of polar probes on P /PS -Gsp (kJ mol-1) -H sp -Ssp103 Adsorbent Polar probes 40 oC 50 oC 60 oC 70 oC (kJ mol-1) (kJ mol-1K-1) PS-2% TCM 10.69 10.81 11.43 11.28 3.13 24.16 DEE 8.25 8.19 8.66 8.09 8.16 0.44 Acetone 14.44 14.34 15.08 14.39 12.34 6.78 THF 11.52 11.37 12.13 11.96 4.98 4.98 Et. Ac 12.57 12.24 13.16 12.18 13.1 1.70 6,0 y = 0,1327x + 0,2108 R² = 0,λλ85 DHsp/AN* 5,0 4,0 3,0 2,0 1,0 0,0 0 10 20 30 40 50 DN/AN* Figure 3. Plots of ΔHsp/AN*versus (DN/AN *) for Perlite POSTER PRESENTATION 360 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 6,0 DHsp/AN* 5,0 4,0 3,0 y = 0,049x + 0,5283 R² = 0,880γ 2,0 1,0 0,0 0 10 20 30 40 50 DN/AN* Figure 4. Plots of ΔHsp/AN*versus (DN/AN *) for P/PS Table 4. Acid and base interaction constants of the Perlite, PS and P/PS Sample KA KD SC=KD/KA Perlite 0.133 0.175 1.318 PS0a 0.131 0.528 4.025 PS2 0.049 0.528 10.775 a Bilgiç and Karakehya, β016 5. CONCLUSION IGC as an independent field of study has certainly proven beneficial to many industries. Despite a long history and several hundred publications in the last 50 years, it is still evolving and considered a modern technique that is quite attractive to chemical engineers, analytical chemists and material scientists in various fields. Results of a large quantity of research experiments on a wide range of materials have evidenced that IGC is successfully applied to characterizing different surface and bulk properties of solids in different shapes and morphologies. One of the greatest advantages of this method is that no special sample preparation is required. In fact, IGC requires the minimum sample preparation when compared to other surface energy analysing techniques. Therefore, various forms of solids and even semi-solids can be characterized quickly and efficiently. The composite’s surface usually has different chemical and physical properties from both matrix and filler, probably due to changing surface roughness and chemical heterogeneity. It is important to understand the perlite-filled polymer surfaces to control adhesion, wettability, and printability properties of these composites. In this study, perlite/PS nanocomposites were prepared by solution blending method using chloroform as solvent. Solution blending is widely used in nanocomposite preparation. It is a simple way to obtain for polymer composites if both the polymer and the nanoparticles are dissolved or dispersed in solution. In solution blending method, it is easy to control the concentrations of the polymer and inorganic components and ultrasonication is applied to further improve the exfoliation of the perlite. It is important to understand the perlite-filled polymer surfaces to control adhesion, wettability, and printability properties of these composites. IGC is a very sensitive and reliable technique for distinguishing nanocomposite surfaces. IGC at infinite dilution was used to find how perlite and perlite/PS would change the dispersive component POSTER PRESENTATION 361 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org of the surface free energy and surface acidity (KA) and basicity (KD) of the composite. The experimental results indicate that γ S values of studied materials gradually decreased with increasing column temperature which is consistent with the fundamental concept of Gibbs free energy. The overall acid-base character of perlite and P/PS can be evaluated from K D / K A ratio. According to the values obtained for of K A and K D , the surface of exhibits basic character. d ACKNOWLEDGEMENTS This study is the part of a project (2017-1426) supported by the Research Fund of Eskişehir Osmangazi University. REFERENCES Akbari A, Tehrani MA, 2014, Cherghibidsorkhi H Polysterene layered silicate nanocomposites. In: Pandey JK, Reddy KR, Mohanty AK, et al., editors. Handbook of polymernanocomposites. Processing, performance and application. Berlin Heidelberg: Springer; p. 205–221. Bilgic C, Karakehya N, 2016, Inverse gas chromatographic characterization of polystyrene and organo-montmorillonite/polystyrene nanocomposites, Journal of Adhesion Science and Technology, 30: 18, 1945-1956. Bolen P W, 2011. USGS Mineral Commodity Summaries 2011, U.S. Department of the Interior, U.S. Geological Survey, Reston, Virginia-USA. Cava D, Gavara R, Lagaron JM, 2007, Surface characterization of poly(lactic acid) and polycaprolactone by inverse gas chromatography. Journal of Chromatography A., 1148:86–91. Cordeiro N, Gouveia C, John MJ, 2011, Investigation of Surface Properties of Physico-Chemically Modified Natural Fibres Using Inverse Gas Chromatography, Industrial Crops and Products, 33, 108-115. Fu X, Ding M, Tang C, 2008, Toughening of recycled polystyrene used for TV backset. Journal of Applied Polymer Science, 109:3725–3732. Fu H-K, Huang C-F, Huang J-M, 2008, Studies on thermal properties of PS nanocomposites for the effect of intercalated agent with side groups. Polymer. 49:1305–1311. Hole BB, Keller DS, Burry WM, 2011, Surface energetics of bone mineral and synthetic hydroxyapatite using inverse gas chromatography. J. Chromatogr. B., 2011, 879:1847–1850. Kim KY, Lim HY, Park SM, Lee SJ, 2003, Synthesis and characterization of high impact polystyrene/organically modified layered silicate nanocomposites, Polymer-Korea, 27:377. Lavielle L, Schultz J, 1991, Surface properties of carbon fibers determined by inverse gas chromatography: role of pretreatment. Langmuir, 7:978–981. Lazarevic S, Radovanovic Z, Veljovic Dj, Onjia A, Janackovic Dj, Petrovic R, 2009, Characterization of sepiolite by inverse gas chromatography at infinite and finite surface coverage. Applied Clay Science, 43, 41–48. Matsushita Y, Wada S, Fukushima K, 2006, Surface characteristics of phenol–formaldehyde–lignin resin determined by contact angle measurement and inverse gas chromatography. Ind. Crop. Prod., 23:115– 121. Mohammadi-Jam S, Waters KE, 2014. Inverse gas chromatography applications: a review, Advanced Colloid Interface, 212, 21–44. Morgan AB, Harris JD., 2004, Exfoliated polystyrene–clay nanocomposites synthesized by solvent blending with sonication. Polymer. 45:8695–8703. Noh MW, Lee DC, 1999, Synthesis and characterization of PS-clay nanocomposite by emulsion polymerization, Polymer Bulletin, Polym Bull (Berlin), 42:619–626. Price GJ, Ansari DM, 2003, An inverse gas chromatography study of calcination and surface modification of kaolinite clays. Phys. Chem. Chem. Phys., 5:5552–5557. Remili C, Kaci M, Benhamida A, 2011. The effects of reprocessing cycles on the structure and properties of polystyrene/Cloisite15A nanocomposites. Polymer Degradation and Stability. 96:1489–1496. Saad Z, Al-Mashaikie AK, Al-Hawbanie AM. 2010. Petrography and geochemical study of the perlite rocks from Bait Al-Qeyarie, Kawlan Area, Yemen. JAKU: Earth Sci 21:195–217. POSTER PRESENTATION 362 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Santos, JMRCA, Fagelman K, Guthrie JT, 2002, Characterization of the surface Lewis acid–base properties of poly(butyleneterephthalate) by inverse gas chromatography. Journal of Chromatography A., 969(1-2), 111-118. Sohn, JI, Lee CH, Lim ST, Kim TH, Choi HJ, John MS, 2003, Viscoelasticity and Relaxation Characteristics Of Polystyrene/Clay Nanocomposite, Journal Of Materıals Science, J Mater Sci, γ8, 184λ1852. Thielmann F, 2004, Introduction into the characterisation of porous materials by inverse gas chromatography. Journal of Chromatography A., 1037:115–123. Yang F, Manitiu M, Kriegel R, 2014, Structure, permeability, and rheology of supercritical CO 2 dispersed polystyrene–clay nanocomposites. Polymer. 55:3915–3924. Zhang WA, Chen DZ, Xu HY, 2003. Influence of four different types of organophilic clay on the morphology and thermal properties of polystyrene/clay nanocomposites prepared by using the γ-ray irradiation technique. European Polymer Journal. 39:2323–2328. Zhao Q, Samulski ET.,2006, A comparative study of poly(methyl methacrylate) and polystyrene/clay nanocomposites prepared in supercritical carbon dioxide. Polymer. 47:663–671. Zhu J, Morgan AB, Lamelas FJ, Wilkie CA, 2001, Fire properties of polystyrene− clay nanocomposites, Chemistry of Materials, 13, 3774-3780. Zhong Y, Zhu Z, Wang S-Q., 2005, Synthesis and rheological properties of polystyrene/layered silicate nanocomposite. Polymer. 46:3006–3013. POSTER PRESENTATION 363 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Production and Characterization of Functionalized Carbon Nanotube-Loaded Polyvinyl Alcohol Membranes for Desalination Beyzanur Yılman1*, Filiz Uğur Nigiz1, Ayşe Aytaç1,2, Nilüfer Durmaz Hilmioğlu1 *1 2 Kocaeli University, Faculty of Engineering, Chemical Engineering, Kocaeli, Turkey Polymer Science and Technology Programme, Kocaeli University, Kocaeli, Turkey beyzayilman@gmail.com Abstract In this study, functionalized multi-walled carbon nanotube (F-CNT) loaded polyvinyl alcohol (PVA) membranes were synthesized and applied for desalination by means of pervaporation technique. Membranes were characterized using thermo-gravimetric analysis (TGA), fourier transform infrared spectroscopy (FTIR) and differential scanning calorimetry (DSC). Sorption studies were carried out to determine the degree of swelling of the F-CNT/PVA membranes into different types of salt solution. Pervaporation experiments were carried using the F-CNT membranes. Effect of F-CNT concentration and salt concentration on flux and salt rejection were investigated at the constant temperature of 40 °C. As a result, greater than 99.5% rejections were obtained using all membrane. The incorporation of FCNT into PVA matrix, improved the flux with a percentage of 40% at low salt concentration. Keywords: Desalination, Carbon Nanotubes, Pervaporation 1. INTRODUCTION Water is a necessity for people to survive and in most parts of the world, people are facing with the water scarcity. In the last century, the use of water increased almost two times. It is estimated two billion people in 48 countries will have to overcome water scarcity in 2050 (Goh et al., 2013). More than 96.5% of the earth's water is on the surface; however, only 2.5 % of the total water is drinkable without deep purification (Kaminski et al., 2018). To convert the saline water into potable water, salt and minerals must be removed. Various desalination systems have been developed to produce drinking water from the saline water. In the last 20 years, significant developments have been made in order to obtain more attractive and affordable water supply using the membrane technology. Thus, the numbers of membrane desalination plants have gained momentum in recent years. It has been reported that the number and the size of desalination plants have increased by 5-6% in the year since 2010 (Voutchkov et al.,2018). Basically, there are two main categories of desalination methods; thermal methods and membrane technologies. The common membrane based desalination technique is reverse osmosis (RO) and it constitutes of 60% of total desalination capacity (Irena, 2013). Reverse osmosis technology based on the pressurized water purification by using a semi-permeable membrane. Thermal separation techniques such as multi effect distillation (MED) and multi-stage flash (MSF) distillation depend on the heating and condensing of the seawater by the heat energy (Nigiz et al., 2017). It is reported that the thermal desalination techniques consume high energy compared to the RO (Zhou et al., 2016). Contrary to thermal techniques, membrane based techniques offer many advantages. It is preferred over traditional distillation techniques due to its high efficiency and potential energy saving separation route (Wang et al., 2016). However, there are some disadvantages such as membrane fouling and low yield in high salinity water (Chaudhri et al., 2018). Pervaporation is another membrane technology that attracts attention as a potential desalination method. In this system, water is preferably pass through a selective membrane. During the transition, water evaporates and then liquefied in the nitrogen traps. The driving force in the pervaporation is provided by the formation of a concentration gradient between the two sides of the membrane. Because of the permeate is removed by the vacuum or air sweep, high pressure is not required. POSTER PRESENTATION 364 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Pervaporation has been found to be quite promising technique for desalination. Recently, many of pervaporative desalination studies have been made by Researchers. Chaudhri et al. (2015) used an ultra-thin polyvinyl alcohol membrane supported on polysulfone hollow fiber membrane and obtained a rejection of 99.9%. Li et al. (2017) prepared a graphene oxide incorporated PVA/PVDF membrane and obtained 99.99% of rejection. Xie. et al. (2011) obtained 99.5% of rejection with a hybrid PVA/maleic acid/silica membrane. Although many polymers and nanomaterials such as graphene oxide have been used in the desalination with pervaporation, carbon nanotubes (CNTs) have not yet been used (Wang et al., 2016). It is mostly used in membrane processes such as reverse osmosis, ultrafiltration (Daer et al., 2015). Carbon nanotubes (CNT) discovered in 1991 attracted interest in a wide range of applications due to their durability, electrical conductivity, high adsorption properties. There are two main constructed types of CNT as single-walled (SWCNT) and multi-walled carbon nanotubes (MWCNT) (Aqel et al., 2012). Carbon nanotubes have applications such as sensors, adsorbents, membranes, and catalysts (Sarkar et al., 2018). It has been reported that CNT has advantages of increasing water flow, maximizing the salt rejection and extend the life of membrane by preventing the membrane contamination and biological fouling (Rashid et al., 2017). It has also been reported that the CNTs have excellent absorbent properties against both chemical and biological contaminants such as heavy metals, phenols, organic chemicals and various natural organic substances (Teow et al., 2017). In addition to these beneficial properties, carbon nanotubes have a property of affecting the membrane performance. Recently, CNT incorporated mixed matrix membranes have been prepared and used for many of membrane application. Owing to the chemically inert property and agglomeration tendency of CNT, it is difficult to achieve a homogeneous distribution within a base matrix. Therefore, the surfaces of CNTs are treated with strong acids to achieve a good compatibility (Wang et al., 2014). Thus, the functionalized carbon nanotubes (F-CNT) can be homogenously distributed to the polymer matrix of the membrane. CNTs have been used with polymers such as polyamide (PA), polyether sulfonate (PES), polyvinylidene fluoride (PVDF) and polyvinyl alcohol (PVA) to synthesize mixed matrix membrane for applications of reverse osmosis, forward osmosis and ultrafiltration (Daer et al., 2015). Any study has not been reported yet on the use of functionalized CNT for pervaporative desalination. Hence, in this study, F-CNT loaded PVA non porous membrane has been produced and used for synthetic water desalination including NaCl, KCl, MgCl2. 2. MATERIALS AND METHODS 2.1. Materials COOH functionalized CNTs (F-CNT) were supplied from Grafen Co. with diameters ranging from 10 to 30 nm and lengths ranging from 10 to 30 nm. Polyvinyl alcohol (MW= 125,000 g/mol) was supplied from Aldrich Chemistry, Turkey. Hydrochloric acid was supplied from J.T.Baker Inc. 2-propanol and magnesium chloride hexahydrate (MW=203,3 g/mol) were supplied from Merck Chemicals, Turkey. Sodium Chloride was supplied from Carlo Erba Reagents. Potassium chloride (MW=74,55 g/mol) was supplied from Sigma Aldrich, Turkey. Gluteraldehyde %50 aq. sol. was supplied from Alfa Aesar, Turkey. 2.2 Preparation of Hybrid Membranes Containing Functionalized MWCNTs Functionalized MWCNTs incorporated PVA membranes were prepared by casting and solvent evaporation technique by adding different concentrations of functionalized MWCNTs. 6 wt% PVA was prepared and stirred for three hours at 85°C. MWCNTs were added with the varying concentration from 0.1 wt% to 0.5 wt% respect to the polymer’s weight. Prior to incorporate functionalized MWCNTs into the polymer solution, functionalized MWCNTs were kept in an ultrasonic bath for 15-20 minute to prevent the agglomeration of nanotubes in the polymeric matrix. Following the homogenization, membrane solution was poured onto a polymethyl metacrylate surface and allowed to dry for two days at the room temperature. The dried membranes were cross-linked in a glutaraldehyde-containing cross-linking bath for three hours. POSTER PRESENTATION 365 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 2.3. Membrane Characterization Thermal behavior of the membrane was analyzed using differential scanning calorimetry (DSC). The analysis was done with the temperature rising from 40 °C to β00 °C at a heating rate of β0 °C/min under nitrogen atmosphere. The cross-linking evidence of the membrane was investigated using Fourier-transform infrared spectroscopy. 2.4. Sorption Test In order to investigate the swelling properties of the membranes in the different concentration of saline solutions, membranes were cut into pieces with an area of 2 cm 2. Membranes were immersed in 20.000 ppm NaCl-water, 1000 ppm KCl-water, 1000 ppm MgCl2-water solutions. At an hour interval, membranes were rapidly taken from the solution and after that dried the weighs were recorded. Swelling analysis were carried out 24 hours. The degree of swelling (Sd) values of the membranes were calculated from in following Eq. (1) Ws – Wd Sd = [ Wd ]x (1) Where Ws is the weight of swollen membrane, and Wd is the weight of the dry membrane. 2.5. Pervaporation Experiment The pervaporation test was carried out at a constant temperature of 40⁰C. Membranes were tested with different concentrations of salt-containing solutions. The effective surface area of the membrane was 19.6 cm2. The flux (J) and salt rejection (R) were calculated using the following Eq (2) and Eq(3). �= �= �� (2) �.� �� −�� �� ∗ (3) Where, Wp is the weight of permeate (kg), A is the effective membrane area(m 2), t is the experiment period (h), Gf is conductivity of the feed solution, Gp is the conductivity of permeate. The conductance of the water before and after the desalination experiments at one hour interval was measured using a conductivity meter. For the accuracy of the conductance, permeated water was measured at least three times. 3.RESULT AND DISCUSSION 3.1 Membrane Characterization Figure 1 shows the FTIR spectra of the membranes with and without F-CNT. The peaks between the range of 3280-3295 cm-1 are corresponding to O-H stretching vibration in the membrane. The intense of O-H band increased depending on the F-CNT incorporation in which functionalized with O-H groups. As is known from the literature, the FTIR spectrum of the COOH-MWCNT exhibited a relatively weak C=O stretching band at 1720 cm-1 and an O-H stretching band at 3300 cm-1 (Jang et al., 2015). The strong vibration peaks of CH2 and CH3 were observed at 2928 cm-1. Asymmetric and symmetric carboxylate stretching was found at 1650 cm-1 and 1420 cm-1 respectively. POSTER PRESENTATION 366 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 1. FTIR spectra of the pure and F-CNT incorporated PVA membranes Thermal behaviour of the pure and F-CNT incorporated PVA membranes was analysed by DSC. DSC curves of the prepared membranes were given in Figure 2. According to DSC results, pure PVA membrane show one single broad glass transition peak (Tg) at about 55 ˚C, a Tm value at βββ,81˚C associated with a ∆H f value of 45.24 J/g. The F-CNT incorporated PVA membrane shows a Tm at 1λ7.0λ ˚C with a ∆Hf of 21.06 J/g. The F-CNT incorporated PVA membrane compared to the pure PVA membrane, it has lower melting temperature and enthalpy values. This case indicating that F-CNT incorporated PVA membrane has the lower structural order of crystallinity. Figure 2. DSC curves of the Pure and F-CNT loaded PVA membranes 3.2 Swelling Results Time dependent degrees of swelling values of the membranes at different concentration of F-CNT in different salt solutions are given in Figure 3. In the first plot, the effect of F-CNT concentration on swelling indicated at 20.000 ppm NaCl-water solution. The highest degree of swelling values of 180% was obtained when the pure (pristine) PVA was immersed. POSTER PRESENTATION 367 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 3. Swelling degrees of the membrane immersed in different types of salt The degree of swelling provides basic information about the membrane-solvent affinity. Higher swelling degree mostly leads to higher membrane flux. Until a certain point, an acceptable value for swelling degree contributes to enhancing the water permeation. However, membrane selectivity or salt rejection is damaged owing to the excess amount of swelling degree regarding the enlargement of the space between the polymer chains. Therefore, it is important to obtain a stable trend in membrane swelling. It is clearly seen from the Figure 3 that the 0.3 wt% and 0.5 wt% F-CNT loaded membranes exhibited lower and instable swelling behavior. Membranes were also immersed in the saline water solution containing 1000 ppm of MgCl2. Due to the different charge density occurred by the differ salt ions, the swelling behavior of the membrane changed. In the MgCl2-water solution, the highest swelling of 350 % was obtained with the 0.3wt% of F-CNT incorporated membrane. This swelling of the membrane was very high to be used for a selective desalination. Other membranes also showed the high degree of swelling values varying from 180% to 240%. Compared to the NaCl solutions, higher swelling was obtained in MgCl2 and KCl owing to the different type and concentration of the immersing solutions. In the real seawater, the concentration of the NaCl is higher compared to the MgCl2 and KCl. In order to obtain realistic results, concentrations of the solutions were adjusted close to the seawater. In the case of NaCl-water solution, numbers of ions were more than those of MgCl2 and KCl solutions. Salt ions could increase the toughness of the membrane structure and restricted the excess swelling. According to the results obtained in Figure 3, 0.1 wt% F-CNT incorporated membrane exhibited more stable and acceptable swelling degree compared to the other membranes. POSTER PRESENTATION 368 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3.2 Desalination Results Figure 4 shows the flux and total salt rejection results of the membranes in different concentration of NaCl (10000, 15000 and 20000 ppm) and constant concentrations of MgCl 2 and KCl (1000 ppm). All membranes exhibited superior salt rejection greater than 99%. This was due to the selective character of PVA membrane. According to the size exclusion theory on desalination process through a selective membrane, structure of PVA prevented a non-selective ion passage. There were not seen any remarkable difference between the rejection values of pure and F-CNT loaded membranes. Therefore, performance-determinant factor was considered to be the water flux. Figure 4. Flux and rejection results of the membranes at varying concentration of NaCl and constant concentration of MgCl2 and KCl At the lowest salt concentration (10.000 NaCl), compared to the pure PVA membrane, flux increment was found to be greater than 10% using F-CNT loaded membranes. The highest flux was obtained using 0.1 wt% F-CNT loaded membrane with the salt rejection of >99. The increase in at 0.1 wt% F-CNT loaded membrane flux was found to be 40% compared to the pure PVA. With increasing NaCl concentration from 10000 ppm to 15000 ppm, an increase of 45% was obtained using 0.5 wt% F-CNT membrane due to the ease of water permeability throughout the CNT. 4.CONCLUSIONS This study focused on the preparation F-CNT incorporated PVA membranes and application for pervaporative desalination. As a result, greater than 99.5% rejections were obtained using all membrane. With increasing F-CNT amount in the membrane, rejection showed the very slight increase. This increase can be neglected compared to the flux variation. With increasing nanotube concentration in PVA matrix, flux values enhanced. Especially, at low NaCl concentration (10.000 and 15.000 ppm) improvement in the flux POSTER PRESENTATION 369 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org was found to be 40%. These results show a correlation with the swelling values, at the higher NaCl concentration, pure PVA membrane swelling was higher than those of F-CNT loaded membranes. Consequently, in this study, the higher flux of 1.05 kg/m2.h was obtained with a rejection of >99.5 using 0.1 F-CNT loaded PVA membrane. Abbreviations CNTs carbon nanotubes DSC differential scanning calorimetry F-CNT functionalized multi-walled carbon nanotube FTIR Fourier transform infrared spectroscopy MED multi effect distillation MSF multi-stage flash distillation MWCNT multi-walled carbon nanotubes PVA polyvinyl alcohol PA polyamide PES polyether sulfonate PVDF polyvinylidene fluoride RO reverse osmosis SWCNT single-walled TGA thermo-gravimetric analysis Symbols Sd degree of swelling Ws weight of swollen membrane Wd weight of the dry membrane J flux R salt rejection Wp weight of permeate A effective membrane area t experiment period Gf conductivity of the feed solution, Gp conductivity of permeate Tg glass transition temperature Tm melting temperature ∆Hf enthalpy of formation ACKNOWLEDGEMENTS The authors would like to thank to colleagues from the Polymer and Rubber Technology: Characterization, Kocaeli University, for their support on use of characterization equipment. POSTER PRESENTATION 370 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org REFERENCES Aqel, A., Abou El-Nour, K. M. M., Ammar, R. A. A., Al-Warthan, A., 2012. Carbon nanotubes, science and technology part (I) structure, synthesis and characterisation. Arabian Journal of Chemistry, 5: 1-23. Chaudri, S.G., Rajai B. H., Singh, P. S., 2015. Preparation of ultra-thin poly(vinyl alcohol) membranes supported on polysulfone hollow fiber and their application for production of pure water from seawater. Desalination, 367: 272-284. Chaudhri, S.G., Chaudhari, J.C., Singh, P.S., 2018. Fabrication of efficient pervaporation desalination membrane by reinforcement of poly(vinyl alcohol)–silica film on porous polysulfone hollow fiber. Journal of Applied Polymer Science, 135: 1-13. Daer, S., Kharraz, J., Giwa, A., Hasan, S. W., 2015. Recent applications of nanomaterials in water desalination: A critical review and future opportunities. Desalination, 367: 37-48. Goh, P.S., Ismail, A.F., Ng, B.C., 2013. Carbon nanotubes for desalination: Performance evaluation and current hurdles: Desalination, 308: 2-14. International Renewable Energy Agency (IRENA), 2013. Water Desalination Using Renewable Energy. Technology Policy Brief, 12: 1-10. Jang, M.G., Lee, Y.K., Kim, W.N., 2015. Influence of Lactic Acid-Grafted Multi-Walled Carbon Nanotube (LA-g-MWCNT) on the Electrical and Rheological Properties of Polycarbonate/Poly(lactic acid)/LA-gMWCNT Composites. Macromolecular Research, 23(10): 916-923. Kaminski, W., Marszalek, J., Tomczak, E., 2018. Water desalination by pervaporation – Comparison of energy consumption. Desalination, 433: 89-93. Lin, L., Hou, J., Ye, Y., Mansouri, J., Zhang, Y., Chen, V., 2017. Suppressing Salt Transport through Composite Pervaporation Membranes for Brine Desalination. Applied Sciences, 7: 856. Nigiz, F., Veli, S., Hilmioğlu, N., β017. Deep purification of seawater using a novel zeolite 3A incorporated polyether-block-amide composite membrane. Separation and Purification Technology, 188: 90-97. Rashid, M., Ralph, S., 2017. Carbon Nanotube Membranes: Synthesis, Properties, and Future Filtration Applications. Nanomaterials, 7: 99-126. Sarkar, B., Mandal, S., Tsang, Y., Kumar, P., Kim, K., Ok, Y., 2018. Designer carbon nanotubes for contaminant removal in water and wastewater: A critical review. Science of the Total Environment, 612: 561-581. Shirazi, Y., Tofighy, M. A., Mohammadi, T., 2011. Synthesis and characterization of carbon nanotubes/poly vinyl alcohol nanocomposite membranes for dehydration of isopropanol. Journal of Membrane Science, 378: 551-561. Teow, Y. H., Mohammad, A. W., 2017. New generation nanomaterials for water desalination : A review. Desalination, Article in press. Voutchkov, N., 2018. Energy use for membrane seawater desalination – current status and trends. Desalinastion, 431: 2-14. Wang, T., Shen, J., Wu, L., Bruggen, B., 2014. Improvement in the permeation performance of hybrid membranes by the incorporation of functional multi-walled carbon nanotubes. Journal of Membrane Science, 466: 338-347. Wang, Q., Li, N., Bolto, B., Hoang , M., Xie, Z., 2016. Desalination by pervaporation: A review. Desalination, 387: 46-60. Xie, Z., Hoang, M., Duong,T., Ng, D., Dao, B., Gray, S., 2011. Sol–gel derived poly(vinyl alcohol)/maleic acid/silica hybrid membrane for desalination by pervaporation. Journal of Membrane Science, 383: 96103. Zhou, C., Zhou, J., Huang, A., 2016. Seeding-free synthesis of zeolite FAU membrane for seawater desalination by pervaporation. Microporous and Mesoporous Materials, 234: 377-383. POSTER PRESENTATION 371 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Türkiye’de Yaygın Olarak Tüketilen Baharatların Antibakteriyel Etkileri Emine KOÇYİĞİT1*, Gülçin SAĞDIÇOĞLU CELEP1 1 Gazi Üniversitesi, Sağlık Bilimleri Fakültesi, Beslenme ve Diyetetik Bölümü, Ankara, Türkiye Sorumlu yazar e-mail: kocyigitem@gmail.com Özet Yüksek mortalite ve morbiditeye neden olan bulaşıcı hastalıkların temelinde bakteri, virüs, parazit ya da mantar gibi mikroorganizmalar yer almakta, bu patojen mikroorganizmalar bir insandan diğerine hızlıca yayılmaktadır. Patojen mikroorganizmalar gıdaların bozulmasına ve gıda kaynaklı hastalıkların görülme sıklığının artışına neden olmaktadır. Gıda sanayinde bu patojenlere karşı kullanılan kimyasal koruyucular gıda kaynaklı mikroorganizmaları kontrol altına alarak raf ömrünü uzatsa da çeşitli bakterilere karşı yeterli koruma sağlayamamakta ve bakterilerin koruyuculara karşı direnç geliştirmesine sebep olmaktadır. Bu durum, sentetik kimyasal koruyucuların yerine geçebilecek ve organizmada daha iyi tolere edilebilen baharatların kullanımını gündeme getirmiş, bu doğal ürünlerin gıda endüstrisinde kullanımı giderek artmıştır. Eski çağlardan bu yana baharatların aroma ve tat verici özelliğinin yanında besin koruyucu ve hastalıkları tedavi edici olarak kullanıldığı bilinmektedir. Yapılan çalışmalar bakteri ve mantar gibi patojen mikroorganizmalara karşı antibakteriyel aktivitesi kanıtlanan kimyon, tarçın, sarımsak gibi pek çok baharatın enfeksiyon kaynaklı hastalıkların önlenmesinde ve tedavisinde olumlu sonuçlar oluşturduğunu göstermektedir. Baharatlara bu özelliği yapılarında bulunan polifenoller, uçucu yağ asitleri, flavonoidler gibi ikincil metabolitlerin kazandırdığı belirlenmiştir. Bu çalışmada Türkiye’de besin hazırlama, hastalıkları önleme ve tedavi etme gibi çeşitli amaçlarla yaygın olarak kullanılan sarımsak, tarçın, kimyon, sumak ve kekik gibi baharatların antibakteriyel özellikleri ve bu özelliği sağlayan ikincil metabolitlere yer verilmiştir. Anahtar Kelimeler: baharat, antibakteriyal aktivite, esansiyel yağlar 1. GİRİŞ Bulaşıcı hastalıklar özellikle gelişmekte olan ülkelerde morbidite ve mortalitenin önde gelen nedenleri arasında yer almaktadır. Hastalıkların nedenleri arasında bakteri, virüs, parazit ya da mantar gibi mikroorganizmalar yer alırken, direkt ya da indirekt olarak bir insandan diğerine hızlıca yayılabilmektedir. Konakçı patojenin gelişiminin bir sonucu olarak ortaya çıkan bulaşıcı hastalıklar ciddi halk sağlığı sorunlarına yol açmaktadır (Dhandapani ve Raghunath, 2016). Gıdalardaki mikrobiyal patojenler gıdaların bozulmasına ve gıda kaynaklı hastalıkların görülme sıklığının artışına neden olmaktadır. Gıda sanayinde bu patojenlere karşı kullanılan kimyasal koruyucular gıda kaynaklı mikroorganizmaları kontrol altına alarak raf ömrünü uzatsa da Staphylococcus aureus, Escherichia coli, ve Pseudomonas aeruginosa gibi bakterilere karşı tamamen koruma sağlayamamakta ve patojenlerin koruyucu maddelere karşı direnç geliştirmesine neden olmaktadır. Bu durum, sentetik kimyasal koruyucuların yerine geçebilecek, organizmada daha iyi tolere edilebilen baharatların kullanımını gündeme getirmiş ve bu doğal ürünlerin gıda endüstrisinde kullanımı giderek artmıştır (Miladi ve ark., 2016; Silva ve Domingues, 2017; Souza ve ark., 2005; Tajkarimi ve ark., 2010). Baharatlar eski zamanlardan bu yana tat ve orama verici, tedavi edici ve besin koruyucu olarak kullanılmaktadır (Lai ve Roy, 2004; Zheng ve ark., 2016). Yapılan çalışmalar bakteri ve mantar gibi patojen mikroorganizmalara karşı antibakteriyel aktivitesi kanıtlanan kimyon, tarçın, sarımsak gibi pek çok baharatın enfeksiyon kaynaklı hastalıkların tedavisinde olumlu sonuçlar oluşturduğunu belirtilmektedir (Chaudhary ve ark., 2014; Daka, 2011; Keskin ve Toroglu, 2011). Baharatların yapısında bulunan polifenoller, uçucu yağ asitleri, flavonoidler gibi ikincil metabolitler baharatlara antibakteriyel özellik kazandıran, güvenli kabul edilen ve gıdalarla birlikte kullanıldığında yan etki oluşturmayan bileşenlerdir (Nabavi ve ark., 2015). Ülkemiz coğrafi konum, iklim ve bitki çeşitliliği, tarımın yaygınlığı sayesinde tıbbi ve aromatik bitkilerin yetiştirilmesinde ve ticaretinde önemli yere sahiptir. Besin hazırlama, hastalıklardan korunma, sağlığın iyileştirilmesi, geleneksel tedavi ve inançların baharatların yaygın kullanımına birer örnektir. Bu çalışmada POSTER PRESENTATION 372 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Türkiye’de yaygın kullanıma sahip sarımsak, tarçın, kimyon, sumak, kekik gibi baharatların antibakteriyal etkinliği ve bu etkinliği sağlayan ikincil metabolitlerin özellikleri değerlendirilmiştir. 2. MATERYAL VE METOD Bu çalışmada Türkiye’de yaygın olarak kullanılan sarımsak, tarçın, kimyon, sumak ve kekik gibi baharatların antibakteriyal özelliği ve bu özelliği kazandıran bileşenler değerlendirilmiştir. Sarımsak (Allium sativum L.) Sarımsak (Allium sativum L.), eski çağlardan bu yana hastalıklardan koruyucu teröpatik bir bitki olarak ün kazanmıştır. Sağlığı geliştirici ve iyileştirici etkisine olan inanç sayesinde modern tıpta da kullanımı sürmektedir (Colín-González ve ark., β01β). Allisin (allil 2-propenetiyosülfinat/diallil tiyosülfinat) sarımsağın biyoaktivite gösteren temel bileşenidir. Doğrama ve ezme işlemleri ile aktive olan allinaz enzimi sarımsakta bulunan alliinin aliisine dönüşümünü sağlamaktadır. Sarımsağın yapısındaki diğer önemli bileşenler 1-propenil allil tiyosülfonat, allil metiltiyosülfonat, (E,Z)-4,5,9-tritiyadodesal, 6,11-trien-9-oksit (ajoen), ve γ-L-glutamil-S-allil-L-sistein’dir. (Iciek ve ark., 2009; Lanzotti ve ark., 2012). Sarımsağın antibakteriyel aktivitesinin yapısında bulunan allisin, allil grupları ve diallil sülfid, diallil disülfid, diallil trisülfid gibi suda ve yağda çözünen organosülfür bileşiklerinden ileri geldiği belirlenmiştir (Casella ve ark., 2013; Goncagul ve Ayaz, 2010). Sarımsağın yüzyıllardır bulaşıcı hastalıklarla savaşmak için kullanıldığı bilinmekte, kanıtlanmış veri olmamakla birlikte Louis Pasteur’ün 1858 yılında sarımsağın antibakteriyel etkinliğini tanımladığına inanılmaktadır. Yapılan çalışmalar sarımsağın gram pozitif (+), gram negatif (–) ve aside dayanıklı bakterilerin çoğalmasına karşı etkili olduğunu kanıtlamıştır. Bu bakteriler arasında Salmonella, Escherichia coli, Pseudomonas, Proteus, Staphylococcus aureus, Klebsiella, Micrococcus, Bacillus, Clostridium, Mycobacterium, Helicobacter türleri yer almaktadır (Abubakar, 2009; Adler ve Beuchat, 2002; Chandra ve ark., 2010; Daka, 2011). Tarçın (Cinnamomum zeylanicum L.) Tarçın antik çağlardan bu yana en yaygın kullanılan gıda katkı maddesi ve baharatlardan biri olarak bilinmektedir. Diş ağrılarında ve enfeksiyonlarında, akne tedavisinde, gastrointestinal sistem rahatsızlıklarında kullanıldığı belirtilen tarçının antioksidan ve antiinflamatuvar etkisi sayesinde antibakteriyel, antifungal, bağırsak parazitlerini öldürücü etkinlik göstermektedir. Tarçının yapısında bulunan temel biyoaktif bileşenler polifenoller ve uçucu fenol bileşenleri olmak üzere iki sınıfa ayrılmaktadır. Başlıca polifenoller arasında kaffeik asit, gallik asit, protokateşik asit, p-kumarik asit ve ferulik asit yer alırkenν sinnamaldehit, karyofilin, benzil benzoat, linalol, öjanol asetat ve sinnamil asetat tarçından elde edilen uçucu hidrokarbon ve oksijenlenmiş bileşiklerdir (Muchuweti ve ark., 2007; Wong ve ark, 2014). Farklı dozlarda uygulanan tarçın ekstraktlarının ve tarçından elde edilen esansiyel yağların Klebsiella pneumonia, Bacillus megaterium P. aeroginosa, Staphylococcus aureus, Escherichia coli, Enterobacter cloaca, Corynebacterium xerosis, Streptococcus faecalis, Yersinia enterocolitica, Moraxella catarrhalis türlerine karşı antibakteriyal aktivite gösterdiği yapılan çalışmalarca belirlenmiştir (Keskin ve Toroglu, 2011; Mandal ve ark., 2011; Rasheed ve Thajuddin, 2011; Yap ve ark., 2013). Tarçının yapısında bulunan bileşenler yüksek biyoaktivite göstermekte ve karaciğerde metabolize olmaktadır. Bu nedenle karaciğer hastalığı olanlar, alkolizm öyküsü bulunanlar özellikle tarçın kabuğu kullanmaktan kaçınmalıdır. Ayrıca parasetamol içeren ilaçlarla birlikte alınmaması gerekmektedir. Tarçın yağı kullanılmadan önce çözeltinin içeriği %β’nin altında olacak şekilde dilüe edilmelidir (Price, 2007; NCCIH, 2018). Kimyon (Cuminum cyminum L) Geleneksel tıpta, ses kısıklığı, sarılık, dispepsi ve diyare tedavisinde kimyona başvurulduğu, kimyon çekirdeklerinin diüretik, vazokonstrüktif, gaz giderici ve abortif özellik gösterdiği bildirilmektedir (Leela, 2008; Prajapathi ve ark., 2003). Kimyonun biyolojik aktif özelliği çekirdeklerin zengin fitokimyasal içerinden ileri gelmekte, fitokimyasal özelik gösteren başlıca bileşenler aldehitler (özellikle kumin aldehit), kuminin alkol, γ-terpinen, p-kimen ve ί-pinen’dir (Johri, 2011). POSTER PRESENTATION 373 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Kimyondan elde edilen esansiyel yağ asitlerinin Staphylococcus epidermidis, Staphylococcus aureus, Staphylococcus haemolyticus, Propionibacterium acnes, Corynebacterium diphtheriae, Erysipelothrix rhusiopathiae, Bacillus cereus, Clostridium tetani, Clostridium difficile, Escherichia coli, Salmonella typhi, Klebsiella pneumonia, Vibrio cholerae, Aeromonas hpydrophila, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Asperigillus niger, Saccharomyces cerevisae ve Colletrotrichum gloeosporioides gibi birçok bakteri türünün ortadan kaldırılmasında olumlu etki oluşturduğu saptanmıştır (Chaudhary ve ark., 2014). Esansiyel yağ asitlerinin yanında kimyon çekirdeklerinin gallik asit, sinnamik asit, kumarik asit ve vanilik asit gibi polifenoler ile luteolin, kateşin, kumarin, quersetin ve apijenin gibi flavonoidlerden zengin olduğu belirtilmektedir (Rebey ve ark., 2012). Sumak (Rhus typhina L.) Hidroksibenzoik asit, hidroksisinnamik asit, gallik asit ve kaffeik asit sumağın yapısında bulunan başlıca fenolik asitler olarak dikkat çekmektedir. Bunun yanında antosiyanin, piranoantosiyanin, quersetin, quersetin-3-ramnosid, kamferol ve tannin içeriğince zengindir (Kirby ve ark., 2013; J. Lai ve ark., 2014; Olchowik-Grabarek ve ark., 2014; Wu ve ark., 2013). Sumağın uygulanan doza bağlı olarak Pseudomonas aeruginosa, Candida albicans, Escherichia coli, Staphylococcus aureus, Bacillus cereus, Bacillus subtilis, Listeria monocytogenes, Salmonella typhimurium, Helicobacter pylori, Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces lactis türlerinin gelişimini inhibe ettiği yapılan çalışmalarca ortaya konmuştur. Özellikle gıda kaynaklı patojen bakteriler olan Bacillus cereus ve H.pylori’ye karşı antinakteriyal etkinliği sayesinde tahıl, fermente gıdalar, sebze ve yumurta için gıda güvenliğinin sağlanmasında önemli olabileceği gündeme gelmektedir (Kossah ve ark., 2011; Lee ve ark., 2016; Techer ve ark., 2014) Sumağa antimikrobiyal özelliği gallik asit, kaffeik asit, kuersetin ve tanninlerin kazandırdığı düşünülmektedir (Lee ve ark., 2016; Olchowik-Grabarek ve ark., 2014; Vandal ve ark., 2015). Kekik (Thymus L.) Timol, karvakrol, c-terpinen ve p-kimen geniş çeşitliliğe sahip olan kekiğin antibakteriyal etkinliğinden sorumlu başlıca bileşenlerdir (Sato ve ark., 2007). Antibakteriyal niteliğinin yanında antifungal, sitotoksik, antiviral ve antioksidan gibi çeşitli biyolojik özelliği sayesinde öksürük, üst solunum yolu enfeksiyonu, akut ve kronik bronşit, soğuk algınlığı ve boğmaca başta olmak üzere birçok hastalığın tedavisinde kullanıldığı bilinmektedir (Basch ve ark., β004ν Šegvić Klarić ve ark., β007). Kekiğin antibakteriyel etkisini araştıran ilk çalışma 60’lı yıllarda ortaya konmuş, özellikle β0 yılı aşkın süredir kekik yağı, ekstraktı ve kekikten izole edilen bileşiklerin antibakteriyal etkisini değerlendirmek için çok sayıda çalışma yapılmıştır (Li ve ark., 1963). Yapılan çalışmalarda Bacillus cereus, Escherichia coli, Klebsiella pneumonia, S. aureus türlerine karşı ve özellikle Staphylococcus, Enterococcus, Escherichia ve Pseudomonas türlerine karşı güçlü anltibakteriyel etki oluşturduğu belirtilmektedir (Abu-Darwish ve ark., 2012; Tohidpour ve ark., 2010). Aynı zamanda Helicobacter pylori gelişimini inhibe ettiği saptanan çalışmalar da mevcuttur (Eftekhar ve ark., 2009; Esmaeili ve ark., 2012). Bunlara ek olarak, yaygın olarak tüketilen baharatlardan olan nane (Mentha), karabiber (Piper nigrum L.) ve zerdeçalın (Curcuma Longa L.) antibakteriyel aktiviteleri olduğu yapılan araştırmalarda gösterilmiştir (Ali, 2017; Irshad ve ark., 2017; Zhang ve ark., 2017). 3. SONUÇ Türkiye’de yaygın olarak tüketilen baharatların antibakteriyal etkileri özetlenmiştir. Sarımsak, tarçın, kekik, kimyon, sumak, nane, karabiber ve zerdeçal Bacillus cereus, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa ve antibiyotiğe dirençli pek çok bakteri türünü inhibe edici özellik göstermektedir. Bu baharatlar gıda bozulmaları ve zehirlenmelerine azaltıcı etki göstermekte, gıdaların raf ömrünü uzatmakta ve enfeksiyonları tedavi edici etki oluşturmaktadır. Baharatların etki mekanizmalarının açıklığa kavuşturulduğu klinik çalışmalara ihtiyaç vardır. Patojen mikroorganizmaların inhibisyonunun sağlanması için çeşitli gıdalarda baharatların birarada kullanıldığı çalışmalar yapılmalıdır. Organizmada etkinliği kanıtlanan baharatlar bulaşıcı POSTER PRESENTATION 374 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org hastalıkların tedavisinde antibiyotiğe alternatif oluşturabilir ancak toksik dozların belirlenmesi gerekmektedir. KAYNAKLAR Abu-Darwish MS, Al-Ramamneh E, Kyslychenko VS, Karpiuk UV 2012. The antimicrobial activity of essential oils and extracts of some medicinal plants grown in Ash-shoubak region-South of Jordan. Pakistan Journal of Pharmaceutical Sciences, 25(1): 239-246. Abubakar EmM 2009. Efficacy of crude extracts of garlic (Allium sativum Linn.) against nosocomial Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniea and Pseudomonas aeruginosa. Journal of Medicinal Plants Research, 3(4): 179-185. Adler BB, Beuchat LR 2002. Death of Salmonella, Escherichia coli O157: H7, and Listeria monocytogenes in garlic butter as affected by storage temperature. Journal of Food Protection, 65(12): 1976-1980. Ali N 2017. In vitro studies of antimicrobial activity of (curcuma longa l.) rhizomes against helicobacter pylori. Iraq Medical Journal, 1(1): 7-9. Basch E, Ulbricht C, Hammerness P, Bevins A, Sollars D 2004. Thyme (Thymus vulgaris L.), thymol. Journal of Herbal Pharmacotherapy, 4(1): 49-67. Casella S, Leonardi M, Melai B, Fratini F, Pistelli L 2013. The role of diallyl sulfides and dipropyl sulfides in the in vitro antimicrobial activity of the essential oil of garlic, Allium sativum L., and leek, Allium porrum L. Phytotherapy Research, 27(3): 380-383. Chandra H, Singh A, Srivastava J, Bishnoi P, Nautiyal A 2010. Antibacterial Activity of Allium sativum (L.) Against Bacteria Isolated from Upper Respiratory Tract. IUP Journal of Life Sciences, 4(4):43-49. Chaudhary N, Husain SS, Ali M 2014. Chemical composition and antimicrobial activity of volatile oil of the seeds of Cuminum cyminum L. World Journal of Pharmacy and Pharmaceutical Science, 3: 14281441. Colín-González AL, Santana RA, Silva-Islas CA, Chánez-Cárdenas ME, Santamaría A, Maldonado PD 2012. The antioxidant mechanisms underlying the aged garlic extract-and S-allylcysteine-induced protection. Oxidative Medicine and Cellular Longevity, 2012:1-16. Daka D 2011. Antibacterial effect of garlic (Allium sativum) on Staphyloccus aureus: An in vitro study. African journal of Biotechnology, 10(4): 666-669. Dhandapani KSV, Raghunath P 2016. Investigation on the mechanism of action of the leaves of trianthema portulacastrum on human path only gens. Asian Journal of Pharmaceutical and Clinical Research, 9(3): 135-140. Eftekhar F, Nariman F, Yousefzadi M, Hadiand J, Ebrahimi SN 2009. Anti-Helicobacter pylori activity and essential oil composition of Thymus caramanicus from Iran. Natural Product Communications, 4(8): 1139-1142. Esmaeili D, Mobarez AM, Tohidpour A. 2012. Anti-helicobacter pylori activities of shoya powder and essential oils of thymus vulgaris and eucalyptus globulus. The Open Microbiology Journal, 6: 65-69. Goncagul G, Ayaz E 2010. Antimicrobial effect of garlic (Allium sativum). Recent Patents on Anti-Infective Drug Discovery, 5(1): 91-93. Iciek M, Kwiecień I, Włodek L β00λ. Biological properties of garlic and garlic‐derived organosulfur compounds. Environmental and Molecular Mutagenesis, 50(3): 247-265. Irshad S, Ashfaq A, Muazzam A, Yasmeen A 2017. Antimicrobial and Anti-Prostate Cancer Activity of Turmeric (Curcuma longa L.) and Black Pepper (Piper nigrum L.) used in Typical Pakistani Cuisine. Pakistan Journal of Zoology, 49(5): 1665-1669. Johri R 2011. Cuminum cyminum and Carum carvi: An update. Pharmacognosy Reviews, 5(9): 63-72. Keskin D, Toroglu S 2011. Studies on antimicrobial activities of solvent extracts of different spices. Journal of Environmental Biology, 32(2): 251-256. Kirby CW, Wu T, Tsao R, McCallum JL 2013. Isolation and structural characterization of unusual pyranoanthocyanins and related anthocyanins from Staghorn sumac (Rhus typhina L.) via UPLC– ESI-MS, 1H, 13C, and 2D NMR spectroscopy. Phytochemistry, 94: 284-293. Kossah R, Zhang H, Chen W 2011. Antimicrobial and antioxidant activities of Chinese sumac (Rhus typhina L.) fruit extract. Food Control, 22(1): 128-132. Lai J, Wang H, Wang D, Fang F, Wang F, Wu T 2014. Ultrasonic extraction of antioxidants from Chinese sumac (Rhus typhina L.) fruit using response surface methodology and their characterization. Molecules, 19(7): 9019-9032. POSTER PRESENTATION 375 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Lai P, Roy J 2004. Antimicrobial and chemopreventive properties of herbs and spices. Current Medicinal Chemistry, 11(11): 1451-1460. Lanzotti V, Barile E, Antignani V, Bonanomi G, Scala, F 2012. Antifungal saponins from bulbs of garlic, Allium sativum L. var. Voghiera. Phytochemistry, 78: 126-134. Lee MH, Lee J, Nam YD, Lee JS, Seo MJ, Yi SH 2016. Characterization of antimicrobial lipopeptides produced by Bacillus sp. LM7 isolated from chungkookjang, a Korean traditional fermented soybean food. International Journal of Food Microbiology, 221: 12-18. Leela N 2008. Chemistry of spices. UK: CAB International Press, 124 pp. Li C, Prescott B, Chi L, Martino E 1963. Antiviral and antibacterial activity of thymus extracts. Proceedings of the Society for Experimental Biology and Medicine, 114(2): 504-509. Mandal S, DebMandal M, Saha K, Pal NK 2011. In vitro antibacterial activity of three Indian spices against methicillin-resistant Staphylococcus aureus. Oman Medical Journal, 26(5): 319-323. Miladi H, Zmantar T, Chaabouni Y, Fedhila K, Bakhrouf A, Mahdouani K, Chaieb K 2016. Antibacterial and efflux pump inhibitors of thymol and carvacrol against food-borne pathogens. Microbial pathogenesis, 99: 95-100. Muchuweti M, Kativu E, Mupure C, Chidewe C, Ndhlala A, Benhura M 2007. Phenolic composition and antioxidant properties of some spices. American Journal of Food Technology, 2(5): 414-420. Nabavi SF, Di Lorenzo A, Izadi M, Sobarzo-Sánchez E, Daglia M, Nabavi SM β015. Antibacterial effects of cinnamon: From farm to food, cosmetic and pharmaceutical industries. Nutrients, 7(9): 77297748. Naitonal Center for Complementary and Integrative Health. Herbs at a glance. Cinnamon. Available at: https://nccih.nih.gov/health/cinnamon [Erişim ββ.0β.18] Olchowik-Grabarek E, Swiecicka I, Andreeva-Kovaleskaya Z, Solonin A, Bonarska-Kujawa D, Kleszczyńska H, Saidmukhtar M, Zamaraeva M 2014. Role of structural changes induced in biological membranes by hydrolysable tannins from sumac leaves (Rhus typhina L.) in their antihemolytic and antibacterial effects. The Journal of Membrane Biology, 247(6): 533-540. Prajapathi ND, Purohit S, Sharma AK, Kumar T 2003. A handbook of medicinal plants: A complete source book. India: Agrobios Press, 396 pp. Price L 2007. Aromatherapy for health professionals. China: Elsevier Press,69 pp. Rasheed MU, Thajuddin N 2011. Effect of medicinal plants on Moraxella cattarhalis. Asian Pacific Journal of Tropical Medicine, 4(2): 133-136. Rebey IB, Zakhama N, Karoui IJ, Marzouk B 2012. Polyphenol composition and antioxidant activity of cumin (Cuminum cyminum L.) seed extract under drought. Journal of food science, 77(6): 734-739. Sato K, Krist S, Buchbauer G 2007. Antimicrobial effect of vapours of geraniol,(R)‐(–)‐linalool, terpineol, γ‐ terpinene and 1, 8‐cineole on airborne microbes using an airwasher. Flavour and Fragrance Journal, 22(5): 435-437. Šegvić Klarić M, Kosalec I, Mastelić J, Piecková E, Pepeljnak S β007. Antifungal activity of thyme (Thymus vulgaris L.) essential oil and thymol against moulds from damp dwellings. Letters in Applied Microbiology, 44(1): 36-42. Silva F, Domingues FC 2017. Antimicrobial activity of coriander oil and its effectiveness as food preservative. Critical Reviews in Food Science and Nutrition, 57(1): 35-47. Souza ELd, Stamford TLM, Lima EdO, Trajano VN, Barbosa-Filho JM 2005. Antimicrobial effectiveness of spices: an approach for use in food conservation systems. Brazilian Archives of Biology and Technology, 48(4): 549-558. Tajkarimi M, Ibrahim SA, Cliver D 2010. Antimicrobial herb and spice compounds in food. Food Control, 21(9): 1199-1218. Techer C, Baron F, Delbrassinne L, Belaïd R, Brunet N, Gillard A, Gonnet F, Cochet MF, Grosset N, Gautier M 2014. Global overview of the risk linked to the Bacillus cereus group in the egg product industry: identification of food safety and food spoilage markers. Journal of Applied Microbiology, 116(5): 1344-1358. Tohidpour A, Sattari M, Omidbaigi R, Yadegar A, Nazemi J 2010. Antibacterial effect of essential oils from two medicinal plants against Methicillin-resistant Staphylococcus aureus (MRSA). Phytomedicine, 17(2): 142-145. Vandal J, Abou-Zaid MM, Ferroni G, Leduc LG 2015. Antimicrobial activity of natural products from the flora of Northern Ontario, Canada. Pharmaceutical Biology, 53(6): 800-806. POSTER PRESENTATION 376 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Wong Y, Ahmad-Mudzaqqir M, Wan-Nurdiyana W 2014. Extraction of essential oil from cinnamon (Cinnamomum zeylanicum). Oriental Journal of Chemistry, 30(1): 37-47. Wu T, McCallum JL, Wang S, Liu R, Zhu H, Tsao R 2013. Evaluation of antioxidant activities and chemical characterisation of staghorn sumac fruit (Rhus hirta L.). Food Chemistry, 138(2-3): 1333-1340. Yap PSX, Lim SHE, Hu CP, Yiap BC 2013. Combination of essential oils and antibiotics reduce antibiotic resistance in plasmid-conferred multidrug resistant bacteria. Phytomedicine, 20(8-9): 710-713. Zhang J, Ye KP, Zhang X, Pan DD, Sun YY, Cao JX 2017. Antibacterial activity and mechanism of action of black pepper essential oil on meat-borne Escherichia coli. Frontiers in microbiology, 7: 20943004. Zheng J, Zhou Y, Li Y, Xu DP, Li S, Li HB 2016. Spices for prevention and treatment of cancers. Nutrients, 8(8): 495. POSTER PRESENTATION 377 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Enrofloksasinin TiO2/UV Prosesi ile Giderimi Aslı Berktaş1, Özlem Esen Kartal2* *1,2 İnönü Üniversitesi, Mühendislik Fakültesi, Kimya Mühendisliği, Malatya, Türkiye asli.berktas@gmail.com Özet Günümüzde insan ve hayvanların tedavisinde antibiyotikler yaygın bir şekilde kullanılmaktadır. Canlılar tarafından vücuda alınan bu antibiyotikler metabolizmada değişmeden ya da çok az değişime uğrayarak vücuttan dışarı atılırlar. Bu nedenle, atılan insan ve hayvan dışkıları yüksek miktarda antibiyotik içerebilir. Atılan antibiyotik içeren kalıntılar atıksu arıtma tesislerinde yeterince arıtılamadığı durumda, antibiyotiğin özelliklerine bağlı olarak toprağa, yüzeysel ve yeraltı sularına karışabildiği bilinmektedir. Karıştığı bu ortamlarda, düşük derişimde bulunan antibiyotik kalıntıları mikroorganizmaların antibiyotik direnci kazanmasına, yüksek derişimlerde bulunan kalıntılar ise toksik etkilere neden olabilmektedir. Son yıllarda atıksularda bulunan antibiyotik kalıntılarının gideriminde ileri oksidasyon proseslerinin (İOP) kullanımına yönelik yapılan çalışmalar artmıştır. İOP özellikle biyolojik olarak giderilemeyen bileşiklerin ya tamamen mineralizasyonunu sağlayarak CO 2 ve H2O gibi toksik olmayan ürünlere ya da biyolojik olarak giderilebilen ara ürünlere dönüştürülmesini sağlamaktadır. Bu çalışmada florokinon grubu bir antibiyotik olan enrofloksasinin TiO2 katalizörü varlığında fotokatalitik giderimi incelenmiştir. γ,5,7 ve λ pH değerlerinde 60 dakika sonunda sırasıyla %84, %λ5, %λ6 ve %λ7 enrofloksasin giderimi elde edilmiştir. Enrofloksasinin fotokatalitik oksidasyonla giderimine TiO2 miktarının etkisini araştırmak için 0 - 1 g/L aralığında farklı miktarlarda TiO2 kullanılarak deneyler yapılmış ve TiO2 miktarı arttıkça giderimin de arttığı gözlenmiştir. 10, 20, 30 ve 40 ppm enrofloksasin derişimleri için 60 dakika sonunda sırasıyla %100, %λ7, %λγ ve %87 giderim elde edilmiştir. Karanlıkta (0 W) yapılan deneyde 60 dakika sonunda %5 enrofloksasin giderimi elde edilirken, 56 W ve 11β W gücünde lambalar kullanıldığında %78 ve %λ7 giderim elde edilmiştir. Anahtar Kelimeler: Antibiyotik, fotokatalitik oksidasyon, enrofloksasin, titanyum dioksit 1. GİRİŞ İnsan ve hayvanların tedavisinde antibiyotiklerin kullanımı günümüzde oldukça yaygındır. Canlılar tarafından vücuda alınan bu antibiyotikler metabolizmada değişmeden ya da çok az değişime uğrayarak vücuttan dışarı atılırlar. Bu nedenle, atılan insan ve hayvan dışkıları yüksek miktarda antibiyotik içerebilir (Ötker ve Akmehmet-Balcıoğlu, β005ν Haque ve Muneer, β007). Atılan antibiyotik içeren kalıntılar atıksu arıtma tesislerinde yeterince arıtılamadığı durumda, antibiyotiğin özelliklerine bağlı olarak toprağa, yüzeysel ve yeraltı sularına karışabildiği bilinmektedir. Karıştığı bu ortamlarda, düşük derişimde bulunan antibiyotik kalıntıları mikroorganizmaların antibiyotik direnci kazanmasına, yüksek derişimlerde bulunan kalıntılar ise toksik etkilere neden olabilmektedir (Seven Yalap ve Akmehmet-Balcıoğlu,2008). Antibiyotikler özelliklerine göre farklı şekilde sınıflandırılmaktadır. Enrofloksasin ise florokinolonlar grubuna dahil bir antibiyotik olup geniş bir etki spektrumuna sahiptir (Ötker ve Akmehmet-Balcıoğlu, β005). Enrofloksasin kanatlılar ve geviş getiren hayvan başta olmak üzere yaygın şekilde kullanılmakta olup % 10-50 kadarı değişmemiş halde olmak üzere vücudu idrar ve safrayla terk etmektedir. Son yıllarda antibiyotik kalıntısı içeren atıksuların arıtımında OH. radikallerinin oluşumuna dayanan İleri Oksidasyon Proseslerinin (İOP) kullanımı araştırılmaktadır (Homem ve Santos, β011ν Paul ve ark, β010). TiO 2’in fotokatalizör olarak kullanıldığı heterojen İOP’lerinde, TiO2 eşik enerjisine eşit ya da daha büyük bir enerji ile uyarıldığında elektronlar değerlik bandından iletkenlik bandına geçer ve böylece değerlik bandında boşluklar oluşarak elektron (e-) ve boşluk (h+) çiftleri meydana gelir. Oluşan h+ yüzeyde adsorplanmış olan H2O ve OH- ile reaksiyona girerek OH. radikalini oluştururlar. e- ise yüzeyde adsorplanmış olan O2 ile reaksiyona girerek süperoksit radikalini (O2.-) oluşturur (Şekil 1). Oluşan e- - h+ çiftlerinden bazıları da tekrar birleşebilir (Paola ve ark., β01βν Ohtani, β010ν Nakata ve Fujishima, β01β). POSTER PRESENTATION 378 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 1. TiO2 fotokatalizörün foto aktivasyon mekanizması 2. MATERYAL VE METOD 2.1. Materyal Deneysel çalışmalarda, fotokatalizör olarak Pβ5 Titanyum dioksit (TiO 2, Evonik), antibiyotik olarak molekül yapısı Şekil β’de verilen enrofloksasin (Baytril %β.5 oral çözelti, Bayer) kullanılmıştır. Şekil 2. Enrofloksasin molekül yapısı 2.2. Karakterizasyon Fototakatalizör olarak kullanılan TiO2’in kristal yapısı Rigaku RadB-DMAX II model X-Işınları Difraktometresi (XRDν 1.54050 Å CuKα) ile incelenmiştir. XRD analizi sonucu elde edilen verilerden % anataz miktarı Eşitlik 1 ve kristal boyutu Scherrer denklemi olarak bilinen Eşitlik β ile hesaplanmıştır. % X = 100 / ( 1+1.265 IR / IA ) Burada; X: % anataz miktarıν IAμ Anataz pik şiddetiν IRμ rutil pik şiddetidir. (1) L = Kλ / β cosθ (2) Buradaν Lμ kristal boyutuν Kμ Scherrer sabiti (0.λ)ν ζμ X ışını dalga boyu (1.54050 Å)ν ίμ yarı şiddet genişliğiν θμ Bragg açısıdır. 2.3. Fotokatalitik Deney Yöntemi Enrofloksasinin fotokatalitik oksidasyonla giderimi Şekil γ’de görülen deney sisteminde gerçekleştirilmiştir. Kuvars camdan yapılmış ceketli fotoreaktör etrafına 8 W gücünde 14 adet UV-A lamba (Topbulb EIKO F8T5/BL) yerleştirilmiştir. Belirlenen derişimde hazırlanan 500 ml enrofloksasin çözeltisi reaktöre konulmuş ve sonra TiO2 fotokatalizörü eklenip lamba açılmadan γ0 dakika boyunca karıştırılarak çözeltinin giderimine adsorpsiyonun etkisi incelenmiştir. γ0 dakika sonunda lamba açılmış ve reaksiyon süresince belirli zaman aralıklarında sistemden örnekler alınmıştır. Bu örneklerden TiO 2 santrifüj işlemi ile uzaklaştırıldıktan sonra enrofloksasin derişimi UV-1800 Shimadzu UV-VIS Spektrofotometresi ile ölçülen absorbans değerlerinden belirlenmiştir. Şekil 3. Deney düzeneği a) Kuvars fotoreaktör, b) Manyetik karıştırıcı, c) Gaz dağıtıcı, d) pH metre, e) Sıcaklık probu, f) Biyolamba, g) Oksijen tüpü, h) Su banyosu POSTER PRESENTATION 379 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3. SONUÇ 3.1.XRD Analizi Sonuçları TiO2 fotokatalizörünün XRD kırınım diyagramı Şekil 4’te verilmiştir. βθ= β5.180 değerinde karakteristik anataz piki, βθ= β7.γγλ değerinde de karakteristik rutil piki görülmüştür. Bu piklere ait verilerden yararlanarak % anataz miktarı ile kristal boyutu hesaplanmıştır. Buna gore, Pβ5 fotokatalizörü % 81 anataz ve % 1λ rutil yapıda olup 18.54 nm kristal boyutuna sahiptir. A: anataz R: rutil Şekil 4. TiO2 fotokatalizörü XRD kırınım diyagramı 3.2. Fotokatalitik Oksidasyon Deneyleri 3.2.1. pH’ın Etkisi pH’ın etkisini incelemek için enrofloksasinin β0 ppm sulu çözeltisi hazırlanarak farklı pH değerleri için fotokatalitik oksidasyon deneyleri yapılmış ve elde edilen sonuçlar Şekil 5’de sunulmuştur. Şekil 5. pH’ın enrofloksasin giderimine etkisi TiO2 miktarı=1 g/L, [Enrofloksasin]=β0 ppm, Lamba=UV-A (112 W) 3.2.2. Enrofloksasin Başlangıç Derişiminin Etkisi Enrofloksasinin başlangıç derişiminin etkisini incelemek için pH=λ değerinde 10, β0, γ0, ve 40 ppm derişimlerinde enrofloksasin çözeltisi kullanılarak deneyler yapılmıştır. POSTER PRESENTATION 380 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 6. Enrofloksasin başlangıç derişiminin enrofloksasin giderimine etkisi TiO2 miktarı=1 g/L, pH=9, Lamba=UV-A (112 W) 3.2.3. TiO2 Miktarının Etkisi Enrofloksasinin fotokatalitik oksidasyonla giderimine TiO2 miktarının etkisini araştırmak için 0 - 1 g/L aralığında farklı miktarlarda TiO2 kullanılarak deneyler yapılmış ve sonuçlar Şekil 7’de verilmiştir. Şekil 7. TiO2 miktarının enrofloksasin giderimine etkisi [Enrofloksasin]=20 ppm, pH=9, Lamba=UV-A (112 W) 3.2.4. UV-A Lamba Gücünün Etkisi Enrofloksasinin fotokatalitik oksidasyonla giderimine kullanılan UV-A lambanın gücünün etkisi lamba kullanılmadan ve 56 W ile 11β W gücünde lambalar kullanılarak incelenmiş ve sonuçlar Şekil 8’de verilmiştir. POSTER PRESENTATION 381 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Şekil 8. UV-A lamba gücünün enrofloksasin giderimine etkisi TiO2 miktarı=1 g/L, [Enrofloksasin]=β0 ppm, pH=9 4. TARTIŞMA TiO2’nin yüzey özellikleri pH’a bağlı olarak değiştiğinden pH organik bileşiklerin fotokatalitik oksidasyon ile gideriminde önemli parametredir. Pβ5 TiO2’in izoelektrik noktası pH=6.8 olduğundan, TiO2’in yüzeyi pH< 6.8 olduğunda artı yüklü, pH>6.8 olduğunda ise eksi yüklü olmaktadır. Şekil 5’ten görüldüğü gibi γ,5,7 ve λ pH değerlerinde 60 dakika sonunda sırasıyla %84, %λ5, %λ6 ve %λ7 enrofloksasin giderimi elde edilmiştir. Enrofloksasin zwiteriyon molekül olup pKa1(5.88-6.06) ve pKa2( 7.7-7.74) değerlerine sahiptir. Bu iki pH değeri arasında yüksüzdür. Çözelti pH’ının nötral ve bazik olduğu koşullarda giderim asidik koşula göre daha yüksek olmuştur. Şekil 6’dan görüldüğü gibi 60 dakika sonunda 10, 20, 30 ve 40 ppm enrofloksasin derişimleri için sırasıyla %100, %λ7, %λγ ve %87 giderim elde edilmiştir. Başlangıç enrofloksasin derişiminin artması ile katalizör yüzeyi üzerindeki aktif alanlar kaplanmakta ve katalizör yüzeyinde OH. radikali oluşumu azalmaktadır. Bu nedenle enrofloksasin derişimi arttıkça giderim azalmaktadır. Enrofloksasinin fotokatalitik oksidasyonla giderimine TiO2 miktarının etkisi incelendiğinde Şekil 7’den görüldüğü gibi 60 dakika sonunda TiO 2‘nin kullanılmadığı durumda %18 enrofloksasin giderimi elde edilirken, 0.25 g/L, 0.50 g/L ve 1 g/L TiO2 miktarları için sırasıyla %81,%87 ve %λ7 giderim elde edilmiştir. Organik bileşiklerin fotokatalitik olarak bozunma etkinliğinin fotokatalizör miktarı arttıkça katalizör yüzeyindeki aktif kısımların sayısının da artması nedeniyle arttığı bilinmektedir. Ancak katalizör miktarı çok fazla artırıldığında süspansiyonun UV ışını geçirgenliği azalmaktadır. Bu çalışmada katalizörün UV ışınının geçirgenliğinde bir azalma görülmemiştir. Şekil 8’den görüldüğü gibi karanlıkta (0 W) yapılan deneyde 60 dakika sonunda %5 enrofloksasin giderimi elde edilirken, 56 W ve 11β W gücünde lambalar kullanıldığında %78 ve %λ7 giderim elde edilmiştir. Lamba gücünün artmasıyla foton enerjisi arttığından giderim artmıştır. KAYNAKLAR Haque MM, Muneer M 2007. Photodegradation of norfloxacin in aqueous suspensions of titanium dioxide. Journal of Hazardous Materials, 145: 51-57. Homem V, Santos L 2011. Degradation and removal methods of antibiotics from aqueous matrices- A review. Journal of Environmental Management 92: 2304-2347. Nakata K, Fujishima A, 2012. TiO2 Photocatalysis: Design and Applications, Journal of Photochemistry and Photobiology C: Photochemistry Reviews, 13: 169-189. Ohtani B 2010. Photocatalysis A to Z-what we Know and what we do not know in a scientific sense. Journal of Photochemistry and Photobiology C: Photochemistry Reviews, 11: 157-178. POSTER PRESENTATION 382 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Ötker HM, Akmehmet-Balcıoğlu I β005. Adsorption and degradation of enrofloxacin, a veterinary antibiotic on natural zeolite. Journal of Hazardous Materials, 122: 251-258. Paola AD, Lopez EG, Marci G, Palmisano L 2012. A Survey of photocatalytic materials for environmental remediation. Journal of Hazardous Materials, 211-212: 3-29. Paul T, Dodd MC, Strathmann TJ. 2010. Photolytic and photocatalytic decomposition of aqueous ciprofloxacin: Transformation products and residual antibacterial activity. Water Research, 44: 31213132. Yalap Seven K, Akmehmet-Balcıoğlu I β008. Oksitetrasiklinin ileri oksidasyon ile arıtımına su bileşenlerinin etkisi. Su Kirlenmesi Kontrolü, İTÜ Dergisi, 18(β-3): 51-60. POSTER PRESENTATION 383 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Karanfil Çiçeğinin (Dianthus caryophyllus L.) Farklı Toprak Türlerinde Çimlenme Fizyolojisinin İncelenmesi; Gaziantep’te Bir Sera Uygulaması Kamil Mencik1*, Ömer Faruk Gecesefa1, Kenan Ercan1 *1 Gaziantep Üniversitesi, Nurdağı Meslek Yüksekokulu, Gaziantep, Türkiye Sorumlu yazar e-mail: kercan@gantep.edu.tr Özet Bu çalışmada farklı toprak türlerinin Karanfil çiçeğinin (Dianthus caryophyllus L.) tohumdan çimlenmesine etkisi araştırılmıştır. Tohumların çimlenmesi için perlitμtorf karışımı (1μβ oranında), açık arazi toprağı ve torf-açık arazi toprağı karışımı (1μ1 oranında) kullanılmıştır. Toplam γ4 tohum uygun büyüklükteki viyollere ekilmiştir. Bu tohumların 1β tanesi perlit-torf karışımına, 11 tanesi açık arazi toprağına, 11 tanesi de torf-açık arazi toprağı karışımına ekilmiştir. Tohumlar sıcaklık nem ve ışık miktarı gibi aynı fiziksel şartlara tabi tutulmuştur. Ekilen tohumlar periyodik olarak kontrol edilmiştir. Yapılan çalışma sonucunda çimlenme oranları perli-torf karışımında %67, açık arazi topraklarında %γ6, torf-açık arazi toprakları karışımında ise %6γ olarak tespit edilmiştir. Anahtar Kelimeler: Karanfil, Dianthus caryophyllus, çimlenme fizyolojisi, toprak 1. GİRİŞ Karanfil (Dianthus caryophyllus L.) anavatanı Akdeniz bölgesidir. Aynı zamanda Caryophllaceae familyasının bir üyesidir. Ülkemizdeν karanfil, β46 milyon adet üretimi ve 18.β71.67λ USD üretim değeri ile kesme çiçek türleri arasında birinci sırada yer almaktadır ve karanfil üretiminin en yaygın olarak yapıldığı iller Antalya ve İzmir’dir (Kocabaş ve ark., β01β). Karanfil de üretimν tohumla, çelikle ve meristem kültürü ile olmak üzere üç yolla yapılmaktadır. Ülkemizde karanfil üreticilerinin büyük bir kısmı çelikle üretim yapmaktadır. Çelikle üretimde anaç bitkilerden alınan çelikler tekrar anaç bitki olarak kullanılmaktadır. Bu işlem yıllarca devam etmektedir. Modern karanfil yetiştiriciliği kurallarına aykırı olan bu durum sonucu kalite ve verim düşmektedir (Kocabaş ve Kaplan 2007). Ülkemiz genelinde, gerek sera yetiştiriciliği gerekse açıkta yetiştiricilikte birim alandan düşük verim alınmasının nedenlerinin başında kalitesiz fidelerle üretim yapılması gelmektedir. Sağlıklı ve kaliteli fide ile üretim yapmak verimi olumlu yönde etkileyen en önemli faktörlerden birisidir (Kocabaş ve Kaplan β007). Karanfil beslenmeye karşı toleranslı bir bitki olmasına rağmen, yetiştiriciliğinin yapıldığı toprakların pH değerinin 5.5–7.5 ve toprakların saturasyon ekstraktlı elektriki kondaktivitelerinin 0.7– 1.3 mmhos/cm olmasının karanfil üretiminde verim ve kaliteyi arttıracağı belirtilmiştir. Ancak karanfil yetiştirme ortamının doygunluk ekstraktının elektriksel iletkenlik değerleri ortalama β.58, γ.βλ ve γ.5β mS.cm –1 olarak belirlemiş ve bu yetiştirme ortamlarında karanfilin çiçek kalitesi ve veriminin etkilenmediği saptanmıştır. Karanfil yetiştiriciliği için uygun toprak özelliğininν tınlı bünyeli, organik madde içeriği %γ–6, kireç içeriği %4–7, pH 6.0–7.5 arasında, tuzluluk ise 0.7–1.γ mmhos/cm olduğu bildirilmiştir (Kocabaş ve ark., β01β). Bu çalışmanın konusu farklı çimlendirme alanlarında karanfil bitkisi tohumlarının çimlenme fizyolojisinin incelenmesidir. 2. MATERYAL VE METOD 2.1. Materyal, Uygulamalar ve Denemenin Kurulması Bu çalışmadaν bitki materyali olarak karanfil çiçeği (Dianthus caryophyllus) kullanılmıştır. Toplam 34 bitki tohumu ile çalışma gerçekleştirilmiştir. Tohumların çimlenmesi için perlitμtorf karışımı (1μβ oranında), açık arazi toprağı ve torf-açık arazi toprağı karışımı (1μ1 oranında) kullanılmıştır. Tohumların 1β tanesi perlit-torf karışımına, 11 tanesi açık arazi toprağına, 11 tanesi de torf-açık arazi toprağı karışımına ekilmiştir. Tohumlar sıcaklık nem ve ışık miktarı gibi aynı fiziksel şartlara tabi tutulmuştur. POSTER PRESENTATION 384 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tohumlar 45’li viyollere doğrudan ekilmiştir. Tohumlar ortalama 1 cm’lik derinliğe bırakılmıştır. Viyoller sera içerisinde güneş ışığını aynı oranda alacak şekilde konumlandırılmıştır. Sulamada ölçüt olarak tohum alanının nemli kalacağı şekilde yağmurlama sistemi kullanılmıştır. Ekilen tohumların periyodik olarak günlük (gündüz ve gece) kontrolleri yapılmıştır. 2.2. Ortam Parametrelerinin Belirlenmesi Çalışmada γ farklı karakterde çimlenme ortamı seçilmiştir. Bunlardan biri ticari olarak satılan torf ortamlarından seçilmiştir. Diğer ortam ise açık arazi topraklarından alınmıştır. Bir diğer ortam ise yukarıdaki farklı kültürdeki iki toprağın bire bir oranında karıştırılması ile elde edilen topraktır. Bu farklı toprak türlerinin pH, iletkenlik, toplam organik madde miktarı, toprak cinsi belirlemek üzere fizikokimyasal analizleri yapılmıştır. 3. SONUÇ 3.1. Fizikokimyasal Değerler Çimlenmenin gerçekleştiği ortamın pH değeri, ortamın toplam tuzluluk miktarı, toplam organik madde miktarı ve toprağın cinsi gibi fizikokimyasal ve mineralojik özellikleri tohum çimlenmesi için büyük önem taşımaktadır. Aynı zamanda nem ve sıcaklık gibi fiziksel şartlar da çimlenme fizyolojisini etkileyen etmenlerdendir. Çalışmanın yapıldığı toprağın fizikokimyasal özellikleri Tablo.1’de verilmiştir. Çimlenme ortamı Torf Açık Arazi Toprağı Tablo 1. Toprağın fizikokimyasal özellikleri pH 6.1 7.7 iletkenlik 550 1004 Toprak Cinsi Humuslu Killi OM 90.0 6.6 Bu çalışma Kasım-Aralık aylarında 60 günlük bir dönem içerisinde gerçekleştirilmiştir. Çalışmanın yapıldığı sera ortamında ortalama sıcaklık değerleri gündüz βγ oC, gece 15 oC olarak tespit edilmiştir. Gece ve gündüz ortalama nem değeri %60 olarak görülmüştür. 3.2. Bitkinin Fizyolojik Gelişimi Tohumların ekimi ile başlayan süreçte ilk topraküstü sürgünler β5. günde çıktığı gözlemlendi. Yapılan çalışma sonucunda çimlenme oranları perlit-torf karışımında %67, açık arazi topraklarında %γ6, torf-açık arazi toprakları karışımında ise %6γ olarak tespit edilmiştir. Tablo 2. Farklı ortamlarda çimlenme oranları Örnek sayısı Çimlenen tohum sayısı Çimlenme yüzdesi Torf-Perlit (2:1) 12 8 67 Açık Arazi Toprağı 11 7 63 Torf- Açık Arazi Toprağı (1μ1) 11 4 36 Çimlenme ortamı Farklı çimlenme ortamlarında çimlenme yüzdeleri şekil 1. de verilmiştir. Bu çalışmada karanfil çiçeğinin çimlenmesi için farklı çimlenme ortamları denenmiştir. Bunun için öncelikle çimlenme ortamlarının analizi yapılmıştır. Tablo 1.’de görüldüğü gibi torfun pH düzeyi açık arazi toprağına göre daha düşük seviyede olduğu görülmektedir. Bunun yanında tuzluluk miktarının torf ortamında daha düşük seviyede olduğu anlaşılmaktadır. Organik madde miktarı açısından torf oldukça zengindir. Ancak açık arazi topraklarına bakıldığında torfa göre düşük oranda olduğu görülse de zengin organik madde miktarına sahip olduğu anlaşılmaktadır. Toprağın yapısı incelendiğinde tofun humuslu yapıda olduğu, açık arazi topraklarının ise aşırı killi olduğu anlaşılmaktadır. POSTER PRESENTATION 385 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 100 90 80 70 60 50 Çi le 40 e yüzdesi 30 20 10 0 Torf-Perlit (2:1) Açık Arazi Toprağı Torf- Açık Arazi Toprağı (1:1) Şekil 1. Çimlenme yüzdesi Yukarıda gösterilen toprak özelliklerine göre en yüksek çimlenme oranı %67 ile torf-perlit ortamındaν en düşük çimlenme oranı ise %γ6 ile açık arazi topraklarında gözlemlenmiştir. Çimlenme oranına pH, iletkenlik, toplam organik madde miktarı, besin elementleri gibi etmenlerin etki ettiği bilinmektedir. 4. TARTIŞMA Sulama, nem, sıcaklık, ışık miktarı gibi etkenlerin sabit ve eşit koşullarda olduğu düşünülürse çimlenme oranlarında en büyük etkiyi pH miktarının oluşturduğu söylenebilir. pH seviyesi azaldıkça makro ve mikro besin elementlerinin bitki tarafından alınabilirliği artmaktadır. Besin ortamı bazik yapıya dönüştükçe besinlerin bitkiler tarafından biyoyararlanım miktarları azalmaktadır. Asidik özelliği daha fazla olan torf ortamının (pHμ 6.1), açık arazi toprağına göre (pHμ 7.7) daha yüksek çimlenme oranına sahip olması literatür bilgileri ile örtüşmektedir. Bunun yanında toprak tuzluluk oranı, toplam organik madde miktarı ve toprak kirecinin de çimlenme oranına etkileri olduğu düşünülebilir. Toplam organik madde miktarının çimlenme oranına etkisi göz ardı edilemez. Ancak iki toprak türünün de zengin organik madde içeriğine sahip olması çimlenmeye etkinin karşılaştırılması açısından açık bir fikir vermemektedir. Torf ile açık arazi toprakları bire bir oranında karıştırıldığında çimlenme yüzdesinin sadece torf olan besi ortamına yakın olduğu görülmektedir. Buradan da tohum çimlendirmede maliyeti düşürme adına açık arazi toprağı ile torf karışımının daha verimli olabileceği sonucuna varılabilir. TEŞEKKÜR Yapılan çalışmalarda değerli fikirleri ile bizlere yön gösteren ve destek veren Yrd. Doç. Dr. Mehmet AYTEKİN ve Yrd. Doç. Dr. Mustafa PEHLİVAN’a teşekkürlerimi borç bilirim. KAYNAKLAR KOCABAŞ, I., ÇITAK, S., ASRİ, F. Ö., SÖNMEZ, S., & KAPLAN, M. (β01β). Depolanan ve Depolanmayan Karanfil Çeliklerine Yapraktan Uygulanan Fe-EDTA Gübrelemesinin Karanfil (Dianthus caryophyllus L.) Bitkisinin Beslenmesi Üzerine Etkisi. Anadolu Tarım Bilimleri Dergisi, βγ(β), 8γ-91. KOCABAŞ, I., & KAPLAN, M. (β007). Farklı Gübre Uygulamalarının Karanfil (Dianthus caryophyllus L.) Fidesi’nin Beslenme ve Renk Değerleri Üzerine Etkisi. Bahçe, γ6(1). KOCABAŞ, I., & KAPLAN, M. (β007). Köklendirme Döneminde Yapraktan Uygulanan Farklı Gübrelerin Karanfil (Dianthus Caryophyllus L)’in Beslenme, Kardeşlenme ve Kuru Ağırlığı Üzerine Etkisi. MEDITERRANEAN AGRICULTURAL SCIENCES, 20(2), 301-309. POSTER PRESENTATION 386 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Çeşitli hücre hatlarında Opunti ficus-indica spp. meyve ve yaprak ekstraktının in vitro sitotoksik etkisinin araştırılması Ilgın ŞİRİN1, Ata TURGUT1, Serpil YANBAKAN2, Demet İZGÜ1, Maksut COŞKUN3, Özgür ŞAHİN4, Üstün EZER2, Ahmet Emin KÜREKÇİ2 TED Ankara Vakfı Özel Lisesi, Ankara LÖSANTE Çocuk ve Yetişkin Hastanesi, Ankara, TÜRKİYE. 3 Ankara Üniversitesi, Eczacılık Fakültesi Farmasötik Botanik ABD, Ankara, TÜRKİYE 4 Bilkent Üniversitesi, Fen Fakültesi Moleküler Biyoloji ABD, Ankara, TÜRKİYE. *1 2 Sorumlu yazar e-mail: serpilyanbakan@gmail.com Özet Türkiye’de Akdeniz kıyı bölgelerinde kendiliğinden doğal olarak yetişen devedikeni, kaynanadili, Frenk inciri yerel adları ile bilinen Opuntia ficus-indica, antioksidan aktivite varlığı, antikanserojen ve antiinflamasyon etkileri ile bilinen Cactus ailesine mensup bir bitkidir. Bu araştırma ile farklı dozlardaki O. ficus-indica meyve ve yaprak ekstraktlarının prostat, meme ve kolon kanseri hücre hatları üzerindeki sitotoksik etkisi methyl thiazolyl tetrazolium (MTT) testi ile değerlendirilmiştir. Optik dansite (OD), doz bağımlı inhibisyon (%) ve hücre canlılığını kontrol hücre grubuna kıyasla %50 oranında azaltan etkin doz (IC50) değerleri hesaplanarak elde edilen inhibisyon oranları karşılaştırılmıştır. Ekstrakt ihtiva etmeyen kontrol hücre grubuna kıyasla, ekstraktların kanser hücrelerinin her üçüne birden 0,001-0,08 mg/ml değişen gayet düşük etkin IC50 doz aralığı ile %1λ-74 gibi yüksek oranda bir inhibisyon yüzdesi gösterdiği belirlenmiştir. Ekstraktlara ait IC50 etkin dozların ve inhibisyon yüzdelerinin belirlenmesi amacıyla SPSS ve Excel programları kullanılmıştır. Bu çalışma, bitkiye ait ekstraktların yaygın görülen kanserli hücreler üzerindeki in vitro sitotoksik etkisinin detaylı olarak ele alındığı Türkiye’deki ilk araştırmadır. Minumum dozlar ile elde edilen yüksek inhibisyon oranları, ülkemizdeki O. ficusindica’nın dünya üzerindeki benzerlerine kıyasla daha yüksek polifenolik ve antioksidan varlığına sahip olduğunu düşündürmektedir. Araştırma, biyolojik ve tıbbi aktivite çalışmaları ile derinleştirildiğinde, ülkemiz ve dünyadaki tamamlayıcı ve alternatif tıp ile aromatik bitki çeşitliliğinin sürdürülmesine katkı sağlayacaktır. Anahtar Kelimeler: Opuntia ficus-indica, in vitro, IC50, sitotoksisite, MTT, prostat, kolon, meme kanseri hücre hatları. 1. GİRİŞ Çalışmada ülkemizde doğal olarak yetişen Frenk inciri, Hint inciri yerel adları ile bilinen, kaktüsgiller (Cactaceae) familyasında sınıflanan (Karamanoğlu, 1λ76) O. ficus-indica cinsinin tipik türü olan O. ficusindica ‘nın meyve ve yaprak metanol ekstarktları hazırlanarak kullanılmıştır. Antioksidan fenolik bileşikler acısından zengin olan meyve, yaprak ve diğer kısımlarının antikansorejen ve sitotoksik etkisinin prostat, kolon kanseri ve kronik hastalıklar üzerinde in vitro olarak değerlendirildiği çeşitli araştırmalar (ChavezSantoscoy, 2009, Kim ve ark., 2014, María ve ark., β017) mevcuttur. Bu bildiri ile bitkiye ait meyve ve yaprak metanol ekstraktlarının üç farklı kanserli hücre hattı üzerindeki sitotoksik aktivitelerinin karşılaştırılması amaçlanmıştır. 2. MATERYAL VE METOD O. ficus-indica meyve ve yaprakları Antalya yöresinden Eylül-Ekim β016 tarihleri arasında toplanarak metanol uçurma metodu (Su ve ark β008) ile meyve ve yaprak ekstraktları hazırlanmıştır. Her bir ekstrakt %0,1 dimetil sülfoksit (DMSO) içerisinde çözdürülerek, her bir ekstrakt türü için dört ayrı doz (0,002 mg/ml, 0,001 mg/ml, 0,0002 mg/ml, 0,0001 mg/ml) hazırlanmıştır. İn vitro hücre ortamının sağlanması amacıyla, American Type Cell Culture (ATCC -USA), Prostat (PC-3), Kolon (HCT 116), Meme (MDA MB 231) karsinom (Ca) insan kanser hücre hatları kullanılmıştır. Her bir hücre hattı, β5 cm2’lik flasklarda %10 fötal dana serumu (Capricorn, Germany), %1 antibiyotik katkılı (PenStrep) RPMI 1640, (Capricorn, Germany) ilavesi ile 370C’de %5 CO2‘li ortamda kültüre edilmiştir. λ6 gözlü pleyt (Biologix) gözlerine 100’er µl 1×10 4 hücre/göz hücre ekimi yapılarak, %5 CO2’li inkübatör içerisinde γ7°C‘de 48 saat süreyle inkübe edilmiştir. Her bir test materyali için altışar tekrarlı göz ayrılarak ilgili ekstraktın ilgili sulandırma basamağından her bir göze 100’er µl konularak β4 saat süreyle inkübe edilmiştir. Sitotoksisite etkinliğini değerlendirmek amacıyla, her bir göze β0 µl γ-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) konularak 3 saat POSTER PRESENTATION 387 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org inkübasyon sonunda mavi renkli formazan kristallerinin oluşumu gözlemlenmiştir. Süre sonunda her bir göze 100 ηL DMSO konularak ELISA okuyucusu (OD 540 nm) ile değerlendirilmiştir. inhibisyon değerleriν % İnhibisyon=[(OD örnek-OD blank)/(OD negatif kontrol-OD blank)]×100 formülü ile hesaplanmıştır. Bu dozlara ait % inhibisyon değerleri XY dağılımı grafiğinden yararlanarak infektif doz 50 değeri (IC50 mg/ml) ve R2 değerleri belirlenmiştir. IC50 değerleri, dağılıma ait eğilim çizgisi eğrisinden hesaplanmıştır. İnhibisyon yüzdeleri arasındaki farkın istatistiksel açıdan anlamlılığının tespiti amacıyla, SPSS 15.0 istatistik programı ile bağımsız örnekler t-testi, Kruskal-Wallis ve Mann Whitney-U veri analizleri kullanılmıştır. İstatistiksel anlamlılık için p<0.05 değeri kabul edilmiştir. 3. SONUÇ Bitkiye ait ekstraktların kontrol grubuna kıyasla kanserli hücre proliferasyonunu azalttığı gözlemlenmiştir. Negatif kontrol yani ekstrakt içermeyen gözlerdeki sitotoksisite değeri %0 olarak yani %100 canlılık tespit edilmiştir. Ekstraktlara ait doz miktarları ile inhibisyon yüzdeleri arasında pozitif bir korelasyon (p=0,018) varlığı tespit edilmiştir. Buna göreν en yüksek (0,0β mg/ml) ve en düşük (0,001 mg/ml) yaprak metanol ekstraktı dozları ile elde edilen en yüksek ve en düşük inhibisyon yüzdeleri, Prostat ca ile %74 ve %58ν Kolon ca ile %48 ve %ββν Meme ca ile %50 ve %50ν meyve metanol ekstraktı -Prostat ca ile %52 ve %19; Kolon ca ile %31 ve %19; Meme ca ile %β0 ve %β0 olarak belirlenmiştir (Grafik 1). IC50 etkin dozları (mg/ml) (Tablo 1) karşılaştırıldığında, meyve ekstraktı ile en düşük etkinin (0,08 mg/ml) Meme ca ile ve en yüksek etkinin (0,0018 mg/ml) prostat ca ileν yaprak ekstraktı ile en düşük etkinin (0,0019 mg/ml) kolon ca ile ve en yüksek etkinin (0,001 mg/ml) prostat ca ile olduğu görülmüştür. Ekstrakt gruplarının hücreler üzerindeki inhibisyon etkileri arasındaki farklılığın anlamlı olduğu bağımsız örnekler t-testi, (p=0,000) ve ANOVA testi ile (Tablo β) belirlenmiştir. Bu farklılığın prostat ve meme kanseri hücre hatlarında daha yüksek olduğu ve yaprak ekstraktı grubu lehine gerçekleştiği belirlenmiştir (Mann Whitney-U=14: z=-3,352, p=0,001). Ekstraktların prostat (p=0,0β0) ve meme (p=0,01λ) hücre hattı üzerindeki etkisi, kolon hücre (p=0,386) hattına göre anlamlı bir farklılık arz etmektedir. Her iki ekstraktın prostat ca hücreleri üzerinde yüksek düzeyde, kolon kanseri hücre hattında orta seviyede ve istatistiksel açıdan anlamlı olmayan bir sitotoksik etki oluşturduğu tespit edilmiştir (Şekil 1, Tablo γ). 80 Yaprak ekstraktı Prostat ca %inhibisyonu % İnhibisyon 70 Yaprak ekstraktı Meme ca %inhibisyonu 60 50 Yaprak ekstraktı Kolon ca %inhibisyonu 40 Meyve ekstraktı Prostat ca %inhibisyonu 30 20 Meyve ekstraktı Kolon ca %inhibisyonu 10 0 NK 0,001 0,002 0,01 0,02 (mg/ml) Meyve ekstraktı Meme ca %inhibisyonu Grafik 1. Meyve ve yaprak metanol ekstraktlarına ait inhibisyon yüzdeleri. Tablo 1. Meyve ve yaprak metanol ekstraktlarına ait IC50 ve Rβ değerleri. Kanser Hücre Hattı Türü Prostat kanseri hücre hattı IC50 Etkin Doz (PC-3) R2 değeri Meyve ekstraktı 0,0018 mg/ml 0,9839 Kolon kanseri hücre hattı IC50 Etkin Doz (HCT-116) R2 değeri 0,0047mg/ml 0,5758 0,002 mg/ml 0,8228 Meme kanseri hücre hattı IC50 Etkin Doz (MDA-MB-231) R2 değeri 0,0810 mg/ml 0,087 0,0013 mg/ml 0,1894 POSTER PRESENTATION metanol Yaprak ekstraktı 0,0010 mg/ml 0,9268 metanol 388 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Tablo 2. Independent t-test ve ANOVA test tabloları Group Statistics: %inhibisyon ortalama±ssapma % İnhibisyon Ekstrakt türü N Mean Std. Deviation Std. Error Mean Meyve ekst 12 25,98 10,715 3,093 Yaprak ekst 12 49,33 13,963 4,031 Sum Squares of df ANOVA Table Gruplar arası % İnhibisyon Ekstrakt türü * (Combined) Mean Square F Sig. ,000 3509,002 1 3509,002 Grup içi 3712,503 22 168,750 Toplam 7221,505 23 20,794 Şekil 1. Bağımsız örnekler t-testi kutu grafikleri Tablo 3. Ekstrakt türü ve hücre hattına bağlı % inhibisyon ve etkin dozların karşılaştırılması Ekstrakt türü Yaprak ekst Meyve ekst Hücre Hattı Prostat Ca Meme Ca Kolon Ca Prostat Ca Kolon Ca Meme Ca %İnhibisyon (ortalama±standart sapma) 65,50± 7,7 48,75± 5,5 γ6,β5± 1β,γ γ1,λ5± 16,1 β7,00± 6,7 1λ,00± 1,1 IC50 Etkin (mg/ml) 0,001010000 0,001285005 0,001907059 0,001820157 0,004761261 0,080994621 Doz 4. TARTIŞMA Bitkiye ait farklı ekstratların hücreler üzerindeki antikansorejen etkisinin araştırıldığı birçok araştırmada (Butera ve ark., β00β, Khatabi ve ark., β01γ, Faten ve Rehab, β014) total fenolik bileşen miktarı ile antikansorejen özelliğinin parelel bir artış içinde olduğu bildirilmektedir. Yaprak ve meyve ekstraktlarının çeşitli kanser hücreleri üzerinde in vitro sitotoksik aktivesinin belirlenmesi amacıyla yapılan çalışmamızda, bitkiye ait yaprak ekstraktının tüm hücre hatlarında %4λ,γ±1γ,γ ortalama inhibisyon ve 0,001-0,002 mg/ml IC50 etkin doz aralığı ile istatistiksel olarak anlamlı bir düzeyde (p=0,000) bir sitotoksik etki gösterdiği POSTER PRESENTATION 389 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org belirlenmiştir. Çalışmamız, meyve ekstraktı uygulanan kolon kanseri hücrelerinin meme kanseri hücrelerine göre daha duyarlı olduğunu bildiren araştırmalar (Kim ve ark., β015) ile uyum göstermektedir. Çalışmamızda meyve metanol ekstraktı-prostat ca ile elde edilen en etkili dozun (0,018 mg/ml), Kannusamy ve Rengaswamy (β016) tarafından meyve metanol ekstraktı -HeLa hücreleri üzerindeki en etkili dozdan (0,04 mg/ml) yaklaşık olarak dört kat daha duyarlı olduğu tespit edilmiştir. Bu çalışma ile elde edilen bulgular, ülkemizdeki Opuntia ficus-indica’ya ait polifenolik ve antioksidan madde içeriğinin diğer Akdeniz ülkeleri ile kıyaslandığında çok daha yüksek düzeylerde olabileceğini düşündürmektedir. Sonuç olarak, ülkemize ait zengin bitki florasından sadece biri olan Opuntia ficus-indica’nın antioksidan ve apoptotik etkilerinin, içerdiği biyoaktif bileşikler ve polifenoller düzeyinde ele alındığı daha ayrıntılı çalışmalar ile değerlendirilmesi gerekmektedir. KAYNAKLAR Butera D, Tesoriere L, di Gaudi F, Bongiorno A, Allegra M, Pintaudi AM, Kohen R, Livrea MA 2002. Antioxidant activities of sicilian prickly pear (Opuntia ficus indica) fruit extracts and reducing properties of its betalains: Betanin and indicaxanthin. J. Agric. Food Chem, 50: 6895–6901. Chavez-Santoscoy RA, Gutierrez-Uribe JA, Serna-Saldívar SO β00λ. “Phenolic composition, antioxidant capacity and in vitro cancer cell cytotoxicity of nine prickly pear (Opuntia spp.) juices,” Plant Foods for Human Nutrition, 64(2): 146-152. Faten MAE, Rehab FMA 2014. Antioxidant and Anticancer Activities of Different Constituents Extracted from Egyptian Prickly Pear Cactus (Opuntia ficus-indica) Peel. Abou-Elella and Ali, Biochem Anal Biochem, 3:2. doi: 10.4172/2161-1009.1000158. Kannusamy G, Rengaswamy G 2016. Anticancer Activity of Methanol Fruit Extract of Opuntia ficus indica Against Cervical Cancer Using Hela Cell Line. Int J Pharm Bio Sci, 7(3): 712–720. Karamanoğlu K 1λ76. Türkiye Bitkileri, Ankara Üniversitesi Eczacılık Fakültesi Yayınları, Sayıμ γγ, cilt 1. Khatabi O, Hanine H, Elothmani D, Hasib A 2016. Extraction and determination of polyphenols and betalain pigments in the Moroccan Prickly pear fruits (Opuntia ficus indica). Arab. J. Chem. 9(1): 278281.doi:10.1016/j.arabjc.2011.04.001. Kim J, Soh SY, Shin J, Cho CW, Choi YH, Nam SY 2015. Bioactives in cactus (O. ficus-indica ficus-indica) stems possess potent antioxidant and pro-apoptotic activities through COX-2 involvement. J Sci Food Agric. 95(13): 2601-6. doi: 10.1002/jsfa.6968. María SSD, Ana-Paulina BR, Cécile HT, Françoise G, Anne NS 2017. Opuntia spp.: Characterization and Benefits in Chronic Diseases. Review Article. Oxidative Medicine and Cellular Longevity. Volume 2017(2017): 1-17. Article ID 8634249,. doi.org/10.1155/2017/8634249. POSTER PRESENTATION 390 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The Effects Of Some Plant Extracts On The Digestive And Urinary System Yasemen ADALI1, Özlem ÖNEN2, Gülname FINDIK GÜVENDİ3, Hatice BEŞEREN4, Hasan Basri ŞENER5 18 Mart University, Medicine Faculty, Medical Pathology Department,Çanakkale 2 Kafkas University, Science and Art Faculty, Biology Department, Kars 3 Recep Tayyip Erdoğan Üniversity, Medicine Faculty, Medical Pathology Department,Rize 4 Kafkas University, Veterinary Medicine Faculty, Pathology Department, Kars 5 Detay Pathology and Cytology Laboratory, Ankara Corresponding Author: e-mail: hbeseren@ymail.com Abstract It is a very wide market, from herbal products to slimming medicines, to blends sold in transit. Many herbal products have been used for years and are known to be useful. However, some herbal products can cause serious side effects on the users. Traders say that most of these herbal products are natural. Unlike medicines, herbal products are not tested before use and therefore can not be said to be safe. Some of these products contain toxic substances and pollen; this can lead to diseases and side effects in some people. Some of them may contain substances such as steroids and estrogens, which are not mentioned on the label. Some of them contain poisonous substances such as arsenic, mercury, lead and pesticide. Apart from this, it is very important to set the dosage as well as the content. Whether it's medicine or herbal products, it's often the dose that causes toxicity. Excessive or unnecessary use causes diseases. In this article we will try to show the positive and negative aspects of the histopathological results on the digestive system and the urinary system of studies on current plant extracts. Key words: Liver, Kidney, Pancreas, Plant extract Introduction Recently, the use of herbal products like medicine has become widespread. It is a very worrying and anxious situation to recommend to people and institutions that are not sufficiently competent in terms of healthcare identity through media (WHO traditional medicine strategy 2002– 2005). For this reason, the development of an approach that draws the scientific and ethical framework of this subject has become a matter of responsibility for the institutions and individuals working in this field (Mosihuzzaman et al., 2012) ( Wilt et al. 1998). In this article, we aimed to draw attention once again to the digestive system of the drugs and the histopathological effects of the drugs on the urinary system by compiling the studies done in the world and in our country related to the plant extracts. The authenticity of the accumulation, experience and professional practice of each study was seen as a wealth and in this article it was aimed to protect and develop the health of the community and to take into account the scientific data available (De smet et al., β005) (Dickinson et al., β00λ) (Özyazıcıoğlu et al., β01β). What is Herbal Extract? Each plant has one or more active substances in its essence. This is the name given to the extract of the plant which is used as extraction material by means of extraction and to be presented as food supplement to human health and also used as medicine raw material (Traditional Medicine) (Hansel et al., 1996) (Tanker, 1985, 1990). How to Plant Extraction? It is obtained as a result of carrying out osmosis processes using special extraction methods from dried plants (Heinrich et al., 2004). Use Case Extraction Plant in the World and Turkey The use of herbal products is based on thousands of years. They have been in use since the 3000's on the use of these products and are known to have been used for 60,000 years (Mosihuzzaman et al., 2012). According to a report by the World Health Organization, 70-80% of POSTER PRESENTATION 391 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org the world population is registered for primary health care applications (The ABC Clinical Guide to Herbs, Blumenthal M (Ed), American Botanical Council/Thieme, New York 2003). It is also recorded that in the United States, $ 60 billion has been spent on this area each year and $ 5 million has been spent in Europe since 2003, while 80% of African societies are recorded. In the study of 45,748 people in the 50-75 age group in the United States, those who are older are using more herbal extracts / herbal products than those of younger ones, those who have higher education status than those who are younger and those with normal body mass index (Tilburt et al., 2012). In Malaysia, 33.9% of participants used vegetable products. In Turkey, admitted to a university hospital 4 of every 10 mothers (45.2%) was recorded these types of products it makes available to the child (Dickinson et al., 2009) (Satia-Abouta et al., 2003).Yet among 12 cancer patients under the age of 18 was recorded in a study conducted in Turkey have applied to at least 73.3% of such applications (Karalı et al., β01β). Reasons for Use of Plant Extracts Many factors influence the frequency of use of these products. When these factors are examined, we can begin by increasing the use of process change in the concept of health (How safe is traditional medicine) (WHO Traditional medicine strategy 2002–2005). In other words, reduced trust, inequalities, expensive treatment options, and inability to reach everybody, hinders access to modern medical options cause individuals to have a tendency to produce individual solutions to health problems (Stasio et al., 2008). The responsibility of not having a societal point of view and maintaining the good state is left to the preference and application of the individual, but it also leads to the use of these medicines. These drugs are also used for reasons such as believing that these drugs are natural, increasing the progressive diseases due to age progression(Ruparel et al.,2011). We have also mentioned above that the scientific researches on the use of these drugs, which are produced by means of supporting rules. For example, according to a study done in the united States, the reasons for using joints as pain relief, prevention of memory loss, decreased fatigue state(Şen et al., β010). Women use more than men. Apart from that, shelf stands as an obstacle to effective and reliable applications with product sales application. These products are easily accessible(Mesina et al., 2006). And they have increased the use of their discourse that they are naturally harmless in exaggerated media programs (İzzo et al., β00λ) (Hsieh et al.,β01β)(Kaefer et al., β01β). Health Risks of Using Plant Extracts Pharmacognosy of plant extracts needs to be assessed from the point of collection of the correct part of the plant, detection of the active ingredients, heavy metal and microbial contamination. If assessment has not been made and the effects / risks have been put on the market without proof, it can lead to many health problems. There are many studies on this subject. These products have been shown to contain many toxic substances, poisons, heavy metals, chemical poisons. In addition, due to its pharmacokinetic properties it can cause toxicity when consumed with other medicines and even lead to death. The liver toxicity caused by these products also leads to liver failure. Hypertension is also the result of the phytochemical properties of the prolongation of bleeding time. The Effect of Plant Extracts on the Digestive System Unconscious use of plant extracts can cause some discomfort in our digestive system. For example, unconscious aloe vera and extracts from Sweetgum tree plant can cause abdominal pain, diarrhea, Chappenal plant extract liver damage, John's wort extract digestive system complaints, Senna extract abdominal pain, liver damage. Also after the unconscious use of the GI bleeding, the event is dramatizing until the liver failure. Effect of Plant Extracts on Urinary System As in the digestive system, unconscious consumption of the extract in the urinary system causes disturbances. Particularly when the kidneys are not dosed, they are damaged, kidney stones are formed and further progression to renal failure. For example, unconscious consumption of Chappenal and Flavonoid plant extracts causes renal damage. POSTER PRESENTATION 392 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Histopathological Effects of Digestive System and Urinary System on Plant Extracts Histopathological effects of many plant extracts were investigated by various doses of oral, intravenous, intraperitoneal, intramuscular and various routes on mice. For example, Modaresi and colleagues administered ginger extract intraperitoneally to male rats at doses of 10 mg, 20 mg and 40 mg for 48 days at intervals of 20 days. This application has looked at the effects of liver, kidney. The results are as follows; 10 mg and 20 mg administration: histopathological findings in the liver are normal. Very few harmful effects have been observed in the kidneys. In 40 mg administration; Renal tubular degeneration, glomerulosclerosis and germerul hyperatrophy were seen in the kidneys, increased toxicity, increased interstitial inflammation, hyalin and basement membrane thickening. In this application, no abnormal findings were found in the liver, especially kidney damage (Modaresi et al., 2011). In another study, Land and colleagues administered male Rhaphidophora decursive plant extract to male rats for orally in the form of 140 mg, 210 mg, 2100 mg, 3500 mg for 28 days. They eventually looked at the histopathological effects of kidney and liver. Given the histopathological effects of renal, 2100 mg and 3500 mg doses were noticed in granular cell formation and 3500 mg dosing, especially acute toxicity and protein increase. Acute toxicity and granular cell formation were also observed in the 210 mg dose application (Figure-1, Figure-2). In liver histopathological examination; At doses of 2100 mg and 3500 mg, active kupffer cells, sinicoidal dilation, cytoplasmic vacuolization were observed. Chronic toxicity and cytoplasmic vacuolization were observed in 140 mg and 210 mg dose applications (Figure-3) (Arsad et al., 2014). Figure 1: Pathological changes in kidney tissue. GC: Granular cast, CC: Cytoplasmic cast (HE, X400) (Arsad et al., 2014). Figure 2: Pathologic changes in kidney tissue. PC: Protein cast (HE, X400) (Arsad et al., 2014). POSTER PRESENTATION 393 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 3: Pathological changes in the liver. CPV = Cytoplasmic vacuolation, CV = Central vein, KC Kupffer cell, SD = Sinusodial dilatation (HE, X400) (Arsad et al., 2014). Nottidge and colleagues in Nigeria have been able to extract Garcinia Coke with ethenol to feed on three dogs, 500 mg, 1000 mg daily for three meals a day for 6 weeks. Histopathological evaluation of various organs of otopside made at the end of 6 weeks. Necrosis, mononuclear aggregates, and mild portal fibrosis were seen in 1000 mg administered group as well as vacuolar degeneration in hepatocytes in the liver of 500 mg IUggulana groups. In addition, neutrophils, lymphocytes, macrophage formation and mild periportal fibrosis and kupffer cell proliferation were observed (Figure 4). When the kidney sections are examined; multiple focal glomerular degeneration areas, and coagulative necrosis of focal mononuclear cell aggregation of proximal tubules (Figure 5). In addition, the cortex and medulla have pink tubules casting (Figure 5). When the small intestine sections were examined, mild villous atrophy, goblet cell hyperplasia, lamina propria and submucosa showed diffuse neutrophil and lymphocyte infiltration (Figure 6). These appearances were more severe in 1000 mg applications. In the testis sections, 500 mg doses of the animals were also irregularly found in about 70% of the seminiferous tubules, and the epithelial cells were hypoplasic. At 1000 mg doses, semen tubules were found to be severely fibrotic (Figure 7) (Notidge et al., 2008). Figure 4: A dog liver examination given 1000 mg / kg G. coke extract for 6 weeks. Severe vacuolar degeneration and necrosis of hepatocytes, mononuclear cell aggregations in the liver and mild portal fibrosis (H & E; x450) (Notidge et al., 2008). POSTER PRESENTATION 394 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 5: A dog kidney examination with 500 mg / kg G. coke extract for 6 weeks. In kidneys, a large number of focal glomerular degeneration sites, coagulative necrosis of proximal tubules and focal mononuclear cell aggregates. Also pinkish tubular casts in the cortex and medullary (H & E; x450) (Notidge et al., 2008). Figure 6: A small intestine examination of a dog given 500 mg / kg G. coke extract for 6 weeks. Moderate villous collapse and mild goblet cell hyperplasia (H & E; x600) (Notidge et al., 2008). Figure 7: A dog testis given 500 mg / kg G. Coke extract for 6 weeks review. Severe testicular hypoplasia, absence of live spermatids and spermatozoa in seminiferous tubules (H & E; x600) (Notidge et al., 2008). Abalaka and his colleagues conducted a 96-hour application of Clarias grariepinus named Adenium obesum root shell with ethanol at different doses and finally dissected and liver sections were examined by hematoxylin eosin staining. According to the results of the study, 6.25 mg POSTER PRESENTATION 395 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org administration showed clogging in hepatocyte vessels (Figure 8). In 7.50 mgL administration, liver cell defense mechanism was introduced and mononuclear infiltration increased and hepatocyte vacuole formation was observed in liver asinus cells (Figure 9). 8.20 mgL administration also increased hepatocyte vacuoles (Figure 10). In the 8.80 mgL application, severe clogging of the data structures and deterioration of the liver structure were observed (Figure 11). In the 9.30 mgL application, degeneration and haemorrhagic foci were increased in hepatocytes (Figure 12) (Abalaka et al., 2015). Figure 8: You will see the first cross-sectional liver cross-section. The area marked with a black arrow is the center ven and the area marked with a red arrow is the hepatocyte vocalis cells. Central venous occlusion was observed at the end of the 6.25 mgL application of the second section (H & E x 64) (Abalaka et al., 2015). Figure 9: The mononuclear infiltration cells and the red arrows of the structures marked with the black arrow on the liver of the 7.50 mgL application showed hepatocyte vacuole cells in the liver asinus cells (H & E x 64.) (Abalaka et al., 2015). POSTER PRESENTATION 396 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 10: Figure 10: Hepatocyte vacuole cells in areas marked with a red arrow on the hepatic liver examination with 8.20 mgL (H & E x 64.) (Abalaka et al., 2015). Figure 11: The area marked by the black arrow shows ven cocktail in the liver study with 8.80 mgL, while the area marked with red arrow shows the deterioration of the liver structure (H & E x 64.) (Abalaka et al., 2015). Figure 12: Areas showing green arrows on liver examination with 9.30 mgL applied degenerated hepatocyte and hepatocyte necrosis, area marked with blue arrow Hepatocyte vacuums and areas marked with red arrow Lobular haemorrhagic foci (H & E x 64. )(Abalaka et al., 2015). Uboh et al. Have looked at how psidium guajava plant extract acts on mouse liver enzymes, as well as hematological and histopathological effects. Blood and liver tissues were examined at the end of the application by 200 mg / kg oral route for 30 days. Kanda AST, ALT and ALP values were examined. Blood values were found to increase slightly above normal. Histopathologic POSTER PRESENTATION 397 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org examination revealed an increase in hepatocytes and a more prominent appearance of sinusoids. And the liver is considered relatively normal (Uboh et al., 2010). In 2010, Mohammadi and his colleagues applied the plant extract named Morus alba to the diabetic rats in India and examined their pancreas. Were injected intraperitoneally with a 400 mg / kg and 600 mg / kg intraperitoneal injection over 72 hours for 35 days. When the type-1 diabetic pancreas was examined, damaged nerve cells and ί-cells and langerhans islets showed increased necrosis. Necrosis was reduced at the end of the application of 400 mg / kg, and ί cells appeared to have a better appearance. No necrosis was observed after 600 mg / kg administration. As a result, the therapeutic effect of this plant extract has been elucidated and it has been noted that it regenerates damaged cells and corrects ί cells (Mohammadı et al., β010). Figure 13: Pancreatic cross section of diabetic mice in control group. EX: Exocrine pancreas, beta cell: beta cells, RBCs: red blood cells (CHP staining, 400x) (Mohammadı et al., 2010). Figure 14: Pancreatic cross section of diabetic mice in control group. Increased necrosis has been demonstrated with beta cells and langerhans islets damaged in the exocrine region in the Type-1 diabetic pancreas. EXμ Exocrine pancreas, ί cell: beta cells, RBCs: red blood cells (CHP staining, 400x) (Mohammadı et al., β010). POSTER PRESENTATION 398 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 15: Rat pancreas screening with type-1 diabetes at 400 mg / kg. Regularly distributed ί cells. EXμ Exocrine pancreas, ί cellμ beta cells, RBCsμ red blood cells (CHP staining, 400x) (Mohammadı et al., 2010). Figure 16: Rat pancreas screening with type-1 diabetes at 400 mg / kg. Regularly distributed ί cells. EXμ Exocrine pancreas, ί cellμ beta cells, RBCsμ red blood cells (CHP staining, 400x) (Mohammadı et al., 2010). In another diabetes study, plant extracts of S. Xantocarpum and P. Kurroa were applied to diabetic rats and positive changes were noted in the kidney, anchorose and liver at the end of the administration (Malar and Bai 2009). In the study of the alferaha, Lawsonia inermis named plant extract was given to the animals peritoneally in the form of 200 mg and 1000 mg for 42 days. At the end of the study, the liver, spleen and kidney structures were examined. Animals treated with 200 mg / kg showed moderate degenerative changes in renal sections and renal tubular damage. When the kidney section of animals POSTER PRESENTATION 399 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org was examined at 1000 mg / kg dose, cell death increased. When liver sections of 200 mg / kg animals were examined, degeneration and lymphocytic infiltration of hepatocytes were observed. Bile duct epithelium hyperplasia in liver lecithins, hyalinization in portal area hepatic arterioles, and highly lymphocytic infiltration were observed in 1000 mg / kg animals. No abnormal findings were observed in the splenic sections of animals in both doses (Alferah, 2012). Figure 17: Examination of the kidney section. 1a showed normal glomerulus and kidney tubules with arrow marks. Administration of 200 mg / kg at 1b showed mild degeneration of the kidney epithelium and priming of the kidney tubules. 1000 mg at 1C showed cell death at the end of administration. Apoptosis is shown with arrows (HE 400X)(Alferah, 2012). Figure 18: Cross section of the liver. In 2a, normal liver section was shown. Arrows showed normal hepatocytes. At 2b, 200 mg / kg dose resulted in moderate degeneration in the liver. Hepatocyte degeneration with arrows, stellate lymphocytic infiltration was demonstrated. At 2c doses of 1000 mg / kg doses resulted in severe grade degeneration. Lymphocytic infiltrates on the portal area with arrows, bile duct epithelial hyperplasia and hyalinization findings present in arterial walls have been shown (HE X) (Alferah, 2012). POSTER PRESENTATION 400 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 19: Spleen cross section examination. Normal findings were observed in all 3 sections including normal sections (W, white pulp, R, red pulp, C, central arteriole) (HE X) (Alferah, 2012). RESULT The studies on herbal medicines, which have been practiced in traditional custody since centuries, have been reviewed and summarized concretely. According to the evaluation made, the importance of these plant extracts is very important. While it may be beneficial to certain doses, doses above a certain limit may create a risk factor for health. It was recorded in studies that particularly harm liver and kidney structures. It has also been noted that not only in high vertebrate living organisms, but also in water-borne living organisms, severe over-dose application has also severely damaged the liver. In addition, some plant extracts have been administered with controlled doses for diseases that are particularly difficult to treat, such as diabetes, and have been shown to be partially healed. As a result; In studies performed, single plant extracts are used and doses are adjusted according to kg. For herbal extracts that are put on the market to prevent disease and not become ill, we can say that; These medicines, which you do not know about their content and dose, can cause serious health problems and lead to liver and kidney failure in particular. REFERENCES: Mehrdad Modaresi, Mozhgan Ghobadi Pour, Sayed Ali Tabeidian , Alireza Jalalizand 2011. Study of Histopathologic changes of the effect of Zingiber extract on mice kidneys 2011 International Conference on Food Engineering and Biotechnology vol.9. Nottidge H. O.Omobowale T. O., Taiwo V. O., Omotoso M. A. 2008. Histopathological Studies on the Effects of the Ethanolic Extract of the fruits of Garcinia kola on Selected Organs of the Dog. Int. J. Morphol., 26(4):1067-1072. Ablaka, S. E., Fatıhu, M. Y., Ibrahım, N. D. G. and Ambalı, S. F.β015. Liver histopathological changes in Clarias gariepinus exposed to ethanol extract of Adenium obesum stem bark. J. Morphol. Sci. , vol. 32, no. 1, p. 22-28. Friday E. Uboh, Iniobong E. Okon, Moses B. Ekong 2010. Effect of Aqueous Extract of Psidium Guajava Leaves on Liver Enzymes, Histological Integrity and Hematological Indices in Rats. Gastroenterology Researc;3(1):32-38. POSTER PRESENTATION 401 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Jamshid MOHAMMADI , Prakash R. NAIK 2012. The histopathologic eff ects of Morus alba leaf extract on the pancreas of diabetic rats. Turk J Biol 36;211-216 TUBİTAK doiμ10.γλ06/biy-100851. Malar and Bai.2009. Histopathological Studies of Plant Extract Treated and Control Diabetic Rats. Mosaid A. Z. Alferah 2012. Toxicity Induced Histological Changes in Selected Organs of Male (Wistar) Rats by Lawsonia inermis Leaf Extract. European Journal of Medicinal Plants, 2(2): 151158. Willcox ML, Bodeker G.2004. Traditional herbal medicines for malaria. BMJ;329:11569. WHO traditional medicine strategy 2002–2005. Geneva: WHO; 2002. Tilburt JC, Kaptchuk TJ. 2012. Herbal medicine research and global health: an ethical analysis. http:// www.who.int/bulletin/volumes/86/8/07-042820/en/. 26.8. De Smet PA. 2005. Herbal medicine in Europe--relaxing regulatory standards. N Engl J Med; 352:1176. Dickinson A, Boyonand N, Shao A.2009. Physicians and nurses use and recommend dietary supplements: Report of a survey/ Nutr J. 1;8:29. Haensel R, Hölzl J. 1λλ6. Lehrbuch der pharmazetischen Biologie, Springer Verlag ,BerlinHeidelberg New York. Türkiye’ye Özgü Beslenme Rehberi β004, Sağlık Bakanlığı Yayınları, Ankara. Traditional Medicine 2012. http://www.who.int/topics/traditional_medicine/en/ Mosihuzzaman M. 2012 Herbal medicine in healthcare--an overview. Nat Prod Commun; 7(6):80712. Ozdemir B, Sahin I, Kapucu H, Celbis O, Karakoc Y, Erdogan S, Onal Y. 2012 Feb 21. How safe is the use of herbal weight-loss products sold over the Internet/ Hum Exp Toxicol. Traditional Medicine. http://www.who.int/mediacentre/factsheets/fs134/en/index.html. 2.9.2012. Chan K. 2003. Some aspects of toxic contaminants in herbal medicines. Chemosphere ;52(9):136171. Tanker N, Tanker M. 1985 ve 1990. Farmakognozi Cilt 1 ve 2, Ankara Üniversitesi Eczacılık Fakültesi Yayınları No 58 ve 65, Ankara Üniversitesi Basımevi Ankara. Bruneton J. 1995. Pharmacognosy, Phytochemistry, Medicinal Plants, Lavoisier Publishing, Paris. Haensel R, Sticher O, Steinegger E.1999. Pharmacognosie-Phytopharmazie, Springer Verlag,Berlin, New York, Tokio. Heinrich M, Barnes J, Gibbons S, Willamson E. 2004. Fundamentals of Pharmacognosyand Phytotherapy, Churchill Livingstone,Edinburgh. Wilt TJ, Ishani A, Stark G, 1998. Saw palmetto extracts for treatment of benign prostatic hyperplasia: a systematic review. JAMA; 280:1604. The ABC Clinical Guide to Herbs, Blumenthal M (Ed) 2003, American Botanical Council/Thieme, New York. Chan K.2003. Some aspects of toxic contaminants in herbal medicines. Chemosphere;52(9):136171. Ohnishi N, Yokoyama T. 2004. Interactions between medicines and functional foods or dietary supplements. Keio J Med.; 53: 137-150. Sparreboom A, Cox MC, Acharya MR, Figg WD. 2004. Herbal remedies in the United States: Potential adverse interactions with anticancer agents. J Clin Oncol.; 22: 2489-2503. Satia-Abouta J, Kristal AR, Patterson RE, Littman AJ, Stratton KL. 2003. White E. Dietary Supplement and Medical Conditions the VITAL study Am J Prev Med; 24(1):43-51. Honda K, Jacobson JS. 2005. Use of complemantary and alternative medicine among United States adults: the influences of personality, coping strategies, and social support. Preventive Medicine, 40:46-53. POSTER PRESENTATION 402 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Kayaalp O. 1λλ8. Klinik Farmakolojinin Esasları.β. baskı, Hacettepe Taş Ankara,2001. 48 Winslow LC, Kroll DJ. Herbs as medicines. Arch Intern Med;158:2192-2199. Linde K, Mulrow CD.β00γ. St John’s wort for depression (Cochrane Review). Inμ The Cochrane Library, Issue 3,. Oxford: Update Software. Aziz Z, Tey NP. 2009. Herbal medicines:prevalance and predictors of use among Malaysian adults Complement Ther Med;17(1):44-50. Özyazicioğlu N, Ogur P, Tanriverdi G, Vural P.β01β. Use of complementary and alternative medicine and the anxiety levels of mothers of children with chronic diseases. Jpn J Nurs Sci;9(1):19-2 Karalı Y, Demirkaya M, Sevinir B. β01β.Use of complementary and alternative medicine in children with cancer: effect on survival. Pediatr Hematol Oncol.;29(4):335-44. Şen B, Meriçli F. β010. Boswelia serrata ve Bosvelik Asit Türevlerinin Artrozlarda Etkisi, Fitomed Bilimsel Fitoterapi Dergisi,14 : 36- 40. Stjernberg L, Berglund J, Halling A. 2006. Age and gender effect on the use of herbal medicine products and foodsupplements among the elderly Scand J Prim Health Care.;24(1):50- 5. Bateman J, Chapman RD, Simpson D.1998. Possible toxicity of herbal remedies. Scott Med J.;43(1):7-15. Izzo AA. 1998. Interactions between Herbs and Conventional Drugs: Overview of the Clinical Data. Med Princ Pract. ;21(5):404-28. Hsieh CF, Huang SL, Chen CL, Chen WT, Chang HC, Wu ML, Yang CC.2012. Increased risk of chronic kidney disease among users of non-prescribed Chinese herbal medicine in Taiwan. Prev Med. 2012 Aug;55(2):155-9. Epub. Kaefer CM, Milner JA. 2011. Herbs and Spices in Cancer Prevention and Treatment. In: Benzie IFF, Wachtel-Galor S, editors. Faydaoğlu E, Sürücüoğlu MS.β011. Geçmisten Günümüze Tıbbi Ve Aromatik Bitkilerin Kullanılması ve Ekonomik Önemi. Kastamonu Üni., Orman Fakültesi Dergisiν11 (1)μ 5β-67. Sinmez CC, Yaşar A.β011. Animal-Based Drugs Employed At Folkloric Veterinary Medicine in Bozlak Culture of Central Anatolia. Lokman Hekim; Supplement, 12. Canooğlu E, Atatuş Y, Bekyürek T. β010. Organik Hayvancılıkta Veteriner Homeopati, Türkiye I. Organik Hayvancılık Kongresi Kelkit. Chan TY. 2009. Potential risks associated with the use of herbal anti-obesity products. Drug Saf. ;32(6):453-6. Yarsan E. β007. Veteriner Sağlık Ürünleri ve Sebest Veteriner Hekimil Sempozyumunun ardından. Türk Veteriner Hekimleri Birliği Dergisiν7(1-2):34-41. Dokuzuncu Kalkınma Planı (β007-β01γ), Veteriner İlaç Sanayii Çalışma Grubu Raporu, β01- 237. Bischoff K, Guale F. 1998. Australian tea tree Oil Poisoning in three purebred cats, Journal of Veterinary Diagnostic Investigation;10:208. Villar D, Knight MJ, Hansen SR, Buck WB.1994. Toxicity of melaleuca oil and related essential oils applied topically on dogs and cats. Vet Hum Toxicol;36(2),139-42. Levy B. The Complete Herbal Book For The Dog, Faber and Faber Limited, 1950, 24 Russel Square, London. Birinci S. β008. Doğu Karadeniz bölgesinde doğal olarak bulunan faydalı bitkiler ve kullanım alanlarının araştırılması. Çukurova Üniversitesi, Fen Bilimleri Enstitüsü, Yüksek Lisans Tezi. Şarışen Ö, Çalışkan D.β005. Fitoterapiμ Bitkilerle Tedaviye Dikkat.STED;14(8):182-187. POSTER PRESENTATION 403 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org The Effects of Arsenic on the Digestive System Histology Özlem ÖNEN1, Yasemen ADALI2 , Gülname FINDIK GÜVENDİ3, Hatice BEŞEREN4, Hasan Basri ŞENER5 1 Kafkas University, Science and Art Faculty, Biology Department, Kars 8 Mart University, Medicine Faculty, Medical Pathology Department,Çanakkale 3 Recep Tayyip Erdoğan Üniversity, Medicine Faculty, Medical Pathology Department,Rize 4 Kafkas University, Veterinary Medicine Faculty, Pathology Department, Kars 5 Detay Pathology and Cytology Laboratory, Ankara 2 Corresponding Author: e-mail: hbeseren@ymail.com Abstract Arsenic is a natural element and is present in trace amounts in all living materials that live in water, on rocks, in plants, in animals. Worldwide chronic arsenic poisoning has become a threat to human health. Arsenic exposure is most often transmitted from contaminated water and food. It is the most harmful substance in drinking water and it is mixed with minerals. In some regions, volcanic movements, forest fires and erosion of rocks increase the amount of arsenic in groundwater.Arsenic, which is used as an agricultural or industrial pollutant, food preservative or agrochemical, can also be mixed with drinking water. Arsenic is not transmitted by direct contact and it needs to be taken orally to cause disease. However, some research shows that arsenic also causes increase in skin pigmentation and makes crust by contact. Apart from this, arsenic is also used in dentistry and can also give damage to teeth, palate and tongue. It is aimed to summarize the histopathologic changes that occurred in digestive system after the ingress of arcenic to the body in the light of previous studies. Keywords: Arsenic, Liver, Bowel, Stomach, Digestive system. 1. Introduction It is classified as most gray-yellow crystals, organic and inorganic, nonmetallic, meta-looid (metal to ametal) most common in the earth's crust (Yağmur ve ark., β00β, Başkan ve ark. β00λ). Underground water passes through the soil and rock and dissolves certain compounds such as arsenic to allow it to mix with the water, which ensures it is in the most water. Most of the inorganic arsenic species found in water are arsenite (As (III)) and arsenate (As (V)). The pH of the water, redox potential and the presence of complex ions such as sulfur, iron and calcium determine the species and distribution of Arsenic.Although it is used as raw material in agriculture, pharmacy and most common industries, it is a toxic and carcinogenic substance (Başkan ve ark. β00λ) . 2.Arsenic Resources 2.a. Natural Resources: Soil is found naturally in some rocks, including lead and copper ores. The dust that the wind carries can pass into the air and the water, which is infiltrated into the ground (Chou and Rosa, 2003).Natural resources of Arsenic include springs, volcanic rocks, sedimentary rocks (organic / inorganic clay), metamorphic rocks, seawater and mineral deposits (EPA, 2003). In addition, volcanic movements, rock erosion and forest fires are among the natural resources of the arsenal (EPA, 2003). 2.b. Anthropogenic Sources: The anthropogenic sources of Arsenic are quite diverse. Industrial products containing arsenic include wood, timber protection, cosmetics, paint operations, pharmaceutical industry, herbicide industry, semiconductor material production, leather production, glass production, medical use, paper and paper clay production and cement businesses. In addition, copper, nickel, gold mining and ore disposal operations, agricultural applications, use of fossil fuels, and landfill leachate are among the anthropogenic sources of arsenic (EPA, 2002). Among the most important human activities that cause arsenic formation are the use of agrochemicals and mining activities that destroy harmful plants and insects POSTER PRESENTATION 404 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org (Mandal et al., 2002; Moore, 2005).The use of arsenic-containing pesticides is one of the non-point anthropogenic sources of arsenic (President et al., 2009). 3. Effects Of Arsenic On The Body There are arsenic in many organic and inorganic materials. Inorganic arsenic is absorbing very quickly in the living body. It has been documented in many studies that have chronic toxicity in vivo. In the whole world but especially in southeastern Asia, it is transmitted from drinking water (WHO 2001; IARC 2004). According to the researches carried out again, arsenic is the most contaminated with water and causes the skin lesions first in the living organisms. In particular, melanosis (increased pigmentation of the skin), keratosis (papillary skin lesions in rough, dry appearance) (WHO 2001). After the skin, it affects our reproductive, neurological, cardiovascular, respiratory, hepatic, hematological systems.Extreme exposure leads to end-stage diabetes and cancer (Morton ve ark. 1994; Naqvi ve ark. 1994; Mandal ve ark. 2002; Ng ve ark., 2003; Yoshida ve ark. 2004; Kapaj Et al. 2006; Wang ve ark. 2007; Chen ve ark. 2007). In addition, during pregnancy can enter the placenta and fetal growth factors, DNA repair may be disturbed, may cause immunosuppression. When taken orally, people have nausea, vomiting and diarrhea. Also on the lips are burning, swallowing difficulty, constant thirst and various abdominal colic. In addition, the epithelium in the gastrointestinal tract damages the cells causing irritation. İn more advanced stages, the bleeding diabetic cause is associated with varicose veins and gastrointestinal bleeding due to portal hipertension. Splenomegaly (hypersplerism) is seen in many cases in the western study (NRC 1999, Mazumder et al., 1997). 4. Research Sıgnıfıcance Arsenic is one of the substances found in nature. In our everyday life, our life mixes with the most water. It is also used as an additive in fields such as agriculture and health. It enters the body of living things orally and creates deformation. Leading to death when taken in advanced doses. When taken orally, it affects the digestive system first. The purpose of this compilation is to show the structural and functional effects of the arsenic on the digestive system. 5.Results Studies are usually done on rats and monkeys and liver, bowel and stomach hematoxylin-eosin is evaluated. It has been shown that structural changes in the arsenic given at low doses lead to pathological changes in high doses.In addition, the most important target in gastrointestinal toxicity in organs is the liver, the most pathologic findings being seen here. Arsenic intake at doses of 00.1 to 0.1 mg per day leads to liver damage (Liu et al., 2002).Histologically, protal fibrosis and necrosis are seen and cirrhosis occurs later (Mazumder et al.,1997).The critical target for arsenic is the gastrointestinal system, causing hemorrhage in the organs of this region and forming lesions (Uede et al., 2003, Vantroyen et al., 2004). In humans, reports of diffuse inflammation and hepatocellular degeneration have been noted in the gastrointestinal tract (Jaghabir et al., 1989). Nausea, vomiting, abdominal pain, hyperactive bowel and diarrhea are seen in clinical findings when 67 mg dose is taken daily (Lee et al., 1995). When a dose of 72.4 mg per day is taken, edema, hemorrhage, necrosis, ulcerated or perforated intestinal mucosa are seen in the thick intestinal mucosa. Histopathological examination revealed epithelial columnar squamous metaplasia in the large intestine mucosa (Arnold et al., 2003, Gur et al., 1991). Hepatic findings: In the studies performed, hepatic lobules were not impaired in the control tissues and hepatic and vacuolary degeneration marked hepatic necrosis in hepatocyte and vacuol degeneration in the liver of the rats exposed to arsenic (Figure 1, Figure 2) (Noman et al., 2015). Mazumder and his colleagues gave monkeys a dose of 80 mg arsenic for 28 days, liver injury, portal travma fibrosis, central venous occlusion, increase in hepatocytes, moderate degeneration and necrosis, There is a mild to moderate increase in fat in the parenchyma. (Figure 2, Figure 3, Figure 4) (Mazumder et al., 2005).Al- Furkan et al. 20 rats were orally administered with 10 ppm, 30 ppm, 50 ppm sodium arsenic distilled water for 90 days, edema, picnosis, occlusion sinusoidal dilatation, focal hemorrhage, portal and sinusoidal mononuclear inflammatory cell infiltration were observed POSTER PRESENTATION 405 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org in euthanasia- 6) (Al-Furkan et al., 2016). In another study, Nain et al. Showed degeneration and necrosis of liver tissues after euthanasia with 18 weeks oral administration of arsenic at 40 ppm. Periodic acid schiff staining showed vacuole cells, glycogen deposits and hepatocytic fat infiltration with oil red stain (Figure 6) Nain et al., 2010). Bowel-stomach Disorders: Heywood and colleagues reported that acute inflammation and bleeding in the small intestine were seen in autopsy intestines after euthanasia with 6 mg orally administered arsenic to monkeys (Heywood and Sortwell, 1979). In a further study, arsenic exposure to orally in the digestive tract was accompanied by villous rupture with mononuclear cell proliferation and degenerative changes (Figure 7) (Hemalatha et al., 2013). In this study, enlargement of the pyloric part of the stomach, combined villus structures, vacuolation and degeneration areas were observed (Hemalatha et al., 2013). 6. Result Arsenic is a substance commonly found in nature and most commonly enters the living body by oral route, mostly from live waters and pesticides.The first goal of the arthritis toxicity is gastrointestinal system, and when taken orally for a long time or over a long time, the first nausea, vomiting, abdominal pain and diarrhea are confronted.Patients who are not fortunate as long as they are taken for a long time at low doses.It makes functional disorders.Degeneration, portal fibrosis, enlargement of the venules and further cirrhosis are seen especially in the liver. The stomach, on the other hand, causes the pylorus to enlarge by breaking the muscle structure. Histopathologically, we see the union and degeneration areas of the villi structures.In the pubs, acute inflammation is caused, and at later doses, degenerative changes parallel to the increase of villus rupture and mononuclear cell are seen. Arsenic is also used as an anthropogenic source in dentistry. When applied to the teeth and veins, the striated muscles in the veins create paralysis, causing destruction of the walls of the endothelium and vessels. Necrosis induces degeneration and causes plazmolysis and caryolysis in pulp cells, resulting in necrosis (Şen, β010). As a result, arsenic compounds are accepted as potent carcinogenic agents in addition to local complications.Development of water treatment plants to prevent oral transmission, retrospective review of the contents of pesticides, Other fields such as dentistry should be used instead of arsenic. As long as this is not under control, the gastrointestinal system will be structurally impaired and the carcinoma cases will increase and it will become more difficult to control it in the future. Figure 1: A- Intact hepatic lobules in the control group. B- Necrotic area in the liver of animals in the group exposed to arsenic(H &E 200X) (Noman et al., 2015). POSTER PRESENTATION 406 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 2: Areas of light liver fat and necrosis (H & E X200) (Hemalatha et al., 2013). Figure 3: Mild degenerative changes in the liver (H & E X200) (Hemalatha et al., 2013). Figure 4: Fat accumulation in liver hepatocytes and veins (H & E X200)(Hemalatha et al., 2013). POSTER PRESENTATION 407 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 5: Increased inflammatory cells in the liver, edema and necrotic cells (H & E X400) (AlFurkan et al., 2016). Figure 6: Untreated control liver tissue (a) exposed to 40 ppm arsenic remaining rat liver section , areas shown with white arrows hepatocyte vacuolization fields (b). Periodic acid - areas marked with white arrows with schiff staining hepatocyte vacuolization, black arrows indicate the presence of glycogen in hepatocytes warehouses. In the final image, the cells indicated by white arrows with Oil Red staining hepatocyte structure infiltration sites have been demonstrated (H & E X200) (Nain S. et al., 2010). POSTER PRESENTATION 408 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Figure 7: Villous rupture in the pubes (H & E X100) (Hemalatha et al., 2013). Figure 8: Pyloric structure enlargement, degeneration in vacuole cells (H & E X200) (Hemalatha et al., 2013). Figure 9: Degenerative changes in the stomach structure (H & E X200) (Hemalatha et al., 2013). Resources Yağmur F., Hancı İ.H., (β00β). Arsenic. Vol. 11 No. 7-250. WHO (2001), World Health Organization Publication Report. IARC (2004), Monographs of Carcinogenic Risk Assessment to Humans. POSTER PRESENTATION 409 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Morton, W. E., & Dunnette, D.A. (1994). Health effects of environmental arsenic. J. O. Nriagu (Ed.), Arsenic in the environment. Part II: Human health and ecosystem effects (pp. 17-34). New York: Wiley. Naqvi, S. M., Vaishnavi, C., & Singh, H. (1994). Toxicity and metabolism of arsenic in vertebrates. In J. O. Nriagu (Ed.), Arsenic in the environment. Part II: Human health and ecosystem effects (pp. 55-92). New York: Wiley. Mandal, B. K., & Suzuki, K. T. (2002). Arsenic round the world: A review. Talanta, 58, 201-235. Yoshida, T., Yamauchi, H., & Sun, G. F. (2004). Chronic health effects in people exposed to arsenic via drinking water: Dose-response relationships in review. Toxicology and Applied Pharmacology, 198, 243252. Yoshida, T., Yamauchi, H., & Sun, G. F. (2004). Chronic health effects in people exposed to arsenic via drinking water: Dose-response relationships in review. Toxicology and Applied Pharmacology, 198, 243252. Kapaj, S., Peterson, H., Liber, K., et al. (2006). Human health effects from chronic arsenic poisoning-a review. Journal of Environmental Science and Health, 41, 2399-2428. Wang, J. P., Wang, S. L., Lin, Q., et al. (2008). Association of arsenic and kidney dysfunction in diabetes and validation of its effects in rats. Environmental International. doi: 10.1016 . Chen, C.J., Wang, S.L., Chiou, J.M., et al. (2007). Arsenic and diabetes and hypertension in human populations: A review. Toxicology and Applied Pharmacology, 222, 298- 304. National Research Council (NRC). (2001). Arsenic in drinking water-2001 update. Washington, DC: National Academy Press. Heywood R, Sortwell RJ. (1979). Arsenic intoxication in the Rhesus monkey. Toxicol. Lett. 3: 137-144. Uede K, Furukawa F. (2003). Skin manifestations in acute arsenic poisoning from the Wakayama curry-poisoning incident. Br. J. Dermatol. 149: 757-762. Lee DC, Roberts JR, Kelly JJ, Fishman SM. (1995). Whole-bowel irrigation as an adjunct in the treatment of radiopaque arsenic. Am. J. Emerg. Med. 13: 244-245. Arnold LL, Eldan M, van Gemert M, Capen CC, Cohen SM. (2003). Chronic studies evaluating the carcinogenicity of monomethylarsonic acid in rats and mice. Toxicology 190: 197-219. Gur E, Pirak M, Waner T. (1991). Methanearsonic acid oncogenicity study in the mouse. Luxembourg Industries (Pamol) Ltd. Submitted to the US Environmental Protection Agency. Liu J, Zheng B, Aposhian HV, Zhou Y, Chen ML, Zhang A, Waalkes MP. (2002). Chronic arsenic poisoning from burning high-arsenic-containing coal in Guizhou, China. Environ. Health Perspect. 110: 119-122. Mazumder DN, Steinmaus C, Bhattacharya P, von Ehrenstein OS, Ghosh N, Gotway M, Sile, Balmes JR, Haque R, Hira-Smith MM, Smith AH. (2005). Bronchiectasis in persons with skin lesions resulting from arsenic in drinking water. Epidemiology 16: 760-765. Jaghabir MTW, Abdelghani AA, Anderson AC. (1989). Histopathological effects of monosodium methanearsonate (MSMA) on New Zealand white rabbits (Oryctalagus cuniculus). Bull. Environ. Gasket. Toxicol. 42: 289-293. POSTER PRESENTATION 410 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Noman ASM, Dilruba S., Mohanto NC, Rahman L., Khantun Z., Riad W., Mamun AA, Alam S., Aktar S., Chowdhuryl S., Saud ZA, Rahman Z., Hossain K., Haquee . (2015). Arsenic-induced Histological Alterations in Various Organs of Mice. Cytol Hysteresis 2015, 6: 3 Jomova K., Jenisova Z., Feszterova M., Baros S., Liska J., Hudecova D., Rhodes D. C. J., Valkoc M. (2011). Arsenic: toxicity, oxidative stress and human disease. J. Appl. Toxicol. , 31: 95-107. Hemalathal P., Reddyl A. G., Ranil M. U., Anandkumar A., Shivakumar P. (2013). ARSENIC-INDUCED HISTOLOGICAL ALTERATIONS IN VARIOUS ORGANS IN RATS. Int. J. LifeSc. Bt & amp; Pharm. Res. 15-10. Sahal J. C., Dikshit A. K., Bandyopadhyay M. (2011). A REVIEW OF ARSENIC POISONING AND ITS EFFECTS ON HUMAN HEALTH. School of Tropical Medicine, Calcutta, India. Al-Forkan M., Islam S., Akter R., Shameen AS, Khaleda L., Rahman Z., Salma CD 2016. A Sub- Chronic Exposure Study of Arsenic on Hematological Parameters, Liver Enzyme Activities, Histological Studies and Accumulation Pattern of Arsenic in Organs of Wistar Albino Rats. J Cytol Hyster, S5: 1. Nain S., Smits J.E.G., (2010). Pathological, Immunological and Biochemical Markers of Subchronic Arsenic Toxicity in Rats. Received 26 April 2010; Revised 14 June 2010; Accepted 15 June. President B. M. and Pala A. (2009). Arsenic pollution in drinking waters: an assessment from the perspective of our country. Journal of engineering sciences, p. 69-79. POSTER PRESENTATION 411 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Study of MAR-pyocin from Pseudomonas aeruginosa isolated from Clinical Specimen and Pomegranate seed oil as Antifungal agents Mais E.Ahmed 1 , Israa A. Ali Al-Temimay2 * Ph.D. in Biology Depart./ Collage of Science/ University of Baghdad. 1 mais.e.mahmood@gmail.com,2 israaahmed51@yahoo.com Abstract This research was designed to study the inhibitory effect of crud bacteriocin (MAR-Pyocin) production from resistance Pseudomonas aeruginosa which has been isolated from Baghdad, Iraq samples of different sources (ear and eye) swab according to biochemical test and vitek 2 system. In vitro assay with the antagonists and their Crude and Purified bacteriocin by precipitation 75% ammonium sulfate and conventional size exclusion using Ion-exchge column DEAE -cellulos gel equilibrated and with 50 mM sodium phosphate buffer pH 7.0 eluted. From resistance Pseudomonas aeruginosa strains on agar plates and Pomegranate peel extraction showed that the effectively inhibited growth of the following fungi (Trichophyton mentagrophyes, Microsporum audouinii , Trichophyton tonsurans, Candida kefyer, Aspergillus fumigatus, Hortaea werneckii, Rhizoctinoa spp). The results showed that the Minimum Fungicidal Concentrations were (γβ.5 and 1βγ) µg/ml bacterocin and Pomegranate peel respectively, also the inhibition zone of reached Bacterocin (12 to 18 ) mm in solid medium .while Pomegranate peel reached (3-5) mm inhibition zone. Key words: MAR-Pyocin, Candida , Pseudomonas aeruginosa, antifungal agents, Pomegranate seeds oil. 1- Introduction: A common global problem Fungal infection of the suffers from skin mycosis currently, 21–β5% of the world’s population, making most frequent forms of infection (Havlickova, et al., 2008) has emerged from Mexico and the Caribbean Trichophyton tonsurans and is now the most prevalent cause of tinea capitis in North America and the UK, frequently resistant to traditional fungicides Trichophyton tonsurans (Shroba. etal. 2009). Identify antifungal lactic acid bacteria (LAB) and characterize their activity against the dermatophyte Trichophyton tonsurans (Guo.etal., 2011) .,A.fumigatus conceders a main cause of morbidity and mortality in immunocompromised patients. This patients group are distributing due to the increasing use of transplantation for end organ disease, the development of immunosuppressive and myeloablative therapies for autoimmune and neoplasticdisease and the human immunodeficiency virus/AIDS pan-demic. So the A. fumigatus is the most common mold infection invasive these patients and the mortality rates overrun 50% in high-risk groups, like leukemic patients and hematopoietic stem cell transplant receivers (Hohl and Feldmesser 2007) and(Denning,1998) Hortaea werneckii caused the superficial mycosis Tinea nigra. It is an uncommon asymptomatic infection that infects human palms and soles, and is mostly seen in tropical area (Bonifaz etal., 2008). Rhizoctonia sp. is one of the important soil borne pathogen all over the world. Very serious diseases, it causes of wide varieties of plants ranging from damping-off till stem canker led to dramatic effects on plant physiology and its nutrition (Mohamed etal.,2014). Protein substances Bacteriocins are which exhibit activity against antibacterial related closely species. Bacteriocins can inhibit very restricted of bacteria spectrum, mostly Gram positive bacteria limited. Bacteriocins Different from each other by chemical structure and antagonistic activity( Fujita. etal.,2007). Has assumed Pseudomonas aeruginosa an increasingly etiological agent prominent serious infections in hospitalized patients. Three distinct types of bacteriocins Pseudomonas aeruginosa strains produce. Classified according to their morpology Bacteriocins functions into pore forming pyocin and DNase activity–pyocins.of P. aerugonosa strains (Al-Shammary etal., 2013). Requires a period Pyocin typing of 24 h to achieve a result but provides adequate discrimination on which to base more confident epidemiological judgment (Waite and Curtis,2009). An alternative source of new active molecules Natural products have proven to be. Basic health treatment plants have been used as the primar (Dell’Agli etal., β00λ). The pomegranate (PUNİCA GRANATUM ) composed the fruit is of a yellow to red peel the seeds that covers, In folk medicine PUNİCA GRANATUM is application a plant with worldwide. An antimicrobial effect there are references to of pomegranate products against many pathogenic fungal species, formation of biofilms including inhibition (Bakkiyaraj etal., 2013). Effect of pomegranate there are references to an antimicrobial products against many pathogenic microbiology species, including inhibition of formation of biofilms(Al-Zoreky,2009) Pomegranate fruit rind extracted Polyphenols from were active against phytopathogenic fungi ( Osorio etal.,2010) Showed good results the extract of P. GRANATUM as antifungal a topical agent for candidosis associated with denture stomatitis of the treatment (Vasconcelos etal.,2003) .Isolated not only this substance was from PUNİCA GRANATUM, but also was described from TERMİNALLİA BRACHYSTEMMA and TERMİNALLİA MOLLİS , as having antifungal activity against CANDİDA ALBİCANS, C. KRUSEİ, and C. POSTER PRESENTATION 412 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org PARAPSİLOSİS ( Liu etal.,2009). This research was designed to study the inhibitory effect R- pyocin and Pomegranate peel extraction which isolated from resistance Pseudomonas aeruginosa in reduction fungal growth in vitro 2- Materials and Methods 2-1 Isolation and identification of resistance Pseudomonas aeruginosa : Sample Collection A total of 12 clinical specimens of resistance Pseudomonas aeruginosa were collected from different were collected from the pathology Hospital in Iraq (ear and eye) Swab on MacConkey agar plates and Kligler Iron agar that we used, were purchased from Sigma Company.For the isolation and identification each specimen was identified, depending on the morphology, cultural characteristics and biochemical reaction (Baron and Finegold,1990) .Finegold. Additional chemicals; Indole, Simmen Citrate and Urea test and identifaction by vitek 2 system. The strain of Candida kefyer, Trichophyton tonsurans., Trichophyton mentagrophytes, T. rubrum, Aspergillus fumigatus, Hortaea werneckii, Rhizoctinoa spp.) Were obtaining, Isolation and identification from (College of Science for Women and Biology Department/ College of Science/University of Baghdad). 2-2 Antibacterial resistance: The isolates pattern of was by Kirby-Bauer disc diffusion technique studied Susceptibility of the isolates were done and interpreted according to (NCCLS) National Committee for Clinical Laboratory Standards recommendations. The antibiotic concentration per disk was as following. Ceftriaxone (30), Ampicillin (10 Mg), Amikacin (30 Mg), Gentamicin (10 Mg) and Cephalexin (30 Mg) 2-3 Production crud MAR- pyocin: Resistance Pseudomonas aeruginosa after growing in a Brain-Heart infusion broth and diluting appropriately to a 0.5 McFarland standard (1.5×107 CFU/ml), incubated at γ7°C for 18 hrs. after centrifuged at 5000 × g for 10 min supernatant fluid of the isolates, the cells were discarded and the cell free extract was filtered using a syringe with 0.βµm filter. The diameter of the inhibition zone around the wells, the antimicrobial activity was determined by measuring., The cell free extract was gently filtered into sterilized test tubes with 0.βµm acetate cellulose filter (Majeed.2004). 2-4 Protein precipitation by ammonium sulphate: Broth culture an overnight of Sample cell free supernatant obtain was centrifuged at 6000 rpm for 10 minutes at 4°C. the ammonium sulphate was added to achieve 75% saturation. It was stirred well and incubated at 4°C overnight. The following day, the precipitates were collected by centrifugation at 6000rpm for β5 minutes at 4°C. The dissolved precipitates were in 500 ml of sterile distilled water (McCaughey.,β016) Antibacterial activity of both the supernatant and the precipitate were tested using agar well diffusion assay and the results were recorded, protine assay according (Lowry etal.,1951). 2-5 Purification of MAR-pyocin: After the supernatnat was thoroughly with Ammonium sulphat at a ratio 70% than Chromatography (DEAE-Cellulose) gel was used as a first step for MAR-pyocin purification . This gel was prepared according to Pharmacia catalogue (Pharmacia Fine Chemical/ Sweden). was loaded slowly over the DEAE-Cellulose.The MAR-pyocin was eluted from the column(β × 40) cm dimensions) by β0mM sodium citrate buffer (pH 7)and flow rate was adjusted to give 40 ml per hour. 5 ml for each fraction was collected. Activity and absorbance at 280nm of each fraction were determined,the active fractions were mixed .Activity and protein concentration were determined, then loaded again on the same column at the same conditions above. 2-6 Determining inhibitory effect of MAR- pyocin and Pomegranate seed oil on Fungal: Was determined using the well diffusion method the antifungal spectrum of the bacteriocin (MAR-pyocin) from P. aeruginosa. The supernatant from a 24-h culture of P. aeruginosa filter sterilized by passage through a 0.45 mm pore size membrane filter. of the sterile supernatant were placed in 6-mm-diameter wells that had been cut in Sabourad agar plate previously seeded with the indicator fungal ,After 12-β4 h of incubation, the diameters of the zones of growth inhibition were measured. Antifungal activity was expressed in arbitrary units (AU/ml). One AU was defined as the reciprocal of the highest level of dilution resulting in a clear zone of growth inhibition (Mélanie etal.,2016). 2-7 Pomegranate seeds oil preparation The seeds were collected from local Pomegranate. This seeds was dried at 45 Cº in oven overnight. Methanol was used as a polar solvent. It used to extract Pomegranate seeds oil. The extraction was done by Soxhlet device, 200ml of solvent was added and still for 8 hr. at 70Cº and the extract was dried by oven for two days to obtain oil extract. This oil stored at 4Cº until use, the concentration was prepared it taken from this formula. C1 V1 = C2 V2 According to this formula the Pomegranate seeds oil concentration was 4%. 2-8 Culture Media:In this study Sabouraud’s Dextrose Agar (SDA) (Himedia/ India) was used as fungal medium. This medium was prepare depending to the manufactory by dissolved 39g powder from PDA in one liter of D.W. and sterilized by autoclave at 15 psi pressure and 1β1 ºC for 15 minute. This medium (with antibiotic penicillin and Streptomycin) was used for culture purposes Koneman etal.,1978). 2-9 The agar well diffusion method: POSTER PRESENTATION 413 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org This method use for determined antifungal activity of R- pyocin and Pomegranate seeds oil extract. The solution are added in wells by using cork porer to make three wells in each one plates after the fungi (Trichophyton tonsurans., Trichophyton mentagrophytes, T. rubrum, Candida kefyer, Tricoderma, Aspergillus fumigatus, Hortaea werneckii, Rhizoctinoa spp.) were cultured on this meidium, then the extract of MAR- pyocin and Pomegranate seeds oil were incubated into the groove after 2-4 days at γ7Cº and β8 Cº. The D.W. was used as control (Sheyin etal.,β015). 3- Result and Discussion: Antibiotic resistance of Pseudomonas aeruginosa showed Table (1) shows the categorization of cases. The results of the present study showed that (60%) were wound infaction (15%) from urine (25%) frome ear and eye infaction . Table (1): Categorization of Pseudomonas aeruginosa cases. Category Ear Numbers of neonates No. & % (45)% Eye (55)% ` Antibiogram Profile P. aeruginosa Isolated Clinical Samples The results showed all isolates of P. aeruginosa, which were Resistace antibiotc, constituted 45% from the ratio in the ear and while the (55%) isolates were from eye samples. Highly significant differences (P˂0.01) recorded in both isolates among clinical samples. R-pyocin production from Only five isolates (P3,P4, P7, P9 ,P11) in the study identified by wells diffusion method, depending on the widest inhibition zone and the highest sensitive number of the basic indicator isolates P9 isolation from eye specimen . Table (2) Antibiotic sensitivity test of P. aeruginosa Antibiotic Amikacin Ampicillin Cephalexin Ceftriaxone Gentamicin P1 R100 S0 R66 S0 R100 S 20 R100 S 0 R75 S 0 P2 R 86 S 12 R 73 S 0 R 83 S 9 R 75 S 11 R 44 S 26 P3 R 72 S 28 R 75 S 25 R80 S 20 R82 S 18 R52 S 48 P4 R 66 S 34 R 74 S24 R80 S20 R80 S 20 R50 S 50 P5 R 66 S 34 R 70 S30 R 76 S 17 R 70 S 32 R 43 S 62 P6 R 66 S 44 R 55 S 45 R62 S 40 R55 S 44 R 88 S 18 P7 R 62 S 40 R 65 S 34 R 77 S 26 R 87 S 14 R 80 S19 P8 R 55 S 42 R 60 S 44 R 73 S 23 R 85 S 20 R 78 S 28 P9 R 72 S32 R63 S34 R 66 S 34 R 74 S 26 R 80 23 S P10 R 83 S 13 R 45 S 55 R 60 S 43 R 55 S 46 R 69 S 35 P11 R 84 S 13 R 74 S 23 R 84 S 14 R 78 S 24 R 84 S 14 P12 R60 S 33 R 72 S 22 R 55 S 43 R 43 S 53 R 14 S 86 S: Sensitive , R: Resistant POSTER PRESENTATION 414 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3-1 Vitek 2 system: Gave confirmation of positive results for P. aeruginosa and as a selected organism with a probability 98-99% (Cartwright etal.,2013) showed that out of P. aeruginosa isolates had resistant profile with a sensitivity of 88.7% and a specificity of 99.5% for the identification of P. aeruginosa isolates. 3-2 Screening for crude MAR-pyocin : " The P. aeruginosa isolate P9 was chosen among five bacterial isolates as a good crude R-pyocin producer according to their widest inhibition zone that reached 15 mm on the basic indicator isolates. Figure (1) and Figure (2) P3 P4 P1 1 P9 P7 Figure (1): Screening of crude R-pyocin from resistance P. aeruginosa against Candida kefyer on Sabourad agar plate at 30°C for 24-48 hrs. 1,9 1,5 washi 0.25M NaCl 160 MRSAcin Elute 140 120 Diameter of inhibition Absorbance(280 1,7 0.5M NaCl 100 1,3 0.15M NaCl 1,1 80 0.75M NaCl 60 0,9 40 0,7 20 0,5 0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 Fraction number Figure (2): Ion exchange chromatography for Bacteriocin column (2×40cm) equilibrated with Tris-HCl buffer (10 mM , pH 7 ), eluted with Tris –HCl buffer with NaCl (0.15 -0.75 M) in flow rate 0.8 ml /min., 5ml for each fraction Ion exchange (DEAE-Cellulose) features used in this step due to high resolution power , easily prepared , high capacity , possibility of reactivate and uses many times as well as the simplicity of the principle of separation, which mainly depends on net charges of protein ( Kateete etal., 2010). Figure (3) MAR-pyocin Figure (3): Screening of Purified MAR-pyocin against Candida kefyer on Sabourad agar plate at 30°C for 24-48 hrs. POSTER PRESENTATION 415 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org 3-3 Determination of Molecular Weight: The protein slandered was compared used as to detection molecular weight of MAR-pyocin,. as shown in Figure (4) the high molecular weight was found to be (38) KDa, particularly for MAR-pyocin .The current results agree with molecular weight of both pyocin and bacillin extracellular bacteriocin were approximately 40 kDa according to reference protein ladder band , while the molecular weight of LB were estimated to be in the range of (10 to 25 ) kDa Ogunshe etal.,2012). 2 kDa 5 kDa 10 kDa 20 kDa 30 kDa MAR-pyocin 40 kDa Figure (4): SDS-PAGE Tricine-SDS-PAGE of MAR-pyocin (A): Molecular weight marker. (B): Purified MAR-pyocin. 3-4 Well plate assay In this study Purified MAR-pyocin and Pomegranate seeds oil were tested among many fungi some of them pathogen for human such as Trichophyton tonsurans., Trichophyton mentagrophytes, T. rubrum, Candida kefyer Aspergillus fumigatus and Hortaea werneckii. Another them was plant pathogen such as Rhizoctinoa spp. All these fungi were sensitive to Bactericin and resistant’s to Pomegranate seeds oil. The Purified MAR-pyocin give high inhibition zone radius when it tested on Hortaea werneckii 38 mm followed by Aspergillus fumigatus 35mm and give the lower inhibition zone radius in Rhizoctinoa spp. 27mm only. While Pomegranate seeds oil don’t give any inhibition zone in all fungi were tested.Figure (5 and 6) showed the activity of MAR-pyocin and Pomegranate seeds oil on this fungi. A B C Figure (5): A: Hortaea werneckii. B: Aspergillus fumigatus. C: Rhizoctinoa spp. Antifungal activity of purified MAR-pyocin (concentration γβ.5 µg/ml) in the same experiment conditions. POSTER PRESENTATION 416 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org B A C Figure (6): A: Trichophyton mentagrophyes. B: Microsporum audouinii C: Trichophyton tonsurans: Antifungal activity of purified MAR-pyocin (concentration γβ.5 µg/ml) in the same experiment conditions. 4. Discussions Four lactobacilli Identified as having strong inhibitory activity against the human pathogenic fungi Microsporum canis, Microsporum gypseum and Epidermophyton floccosum. One of the, namely Lb. reuteri ee1p exhibited the most inhibition against dermatophytes (Guo etal.,2012). Lactic acid bacteria were isolated from yogurt samples. Four species of lactic acid bacteria L. acidophilus, L. plantarum, L. delbrueckii and L. bulgaricus were isolated and their bacteriocins were extracted against Aspergillus niger, Mucor and Penicillium.at zone inhabation 7mm (Yasmin,2015). The study of McCaughey et al., 2016 was show the ability of pyocin SD2 to treat a lethal P. aeruginosa lung infection in a murine model indicates that pyocin SD2 has excellent antimicrobial activity in vivo. So the research of( Scholl and Martin, 2008) were elucidated the R-type pyocins share many features with bacteriophages. Phages have recently been used to treat murine peritonitis and bacteremia. Exhibited antimicrobial activity of Lactobacillus sp against dermatomycotic fungi and foodborne pathogen bacteria. The highest antimicrobial activity was recorded against Trichophyton mentagrophytes and T. rubrum with minimal lethal concentration of 32 mg/ml (Koutb etal.,2016). Lactobacillus reuteri Rβ and Pyocin was identified as having strong inhibitory activity against the dermatophyte T. tonsurans The use of these and⁄or their products may well provide alternative safe approaches for the inhibition of dermatophytic fungi (Guo etal., 2011) .Although all previous research has had a significant effect on bacteria dermatophytic fungi inhibition, but in this study, Pyocin has shown clear results in inhibiting harmful fungi for humans and plants such as Hortaea werneckii, Aspergillus fumigatus and Rhizoctinoa spp was a good step to finding alternative solutions to eliminate this type of fungus. Conclusion : Nowadays use of commercially available antimicrobial drugs such Bacterocin caused drug resistance in many human pathogenic microorganisms. The resistance adaptation properties of fungal many species is a major health concerns and it force scientist to discover new effective antifungal agents. Bacterocin have been a key source for the discovery of new drugs and can provide a potential antifungal lead against the resistance strains pathogen. References: Havlickova, B., V.A. Czaika , V.A. and M. Friedrich, M. (2008) Epidemiological trends in skin mycoses worldwide. Mycoses 51: 2–15. Shroba, J., C .Olson-Burgess, B .Preuett,. and S.M .Abdel-Rahman(2009),. A large outbreak of T. tonsurans among health care workers in a pediatric hospital. Am J Infect Control 37, 43–48. Guo, A. and P .Galle, Inhibition of growth of Trichophyton tonsurans by Lactobacillus reuteri Journal of Applied Microbiology 111, 474–483. Hohl, T.M and M . (2007) Feldmesser,. Aspergillus fumigatus: Principles of Pathogenesis and Host Defense. Eukaryotic Cell, Vol. 6, No. 11. p. 1953–1963. doi:10.1128/EC.00274-07. Denning, D. W. Invasive Aspergillosis. Clin. Infect. Dis. 26:781–803. Bonifaz, A., H. Badali,. G.S.de Hoog, M. Cruz, J. Araiza, M.A. Cruz, and R.M. Ponce, (2008). Tinea nigra by Hortaea werneckii, a report of 22 cases from Mexico. Studies in Mycology 61: 77–82. Mohamed, M.H. E. A .Gado,. S. H. El-Deeb and M. H. Mostafa (2014) .Behavior of fungus Rhizoctonia solani under faba bean cotyledons when away from host and the effect of its starvation on aggressiveness. Journal of Yeast and Fungal Research. Vol. 5(1), pp. 1-8. Fujita, K., S. Ichimasa, T. Zendo, S. Koga and F. Yoneyama, (2007) Structural analysis and characterization of lacticin Q, a novel bacteriocin belonging to a new family unmodified bacteriocins of gram-positive bacteria. Applied Environ. Microbiol., 73: 2871-2877.. Al-Shammary, A.H. I.G .Auda and I.H. Aziz (2013). Pyocin-Based Molecular Typing of Local Isolates of Pseudomonas Aeruginosa Isolated from Blood Samples, Al-Nahrain College of Medicine, 1681-6579. Waite, R.D and M.A. Curtis. (2009). Pseudomonas aeruginosa PAO1 pyocin production affects population dynamics within mixed-culture biofilms. J Bacteriol.; 191: 1349-54. Dell’Agli M, GV .Galli, Y .Corbett, D .Taramelli, L .Lucantoni, A .Habluetzel, O .Maschi, S .Romeo, D. Bhattacharia and E .Bosisio. (2009).Antiplasmodial activity of Punica granatum L. fruit rind. J Ethnopharmacol. 125:279–285. Bakkiyaraj D, JR.Nandhini, B.Malathy and SK .Pandian. (2013) The antibiofilm potential of pomegranate (Punica granatum L.) extract against human bacterial and fungal pathogens. Biofouling. 29:929–937. Al-Zoreky NS. (2009) Antimicrobial activity of pomegranate (Punica granatum L.) fruit. Int J Food Microbiol. 134:244–248. POSTER PRESENTATION 417 International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey www.EurasianBioChem.org Osorio E, M .Flores, D .Hernández, J. Ventura, R. Rodríguez and C.N.Aguilar. (β010) Biological Efficiency of polyphenolic extracts from pecan nuts Shell (Carya illionensis), pomegranate husk (Punica granatum) and creosote bush leaves (Iarrea tridentate Cov.) against plant pathogenic fungi. Ind Crops Prod. 31:153–157. Vasconcelos LCS, MCC. Sampaio, FC .Sampaio and JS .Higino. .( 2003) Use of Punica granatum as an antifungal agent against candidosis associated with denture stomatitis. Mycoses. 46: 192–196. Liu M, DR.Katerere , AI .Gray and V .Seidel , (2009). Phytochemical and antifungal studies on Terminalia mollis and Terminalia brachystemma . Fitoterapia . 80:369–373. Baron EJ and SM .Finegold. Bailey & Scott’s (1λλ0).μ Diagnostic Microbiology. 8th ed. Mocby Company. U.S.A. Majeed, H. A. L. (2004) Identification and immunological study of Candida spp. Causin gvaginitis. M.Sc. thesis ,College of Science for Women, University of Baghdad. McCaughey, L.C., I.Josts, , R.Grinter, P.White , O.Byron, N.Tucker, Kleanthous J.M , and D.Walker,. (2016). Discovery, characterization and in vivo activity of pyocin SD2, a protein antibiotic from Pseudomonas aeruginosa. Biochem. J.; 473, 2345– 2358. Lowry, O. H., N. J.Rosebrough, A. L .Farr and Randall, R. J. (1951) Protein measurement with folin phenol reagent. J. Biol. Chem., 193(1): 265-275. Mélanie,T. D.Khanh, M.Mathieu, D.Claude, and L.Monique. (β016). Influence of Environmental Factors on Bacteriocin Production by Human Isolates of Lactococcus lactis MM19 and Pediococcus acidilactici MM33. Probiotics & Antimicro. Prot. 8: 53. Koneman, E.W, G.D. Roberts and S.E.Wright. (1978) Practical laboratory mycology, 2nd ed. Williams and Wilkins Company. Baltimor USA. pp: 139-140.. Sheyin, Z., J.Maimako, J.Shindang, C.Essien, , E.Bigwan and F.Ede. (2015). Antimicrobial Activity of Albizia lebbeck leafe extract on some Medically Important Bacteria. Int. J. Curr. Microbiol. App. Sci. 4(9): 473-477. Cartwright E., G.Paterson , K .Raven and E. Torok(2013). .Use of Vitek 2 Antimicrobial Susceptibility Profile To Identify mecC in Methicillin-Resistant Staphylococcus aureus. in J.clin. micro. ,51:(8). Kateete, D. C.Kimani, F.Katabazi, A.Okeng, M.Okee, A.Nanteza, and F.Najjuka. (2010). Identification of Staphylococcus aureus: DNase and Mannitol salt agar improve the efficiency of the tube coagulase test. Ann Clin Microbiol. Antimicrob. 9:2330. Ogunshe, A. O.Johnny and A. O. Arinze (2012). Effects of Food Spices on Gram-Negative Food Indicator Bacteria from Some Nigerian Ethnic Fermented Plant Food Condiments,” Afric.J. Plant Scie, (6)μ 18-14. Guo J, B .Brosnan, A .Furey and E .Arendt. (2012). Antifungal activity of Lactobacillus against Microsporum canis, Microsporum gypseum and Epidermophyton floccosum. Bioengineered Bugs 3:2, 104–113. Yasmin A, M.Ashraf, M. Arshad and G. Muhammad.(2015). Determination of biopreservative effects of bacteriocins isolated from lactic acid producing bacteria against food spoiling fungi . Int.J.Curr.Microbiol.App.Sci . 4(2): 88-96. Scholl, D. and D.W Martin. (2008). Antibacterial Efficacy of R-Type Pyocins towards Pseudomonas aeruginosa in a Murine Peritonitis Model. Antimicrobial Agents And Chemotherapy. Vol. 52, No. 5; P. 1647–1652. Doi:10.1128/Aac.01479-07. Koutb M, M. Khider, E .Ali and N .Hussein . (2016).Antimicrobial Activity of Donkey Milk against Dermatomycotic Fungi and Foodborne Bacteria, International Journal of Biomedical Materials Research . 4(3): 11-17. Guo . J, .A Mauch, and S Galle, P. Murphy . (2011). Inhibition of growth of Trichophyton tonsurans by Lactobacillus reuteri. Journal of Applied Microbiology 111, 474–483. POSTER PRESENTATION 418 EJBCS