INTERNATIONAL EURASIAN CONFERENCE ON
BIOLOGICAL AND CHEMICAL SCIENCES
26 - 27 April 2018
(EurasianBioChem 2018)
Ankara / Turkey
PROCEEDING BOOK
EurasianBioChem
International Eurasian Conference on
Biological and Chemical Sciences
(EurasianBioChem 2018)
April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
PROCEEDING BOOK
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Chairman of Conference
Assoc. Prof. Dr. Muhittin DOĞAN
Gaziantep University, Turkey
Organizing Committee
Prof. Dr. Osman GÜLNAZ Chairman
Assoc. Prof. Dr. Aygül KÜÇÜKGÜLMEZ YAND)M
Assoc. Prof. Dr. Belgin GÖZMEN SÖNMEZ
Çukurova University, Turkey
Çukurova University, Turkey
Mersin University, Turkey
International Scientific Committee*
Prof. Dr. Abdullah MART
Prof. Dr. Abdunnasır Y)LD)Z
Prof. Dr. Adem ÖNAL
Prof. Dr. Adil M. ALLA(VERDİYEV
Prof. Dr. Adnan AYHANCI
Prof. Dr. Ahmet AKSOY
Prof. Dr. Ahmet ASAN
Prof. Dr. Ahmet KARADAĞ
Prof. Dr. Aida SAHMUROVA
Prof. Dr. Ali ERDOĞAN
Prof. Dr. Atila YILDIZ
Prof. Dr. Ayla BALABAN GÜNDÜZALP
Prof. Dr. Belma ASLIM
Prof. Dr. Bülent KAYA
Prof. Dr. Dilek DEMİREZEN Y)LMAZ
Prof. Dr. Ebru Gül ASLAN
Prof. Dr. E. Sümer ARAS
Prof. Dr. Elif Şahin )ŞG)N
Prof. Dr. Emin SARIPINAR
Prof. Dr. Emine ARSLAN
Prof. Dr. Emir Baki DENKBAŞ
Prof. Dr. Engin TİLKAT
Prof. Dr. Erdoğan Ç)ÇEK
Prof. Dr. Erdal BALCAN
Prof. Dr. Fatma Jale GÜLEN
Prof. Dr. Fatma ÜNAL
Prof. Dr. Ferda CANDAN
Prof. Dr. Gönül DÖNMEZ
Prof. Dr. Gülay BAYRAMOĞLU
Prof. Dr. Gülay ÖZCENGİZ
Prof. Dr. Güldeniz SELMANOĞLU
Prof. Dr. Gülsen ASMAN
Prof. Dr. Güray UYAR
Prof. Dr. Handan UYSAL
Prof. Dr. Hasan Basri ILA
Prof. Dr. (asan (üseyin DOĞAN
Prof. Dr. (ayati TÜRKMEN
Prof. Dr. (ülya ÖLÇER FOOT)TT
Prof. Dr. (üseyin GÜ(ER
Prof. Dr. (üsniye AKA SAĞL)KER
Prof. Dr. İbrahim ÖRÜN
Prof. Dr. İhsan AKYURT
Prof. Dr. Jitendra PANWAR
Prof. Dr. Kadir YURDAKOÇ
Prof. Dr. Kamil KOÇ
Prof. Dr. Kayahan FISKIN
Prof. Dr. Mehmet Rüştü KARAMAN
Prof. Dr. Muhammet GAFFAROĞLU
Prof. Dr. Murat ÇELİK
Prof. Dr. Mustafa ATEŞ
Prof. Dr. Mustafa ÖZCAN
Prof. Dr. Mustafa TÜRKMEN
Prof. Dr. Naime Funda TAY
Prof. Dr. Nazime MERCAN DOĞAN
Prof. Dr. Nilgün ÖZPOZAN
Prof. Dr. Noor Hasima NAGOOR
Prof. Dr. Numan HODA
Prof. Dr. Nursel PEKEL BAYRAMGİL
Prof. Dr. Oktay ARSLAN
Prof. Dr. Osman DUMAN
Prof. Dr. Ömer )Ş)LDAK
Prof. Dr. Ömer KOZ
Prof. Dr. Ömür BAYSAL
Prof. Dr. Özlem ÇETİN ERDOĞAN
ii
Osmaniye Korkut Ata University, Turkey
Dicle University, Turkey
Gaziosmanpaşa University, Turkey
Yıldız Technical University, Turkey
Eskişehir Osmangazi University, Turkey
Akdeniz University, Turkey
Trakya University, Turkey
Bartın University, Turkey
Okan University, Turkey
Akdeniz University, Turkey
Ankara University, Turkey
Gazi University, Turkey
Gazi University, Turkey
Akdeniz University, Turkey
Erciyes University, Turkey
Süleyman Demirel University, Turkey
Ankara University, Turkey
Dokuz Eylul University, Turkey
Erciyes University, Turkey
Selçuk University, Turkey
Hacettepe University, Turkey
Batman University, Turkey
Nevşehir (acı Bektaş Veli University, Turkey
Manisa Celal Bayar University, Turkey
Yıldız Technical University, Turkey
Gazi University, Turkey
Cumhuriyet University, Turkey
Ankara University, Turkey
Gazi University, Turkey
Middle East Technical University, Turkey
Hacettepe University, Turkey
Gazi University, Turkey
Gazi University, Turkey
Atatürk University, Turkey
Cukurova University, Turkey
Selçuk University, Turkey
Ege University, Turkey
Dumlupınar University, Turkey
Trakya University, Turkey
Osmaniye Korkut Ata University, Turkey
Aksaray University, Turkey
Giresun University, Turkey
Birla Institute of Technology & Science (BITS), India
Dokuz Eylül University, Turkey
Manisa Celal Bayar University, Turkey
Akdeniz University, Turkey
Afyon Kocatepe University, Turkey
Ahi Evran Üniversitesi University, Turkey
Atatürk University, Turkey
Ege University, Turkey
İstanbul Technical University, Turkey
Giresun University, Turkey
Eskişehir Osmangazi University, Turkey
Pamukkale University, Turkey
Erciyes University, Turkey
University of Malaya, Malaysia
Akdeniz University, Turkey
Hacettepe University, Turkey
Balıkesir University, Turkey
Akdeniz University, Turkey
Gaziosmanpasa University, Turkey
Bursa Technical University, Turkey
Muğla Sıtkı Koçman University, Turkey
Trakya University, Turkey
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Prof. Dr. Pınar ÇAMURLU
Prof. Dr. Ramazan ERENLER
Prof. Dr. Remziye DEVECİ
Prof. Dr. Rıdvan ŞEŞEN
Prof. Dr. Sadık D)NCER
Prof. Dr. Sait Aykut AYTAÇ
Prof. Dr. Salih DOĞAN
Prof. Dr. Sema İŞİSAĞ ÜÇÜNCÜ
Prof. Dr. Semra İL(AN
Prof. Dr. Serpil YENİSOY KARAKAŞ
Prof. Dr. Sevda K)RBAĞ
Prof. Dr. Sevil TOROGLU
Prof. Dr. Sevim AKYÜZ
Prof. Dr. Sibel AKAR
Prof. Dr. Süheyla K)RM)Z)GÜL
Prof. Dr. Şenay ÇETİNUS
Prof. Dr. Şengül ALPAY KARAOĞLU
Prof. Dr. Şule Coşkun CEV(ER
Prof. Dr. Talat ÖZPOZAN
Prof. Dr. Tamer AKAR
Prof. Dr. Tülin ASKUN
Prof. Dr. Tülin AYDEMİR
Prof. Dr. Ümmühan Özdemir ÖZMEN
Prof. Dr. Yüksel ABAL)
Prof. Dr. Zehra Nur YÜKSEKDAĞ
Prof. Dr. Zeliha SELAMOĞLU
Assoc. Prof. Dr. Aygül KÜÇÜKGÜLMEZ YAND)M
Assoc. Prof. Dr. Ayşe Gül MUTLU
Assoc. Prof. Dr. Ayşe Dilek ÖZŞA(İN KİREÇCİ
Assoc. Prof. Dr. Belgin GÖZMEN SÖNMEZ
Assoc. Prof. Dr. Berrin DURAN
Assoc. Prof. Dr. Ebru GÜREL-GÜREVİN
Assoc. Prof. Dr. Elif Damla ARISAN
Assoc. Prof. Dr. Elif ÖZTETİK
Assoc. Prof. Dr. Erol AKPINAR
Assoc. Prof. Dr. Gizem Dinler DOĞANAY
Assoc. Prof. Dr. (asan ÇABUK
Assoc. Prof. Dr. (ikmet Yeter ÇOĞUN
Assoc. Prof. Dr. Ilgaz AKATA
Assoc. Prof. Dr. )şık PERÇİN DEMİRÇELİK
Assoc. Prof. Dr. İ. Çağatay KARAASLAN
Assoc. Prof. Dr. M. Burcu )rmak YAZ)C)OĞLU
Assoc. Prof. Dr. Mehmet GÖNEN
Assoc. Prof. Dr. Mehtap TEKŞEN
Assoc. Prof. Dr. Mikail AKBULUT
Assoc. Prof. Dr. Mustafa BOGA
Assoc. Prof. Dr. Nazlı SAR)KA(YA
Assoc. Prof. Dr. Özcan YALÇ)NKAYA
Assoc. Prof. Dr. Özgur ARAR
Assoc. Prof. Dr. Özlem ÖZBEK
Assoc. Prof. Dr. Róbert GYEPES
Assoc. Prof. Dr. Serap Yalçın AZARKAN
Assoc. Prof. Dr. Sevgi SEVSAY
Assoc. Prof. Dr. Şule BARAN
Assoc. Prof. Dr. Şükran Y)LD)Z
Dr. Banu Şebnem ÖNDER
Dr. Chong Yee LING
Dr. Engin BAT
Dr. Jana SOBOTNÍKOVÁ
Dr. Meghane TARE
Dr. Mostafa NORİZADE(
Dr. Nur Airina MUHAMMAD
Dr. Önder YUMRUTAŞ
Dr. Ryan BAIDYA
*This list is arranged in alphabetical order.
Akdeniz University, Turkey
Gaziosmanpasa University, Turkey
Ege University, Turkey
Dicle University, Turkey
Cukurova University, Turkey
Hacettepe University, Turkey
Erzincan University, Turkey
Ege University, Turkey
Eskişehir Osmangazi University, Turkey
Abant Izzet Baysal University, Turkey
Fırat University, Turkey
Kahramanmaraş Sütçü İmam University, Turkey
İstanbul Kültür University, Turkey
Eskişehir Osmangazi University, Turkey
Ege University, Turkey
Cumhuriyet University, Turkey
Recep Tayyip Erdoğan University, Turkey
Gazi University, Turkey
Erciyes University, Turkey
Eskişehir Osmangazi University, Turkey
Balıkesir University, Turkey
Manisa Celal Bayar University, Turkey
Gazi University, Turkey
Manisa Celal Bayar University, Turkey
Gazi University, Turkey
Niğde Ömer (alisdemir University
Cukurova University, Turkey
Mehmet Akif Ersoy University, Turkey
Bitlis Eren University, Turkey
Mersin University, Turkey
Eskişehir Osmangazi University, Turkey
İstanbul University, Turkey
İstanbul Kültür University, Turkey
Anadolu University, Turkey
Abant Izzet Baysal University, Turkey
İstanbul Technical University, Turkey
Bülent Ecevit University, Turkey
Cukurova University, Turkey
Ankara University, Turkey
Hacettepe University, Turkey
Hacettepe University, Turkey
Halic University, Turkey
Süleyman Demirel University, Turkey
Aksaray University, Turkey
Erciyes University, Turkey
Niğde Ömer (alisdemir University, Turkey
Ege University, Turkey
Gazi University, Turkey
Ege University, Turkey
Hitit University, Turkey
Charles University, Czech Republic
Ahi Evran University, Turkey
Erzincan University, Turkey
Sakarya University, Turkey
Manisa Celal Bayar University, Turkey
Hacettepe University, Turkey
Universiti Malaysia Sarawak, Malaysia
Middle East Technical University, Turkey
Karlova University, Czech Republic
Birla Institute of Technology & Science (BITS), India
Bülent Ecevit University, Turkey
University of Malaya, Malaysia
Adıyaman University, Turkey
California Takshila University, USA
Conference Secretariats
Dr. Mustafa PE(LİVAN
Dr. Demet DOĞAN
Dr. Celal BAL
Dr. Mustafa SEVİNDİK
Serap ŞA(İN YİĞİT
Nazrin MURGUZOVA
iii
Gaziantep University, Turkey
Gaziantep University, Turkey
Gaziantep University, Turkey
Gaziantep University, Turkey
Gaziantep University, Turkey
Çukurova University, Turkey
ORAL PRESENTATIONS
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
A Comparison on Antibacterial Activity of Silver Nanoparticles and Chitosan
Hüsnügül Yilmaz Atay
İzmir Katip Çelebi University, Faculty of Engineering and Architecture, Materials Science and Engineering,
İzmir, Turkey.
Corresponding author e-mail: hgulyilmaz@gmail.com
Abstract
Antibacterial and antimicrobial agents have been studied for possible use in a variety of the healthcare
applications, industries, laboratories and environments, in addition to houses. It can be said that the most
important application is to set medical environments and equipment for the sterilization in order to prevent
thousands of deaths resulted from hospital-associated infections. Many different materials have been used by
civilizations throughout the world for thousands of years with this respect. Silver, comes first among these
materials, has been used as an antibacterial agent in our previous works. However, as some toxic effects
have also been reported for silver, the need for the use of organic materials has emerged. Chitosan is one of
the prominent materials in this sense. It can be called environment purification functional material that they
can effectively control the growth, reproduction of hazardous bacteria and also control toxic pollutants. They
are defined as non-toxic, biodegradable, biocompatible and hydrophilic, in addition to having antimicrobial
and antibacterial characteristics. In this study, an acrylic resin was converted to antibacterial composite
materials by using silver nanoparticles and chitosan. Different amount of additives were inserted to the
polymer matrix individually. Glass substrates were coated with this polymeric matrix. Obtained samples were
characterized by Scanning Electron Microscope (SEM) and scratch test. Antibacterial activity against
Staphylococcus aureus (S. Aureus) was studied by applying entitled in vitro test so called percent decreasing
test. It was concluded that chitosan can be considered as an effective antibacterial additive as an alternative to
silver nanoparticles.
Keywords: Antibacterial materials; Silver nanoparticles; Chitosan; Staphylococcus aureus.
1. INTRODUCTION
Unwanted bacterial adhesion, colonization and subsequent biofilm formation, so called bacterial infections, may
cause pain and death. It also brings tremendous additional costs to health care worldwide. It causes major
problems in many sectors such as food processing/storage, marine transport/management, and water treatment.
Although scientists have done countless research on this issue, they have not found a comprehensive solution for
controlling bacterial surface colonization. Over the last few decades plenty of antibacterial materials and
coatings have been developed. Some of them even transferred from the laboratory to the hospital to prevent the
buildup, spread and transfer of harmful bacteria and viruses (Brown, 1998). Silver, is one of the antibacterial
agents, has been used by civilizations throughout the world even by the Ancient Greek and Roman Empires. It
was employed as a germicide and antibiotic long prior to the development of modern pharmaceuticals. Also used
for storing wine to prevent spoilage, storing milk to keep it fresh, and storing drinking water to save it from
bacteria and algae (Purest Colloids, 2014). Unlike other materials, silver works for destroying the enzymes of
microorganisms for disabling them. In addition, comparing with antibiotics, which are only useful for bacteria,
silver is also effective for other microorganisms such as anaerobic bacteria, viruses, yeasts, and fungus (Thurman
et al, 1989, Domek et al. 1984). However, some toxic effects have been reported for silver. In this case the need
for the use of organic materials has emerged. Chitosan to be used in place of antibacterial agent was chosen in
this study. It is the largely used natural biopolymer material is produced from wastes of crab and shrimp shells. It
can be called as functional and environmental purification materials which can effectively control the growth,
reproduction of hazardous bacteria and toxic pollutants (Hu et al., 2004). Chitosan has positively charged amino
group which interacts with negatively charged microbial cell membranes (Rabea et al., 2003). This leads to the
ORAL PRESENTATION
1
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
leakage of proteinaceous and other intracellular constituents of the microorganisms. That may be one of the
reasons of having antimicrobial feature of chitosan (Shahidi et al., 1999). Another reason is related to the moves
of chitosan on the outer surface of bacteria. At a lower concentration (0.2 mg/mL), polycationic chitosan can be
probably bound to the negatively charged bacterial surface for causing agglutination. The larger number of
positive charges may impart a positive charge to the bacterial surfaces in order to keep them in suspension at a
higher concentration (Dutta et al., 2009). In this study, an acrylic resin was converted to antibacterial coating
materials by using silver nanoparticles and chitosan. They were inserted to the polymer matrix individually.
Glass substrates were coated with this polymeric matrix. Then, the samples were characterized by Scanning
Electron Microscope (SEM) and scratch test. Antibacterial activity against Staphylococcus aureus (S. Aureus)
was studied by applying percent decreasing test.
2. MATERIALS AND METHODS
2.1 Preparation of the additives
Ag nanoparticles were synthesized by a reduction reaction (Yan at al, 2005). An aqueous solution of silver
nitrate and an aqueous solution of a nonammonia reducing agent were mixed to form a nano silver particlecontaining solution at room temperature. Glucose was used as a reducing agent wherein silver nitrate and
glucose was at a ratio of about 2:1 by weight (Figure 1-a). Chitosan (Poly-(D) glucosamine, Sigma) colloids
were prepared as presented in Figure 1-b. Different amounts of chitosan were dissolved in the acid solution.
After a complete mixture by using magnetic stirrer at 25 OC for 20 minutes, homogeneous chitosan colloids were
obtained.
(a)
(b)
Figure 1. Production of a) Ag Nanoparticles and b) Chitosan colloid
2.2. Coating Preparation
Acrylic composite coatings were prepared by adding Ag nanoparticles and chitosan colloids to the polymeric
matrix. Polymethyl acrylate was used as an acrylic resin supplied from DYO, Turkey. Additives were
incorporated into the acrylic resin with different loading level to assess the concentration dependence of
material’s antimicrobial affect. Glass substrates were coated with produced polymeric composites. The sample
codes and descriptions coatings are demonstrated in Table 1.
ORAL PRESENTATION
2
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 1. Description and sample codes of composite coatings
Sample codes
P00
PS1
PS2
PS3
PS4
PC1
PC2
PC3
PC4
Ag nanoparticles percentage in the
composites (%)
Chitosan percentage in the
composites (%)
0
0
0.01
0.05
0.50
1.00
0
0
0
0
0
0
0
0
0.01
0.05
0.50
1.00
2.3. Characterisation
Elemental analysis and the microstructural cross-sectional area of the coatings were examined through SEMEDS with a JEOL JJM 6060 model equipment. Antibacterial properties of the samples were measured by percent
decreasing test. A plate counter agar solid culture medium was poured into the plates that were subsequently
incubated at γ7 °C for β4 hours so that the Vital cells, eventually presented, could grow into colonies. The
microorganisms’ colonial presence was then evaluated, by counting the colony-forming units per Petri plate
(CFU/mL). Used bacteria were Staphylococcus aureus (S. Aureus) (ATTC 11228). The difference between the
number of the bacteria obtained at zeroth hour and the one obtained after 24 hours will show the antibacterial
performance (Equation 1).
*
A B
% decrease
x100 ………………….. (Eq. 1)
A
in which, A: Bacteria number at zeroth hour and B: Bacteria number after 24 hours.
3. RESULTS
Figure 2 depics SEM micrographs of the composite coatings. It can be clearly seen that by adding Ag
nanoparticles and chitosan to the composites, the microstructure regularly changed. Smooth surface is obtained
at the pure coating, some defects such as porosity, rough surface and so on are produced at Ag nanoparticle and
chitosan reinforced composites.
Scratch test has been performed to the composite coatings for estimating the adhesion properties of the coatings.
The test results are shown in Table 2. It can be clearly seen that pure resin’s cohesive force is the highest value.
Adhesion properties were deteriorated by adding Ag nanoparticle and chitosan. Corresponding adhesion
strengths are calculated as following; 94.76 Mpa, 80.12 MPa, 82.54 MPa, 65.97 MPa, 66.54 MPa, 91.65 MPa,
89.76 MPa, 78.65 MPa and 75.18 MPa, respectively. Chitosan colloid addition made worse the adhesion as
stated in SEM results which showed that formation of flocculation and cracks lead to split up the contact points
(Renevier et al., 2000).
ORAL PRESENTATION
3
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
a)
b)
c)
Figure 2. SEM micrographs of (a) P00, (b) PS3 (c) PC3 samples
Ag Nanoparticles and chitosan reinforced composite samples were subjected to antibacterial test called “percent
decreasing test”. The initial number of bacteria was 22.3x104, and they were counted again after 24 hours. The
results are shown in Table 3 below. It can be seen that all Ag nanoparticles reinforced composites revealed very
good antibacterial property. Even the lowest quantity of Ag nanoparticles (0.1%) in the polymer matrix caused a
100% destroying on the bacteria of S. aureus. Antibacterial activity of chitosan reinforced composites is a little
bit different. 100% destroying of bacteria was achieved with PC3 and PC4 samples which have 0.50 and 1.00%
chitosan. However, the percent decrease values were 94.62% and 95.52% for PC1 and PC2, respectively.
ORAL PRESENTATION
4
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 2. Scratch test results of composite coatings
Sample codes
P00
PS1
PS2
PS3
PS4
PC1
PC2
PC3
PC4
Corresponding adhesion strengths (MPa)
94.76
80.12
82.54
65.97
66.54
91.65
89.76
78.65
75.18
Table 3. Percent ecreasing test results of the composite samples
Sample codes
P00
PS1
PS2
PS3
PS4
PC1
PC2
PC3
PC4
Bacteria quantity after 24 hours
16.8x104
0
0
0
0
1.2x104
1.0x104
0
0
Decrease, %*
24,67
100
100
100
100
94.62
95.52
100
100
4. DISCUSSION
The results are supported our preivous works (Yilmaz Atay et al. 2015) for silver nanoparticles reinforced
composites. Excellent ahis antibacterial activity was achieved with silver nanoparticles reinforced composites.
This activity is thought that it results from the interaction of silver and thiol groups in bacteria proteins (Li et al,
2008). For the chitosan reinforced composites, also it can be expressed that they showed antibacterial property.
Colloid chitosan allows reaction with the counterparts to a sufficient degree by existing as a disassociating form
in solution and an extending confirmation (Phaechamud et al. 2008). By extending conformation contact to
solution, hydrogels can be formed by covalently cross-linking chitosan with itself. Chitosan particulate systems
can form dispersion in solution with the considerable reactive surface area (Kong et al. 2008).
In addition, the prohibition activity of Ag nanoparticels and chitosan depends on different types of factors, such
as solid surface characteristic and the morphology. Particle size, membrane and fiber thickness cause to occur
different results. It was investigated the effect of particle size and shape of the additives, and it was recorded that
antibacterial activity was improved by decreasing the particle size. Moreover, the antibacterial property of those
additives depends on shape as well as specific surface area.
5. CONCLUSION
In this study, the antibacterial behaviour and effectiveness of Ag nanoparticles and chitosan reinforced polymer
composites were investigated. With SEM photographs it was seen that smooth surface is obtained at the pure
coating, some defects such as porosity, rough surface and so on are produced at Ag nanoparticle and chitosan
reinforced composites. Antibacterial activity against Staphylococcus aureus (S. Aureus) was studied by applying
entitled in vitro test so called percent decreasing test. As chitosan is non-toxic, biodegradable, biocompatible and
ORAL PRESENTATION
5
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
hydrophilic, in addition to having antimicrobial and antibacterial characteristics, it can be considered as an
effective antibacterial additive as an alternative to silver nanoparticles. Using this nontoxic, harmless and
environmentally friendly vegetable material material at the points of our life will be more healthful for people.
That will inspire research towards the next generation of antibacterial materials and coatings.
REFERENCES
Brown SD, 1998. Investigation into the suitability of using water ionized with copper and silver to treat E. coli
infection in slaughtering house. MSc thesis, Cranfield Biotechnology Centre.
Domek M J, LeChevallier MW, Cameron SC, McFeters GA, 1984. Evidence for the role of copper in the injury
process of coliform bacteria in drinking water. Appl. Environ Microbiol. 48: 289–293.
Dutta PK, Tripathi S, Mehrotra GK, Dutta J, 2009. Perspectives for chitosanbased antimicrobial films in food
applications, Food Chem. 114; 1173–1182.
Hu SG, Jou CH, Yang MC, 2004. Biocompatibility and antibacterial activity ofchitosan and collagen
immobilized poly (3-hydroxybutyricacid-co-3-hydroxyvaleric acid), Carbohydr. Polym. 58; 173–179.
Kong M, Chen XG, Xing K, Park HJ, 2010. Antimicrobial properties of chitosan andmode of action: a state of
the art review, Int. J. Food Microbiol. 144: 51–63.
Li B, Liu X, Cao C, Meng F, Dong Y, Cui T, Ding C, 2008.. Preparation and antibacterial effect of plasma
sprayed wollastonite coatings loading silver. Appl. Surf. Sci. 255: 452–454.
Phaechamud T, 2008. Hydrophobically modified chitosans and theirpharmaceutical applications, J. Pharm. Sci.
Technol. 1: 2–9.
Purest Colloids, 2014. A Brief History of
the Health Support Uses of
Silver.
http://www.purestcolloids.com/history-silver.php [Erişim16Octoberβ014].
Rabea EI, Badawy MET, Stevens CV, Smagghe G, Steurbaut W, 2003. Chitosan asantimicrobial agent:
applications and mode of action, Biomacromolecules 4; 1457–1465.
Renevier NM, Fox VC, Teer DG, Hampshire J, 2000. Coating characteristics and tribological properties of
sputter-deposited MoS2/metal composite coatings deposited by closed field unbalanced magnetron sputter
ion. Surface and Coatings Technology, 127: 24-37.
Shahidi F, Arachchi JKV, Jeon YJ, 1999. Food application of chitin and chitosans, Trends Food Sci. Technol.
10; 37–51.
Thurman R, Gerba CA, 1989. small sample of research and articles supporting the efficacy of silver as an
antimicrobial agent follow: The molecular mechanisms of copper and silver ion disinfection of bacteria and
viruses. CRC Crit. Rev. Environ. Control. 18: 295–315.
Yan J, Cheng J, 2005. Antimicrobial Yarn Having Nano silver Particles and Methods for Manufacturing the
Same. U.S. Patent No. 6,979,491 B2.
Yılmaz Atay H, Yaşa I, Çelik E, β015. Antibacterial polymer composite coatings with synthesized silver
nanoparticles. Synthesis and Reactivity in Inorganic, Metal-Organic, and Nano-Metal Chemistry. 45:
DOI:10.1080/15533174.2013.843561
ORAL PRESENTATION
6
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Influence of Tartaric Acid on Phase Transformation Behavior of Glycine
Sevgi Polat*, Perviz Sayan
Marmara University, Faculty of Engineering, Chemical Engineering Department, Istanbul, TURKEY
Corresponding author e-mail: sevgi.polat@marmara.edu.tr
Abstract
Phase transformation of -glycine to α-glycine was investigated in the absence and presence of tartaric acid, a
type of carboxylic acid, used as an additive. XRD, SEM, morphology, and FTIR analysis were performed to
characterize the crystals. XRD results showed that all crystals obtained in the presence of tartaric acid were in α
form and the addition of tartaric acid caused to prolong the phase transformation time. In terms of morphological
characteristics, rod shape glycine crystals experienced morphological change in the presence of the additive.
Compared to the pure media, the crystals obtained in the presence of tartaric acid had agglomeration tendency
and the aspect ratio of the crystals were changed remarkably. The functional groups of the crystals were
determined using FTIR analyzer and this result confirmed the adsorption of tartaric acid on glycine crystal
surface. In addition, filtration characteristics of the crystals were investigated and the specific cake resistance
increased significantly in the presence of the additive. From the experimental results, it is possible to conclude
that tartaric acid addition to crystallization media has created significant variations in the glycine characteristics
especially in terms of morphology.
Keywords: polymorphic phase transformation, crystallization, glycine, tartaric acid.
1. INTRODUCTION
Glycine is the simplest amino acid found in the protein of all living organisms. Structurally, glycine exhibits in
three different polymorphic forms at ambient conditionsμ α, ί and γ (Srinivasan 2008). Polymorphs can exhibit
different mechanical, thermal, and physical properties, such as compressibility, melting point, solubility, and
crystal habit, which can have a great influence on the bioavailability, filtration, and tableting processes of
pharmaceutical, food, and specialty materials (Liu et., al 2008). Therefore, it is important to make sure that the
desired polymorph is consistently obtained since problems can arise when a transformation between two forms
occurs during the production process (Ferrari et., al 2003).
In literature, several studies have shown that the phase transformation process and the physical properties of the
product can be changed with the presence of the additives in crystallization media (Yang et., al 2008). There are
several types of additives such as amino acids, carboxylic acids, metal ions but there is no study examined the
influence of tartaric acid, a type of carboxylic acid, phase transformation process of glycine. Therefore, in this
study, tartaric acid was chosen as the additive and its effects on glycine transformation of to α form were
investigated.
2. MATERIALS AND METHODS
All chemicals used were of analytical reagent grade and α-glycine, tartaric acid and ethanol were provided from
Merck Company.
The phase transformation experiments were performed in a double jacketed glass crystallizer with 2L capacity.
The inside temperature of the crystallizer was kept constant at 25 C by means of a thermostat. Phase
transformation process was continuously followed by an ultrasonic speed measurement system that was placed at
the crystallizer base and can do inline measurement. The stirring velocity was 75 rpm and the stirring was done
by a mechanic stirrer including a paddle type stirring element.
At the beginning of the experiment, saturated α-glycine solution was prepared with triple distilled water at 25 C
and it was put in the crystallizer. After the solution reached to the thermal equilibrium, ethanol, which was
ORAL PRESENTATION
7
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
cooled off to 5 C, was added to the crystallizer at once. With sudden addition of ethanol, -glycine crystals
were appeared and then slowly transformed into the α-form. This transformation process was monitored by the
ultrasonic probe. After the completion of the phase transformation, samples characterizing the end products was
taken from the crystallizer, filtered and then dried. During the experiments, tartaric acid was used as additive.
The same experimental procedure was also applied to the experiments which tartaric acid were used. Tartaric
acid was added to the crystallizer alongside with ethanol at 500 ppm concentration. Experiments were repeated
at least three times.
To characterize the crystals obtained in pure and tartaric acid media, X-ray diffraction (XRD), scanning electron
microscopy (SEM), morphology, and Fourier-transform infrared spectroscopy (FTIR) were carried out. In
addition, filtration rate measurements were conducted under constant vacuum conditions. The obtained results
were evaluated according to Darcy’s Law to detect the filtration characteristics.
3. RESULTS
3.1. Ultrasonic velocity measurements
The phase transformation time of glycine was determined by measuring the ultrasonic velocity change with time.
Figure 1 shows the ultrasonic velocity change results for both pure and additive media. During the phase
transformation process, first -glycine crystals dissolved, then α-glycine nuclei formed and these nucleus formed
the α-glycine crystal by growing.
1487
Sonic velocity (m/s)
1485
1483
1481
1479
1477
1475
Pure media
Additive media
1473
0
10
20
30
40
Time (min)
50
60
70
Figure 1. Change of ultrasonic velocity with time in pure media and in the presence of tartaric acid
As it can be seen in Figure 1, the transformation process was completed in 45 minutes for pure media. With the
addition of tartaric acid to crystallization media, the transformation process was slowed down and this duration
was found to be 63 minutes. From the results, it is noticeable that tartaric acid drastically affected the
transformation time and it had a retardant effect on the phase transformation process.
3.2. XRD analysis
To identify the structure of crystals formed during the phase transformation process, XRD analysis was
conducted for the crystals obtained in pure media and media containing 500 ppm tartaric acid. X-Ray diffraction
patterns of the crystals are provided in Figure 2.
ORAL PRESENTATION
8
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 2. XRD results of the crystals obtained in pure media and in the presence of tartaric acid
X-ray diffraction patterns of the crystals obtained in additive and non-additive media were compared to
reference card. As can be seen in the Figure 2, the crystals formed with the completion of the transformation
process were in α formν and did not contain crystals with form. Compared to pure media, there was an increase
observed in the intensity of XRD peaks for the crystals obtained in the existence of tartaric acid. This situation
may be resulting from the change in the crystal lattice strains due to tartaric acid.
3.3. Morphology analysis
To determine the influence of tartaric acid on glycine crystal morphology, firstly SEM analysis was performed
for the crystals obtained at the completion of the phase transformation. In Figure 3, there are SEM images of αglycine crystals obtained in pure media and media containing 500 ppm tartaric acid media.
Glycine crystals obtained in pure media was prismatic shaped and long formed. The average particle size of the
crystals was 85 µm. The surface of the crystals was smooth and there was no agglomeration tendency in crystals.
On the contrary, the crystals obtained in the presence of tartaric acid lost their rod form and acquired a different
morphology. It was also clear that the presence of tartaric acid created significant changes in the width and
length of the crystals, especially in length. The obtained crystals had a hexagonal form and had high
agglomeration tendency.
To get more information about the crystal morphology and to compare the morphological change quantitatively,
detailed morphology analysis were conducted for the crystals obtained in both media by using a Malvern
Morphologi G3 device. In this context, HS circularity, elongation and aspect ratio of the crystals were
determined. While aspect ratio can be defined as width/length value, elongation value is 1 – width/length or 1aspect ratio. The elongation value is between 0 and 1. This value is 0 for a circle while the value is close to 1 for
rod-type crystals (Malvern 2010). The elongation value of the crystals obtained in pure media was found as
0.517, HS circularity value was 0.552 and aspect ratio was 0.483. In tartaric acid media, the values of elongation,
HS circularity and aspect ratio were are 0.272, 0.784, and 0.728 in order. As it can be clearly seen in these
results, tartaric acid significantly affected glycine morphology, and caused the formation of shorter, more
rounded and more compact crystals.
ORAL PRESENTATION
9
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
(a)
(b)
Figure 3. SEM images of the crystals obtained in pure media (a) and in the presence of additive (b)
3.4. FTIR analysis
The FTIR spectra of the crystals obtained in pure media and in the presence of the tartaric acid media were
collected for the qualitative determination of their functional groups. Figure 4 shows the FTIR spectra of the
crystals in the range of 650-4000 cm-1.
100
Transmittance (%)
95
90
85
80
Pure media
Additive media
75
70
650
1150
1650
2150
2650
Wavenumber (cm-1)
3150
3650
Figure 4. FTIR spectra of the crystals obtained in pure media and in the presence of additive
The 3300-2200 cm-1 was associated with NH stretching vibrations. The peak at 15λλ and 1406 cm−1 were
assigned to the asymmetric and symmetric stretching vibration of the COO- group, respectively. The bands at
8λ1 and 6λγ cm−1 denoted the presence of bending vibration of C-C symmetric stretching and O-C=O bending
vibrations, respectively (Polat et al., 2017). On the other hand, new functional group were detected on the
surface of glycine crystals obtained in the presence of tartaric acid. It was observed that the absorbance band had
peak at around 1700 cm-1 indicating the presence of C=O stretching vibrations of the carboxylic acid group in
tartaric acid. Thus the presence of characteristic band showed the tartaric acid adsorbed on the crystal surface.
3.5. Filtration analysis
In this study, phase transformation process of glycine was investigated in non-additive and additive media. XRD
determine the impact of tartaric acid on filtration characteristics of glycine crystals, filtration rate measurements
of the crystals obtained in the pure media and media consisting 500 ppm tartaric acid were carried out in
ORAL PRESENTATION
10
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
standard filtration test unit under 700 mbar constant pressure. The specific cake resistance and average cake
porosity values were calculated according to Darcy’s law (Rushton et al., 2000). While specific cake resistance
and average cake porosity values of the crystals obtained in pure media was 1.0λ5×1011 m/kg and 0.421, these
values were determined to be 1.48×1011 m/kg and 0.421 and 0.0412 Hence, with the addition of tartaric acid into
the media, filtration became harder due to intense agglomeration tendency, and in relation to this, specific cake
resistance increased as well.
4. CONCLUSION
In this study, phase transformation process of glycine was investigated in non-additive and additive media.
Experiments performed in the tartaric acid media resulted in change in phase transformation time. XRD, SEM,
morphology and FTIR analysis were successfully used to characterize the crystals obtained. The characterization
results showed that the presence of additive in crystallization media caused to morphological change. Prismatic
shaped crystals obtained in pure media transformed into the hexagonal form with more rounded, shorter and
more compact crystals. In addition to SEM analysis, the detailed morphology analysis provided better
information about the morphological changes especially in terms of quantitative identification. The morphology
analysis results showed that the elongation value of the crystals in the presence of tartaric acid was smaller
approximately 50 % than that of in pure media. The morphological change drastically affected the filtration
characteristics of the crystals. In conclusion, the present investigation showed that tartaric acid can be effectively
used as a retarder for the transformation of glycine into α form.
ACKNOWLEDGEMENTS
This work was supported by Marmara University Scientific Research Projects Commission under the funding
FEN-C-DRP-131216-0547.
REFERENCES
Ferrari ES, Davey RJ, Cross WI, Gillon AL, Towler CS 2003. Crystallization in Polymorphic Systems: The
Solution-Mediated Transformation of ί to α Glycine. Crystal Growth & Design, 3: 53-60.
Liu Z, Zhong L, Ying P, Feng Z, Li C 2008. Crystallization of metastable ί glycine from gas phase via the
sublimation of α or γ form in vacuum. Biophysical Chemistry, 1γβμ 18-22.
Morphologi G3 User Manual, Malvern Instruments Ltd., United Kingdom 2010.
Polat S, Sayan P 2017. Kinetic analysis and polymorphic phase transformation of glycine in the presence of
lauric acid. Journal of Crystal Growth, 481: 71-79.
Rushton A, Ward AS, Holdich RG, 2000. Solid-Liquid Filtration and Separation Technology, second ed., WileyVCH Verlag GmbH, Weinheim, Germany.
Srinivasan K 2008. Crystal growth of α and γ glycine polymorphs and their polymorphic phase transformations.
Journal of Crystal Growth, 311: 156-162.
Yang X, Lu J, Wang XJ, Ching CB 2008. Effect of sodium chloride on the nucleation and polymorphic
transformation of glycine. Journal of Crystal Growth, 310: 604-611.
ORAL PRESENTATION
11
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Bor Mineral ve Bileşiklerinin Sarıçam (Pinus sylvestris L.) Tohumlarının Çimlenmesine Etkisi
Handan Ucun Özel1, Mehmet Akif Barış1, Halil Barış Özel2*
1
Bartın Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Bartın, TÜRKİYE
*2
Bartın Üniversitesi, Orman Fakültesi, Orman Mühendisliği Bölümü, Bartın, TÜRKİYE
Sorumlu yazar e-mail: halilbarisozel@gmail.com
Özet
Bu çalışmada, bor mineralinin sarıçam tohumlarının çimlenme yüzdesi ve çimlenme gücü üzerindeki etkileri
incelenmiştir. Bu amaçla değişik konsantrasyon düzeylerinde sıvı bor kullanılarak oluşturulan çimlenme
ortamları Eskişehir-Çatacık orijinli sarıçam (Pinus sylvestris L.)tohumlarına uygulanmıştır. Yapılan deneylerde
sıvı bor maddesinin konsantrasyonlarına bağlı olarak tohumların çimlenme yüzdesini %γ8.5-100 arasında
düşürdüğü ve çimlenme sürecini negatif yönde etkilediği belirlenmiştir. Bu durumun özellikle tohumların
çimlenmesi sırasında endosprem ve embriyoda meydana gelen sıvı alış verişinden kaynaklanan fizyolojik
bozukluklar sonucunda ortaya çıktığı düşünülmektedir.
Anahtar Kelimeler: Bor, sarıçam, tohum, çimlenme.
1. GİRİŞ
Bor, yeryüzünde yüzden fazla minerali bulunan, değişik amaçlarla kullanılan çok sayıda kimyasal bileşiği olan
bir elementtir. Bor kristali, elmastan sonra elementlerin en sertidir. Bor, bitkilerin gelişmesi için gerekli bir
elementtir. Fakat suda fazla bulunması halinde bitki gelişmesi için zararlı olur hatta bitkiyi öldürür. Bor,
canlıların hayatında eksikliği ya da fazlalığıyla önemli rol oynayan bir elementtir. Örneğin, eksikliği durumunda
bitkilerde yetişme sorunları yaşanırken, fazlalığı durumunda doğrudan bitkisel hayata zararlı bir elementtir.
Topraklarda ve sularda aşırı bor birikimi bitkilerin kök ve yeşil aksam büyümesini engelleyen ve tane verimini
ciddi bir şekilde sınırlayan bir mikro element problemidir. Birçok sanayi sektöründe bor kullanılması (zirai
ilaçlama, tıp, plastik ve cam sanayi vb. ), borun rafinasyonu sonucu oluşan fazla bor , bilinçsiz gübreleme vb.
problemler yüksek miktarda borun toksisitesiyle karşı karşıya bırakmıştır. Aynı zamanda bor mikro elementine
borca fakir olan yerlerde ihtiyaç duyulması ile bor fazlalığının buralarda değerlendirilmesi borun geri kazanımı
yönünden önem teşkil etmektedir (Yenialaca, 2009).
Bor bitkileri geliştirmek için kullanıldığı gibi gelişimi önlemek için de kullanılabilir. Yabani ot kontrolünde ve
toprak sterilizasyonunda, yanmayı geciktirici özelliği ile otoyollar ve demiryolları kenarlarındaki alanlar, petrol
rafinerileri ve kereste depolan gibi alanlarda bitkileri tamamen yok etmede kullanılır (Kalafatoğlu ve ark., 1997;
Uygan ve Çetin, β004). İçme sulan için, farklı bor sınır değerleri verilmektedir. 1λ68'de Su Kalite Kriterleri
Komitesi (Committee on Water Quality Criteria) izin verilen sının 1 mg/l olarak belirlemiştir. 1λ71'de İçme
Suları Teknik Komitesinin (Drinking Water Standarts Technical Review Committee) incelemeleri sonucunda l
mg/1 sınırını gerektirecek kanıt olmadığını, insan sağlığı yönünde 0,γ mg/' nin güvenilir bir sımr olduğuna karar
vermiştir (Kalafatoğlu ve ark., 1λλ7). Ülkemizde ise, Su Kirliliği Kontrol Yönetmeliği 'nde doğrudan içme suyu
olarak kullanılabilecek I. sınıf su kalite sınıfına giren suda bor için izin verilen sınır değer 1 mg/L'dir. 1λλ7'de
resmi gazetede ise içme suyu sınır değeri γ mg/1 olarak verilmiştir (Uygan ve Çetin, β004). Her bitkinin bor
gereksinmesi farklıdır. Tek çenekliler çift çeneklilerden daha az B'a gereksinme gösterirler. Süt özsuyu sistemine
sahip bitkiler ise özellikle B'a büyük ölçüde gereksinme duyarlar. Örneğin, bor eksikliği olan topraklarda,
buğdayda yapılan bir çalışmada 4 kg B/ha bor uygulaması ile verim önemli oranda artmıştır. Daha yüksek bor
uygulamalarında ise verimde azalma görülmüştür (Güneş ve ark., 2000; Uygan ve Çetin, β004)
2. MATERYAL VE METOD
2.1 Materyal
Bu araştırma kapsamında gerçekleştirilen ve farklı sıvı bor maddesi olarak kullanılan çimlenme ortamlarının
hazırlanmasında yararlanılan bor hammaddesi Eskişehir Bor Enstitüsünden araştırma amaçlı olarak temin
ORAL PRESENTATION
12
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
edilmiştir. Bu amaçla sızdırmaz kap ve kutularda 1,5 l olarak gelen dinlendirilmiş ve tamamen atıklarından
arındırılmış sıvı bor hammaddesi doğrudan doğruya çimlenme ortamlarının hazırlanmasında ortam ana maddesi
olarak kullanılmıştır. Araştırmanın materyal kısmını oluşturan ikinci ana faktör ise sarıçam (Pinus sylvestris L.)
tohumlarıdır. Araştırmada kullanılan sarıçam tohumları Eskişehir-Çatacık orijinli olup, 11γ0m yükseklikte,
kuzeybatı bakılı ve orta yamaçta bulunan tohum meşceresinden β015 yılı Eylül-Kasım ayları arasında özel bir
ekipman yardımıyla toplanmış ve Bartın Üniversitesi Orman Fakültesi, Silvikültür Anabilim Dalı tohum
koleksiyonuna dahil edilmiştir
2.2 Metod
Araştırmamızda sarıçam tohum meşceresinden alınan tohumlar üzerinde bor minerali kullanılarak çimlendirme
testlerine tabi tutulmuştur. Bu doğrultuda sıvı bor için %10, %γ0, %50 ve %70 düzeylerinde çözeltiler
hazırlanmıştır. Hazırlanan bu çözeltilerde oluşan parametreleri karşılaştırmak için bor olmayan kontrol örneği
hazırlanmıştır. Her bir bor çözeltisi için γ tekerrürlü çözeltiler hazırlanmıştır. Hazırlanan bu tekerrürler için γ00
adet tohum kullanılmıştır. Her bir bor çözeltisi için λ00 adet tohum ile testler gerçekleştirilmiştir. Araştırmada
yapılan çimlendirme testlerinde kullanılan tohum sayılarının γ00 adet olması orijinler üzerinde yapılan
ölçümlerin daha sağlıklı olması için yeterlidir (Genç, β007). Bu araştırmada, sıvı ve dehidre olmuş 4 farklı
konsantrasyon düzeyinin (%10, %γ0, %50, %70, %100 ve kontrol) sarıçam tohumlarının çimlenmesi üzerindeki
etkileri incelenmiştir (Şekil 1).
Şekil 1. Sıvı bor ile çimlenme ortamlarının hazırlanması, tohumlara aplikasyonu ve çimlendirme dolabına
örneklerin yerleştirilmesi.
Araştırmada farklı bor minerali için hazırlanan değişik oranlardaki (%10, %γ0, %50, %70, %100 ve kontrol)
çözeltilerin sarıçam tohumlarının ortalama çimlenme yüzdesi üzerindeki etkilerini belirleyebilmek için
hazırlanan tohum örnekleri çimlendirme dolabında çimlendirme testlerine tabi tutulmuştur. Bu kapsamda borun
her bir çözelti seviyesi için γ replikasyonlu olarak hazırlanan sarıçam tohum örnekleri plastik petri kaplarda,
filtre kâğıdı üzerinde β0ºC sıcaklıkta ve %70 ışık altında γ0 gün süreyle çimlenme testlerine tabi tutulmuş, Genç
(β007) tarafından açıklanan ve aşağıda belirtilen formül kullanılarak ortalama çimlenme yüzdesi ve çimlenme
gücü parametreleri hesaplanmıştır.
MGP (%) =
ORAL PRESENTATION
(1)
13
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
MGP (%): Çimlenme yüzdesi, ni: gündeki çimlenen tohum sayısı, N: Teste tabi tutulan toplam tohum sayısını
göstermektedir.
Araştırmada genel bor mineraline ait farklı konsantrasyonlarının belirlenmesinde öncelikli olarak SPSS
programında verilerin normal dağılım gösterip göstermediğini belirlemek için Kolmogorov-Simirnov testi
uygulanmıştır. Daha sonra elde edilen ölçüm ve çimlendirme testlerinden P<0,05 güven düzeyinde elde edilen
ham veri setlerine tek yönlü varyans analizi uygulanmıştır. Varyans analizi sonucunda ortaya çıkan istatistiki
farklılıkların gruplandırılmasında P<0,05 güven düzeyinde Duncan testi uygulanmıştır. Ayrıca morfolojik
özellikler arasındaki ilişkileri bir arada inceleme amacıyla çoklu kolerasyon analizi uygulanmıştır.
3. SONUÇ VE TARTIŞMA
Sıvı bor ile farklı konsantrasyonlarda hazırlanan çimlenme ortamlarından 7, 14, β1 ve γ0. Günlerde yapılan
çimlenme sayıları ile hesaplanan çimlenme yüzdesine ilişkin sonuçlar Tablo 1’de verilmiştir.
Tablo 1. Farklı konsantrasyondaki bor çözeltilerinde ve kontrol numunesinde belirlenen çimlenme yüzdesi
değerlerine ait varyans analizi ve Duncan testi sonuçları
Mineral
Bor
Kontrol (% 0)
100a
%10
61.5b
F=97.56***
%30
%50
11,2b
0,0c
%70
0,0c
%100
0,0c
Çimlenme yüzdelerine Arc. Sin transformasyonu uygulanarak gerçekleştirilen varyans analizi sonucunda
P<0,001 güven düzeyinde anlamlı farklılık ortaya çıkmıştır. Bu kapsamda uygulanan Duncan testinin
sonuçlarına göre γ farklı grup ortaya çıkmış olup, P<0.05 güven düzeyinde belirlenen bu gruplar arasında en
yüksek çimlenme yüzdesi bor mineralinin sıvı olarak uygulanmadığı kontrol grubunda belirlenmiştir (%100).
%50 ve %70 konsantrasyon düzeylerinde tohumlarda hiçbir şekilde çimlenme aktivitesi tespit edilmemiştir
(Tablo 1). Bu sonuca göre çimlenme ortamında aktif madde olarak kullanılan dehidrasyona uğramış sıvı bor
maddesinin tohumların çimlenme yüzdesini %γ8.5-100 arasında düşürdüğü ve çimlenme sürecini negatif yönde
etkilediği belirlenmiştir. Bu durumun özellikle tohumların çimlenmesi sırasında endosprem ve embriyoda
meydana gelen sıvı alış verişinden kaynaklanan fizyolojik bozukluklar sonucunda ortaya çıktığını söylemek
mümkündür. Çünkü kısmen de olsa toksik etkiye sahip olan bor maddesinin embriyoya fiziksel ve anatomik
olarak zarar verdiği ve çimlenme reaksiyonlarını tamamen ortada kaldırdığı düşünülmektedir. Nitekim bor
konsantrasyonlarında artışa bağlı olarak çimlenme yüzdesinde ortaya çıkan belirgin düşüşler de bu durumu
kanıtlar niteliktedir. Nitekim arpa bitkisinde gerçekleştirilen bir araştırmada da bor sıvı olarak çimlenme
ortamında kullanılmış ve çimlenme engeline sahip olmayan hatta çimlenme enerjisi çok yüksek olan arpa
tohumlarının çimlenme yüzdesinin %45,6-78,7 oranında azaldığı tespit edilmiştir (Ashagre ve ark., 2014).
Salatalık bitkisinde yapılan bir başka araştırmada da toz olarak kullanılan hem büyüme hem de çimlenme
ortamlarına dahil edilen bor maddesinin gelişmeyi ve çimlenme yüzdesini önemli ölçüde azalttığı ve bunun
tamamen borun çimlenme ortamında toksik bir madde olarak davranmasına bağlı olduğu belirlenmiştir
(Alparslan ve Güneş, β001). Diğer taraftan günlük çimlenen tohum sayısı üzerinden belirlenen çimlenme gücü
grafiği de çalışma kapsamında oluşturulmuştur (Şekil 2).
Tablo 1 incelendiğinde aktif madde olarak çimlenme ortamında kullanılan sıvı bor maddesinin sarıçam
tohumlarının gücünü önemli ölçüde düşürdüğü tespit edilmiştir. Buna göre yapılan sayım sonuçları üzerinden
gerçekleştirilen hesaplamalar sonucunda %10’luk bor konsantrasyonunda dahi %γ8.5’ye varan çimlenme
kayıplarının olduğu belirlenmiştir. Buna göre genel olarak sıvı çimlenme ortamının sarıçam tohumlarının
çimlenme gücü ve çimlenme yüzdesi üzerinde olumsuz etkiler meydana getirdiği saptanmıştır. Bu konuda
yapılan bir araştırmada domates tohumlarına ilişkin deneyde kullanılan bor sıvı maddesinin çimlenme gücü
ORAL PRESENTATION
14
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
indeks değerini %45,6 oranında azalttığı saptanmıştır (Shaikh ve ark., β01γ). Yine bor ve çimlenme gücü indeks
değeri ile ilişkili olarak gerçekleştirilen bir diğer araştırmada da buğday bitkisinde yapılmış olup, çimlenme
ortamında bulunan bor maddesindeki %β,5’lik artışın dahi çimlenme endeks değerini %γ5,7 oranında azalttığı
tespit edilmiştir (Ashagre ve ark., β014). Diğer taraftan çimlenme prosesi üzerindeki etkileri yönünden
Kinfemichael (β011) tarafından gerçekleştirilen bildirime göre, borun çimlenme ortamında yaklaşık %4’lük eşik
değerinden sonra tohum fizyolojisinde önemli tahribatlar yaptığı ve çimlenme ile ilgili tüm parametreleri
düşürdüğü bildirilmektedir.
KONTROL
%10'LUK BOR KONSANTRASYONU
140
Çimle me gü ü i deks değeri
120
100
80
60
40
20
0
1
-20
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16 17 18 19 20
Çimle me i takip edildiği gü ler
Şekil 2. Çimlenme gücü eğrisi
4. ÖNERİLER
En yüksek çimlenme yüzdesi bor mineralinin sıvı olarak uygulanmadığı kontrol grubunda belirlenmiştir (%100).
%50 ve %70 konsantrasyon düzeylerinde tohumlarda hiçbir şekilde çimlenme aktivitesi tespit edilmemiştir
(Tablo 1). Bu sonuca göre çimlenme ortamında aktif madde olarak kullanılan dehidrasyona uğramış sıvı bor
maddesinin tohumların çimlenme yüzdesini %γ8.5-100 arasında düşürdüğü ve çimlenme sürecini negatif yönde
etkilediği belirlenmiştir. Bu durumun özellikle tohumların çimlenmesi sırasında endosprem ve embriyoda
meydana gelen sıvı alış verişinden kaynaklanan fizyolojik bozukluklar sonucunda ortaya çıktığını söylemek
mümkündür. Çünkü kısmen de olsa toksik etkiye sahip olan bor maddesinin embriyoya fiziksel ve anatomik
olarak zarar verdiği ve çimlenme reaksiyonlarını tamamen ortada kaldırdığı düşünülmektedir. Aktif madde
olarak çimlenme ortamında kullanılan sıvı bor maddesinin sarıçam tohumlarının gücünü önemli ölçüde
düşürdüğü tespit edilmiştir. Buna göre yapılan sayım sonuçları üzerinden gerçekleştirilen hesaplamalar
sonucunda %10’luk bor konsantrasyonunda dahi %γ8.5’ye varan çimlenme kayıplarının olduğu belirlenmiştir.
Buna göre genel olarak sıvı çimlenme ortamının sarıçam tohumlarının çimlenme gücü ve çimlenme yüzdesi
üzerinde olumsuz etkiler meydana getirdiği saptanmıştır (Şekil β). Dolayısıyla tohum çimlenme ortamının bor
atıklarıyla kirlenmemiş olması önem arz etmektedir.
ORAL PRESENTATION
15
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
TEŞEKKÜR
Bu çalışmanın gerçekleştirilmesinde bizden yardımlarını esirgemeyen sayın Dr. Mustafa BARIŞ’a ve bor
hammaddesinin temini konusunda destek veren Eskişehir Bor Enstitüsüne teşekkür ederiz.
KAYNAKLAR
Alpaslan, M., Güneş, A. β001. Interactive effects of boron and salinity stress on the growth, membrane
permeability and mineral composition of tomato and cucumber plants. Plant and Soil 236:123-128
Ashagre, H., Hamza, I.A., Fita, U., Nedesa, W. 2014. Influence of boron on seed germination and seedling
growth of wheat (Triticum aestivum L.), African Journal of Plant Science, 8(2): 133-139.
Genç, M. β007. Fidan standardizasyonu, Süleyman Demirel Üniversitesi, Orman Fakültesi, Yayın Noμ75, 55γ
pp.
Güneş, A., Alpaslan, M., Özcan, H., Çıkılı, Y. β000. Türkiye’de Yaygın Olarak Yetiştirilen Mısır (Zea mays L.)
Çeşitlerinin Bor Toksitesine Duyarlılıkları. Turkish Agricultural and Foresty. β4μ β77-β8β. TÜBİTAK.
Ankara.
Kalafatoğlu, E., Ors, N, Sain, S., Yüzer, H., Erbil, AÇ., 1λλ7. Bor Bileşikleri İçeren Atık Suların Arıtılması.
TUBITAK Marmara Araştırma Merkezi, 1-9. Gebze- Kocaeli.
Kinfemichael, GA. 2011. The response of some haricot bean (Phaseolus vulgaris) varieties for salt stress during
germination and seedling stage. Cur. Res. J. Biol. Sci. 3(4):282-288.
Shaikh IRS, Rafique AS, Shaikh AA 2013. Phytotoxic effects of heavy metals Parveen Rajjak (Cr, Cd, Mn and
Zn) on Wheat (Triticum aestivum L.) seed germination and seedlings growth in black cotton soil of Nanded.
India. Res. J. Chem. Sci. 3(6):14-23
Uygan, D., Çetin, Ö., β004. Borun tarımsal ve çevresel etkileri Seydisuyu Su Toplama Havzası, II.Uluslararası
Bor Sempozyumu. 23-β5 Eylül. Maden Mühendisleri Odası Yayınları, Ankara.
Yenialaca, Ç. β00λ. Bor ve Kullanım Alanları. Gazi Üniversitesi, Fen Bilimleri Enstitüsü, Ortaöğretim Fen ve
Matematik Alanları Eğitim Anabilim Dalı Yüksek Lisans Tezi, Ankara, 35pp.
ORAL PRESENTATION
16
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
İnsan Astrositoma Hücre Hatlarında HIV-1 Tat Geninin BDNF ve c-fos Ekspresyonu Üzerine
Etkisinin Araştırılması
Selçuk Özdemir
Atatürk Üniversitesi, Veteriner Fakültesi, Genetik Anabilim Dalı, Erzurum, Türkiye
Sorumlu yazar e-mail: selcuk.ozdemir@atauni.edu.tr
Özet
Bu çalışmanın amacı, HIV-1 tat geni ile transfekte olmuş insan astrositoma hücrelerinde ((U373.MG) BDNF
ve c-fos gen ekspresyon farklılıklarını qRT-PCR yöntemiyle belirlemektir. Bu amaç için, öncelikle hücreler
HIV-1 Tat geni ile transfekte edildi. Daha sonra bu hücrelerden total RNA izolasyonu yapılarak cDNA elde
edildi. Son olarak qRT-PCR ile HIV-1 Tat, BDNF ve c-fos genlerine ait mRNA transkript seviyeleri belirlendi.
HIV-1 Tat genin transfekte edildiği hücrelerde tat geninin, kontrol gruplarına göre yüksek oranda eksprese
edildiği gözlendi (p<0.001). BDNF ekspresyonunun ise HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol
gruplarına göre istatistiksel olarak önemli derece de arttığı görüldü (p<0.01). Son olarak c-fos ekspresyonunun
BDNF’ye benzer şekilde HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol grubuna göre arttığı, ancak
BDNF’ye göre bu artışın daha az olduğu belirlendi (p<0.05). Sonuç olarak, HIV-1 Tat geninin insan
Astrositoma hücrelerine transfeksiyonu sonucu artan Tat ekspresyonu, BDNF ve c-fos genlerine mRNA
transkript seviyelerinin artışına neden olmaktadır. Bu sonuç, bize HIV-1 Tat geninin beyin hücrelerinde
nörotoksik bir etki oluşturduğunu göstermektedir. Ayrıca BDNF ve c-fos ekspresyonunun artması astrositlerin
HIV-1 Tat nedeniyle strese maruz kaldığını doğrulamaktadır.
Anahtar Kelimeler: HIV-1 Tat; BDNF; c-fosν Astrositoma hücreleriν qRT-PCR.
1. GİRİŞ
İnsan immün yetmezlik virüsü tip 1 (HIV-1), enfeksiyonun akut fazı sırasında merkezi sinir sistemine (MSS)
girer ve viral proteinlerin üretilmesine, mikroglia / makrofajların aktivasyonuna ve nöronların yaralanmasına
neden olur (Valcour ve ark., β01βν Atluri ve ark., β015). Antiretroviral kombinasyon tedavisinden önce, MSS'in
HIV-1 enfeksiyonu, enfekte kişilerin % 15'in de rastlandığı rapor edilmiştir (Hult ve ark., β008). Aktif HIV
replikasyonunun bastırılmasında antiretroviral kombinasyon tedavisinin başarısı, HIV-1'e bağlı bunama
vakalarında % β düşüş ile belirgin olduğu gibi, nörobilişsel bozuklukların şiddetini önemli ölçüde azalttığı
gösterilmiştir (Ghafouri ve ark., β008). Buna ek olarak, HIV ile ilişkili nörobilişsel bozukluklarının daha hafif
bir biçimi, HIV ile enfekte kişilerin % 50'sinde saptanmaktadır (Bell ve ark., β006).
Tat, HIV-1 transkripsiyonu ve replikasyonu için vazgeçilmezdir (Kingsman, 1λλ6). Tat, aynı zamanda
nörobilişsel bozukluklar için önemlidir çünkü güçlü bir nörotoksindir ve hem in vitro hem de in vivo olarak
nöronlarda doğrudan akut hasara neden olur (Li ve ark., β00λν Kim ve ark., β00γ). Astrositlerin HIV-1
enfeksiyonu, HIV-1 erken gen ürünlerini olan Tat, Nef ve Rev proteinlerinin yüksek oranda ekspresyonuna yol
açar (Gorry ve ark., β00γν Messam ve Major, β000). Tat önemli bir özelliğe sahiptir, diğer bir deyişle bir
hücreden salınır ve diğer hücre tarafından alınır (Ma ve Nath, 1λλ7). Bu bulgularla uyumlu olarak, Tat, HIV ile
enfekte olmuş bireylerin MSS'lerinde bulunur ve HIV-1 tarafından latent olarak enfekte olmuş astrositler
tarafından eksprese edilir (Hudson ve ark., β000ν Chauhan ve ark., β00γ). Bunlara ek olarak, Tat, sitokin ifadesi,
eksitatör özellikler, hücre içi işaretleme, otofaji yoluyla nöronun sağkalımını (survival) olumsuz yönde etkiler
(Eugenin ve ark., 2007).
Beyin türevi nörotrofik faktör (BDNF), nörotrofin ailesine ait bir proteindir (Chao, β00γ). BDNF, nöronal
sağkalım (survival), büyüme, farklılaşma ve sinaptik esneklik (Huang ve Reichardt, β001), nöronal göç (Carter
ve ark., β00γ), miyelinasyon (Cosgaya ve ark., β00β) ve nöronal apoptozda önemli rol oynamaktadır (Bamji ve
ark. , 1λλ8ν Boyd ve Gordon, β00β). Dahası BDNF, bellek, öğrenme süreçlerini (Yamada ve ark., 2002) ve
nörodejeneratif hastalıklarının modülasyonu için önemlidir (Fumagalli ve ark., β006ν Peng ve ark., β00λν Zhang
ve ark., 2012). c-fos bir protoonkojendir ve bir nörotransmitterin uyarılmasıyla (Greenberg ve diğerleri, 1λ86)
ORAL PRESENTATION
17
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
aktive edilebilir, dolayısıyla erken erken cevap geni olarak adlandırılır. c-Fos, zararlı uyarı ve doku hasarından
sonra nöronal aktivasyon için belirteç olarak kullanılabilir (Gao ve Ji, β00λ). Daha önce yapılan çalışamalra
bakıldığında HIV-1 tat geninin insan astrositoma hücrelerindeki yüksek ifadesinin, BDNF ve c-fos gen
expresyon profili üzerine olan etkisiyle ilişkili çok az bilgi bulunmaktadır. Bu çalışmanın amacı, HIV-1 tat
geniyle transfekte olmuş insan astrositoma hücrelerinde BDNF ve c-fos gen ekspresyon farklılıklarını qRT-PCR
yöntemiyle belirlemektir.
2. MATERYAL VE METOD
2.1. Hücre Kültürü
İnsan astrositoma hücresi (Uγ7γ.MG) Amerikan Tipi Kültür Koleksiyonundan (ATCC, Manassas, VA) satın
alındı. Hücreler % 10 fetal sığır serumu ile takviye edilmiş (FBS) Dulbecco'nun modifiye Eagle’s (DMEM), 50
U / ml penisilin ve 50 ug / ml streptomisin ortamı içerisinde γ7 ° C ve % 5 CO 2 ayarlanmış inkübatör de
çoğaltıldı.
2.2. Plazmit ve Tranfeksiyon
Bu çalışmada 4 adet plazmit kullanıldı. Bu plazmitler, pTZ57R/T, pJET1.2/blunt (Fermentas), pBudCE4.1
(Invitrogen), pBudCE4.1-Tat (Şengez, β011ν Özdemir, β016). pBudCE4.1 ve pBudCE4.1-Tat plazmitleri insan
astrositoma hücrelerine Lipofectamine β000 (Invitrogen, Carlsbad, CA) kullanılarak transfekte edildi.
2.3. Total RNA İzolasyonu
Transfeksiyon işleminden sonra insan astrositoma hücrelerinden, Trizol (Invitrogen, USA) kullanılarak total
RNA izolasyonu yapıldı. Total RNA izolasyonu kitin prosedürüne uygun olarak yapıldı. Total RNA
izolasyonunda sonra RNA konsantrasyonu NanoDrop (Epoch Microplate Spectrophotometer, USA) ile ölçüldü.
Total RNA kalitesini kontrol etmek amacıyla RNA’lar %1.5’lik agaroz jel de 1XTBE solüsyonu içerisinde 80
voltta bir saat yürütüldü ve jel görüntüleme sistemi ile görüntülenerek RNA kalitesi belirlendi.
2.4. DNaz I uygulaması ve cDNA çevrimi
İzole edilen RNA örneklerinde DNA kontaminasyonuna karşı DNaz I (Thermo Scientific, USA) kullanıldı. Dnaz
I uygulaması kitte verilen protokole uygun olarak yapıldı. Daha sonra bu RNA’lardan 1 µg alındı ve miScript
Reverse Transcription Kiti (Qiagen, Germany) verilen protokole uygun şekilde kullanılarak cDNA sentezlendi.
Elde edilen cDNA’nın saflığı ve miktarı spektrofotometrede (Epoch Microplate Spectrophotometer, USA)
yapılan β60-β80 nm absobans ölçümleri ile belirlendi ve cDNA’lar aynı oranlarda sulandırıldı. Daha sonra
cDNA örnekleri Real Time PCR çalışmalarında kullanılmak üzere -β0 °C de muhafaza edildi.
2.5. Real time PCR
HIV-1 Tat, BDNF ve c-fos genlerinin mRNA transkript seviyelerini ölçmek amacıyla CFXλ6 BioRad marka
cihaz kullanılarak qRT-PCR yapıldı. İnternal kontrol olarak GAPDH geni kullanıldı. Real time PCR
deneylerinde oluşturulan master mix içeriğiν Syber Green βX Rox Dye Master mix (Qiageni Germany), genler
için tasarlanmış forward ve reverse primerler, template olarak cDNA’lar ve nükleaz free su. Master mixler
hazırlandıktan sonra örnekler Real Time cihazında analiz edildi ve elde edilen Ct değeleri β -DeltaDeltaCt metoduna
uygun olarak hesaplanarak ilgili genlerin ekspresyon seviyeleri belirlendi (Livak ve Schmittgen, 2001). Genlerin
reaksiyon koşulları ve primer dizileri Çizelge 1’de gösterilmiştir.
2.6. İstatistiksel Analiz
İstatistiksel analizlerde IBM SPSS β0 programı kullanılmıştır. HIV-1 Tat, BDNF ve c-fos genlerinin mRNA
transkript seviyelerinin istatistiksel farkları Tek Yönlü Varyans Analizi (ANOVA) kullanılarak saptandı.
Göreceli mRNA ekspresyon grafikleri, Graph pad prism software Inc., (Version 7.0, California, ABD)
kullanılarak oluşturuldu. qRT-PCR sonuçları, ortalama ± SEM (ortalamanın standart hatası) olarak ifade
edilmiştir. İstatistiksel olarak anlamlı farklar p <0.05, p <0.01 ve p <0.001 arasında anlamlı kabul edildi.
ORAL PRESENTATION
18
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tablo 1. Kullanılan primerlerin dizilimleri ve reaksiyon koşulları.
Primer
Diziler (5’-3’)
GAPDH
F: TCGACAGTCAGCCGCATCTTCTTT
R: ACCAAATCCGTTGACTCCGACCTT
F: AGA TCC TAG ACT AGA GCC CTG GAA
R: CAA ACT TGG CAA TGA AAG CAA CAC
F: CCTGGTGGAACTTCTTTGCGG
R: GAAAGCGAGCCCCAGTTTGG
HIV-1 Tat
BDNF
F: CAAGCGGAGACAGACCAACT
R: AGTCAGATCAAGGGAAGCCA
c-fos
Bağlanma
sıcaklığı 0C
57
57
57
57
Reaksiyon Koşulları
Kaynak
λ4°C 15 s / 57°C γ0 s /
7β°C γ0 s (40 cycles)
λ4°C 15 s / 57°C γ0 s /
7β°C γ0 s (40 cycles)
λ4°C 15 s / 57°C γ0 s /
7β°C γ0 s (40 cycles)
Donnio ve ark., 2017
λ4°C 15 s / 57°C γ0 s /
7β°C γ0 s (40 cycles)
Donnio ve ark., 2017
Şengez, β011
Rahimian ve He, 2016
3. SONUÇ
3.1. Transkripsiyonel Analiz
HIV- Tat geniyle transfekte olmuş insan astrositoma hücrelerinde HIV-1 Tat, BDNF ve c-fos genlerine ait
mRNA transkript seviyeleri qRT-PCR ile belirlendi. qRT-PCR ile ilgili parametreler Tablo β’de verildi. HIV-1
Tat genin transfekte edildiği hücrelerde tat geninin, kontrol gruplarına göre (tat içermeyen plasmit ile
transfeksiyon yapılmış ve trasfeksiyon yapılmamış hücreler) yüksek oranda eksprese edildiği gözlemlenmiştir
p<0.001) (Şekil 1A). BDNF ekspresyonunun ise HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol
gruplarına göre istatistiksel olarak önemli derece de arttığı görüldü (p<0.01) (Şekil 1B). Son olarak c-fos
ekspresyonunun BDNF’ye benzer şekilde HIV-1 Tat geni ile transfekte edilen hücrelerde kontrol grubuna göre
arttığı, ancak BDNF’ye göre bu artışın daha az olduğu belirlendi (p<0.05) (Şekil 1C).
Tablo 2. Real-Time RT-PCR ile ilgili parametreler
Parametreler
Algılama Limiti
Quantifikasyon Limiti
Quantifikasyon Aralığı
PCR Verimliliği
HIV-1 Tat
7 ag
400 ag
r= 0.996
1.86
BDNF
12 ag
402 ag
r=0.997
1.91
c-fos
9 ag
200 ag
R=0.994
1.84
Şekil 1. İnsan astrositoma hücrelerindeki HIV-1 Tat, BDNF ve c-fos genlerine ait mRNA transkript seviyeleri.
Değerler γ bağımsız örneklemin ortalama ± SD' sini temsil ederν Hata çubukları standart sapmayı gösterir.
İstatistiksel anlamlılık (* P <0.05, ** P<0.01, p<0.001) faktöriyel ANOVA ile analiz edildi. A) HIV-1 Tat
geninin göreceli mRNA ekspresyon seviyelerini temsil eder. B) BDNF geninin göreceli mRNA ekspresyon
seviyelerini temsil eder. C) c-fos geninin göreceli mRNA ekspresyon seviyelerini temsil eder.
4. TARTIŞMA
Bu çalışma HIV-1 Tat geniyle transfekte olmuş insan astrositoma hücrelerinde BDNF ve c-fos genlerine ait
ekspresyon seviyelerinin ortaya koymaktadır. HIV-1 Tat’ın, beyinde nörotoksik etkilere neden olduğu
ORAL PRESENTATION
19
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
bilinmektedir. Ayrıca HIV-1 Tat, dendritik yapılara zarar verir, nöritleri kısaltır ve sinaptik protein seviyelerini
azaltır (Hargus ve Thayer, β01γν Kim ve ark., β008). HIV ile enfekte olmuş MSS’deki hücrelerde yaygın olarak
ifade edilen bu proteinin salgılanması, sinaptodendritik hasar ile güçlü bir korelasyona sahiptir (Masliah ve ark.,
1997; Everall ve ark., 1999). HIV-1 Tat’ın astrositome hücrelerinde BDNF ve c-fos gen ekspresyonu üzerine
olan etkisini açıklayan yeterli bilgi bulunmamaktadır. Bu çalışmada HIV-1 Tat geniyle transfekte olmuş
hücrelerde yüksek oranda Tat geninin eksprese olduğunu gösterdik. Bu sonuç transfeksiyon işleminin başarılı
olduğunu göstermektedir.
BDNF’nin neuronal proliferasyon, survival, farklılaşma ve plasticity ile ilişkili olduğu ve ayrıca neuronal
aktivitede görev aldığı bilinmektedir (Reichardt, β006ν Theodoridi et al., β017). Beyin korteksi ve hipokampusün
gelişmesi süresince BDNF, nöral kök hücrelerinin nöronlara farklılaşmasını tetikler ve yeni nesil nöronların
canlılığını teşvik eder. Ayrıca, BDNF stres süresince nöron ölümlerinin önlenmesinde önemli rol oynar ve
erişkin beyninde enfeksiyon, toksikasyon, iskemi ve travma gibi stresli olaylar süresince hücre canlılığını
destekler (Cheng et al., β00γν Lee et al., β00β). Bu çalışmada HIV-1 Tat geniyle transfekte olmuş hücrelerde
BDNF mRNA transkript seviyesinin önemli düzeyde arttığı gözlemlenmiştir. BDNF mRNA transkript
seviyesinin artmasının intraselüler kalsiyum konsantrasyonunun artması, endogenous BDNF/TrkB-mediated
MAPK ve mTOR yolaklarının aktive olmasıyla ilişkili olabileceği düşünülmektedir. Buna ek olarak, HIV-1 Tat
ekspresyonu sonucu neuronal aktivitenin artması astrositoma hücrelerinde BDNF ekspresyonunu arttırabilir. Son
olarak, HIV-1 Tat ekspresyonu sırasında hücreler stres sürecine girer ve bu süreçte hücrelerin canlılığını
korumak için BDNF ekspresyon seviyesi artabilir.
c-fos geni hücrede herhangi bir uyarana karşı ilk yanıt veren genlerdendir. Bu gruba giren genler hücre
büyümesi, çoğalması, farklılaşması ve apoptosis ile ilgili transkripsiyon faktörleridir (Roche et al., 1λλλν Schofl
et al., 2002). Büyüme faktörleri gibi hücrenin devamlılığını sağlayan faktörler olan Protoonkogenler, mutajenik
kimyasal ve viral enfeksiyonların bu genler üzerindeki olumsuz etkileri nedeniyle onkoge dönüşür.
Onkogenezisi aktive etmek, hücrelerin kansere dönüşmesine yardımcı olan bazı proteinlere gerek vardır. c-fos,
DNA'ya bağlanan nükleer protein ailesinden kaynaklanan kanserojenlerin bir üyesidir (Greenberg ve diğerleri,
1λ86). Bu çalışmada HIV-1 Tat geninin transfekte edildiği hücrelerde c-fos gen expresyonunun arttığı
gösterilmiştir. HIV-1 Tat geninin eksprese edildiği hücrelerde c-fos ekspresyon seviyesinin artışı neuronal
yolakta rol alan intraselüler cAMP sinyal seviyesinin azalması, alpha-7-nicotinic receptors ve serebral
acetylcholinesterase inhbisyonundan dolayı olabilir (Carvajal et al., β007). Ayrıca, protoonkojen olarak bilinen
c-fos geninin ekspresyon düzeyindeki artış (Milde-Langosch, 2005), HIV-1 Tat geninin yüksek ekspresyonunun
astrositoma hücrelerinin kanserleşmeye doğru gidebileceğini göstermektedir.
Sonuç olarak, HIV-1 Tat geninin insan Astrositoma hücrelerine tranfeksiyonu sonucu artan Tat ekspresyonu,
BDNF ve c-fos genlerine mRNA transkript seviyelerinin artışına neden olmaktadır. Bu sonuç, bize HIV-1 Tat
geninin beyin hücrelerinde gerçekten nörotoksik bir etki oluşturduğunu göstermektedir. Ayrıca BDNF ve c-fos
ekspresyonunun artması astrositlerin HIV-1 Tat nedeniyle strese maruz kaldığını doğrulamaktadır.
TEŞEKKÜR
Bu çalışmanın moleküler kısımları Atatürk Üniversitesi Doğu Anadolu Yüksek Teknoloji Uygulama ve
Araştırma Merkezinde (DAYTAM) yapılmıştır.
KAYNAKLAR
Atluri V, Hidalgo M, Samikkannu T, Kurapati KRV, Jayant RD, Sagar V, Nair M 2015. Effect of HIV infection
and its proteins on blood-brain barrier integrity and function: an update. Frontiers in Cellular
Neuroscience, 9: 212.
Bamji SX, Majdan M, Pozniak CD, Belliveau DJ, Aloyz R, Kohn J, Causing CG, Miller FD 1998. The p75
neurotrophin receptor mediates neuronal apoptosis and is essential for naturally occurring sympathetic
neuron death. J Cell Biol, 140: 911-923.
Bell JE, Arango JC, Anthony IC. 2006. Neurobiology of multiple insults: HIV-1- associated brain disorders in
those who use illicit drugs. J Neuroimmune Pharmacol, 1(2): 182–91.
ORAL PRESENTATION
20
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Boyd JG, Gordon T 2002. A dose-dependent facilitation and inhibition of peripheral nerve regeneration by
brain-derived neurotrophic factor. Eur J Neurosci, 15: 613-626.
Burcu ŞENGEZ β011. Investıgatıon of the Effects of HIV-1 Regulatory Genes on Afrıcan Green Monkey Cell
Lines. Izmir Technology of Institute Library, Master Thesis.
Carter AR, Berry EM, Segal RA 2003. Regional expression of p75NTR contributes to neurotrophin regulation of
cerebellar patterning. Mol Cell Neurosci, 22: 1-13.
Carvajal F, Lopez-Grancha M, Navarro M, Sanchez-Amate Mdel C, Cubero I 2007. Long-lasting reductions of
ethanol drinking, enhanced ethanol-induced sedation, and decreased c-fos expression in the EdingerWestphal nucleus in Wistar rats exposed to the organophosphate chlorpyrifos. Toxicol Sci, 96: 310-320.
Chao MV 2003. Neurotrophins and their receptors: a convergence point for many signalling pathways. Nat Rev
Neurosci, 4: 299-309.
Chauhan A, Turchan J, Pocernich C, Bruce-Keller A, Roth S, Butterfield DA, Major EO, Nath A 2003.
Intracellular human immunodeficiency virus Tat expression in astrocytes promotes astrocyte survival but
induces potent neurotoxicity at distant sites via axonal transport. J Biol Chem, 278(15): 13512-9.
heng A, Wang S, Cai J, Rao MS, Mattson MP 2003. Nitric oxide acts in a positive feedback loop with BDNF to
regulate neural progenitor cell proliferation and differentiation in the mammalian brain. Dev Biol, 258:
319-333.
Cosgaya JM, Chan JR, Shooter EM 2002. The neurotrophin receptor p75NTR as a positive modulator of
myelination. Science, 298: 1245-1248.
Donnio LM, Bidon B, Hashimoto S, May M, Epanchintsev A, Ryan C, Allen W, Hackett A, Gecz J, Skinner C3,
Stevenson RE, de Brouwer APM, Coutton C, Francannet C, Jouk PS, Schwartz CE, Egly JM 2017.
MED12-related XLID disorders are dose-dependent of immediate early genes (IEGs) expression. Hum
Mol Genet, 26(11): 2062-2075.
Eugenin E, King J, Nath A, Calderon M, Zukin R, Bennett M, Berman J 2007. HIV-tat induces formation of an
LRP–PSD-95– NMDAR–nNOS complex that promotes apoptosis in neurons and astrocytes. Proc Natl
Acad Sci U S A, 104: 3438–43.
Everall IP, Heaton RK, Marcotte TD, Ellis RJ, McCutchan JA, Atkinson JH, Grant I, Mallory M, Masliah E
1999. Cortical synaptic density is reduced in mild to moderate human immunodeficiency virus
neurocognitive disorder. HNRC Group. HIV Neurobehavioral Research Center. Brain
Pathol, 9(2): 209–17.
Fumagalli F, Racagni G, Riva MA 2006. The expanding role of BDNF: a therapeutic target for Alzheimer's
disease? Pharmacogenomics J, 6: 8-15.
Gao YJ, Ji RR 2009. c-Fos and pERK, which is a better marker for neuronal activation and central sensitization
after noxious stimulation and tissue injury? Open Pain J, 2: 11-17.
Ghafouri M, Amini S, Khalili K, Sawaya BE 2006. HIV-1 associated dementia: symptoms and causes.
Retrovirology, 3: 28.
Gorry PR, Ong C, Thorpe J, Bannwarth S, Thompson KA, Gatignol A, Vesselingh SL, Purcell DF 2003.
Astrocyte infection by HIV-1: mechanisms of restricted virus replication, and role in the pathogenesis of
HIV-1-associated dementia. Curr HIV Res, 1(4): 463–73.
Greenberg ME, Ziff EB, Greene LA 1986. Stimulation of neuronal acetylcholine receptors induces rapid gene
transcription. Science, 234: 80-83.
Hargus NJ, Thayer SA 2013. Human immunodeficiency virus-1 Tat protein increases the number of inhibitory
synapses between hippocampal neurons in culture. J Neurosci Off J Soc Neurosci, 33(45): 17908–20.
Huang EJ, Reichardt LF 2001. Neurotrophins: roles in neuronal development and function. Annu Rev Neurosci,
24: 677-736.
Hudson L, Liu J, Nath A, Jones M, Raghavan R, Narayan O, Male D, Everall I, 2000. Detection of the human
immunodeficiency virus regulatory protein Tat in CNS tissues. J Neurovirology, 6(2): 145–55.
Hult B, Chana G, Masliah E, Everall I 2008. Neurobiology of HIV. Int Rev Psychiatry, 20(1): 3–13.
Kim BO, Liu Y, Ruan Y, Xu ZC, Schantz L, He JJ.2003. Neuropathologies in transgenic mice expressing human
immunodeficiency virus type 1 Tat protein under the regulation of the astrocyte-specific glial fibrillary
acidic protein promoter and doxycycline. Am J Pathol, 162(5): 1693–707.
Kim HJ, Martemyanov KA, Thayer SA 2008. Human immunodeficiency virus protein Tat induces synapse loss
via a reversible process that is distinct from cell death. J Neurosci Off J Soc Neurosci, 28(48): 12604–13.
ORAL PRESENTATION
21
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Kingsman SM, Kingsman AJ 1996. The regulation of human immunodeficiency virus type-1 gene expression.
European journal of biochemistry/FEBS, 240(3): 491–507.
Lee J, Duan W, Mattson MP 2002. Evidence that brain-derived neurotrophic factor is required for basal
neurogenesis and mediates, in part, the enhancement of neurogenesis by dietary restriction in the
hippocampus of adult mice. J Neurochem, 82: 1367-1375.
Li W, Li G, Steiner J, Nath A 2009. Role of Tat protein in HIV neuropathogenesis. Neurotox Res, 16(3): 205–
20.
Livak KJ, Schmittgen TD 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR
and The 2 (-Delta Delta C(T)) Method. Methods, 25: 402–408.
Ma M, Nath A 1997. Molecular determinants for cellular uptake of Tat protein of human immunodeficiency
virus type 1 in brain cells. J Virol, 71(3): 2495–9.
Masliah E, Heaton RK, Marcotte TD, Ellis RJ, Wiley CA, Mallory M, Achim CL, McCutchan JA, Nelson JA,
Atkinson JH 1997. Dendritic injury is a pathological substrate for human immunodeficiency virus-related
cognitive disorders. HNRC Group. The HIV Neurobehavioral Research Center. Ann Neurol, 42(6): 963–
72.
Messam CA, Major EO 2000. Stages of restricted HIV-1 infection in astrocyte cultures derived from human fetal
brain tissue. J Neurovirology, 6(1): 90–94.
Peng S, Garzon DJ, Marchese M, Klein W, Ginsberg SD, Francis BM, Mount HT, Mufson EJ, Salehi A,
Fahnestock M 2009. Decreased brain-derived neurotrophic factor depends on amyloid aggregation state in
transgenic mouse models of Alzheimer's disease. J Neurosci, 29: 9321-9329.
Rahimian P, He JJ 2016. HIV-1 Tat-shortened neurite outgrowth through regulation of microRNA-132 and its
target gene expression. Journal of Neuroinflammation, 13: 247.
Roche E, Buteau J, Aniento I, Reig JA, Soria B, Prentki M 1999. Palmitate and oleate induce the immediateearly response genes c-fos and nur-77 in the pancreatic beta-cell line INS-1. Diabetes, 48: 2007-2014.
Schofl C, Waring M, Bergwitz C, Arseniev L, von zur Muhlen A, Brabant G 2002. Cyclic-adenosine 3',5'monophosphate-stimulated c-fos gene transcription involves distinct calcium pathways in single betacells. Mol Cell Endocrinol, 186: 121-131.
Selçuk ÖZDEMİR β016. Investigation of The Effects of The HIV-1 Tat Gene on The Expression of Secretory
Leukocyte Protease Inhibitor in Primate Cell Lines. Izmir Technology of Institute Library. Doctor of
Philosophy Thesis.
Valcour V, Chalermchai T, Sailasuta N, Marovich M, Lerdlum S, Suttichom D, Suwanwela NC, Jagodzinski L,
Michael N, Spudich S 2012. Central nervous system viral invasion and inflammation during acute HIV
infection. J Infect Dis, 206(2): 275–82.
Yamada K, Mizuno M, Nabeshima T 2002. Role for brain-derived neurotrophic factor in learning and memory.
Life Sci, 70: 735-744.
Zhang F, Kang Z, Li W, Xiao Z, Zhou X 2012. Roles of brain-derived neurotrophic factor/tropomyosin-related
kinase B (BDNF/TrkB) signalling in Alzheimer's disease. J Clin Neurosci, 19: 946-949.
ORAL PRESENTATION
22
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The Activity of Aqueous Bananas Peel Extract against the Fungi that Isolated from Milk Samples
Israa A. Al-Temimay*, Faiza Kadhim Emran*, Nada Abdulrahman F. Al-Easawi*
*University of Baghdad, Collage of Science, Biology Department. Baghdad, Iraq.
israaahmed51@yahoo.com, faizakadhim@scbaghdad.edu.iq , indayda@yahoo.com.
Abstract
Milk and dairy products are a permanent part of our everyday life. Milk and milk products can be affected by
fungal spoilage in a variety of ways. In this study fungi were isolated and diagnosis from 15 types of milk were
available in local market in Baghdad from several companies and originals, some of them powder and another
liquid such as 1) Al-Tazege milk powder 2) Dielac milk for infant 3) KDD milk without flavor 4) Al-Safi milk
with cacao 5) Hamoda milk and another types..….
The most isolated fungi were Aspergillus spp., Penicillium spp., Rhizopus spp. and Microsporum spp. With the
following percentage: 100% Aspergillus spp., 15.4% Penicillium spp., 15.4% Rhizopus spp. and 7.7%
Microsporum spp. from the total milk samples, while fresh cow milk don’t give any fungal growth. Ca ++ and
Fe++ elements were estimated in this milk samples to compare this results with the typical amounts. Aqueous
extract of fresh yellow bananas peels could be considered as a good antifungal agent against the most frequently
isolated fungus Aspergillus fumigatus from milk samples. This result involves replacing the synthetic medicines
in treatment of diseases caused by this fungus.
Keywords: Milk spoilage, Bananas Peel, Aspergillus fumigatus, fungi in milk.
1. INTRODUCTION
Milk and dairy products are a permanent part of our everyday life. Milk and milk products such as butter,
cheese, ice cream, milk powder, yoghurt etc. can be affected by fungal spoilage in a variety of ways (Pal, 2014).
Presently, over 250,000 fungi are present in our environment. The fungi are ubiquitous in distribution, and are
found in the soil, water, and air (Pal, 2007).The fungi which include molds and yeasts are responsible for the
spoilage of milk and milk products (Pal and Jadhav, 2013). Molds are filamentous fungi with branching hyphae,
multi-cellular, generally aerobic and grow at a pH range of 3 to 8.The spores can tolerate harsh environmental
conditions but sensitive to heat treatment. Acremonium, Alternaria, Aspergillus, Cladosporium, Curvularia,
Fusarium, Mucor, Penicillium etc., are some of the examples of molds (Pal, 2014). Many types of fungi which
include molds and yeasts are isolated from different milk products on mycological media by employing standard
techniques. Among these fungi, Aspergillus , Fusarium and Penicillium are important as they produce
mycotoxins which can cause serious health hazards among the susceptible individuals. Hence, it is advised that
fungal contaminated milk products should not be consumed as it can be potential source of mycotoxicosis in
humans (Pal, 2007). Plant extracts derived from their parts (roots, stems, leaves, fruits) are now increas-ingly
used in research due to their widespread, immediate availability and cheaper cost, besides having potential
medicinal properties and ability to manage certain health conditions which have been growing in recognition.
Banana has long been used as a medicinal agent due to its nutritional rich properties. Banana is thought to have
antibacterial activity, antioxidant activity and other biological activities such as antidiabetic, antidiarrheic, antitumoral, antimutagenic, antihelminthic and antiulcerogenic (Jalani et al., 2014). The phytochemical components
of banana, tannins, eugenol and tyra-mine have been proven to have antibacterial effects. Other active
compounds present in banana such as alkaloids, glycosides, flavonoids, saponins, steroids, serotonin and dopamine also contribute to pharmacological effects (Subrata et al., 2011). Moreover, Banana peel contains Vitamin
A, Vitamin C, Gallocatechin, dopamine, Vitamin E, Vitamin B6, â- sitosterol, malic acid, succinic Acid,
palmatic acid, Magnesium, phosphorus, potassium, fiber, Iron. Fatty acids present in the Banana peel are
responsible for their antimicrobial activity (Sumathy and Sumathy, 2011). The study of Chabuck et al., 2013 in
Babylon/ Iraq, showed that this the aqueous extract of banana peel give a good inhibition effect against Grampositive bacteria including S. aureus and S. pyogenes with inhibition zone 30 and 18mm respectively, with no
effect against C. albicans.
ORAL PRESENTATION
23
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The aims of this study:
1. Fungal isolation from many types of milk (powder, liquid) available in local markets in Baghdad/ Iraq.
2. To assess the antifungal capacity of the aqueous extracts of fresh banana peels against different fungal
isolates from milk. Banana peel was selected because of its cheap edible source.
2.MATERIALS AND METHODS
2.1 Culture Media
In this study Potatose Dextros Agar (PDA) (Himedia/India) was used as culture media to growth and
isolated fungi from milk samples. This medium was prepare depending to the manufactory by dissolved 39 g
powder of PDA in one liter of D.W. and sterilized by autoclave at 15 psi pressure and 121 C for 15 minute. This
medium (with antibiotic Ceftriaxone (5ml/L) Nevakson/Turky) was used for culture purposes to isolated fungi (
Koneman et al,1978; Ali, 2017 ).
2.2 Milk cultured in PDA
In this study 15 types of milk (powder and liquid) (Table 1) which were available in local market (fresh
milk cow was obtain from the cow directly and put in sterile container) in Baghdad/Iraq were cultured on PDA
medium by put 0.5ml milk on this medium (powder milk was solved by D.W. (W/V)) and incubated in to two
temperatures β8Cº and γ7Cº to detected of fungal contamination in milk if it found.
2.3 Estimate the elements in milk samples.
Sample preparation:
1-The milk samples were put in glass plate and then dried in oven (Memmert/ Germany) with
temperature 70Cº for 48h., then grinding and take 1 gm. from dry material in glass baker for making
digestion process.
2-Added 5 ml from concentrated nitric acid H 2NO3 (Laboratory reagent/ China) and then leaved for 24
h. with covering the samples by putting glass watch and avoid a boiling of acid.
3- The samples was put on hot plate for 1h., then leave to cooled.
4-Hydrogen peroxide H2O2 (Laboratory reagent/ China) 1.5ml was added gradually with moving on
hot plate for 1 hr. to cooled.
5-The samples return to hot plate for digestion complete, cooled and transfer to sterilized bottle with
capacity 25 ml after the baker washing by D.W. and filtered, then estimate the elements in ATOMIC
ABSORPTION SPECTROPHOTOMETER model 5000 (Apha, 1975).
Table (1): The milk samples were cultured on PDA medium, available in local market in Baghdad/Iraq.
N
Milk samples
Origin of company
o.
1
Al-Tazege milk powder
China
2
Dielac milk for infant
UA/ Dubi
3
KDD milk without flavor
Kuwait
4
Al-safi milk with cacao
Saudi Arabia
5
Milk with banana Aynes
Turkey
6
Hamoda milk
Jordan
7
Milk with strawberry Anyes
Turkey
8
Without flavor milk Anyes
Turkey
9
Spiky milk with strawberry
Egypt
0
Spiky milk with banana
Egypt
1
Spiky milk with cacao
Egypt
2
Anchor powdery milk
New Zealand
3
Munish powdery milk
China
4
Howlera
Iraq
5
Fresh milk cow
Iraq
ORAL PRESENTATION
24
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2.4 Plant collection
Fresh bananas were obtained from the local market at Baghdad city, Iraq, 2017. Bananas were washed
with running tap water in laboratory, surface sterilized with 70% alcohol, rinsed in sterile distilled water, then
peels were taken. Distilled water was boiled, peels were added to the water and left to cool. Later on, these
contents were mixed by the blender and filtered to remove large, un homogenized particles to get clear aqueous
extract, the extract was kept at 4Cº until to be use (Chabuk el at., 2013).
2.5 Agar well diffusion method
This method was used to determine the antifungal activity of aqueous banana peel extract. The solution of
aqueous banana peel extract (β5 ,50, 75 ,100) µl, are added in wells by using cork porer to make four grooves
well in each one plates then the extract was incubated into the groove and the D.W. was used as control (sheyin
et al., 2015).
3.RESULTS AND DISCUSSION
3.1 The isolated Fungi from milk samples
In this study different types of Fungi were isolated from different milk samples (15 samples) When the
samples were cultured on PDA media such as Rhizopus, Aspergillus spp., Penicilinum spp. Table (2) in this
results 5 species of fungi were isolated from Al-Tazege milk powder (Rhizopus, Penicilium, Aspergillus niger,
Aspergillus fumigatus and Aspergillus flavus) this type of milk was recorded high percentage of fungi
contamination followed by Anyes milk with strawberry flavor, 4 species of fungi were isolated from this type of
milk (Aspergillus niger, Aspergillus flavus, Penicilium, Aspergillus fumigatus). While the Fresh milk cow
doesn’t give any fungi growth it was No fungal contamination. Asprergillus spp. was recorded the highest
percentage of isolated fungi from all milk samples 93.3 %, while microsporum flavum recorded the lowest
percentage of fungi from all milk samples 6.6% (table 3). Aspergillus spp. was appear by many different species,
the highest percentage was for Aspergillus fumigatus 80% and the lowest percentage for Aspergillus terreus 20%
(table4).
Table (2): The fungi were isolated from milk samples.
samples
No. of
Isolated fungi
o.
fungi isolated
Al-Tazege milk powder
5
Dielac milk for infant
1
Rhizopus
Penicilium
Aspergillus niger
Aspergillus flavus
Aspergillus fumigatus
Aspergillus flavus
KDD milk without flavor
1
Aspergillus fumigatus
Al-safi milk with cacao
2
Milk with banana Aynes
1
Aspergillus fumigatus
Rhizopus
Aspergillus fumigatus
Hamoda milk
2
Aspergillus niger
Aspergillus fumigatus
Milk with strawberry
Anyes
4
Aspergillus niger
Aspergillus flavus
Aspergillus fumigatus
Penicilium
Without
Anyes
2
Aspergillus flavus
Aspergillus fumigatus
3
Aspergillus fumigatus
Aspergillus flavus
.
Spiky
ORAL PRESENTATION
flavor
milk
milk
with
25
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
strawberry
Aspergillus terreus
Spiky milk with banana
1
Aspergillus fumigatus
Spiky milk with cacao
1
Aspergillus fumigatus
Aspergillus flavus
Anchor powdery milk
3
Munish powdery milk
3
Howlera
2
Aspergillus fumigatus
Aspergillus flavus
Aspergillus terreus
Aspergillus fumigatus
Aspergillus niger
Aspergillus terreus
Aspergillus niger
Microsporum fulvum
Fresh milk cow
-
0
1
2
3
4
No growth
5
Table (3): Percentage of fungi species from milk samples.
Fungi
Percentage
o.
Aspergillus spp.
93.3%
Rhizopus spp.
13.3%
Penecilium spp.
13.3%
Microsporum flavum
6.6%
Figure (1): fungi growth on PDA were isolated from milk samples, (A): Aspergillus spp., (B): A. niger , (C): A.
fumigatus,(D): Microsporum flavum, (E): Penecilium spp., (F): Rhizopus spp.
ORAL PRESENTATION
26
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table (4): The percentage of Aspergillus spp. was isolated from all milk samples.
Aspergillus spp.
Percentage
o.
Aspergillus
fumigatus
80%
Aspergillus niger
33.3%
Aspergillus flavus
46.6%
Aspergillus terreus
20%
The Activity of Aqueous Bananas Peel Extract
The antifungal prosperities of aqueous banana peels extract were tested by well diffusion assay against the
most fungi isolated frequently (Aspergillus spp. 93.3% (A. fumigatus and A. niger). The results of this test was
presented in (figure ( 2)) show that the aqueous extract of banana peel exhibited a variable antifungal agent.
These results showed that this extract give an excellent inhibition effect against A. fumigatus with inhibition
zone 4γmm at 100 µl concentration, wile the β5, 50, 75 µl were give les of inhibition zone 11, 24, 31 mm
respectively. The extract was act as a good inhibition agent against A. niger with inhibition zone 7, 19, 23, 28
mm when the extract concentration was β5, 50, 75, 100 µl respectively.
Figure (2): (A) The inhibition zone to A. fumigatus by the aqueous banana peels extract 100 µl
concentration , (B) the inhibition zone of A. niger with β5, 50, 75, 100 µl concentration respectively from the
same extract.
4. DISCUSSION
Many study have been done to evaluate the phytochemical compositions and antimicrobial activities of
different parts of diverse plants, such as banana peels (Hsieh et al., 2001). The study of Chabuck et al. (2013) of
aqueous extract of banana peel found that this extract give a good inhibition effect against Gram-positive
bacteria including S. aureus and S. pyogenes with inhibition zone 30 and 18 mm respectively, with no effect
against C. albicans. There are many composition of banana skin like enzymes such as polyphenoloxidase, pectin
as gelling agent and that the banana peel extract is used alone or combined with a cream or ointment, medicinal
benefits of the extract include relief of pain, swelling and itching (Daniells et al., 2000 and Wuyts et al.).
Additionally, Flavonoids, tannins, phlobatannins, alkaloids, glycosides and terpenoids were found to be present
in the peels of genus Musa. These phytochemicals have been reported to exert multiple biological and
pharmacological effects (antibacterial, antihypertensive, antidiabetic and anti-inflammatory activities). The
presence of these bioactive substances in banana peels therefore suggests that the peels possess valuable
medicinal potential yet to be explored. As the bioactive compounds contained in plants are majorly responsible
for their medicinal properties (Ighodaroro et al., 2009). Moreover, Banana peel contains Vitamin A, Vitamin C,
Gallocatechin, dopamine, Vitamin E, Vitamin B6, âsitosterol, malic acid, succinic Acid, palmatic acid,
ORAL PRESENTATION
27
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Magnesium, phosphorus, potassium, fiber, Iron. Fatty acids present in the Banana peel are responsible for their
antifungal activity.
REFERENCES
Ali, A. A. 2017. Isolation, identification and determination of antifungal Sensitivity of Fungi Isolated from A
Sample of Patients with Rhinosinusitis in Baghdad City. Iraqi JMS 2017; Vol. 15(1), PP: 64-70.
Chabuck , Z. A. G.; Al-Charrakh, A. H.; Hindi, N. K. K. and Hindi, S. K. K. 2013. Antimicrobial Effect of
Aqueous Banana Peel Extract, Iraq. Research Gate: Pharmaceutical Sciences, 1:73-75.
Daniells, S. 2000. Banana skin could offer cheap pectin from waste. Dry tech, 18, 1327-7.
Hsieh PC, Mau J, Huang SH. Antimicrobial effect of various combinations of plant extracts. Food Microbiology
2001; 18, 35-43.
Ighodaroro, O.M.; Mairiga, J.P. and Adeyi, A.O. 2009. Reducing and Antiproxidant profiles of flavonoids in
Ocimum gratissimum. Inter J Chem Sci , 2, 85-9.
Jalani, F. F. M.; Mohamad, S.; Shahidan, W. N. S. (2014). Antibacterial effects of banana pulp extracts based on
different extraction methods against selected microorganisms. Asian Journal of Biomedical and
Pharmaceutical Sciences; 4(36): 14-19.
Koneman, E.W.; Roberts, G.D. and Wright, S.E. 1978. Practical laboratory mycology, 2nd ed. Williams and
Wilkins Company. Baltimor USA. pp: 139-140.
Pal, M. 2007. Veterinary and Medical Mycology. 1st Edition. Indian Council of Agricultural Research, New
Delhi, India.
Pal, M. 2014. Spoilage of Dairy Products due to Fungi. Beverage and Food World. Vol. 41, No. 7, PP: 37-40.
Pal, M. and Jadhav,V.J. 2013. Microbial contamination of various India milk products. Beverage and Food
World 40:43-44.
Sheyin, Z., Maimako, J., Shindang, J., Essien, C. U., Bigwan, E. I. and Ede, F. R. 2015. Antimicrobial Activity
of Albizia lebbeck leafe extract on some Medically Important Bacteria. Int. J. Curr. Microbiol. App. Sci.
4(9): 473-477.
Subrata, K. B, Anusua, C., Joysree, D., Sheikh, Z. R., Manik, C. S., Utpal, K. K. 2011. Investigation of
antibacterial activities of ethanol extracts of Musa paradisiaca Lam. Journal of applied pharmaceutical
science. 1 (6), 133-135.
Sumathy, N.H.; Sumathy, J.H. 2011. Antibacterial and Antifungal Activity of Musa Fruit Peels against Skin and
Gastrointestinal Tract Diseases. Herbal Tech Industry. Short communication. 9-11.
Sumathy, N. H., Sumathy, J. H. 2011. Antibacterial and Antifungal Activity of Musa Fruit Peels against Skin
and Gastrointestinal Tract Diseases. Herbal Tech Industry. Short communication. PP: 9-11.
Wuyts, N.; Dewaele, D.; Swennen, R. 2006. Extraction and partial characterization of polyphenol oxidase from
banana (Musa acuminate Grand naine) roots. Blant Physiol Biochem. 44, 308-4.
ORAL PRESENTATION
28
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Modifiye Aljinik Asid Reçinesi ile Bor İçeren İyonların Sulu Ortamdan Alıkonması
Adnan Aydın 1, Sabahattin Deniz 2*
1
İstanbul Bilim Üniversitesi, Sağlık Bilimleri Fakültesi, Beslenme ve Diyetetik Bölümü, İstanbul, Türkiye
*2
Marmara Üniversitesi, Teknoloji Fakültesi, Tekstil Mühendisliği Bölümü, İstanbul, Türkiye
Sorumlu yazar e-mail: sdeniz@marmara.edu.tr
Özet
Sulu ortamlardan bor içeren bileşiklerin alıkonması için bor tutucu özelliği yüksek olan bileşiklerin sentezi ve
kullanımları gerek çevre koruması ve gerekse endüstriyel açılardan önem arz etmektedir. Jeotermal sulardaki
yüksek bor içeriği son derece yüksek tarımsal önemi haizdir. Bor gerek toprakta gerekse sulama sularında
oldukça düşük miktarda bulunmasına karşın tutulma ve yıkanmasının güçlüğü nedeniyle toprakta hızla
birikmektedir. Tarımsal ekonomik kıymeti olan bitkilerin büyük çoğunluğu yüksek bor içeriğinden olumsuz
etkilenmektedir.
Bu çalışmada doğal bir makromolekül olan aljinik asid (AA), 2,4,6–trikloro–1,3,5–triazin (TTC) ile modifiye
edilmiş ve modifiye aljinik asid reçinelerinin yaklaşık kimyasal bileşimi, elementel analiz ve IR spektroskopisi
yardımı ile ortaya konmuştur. Sonrasında sentezlenen reçinenin bor tutma kapasitesinin sabit sıcaklıkta zamana
bağlı olarak değişimi incelenmiştir.
Aljinik asid ile 2,4,6–trikloro–1,3,5–triazin aralarındaki reaksiyon, AA:TTC, (1μ1) ve (βμ1) mol oranlarında, oda
sıcaklığında (β5°C) gerçekleştirilmiştir. Ele geçen iki ürünün bor tutma kapasiteleri belirlenmiştir.
Sentezlenen modifiye aljinik asid reçineleriyle bor tutulması yaklaşık γ0 dakika temas ile tamamlanmaktadır.
(1μ1) oranında modifiye edilmiş aljinik asidin bor tutma kapasitesi 1,60 mg B.g-1 reçine, (βμ1) oranında modifiye
edilmiş aljinik asid reçinesinin bor tutma kapasitesi 1,5β mg B.g-1 reçine olarak bulunmuştur.
Sentezlenen modifiye edilmiş aljinat reçinelerinin bor tutma kapasiteleri aljinik aside göre 4 kat fazla olduğu
görülmüştür. Bu sonuçlara göre ele geçen modifiye edilmiş aljinik asid reçinelerinin borun sulardan
uzaklaştırılmasında kullanılan mevcut endüstriyel bazı reçinelere yakın bor tutma özelliğine sahip olduğu
görülmüştür.
Anahtar Kelimeler: Bor, aljinik asid, 2,4,6–trikloro–1,3,5–triazin
1. GİRİŞ
Bor, yeryüzünde yüzden fazla minerali bulunan, değişik amaçlarla kullanılan çok sayıda kimyasal bileşiği olan
bir elementtir. Çok çeşitli sektörlerde kullanılan bor mineralleri ve ürünlerinin kullanım alanları giderek
artmaktadır. Üretilen bor minerallerinin %10' a yakın bir bölümü doğrudan mineral olarak tüketilirken geriye
kalan kısmı bor ürünleri elde etmek için kullanılmaktadır. Bor bileşikleri çok çeşitli alanlarda kullanım alanına
sahip önemli bileşiklerdir. Tarımdan seramik ve cam sanayiine, temizlik ürünlerinden enerji sektörüne ve hatta
askeri alanlarda kullanımı olan bor bileşikleri vardır (Deniz ve Aydın, β00γ). Tüm bu önemli kullanım
alanlarından dolayı stratejik bir öneme de sahiptir.
Bor ürünlerinin pek çok alanda yaygın kullanımının olmasına rağmen bazı durumlarda sulu ortamlardan
uzaklaştırılması gerekmektedir.
Bitkilerin büyümesi için az miktarda da olsa Bor’ a ihtiyaç vardır. Bununla birlikte Bor’ un gerektiğinden fazla
bulunması onun zararlı bir etki göstermesine neden olmaktadır (Badruk ve ark., 1λλλ). Ülkemiz dünya bor
kaynaklarının yaklaşık %60’ ına sahiptir. Bununla birlikte jeotermal sularda yüksek bor içeriklerinin olması ve
bor madenlerinin drenaj sularında bulunan bor, tarım arazilerinin sulanmasında kullanılan su kaynaklarında
kirliliğe neden olmakta ve tarım ürünlerine zarar vermektedir (Dilek ve ark., β00β).
Bor gerek toprakta gerekse sulama sularında oldukça düşük miktarda bulunmasına karşın tutulma ve
yıkanmasının güçlüğü nedeniyle toprakta hızla birikmektedir. Toprak ve sularda bulunan bor bileşikleri çeşitli
toksik etkileri olan ağır metallerle kompleksler oluşturmakta bu da elementlerin potansiyel zehirliliklerini
ORAL PRESENTATION
29
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
arttırmaktadır. Tüm bu sağlık problemlerinin yanı sıra jeotermal sulardaki yüksek bor içeriği bu sulardan enerji
elde edilmesine ilişkin projeleri de kısıtlamaktadır.
Bor atomu içeren iyonlar sulu ortamdan uzaklaştırılması zor olan iyonlardır. Özel yapıya sahip reçineler yardımı
ile bor içeren iyonlar sulu ortamdan uzaklaştırılabilmektedir. Bor’un ortamdan uzaklaştırılmasında
ultrafiltrasyon yöntemi kullanılsa da reçineler ile borun alıkonması kullanılan en yaygın yöntemdir.
Tablo 1.’ de bor tutma amaçlı kullanılan bazı ticari reçineler ve bor tutma miktarları verilmiştir (Badruk ve ark.,
1999; Beker ve ark., 1996; Bhatnagar ve Mathur, 1977; Okay ve ark., 1985; Sarri ve ark., 2018).
Reçine
Diaion CRB 02
Örnek
0,1 M Borik Asid
Tutulma Miktarı
4,15 mg B.cm-3 reçine
Purolite S108
0,1 M Borik Asid
2,73 mg B.cm-3 reçine
Diaion CRB 02
Kızıldere jeotermal atık suyu
3,80 mg B.cm-3 reçine
Purolite S108
Kızıldere jeotermal atık suyu
2,94 mg B cm-3 reçine
Diaion SAN-1
0,0647 M Borik Asid
4,22 mol B L-1 reçine
Diaion SAN-1
0,00925 M Borik Asid
1,46 mol B L-1 reçine
Diaion SAN-1
0,β78 M Borik Asid, 5° C
3,78 mol B L-1 reçine
Diaion SAN-1
0,β78 M Borik Asid, 70° C
2,94 mol B L-1 reçine
Diaion SAN-1
0,00λβ5 M Borik Asid, 5° C
1,58 mol B L-1 reçine
Diaion SAN-1
0,00λβ5 M Borik Asid, 70° C
1,15 mol B L-1 reçine
Amberlite IRN 78LC
0,00λβ5 M Borik Asid, 60° C
1,6 B atomu monomer-1
Amberlite IRN 78LC
0,00λβ5 M Borik Asid, 10° C
2,1 B atomu monomer-1
Amberlite IRA 743
Kızıldere jeotermal atık suyu
5,12 mg B mL-1 reçine
Nalcite HCR (Dowex 50)
Borik Asid çözeltisi
3,93 mg B 50 mL-1 reçine
Nalcite WBR–Nalcite HCR
Borik Asid çözeltisi
3,95 mg B 50 mL-1 reçine
Guar gum–siyanurik klorür
Borik Asid çözeltisi
4,2 meg B g-1 reçine
Selüloz
Bigadiç Bor madeni drenaj suyu
0,3–0,54 mg B g-1 reçine
Polietilenimin-epiklorhidrin
reçinesi
100-500 ppm bor çözeltisi
55 mg B g-1 reçine
Tablo 1. Bor giderimi amacıyla kullanılan bazı ticari reçineler
Bor giderimi için kullanılan bu reçineler bilinen klasik iyon değiştirici reçineler olmayıp bor seçici reçinelerdir.
Bu reçinelerde bulunan fonksiyonel gruplar bor atomu ile kompleks yapmaya uygun gruplardır. Bu reçinelerin
yapıları Şekil 1.’ de gösterilmiştir.
*
H
C
H2
C
H
C
H2
C
*
n
n
*
*
OH
C C
H H2
C
H2
N
CH3
C
H2
H
C
H
C
H
C
H
C
R N
N
CH3
CH3
C
H2
H
C
OH
OH
CH2OH
OH OH OH OH
(1)
OH
H
C
H
C
H
C
CH2OH
OH
OH
(2)
OH OH OH OH
(3)
Şekil 1. Bor seçici reçinelerin yapıları. (1) Diaion CRB0β, (β) Purolite S108, (γ) Amberlite IRA-743
ORAL PRESENTATION
30
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Aljinik asid, farklı tipteki deniz yosunlarından ekstrakte edilerek elde edilir. Aljinik asidin temel kaynağı olan
kahverengi deniz yosunu macrosystis pyrifera, modern teknoloji ile ideal bir hammadde özelliği sağlayabilmek
için yetiştirilmektedir. Macrosystis pyrifera, nispeten durgun ve geniş sularda yetişir. Bitki yıllıktır ve hızlı
büyümesi sebebiyle yılda dört defa hasat edilebilmektedir (Deniz ve Aydın, β00γ).
Aljinik asid, D-mannuronik asid ve L-guluronik asid zincirlerinden oluşan bir polimerdir. Kahverengi deniz
yosunundan elde edilen aljinik asid, lineer yapıda bulunur ve %61 D-mannuronik asid ile %39 L-guluronik asid
içerir. Kimyasal yapılar Şekil β.’ de gösterildiği gibidir (Bertoni ve ark., β014).
Şekil 2. Aljinik asidin kimyasal yapısı
2. MATERYAL VE METOD
2.1. 1:1 (AA:TTC) Modifiye Edilmiş Aljinik Asid Sentezi
λ,β5 g (0,05 mol) TTC tartıldı. Oda sıcaklığında yaklaşık 40 mL destile suda süspanse edildi. β50 mL’ lik
reaksiyon balonunda iyice karıştırıldı. pH sının β–γ civarında olduğu gözlendi. Na2CO3 çözeltisi ile pH sı
yaklaşık 7–8’ e ayarlandı.
8,8 g (0,05 mol) aljinik asid tartıldı ve katı olarak oda sıcaklığında yukarıdaki karışıma yavaş yavaş ilave edildi.
Aljinik asid sebebiyle pH’ nın β civarına düştüğü gözlendi. Derişik NaOH çözeltisi ile pH yeniden 7–8 civarına
ayarlandı. Reaksiyonun yürümesi sırasında açığa çıkan H + iyonları pH’ nın hızlı bir şekilde düşmesine neden
olmaktadır. O sebeple pH ayarı, pH’ nın bir-iki dakika sabit kalmasına kadar yapıldı. Yaklaşık 1 saat sonra pH
kontrol edildi ve tekrar düştüğü gözlendi. Derişik NaOH çözeltisi ile tekrar ayarlandı. Reaksiyon pH kontrolü
yapılarak β gün devam ettirildi. İkinci günün sonunda beyaz bir karışım gözlendi. Elde edilen karışımın 6–7
civarında olan pH’ sı seyreltik HCl ile yaklaşık β,5’ a ayarlandı. Böylece taneciklerin çözünürlüğünün azaldığı
ve büyüdüğü gözlendi. Karışım sinterlenmiş cam filtreden süzüldü. Çökelek metanolle β defa yıkandı. Ele geçen
beyaz renkli ürün vakum desikatöründe kurutuldu.
2.2. 2:1 (AA:TTC) Modifiye Edilmiş Aljinik Asid Sentezi
4,6β5 g (0,0β5 mol) TTC ve 8,8 g (0,05 mol) aljinik asid alınarak bir önceki reaksiyonda olduğu gibi
sentezlendi.
2.3. Aljinik Asid ve Modifiye Aljinat Reçinelerinin Bor Tutma Kapasitelerinin İncelenmesi
Sentezlenen iki ayrı modifiye edilmiş aljinat reçinesinin ve aljinik asidin bor tutma kapasitesini belirlemek için
borik asid çözeltisi kullanıldı. Her iki reçineden ve aljinik asidden ayrı ayrı 0,500’ er gram tartıldı. Bir beher
ORAL PRESENTATION
31
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
içine 50 mL β00 ppm borik asid çözeltisi ve tartılan reçineden konuldu. Manyetik karıştırıcı ile karıştırıldı. Oda
sıcaklığında 10 - 60 dakikalık karıştırma sürelerinde tutulan bor miktarı belirlendi.
Yukarıda verilen sürelerde borik asid çözeltisi sentezlenen reçine ile manyetik karıştırıcıda karıştırıldıktan sonra
süzüldü. Süzüntüde tutuklanmadan kalan bor miktarı mannitol ile borik asid tayini yöntemiyle belirlendi.
Süzüntü 100 mL’ ye seyreltildi. Üzerine yaklaşık β g mannitol ilave edildi. Mannitol çözündükten sonra birkaç
damla fenolftalein indikatörü katıldı ve 0,1 N NaOH ile titre edildi. Renk kalıcı pembe olduktan sonra yaklaşık
0,5 g mannitol daha ilave edildi. Renkte bir açılma gözlenmedi. Dönüm noktasına kadar sarf edilen NaOH
miktarına göre süzüntüdeki bor miktarı hesaplandı (Cson) ve başlangıç konsantrasyonundan (Cilk) çıkarılarak
tutulan bor miktarı (Ctutulan) bulundu.
� �
3. SONUÇ
=
−
�
3.1. Sentezlenen Reçinelerin Karakterizasyonu
Aljinik asid, 1μ1 (AAμTTC) ve βμ1 (AAμTTC) oranında modifiye reçinelerin IR spektrumları alınmış ve Şekil γ.’
te gösterilmiştir. Aljinik asidin spektrumunda yer alan γ46γ cm -1’ deki pik OH bandını göstermektedir.
Sentezlenen reçinelerin spektrumlarında γ46γ cm -1 civarında bulunan omuz sentezlenen reçinelerde OH
grubunun bulunduğunu göstermektedir.
Reçinelerin IR spektrumlarında bulunan 106γ cm-1’ deki pik aljinik asiddeki OH gruplarının TTC ile reaksiyonu
sonucu eter bağlarının (C–O–C) oluştuğunu göstermektedir.
TTC’ nin IR spektrumunda bulunan 8γ4 cm-1’ deki pik maddede C–Cl bağının olduğunu göstermektedir.
Sentezlenen polimerlerin IR spektrumlarında 8γ4 cm -1’deki pikin kaybolması reaksiyonun gerçekleştiğini
göstermektedir (Erdik, 1λλ8).
Şekil 3. IR spektrumları. (1) AA, (β) TTC, (γ) 1μ1 ve βμ1 (AAμTTC) reçinesi
3.2. Sentezlenen Reçinelerin Elementel Analizleri
Sentezlenen reçinelerin elementel analizleri TÜBİTAK M.A.M.’ de yaptırıldı. Elde edilen sonuçlar Tablo β.’ de
verilmiştir.
ORAL PRESENTATION
32
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tablo 2. Sentezlenen reçinelerin elementel analiz sonuçları
Reçine
%C
%H
%N
%Cl
1:1 (AA:TTC)
29,07
3,22
12,10
0,50
2:1 (AA:TTC)
29,90
3,90
5,15
0,61
3.2. Sentezlenen Reçinelerin Bor Tutma Kapasiteleri
0,500 g aljinik asid (AA), 0,500 g 1μ1 (AAμTTC) ve 0,500 g βμ1 (AAμTTC) oranındaki modifiye edilmiş aljinik
asid reçinelerine ait bor tutma kapasitesini gösteren veriler Tablo γ’ de verilmiştir. Yine aynı maddelerin bor
tutma kapasitesinin zamanla değişimini gösteren grafik Şekil 4’ te verilmiştir.
Tablo 3. 0,500’ er gram aljinik asid ve sentezlenen reçinelerin zamana bağlı bor tutma kapasiteleri
Süre (dak.)
Aljinik Asid
(AA) (mg.g-1)
1:1 (AA:TTC)
(mg.g-1)
2:1 (AA:TTC)
(mg.g-1)
0
10
15
20
25
30
35
40
45
50
60
0
0,15
0,20
0,20
0,20
0,21
0,21
0,20
0,21
0,20
0,19
0
0,54
0,73
0,75
0,83
0,82
0,81
0,78
0,81
0,80
0,81
0
0,51
0,70
0,76
0,76
0,76
0,77
0,76
0,76
0,78
0,76
2
Bor tutma kapasitesi (mg.g-1)
1,8
Aljinik Asid (AA)
1,6
1,4
1:1 (AA:TTC)
1,2
2:1 (AA:TTC)
1
0,8
0,6
0,4
0,2
0
0
10
20
30
40
50
60
70
Zaman (dak.)
Şekil 4. Aljinik asid ve modifiye aljinatların bor tutma kapasitelerinin zamanla değişimi
ORAL PRESENTATION
33
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4. TARTIŞMA
Bu çalışmada aljinik asid (AA), β,4,6–trikloro–1,3,5–triazin (TTC) ile 1μ1 ve βμ1 mol oranlarında reaksiyona
sokularak modifiye edildi. Elde edilen modifiye aljinat reçinelerinin bor tutma kapasiteleri belirlendi ve aljinik
asid ve diğer bor tutucu reçinelerin kapasiteleri ile kıyaslandı.
2,4,6–trikloro–1,3,5–triazin, farklı reaktiflikte üç klor atomuna sahiptir. Bu klor atomlarının yer değiştirmeleri
reaksiyon ortamının sıcaklık ve pH’ sına bağlı olarak farklılık göstermektedir. β,4,6–trikloro–1,3,5–triazindeki
klor atomlarının ilki reaksiyon ortamının sıcaklığı 0 °C civarında iken yer değiştirir. İkinci klor atomu β5 °C
civarında, üçüncü klor atomu da 60 °C civarında iken yer değiştirmektedir (Hoog ve ark., β00βν Attardi ve ark.,
β000ν Menicagli ve ark., β000). Ancak bunların dışında ortamın pH’ sının ve reaksiyon süresinin de etkisi vardır
(Su ve ark., β001ν Mahler ve ark., 1λλλ). Bu çalışmada aljinik asidin β,4,6–trikloro–1,3,5–triazin ile reaksiyonu
β5°C’ de pH=7’ de ve 48 saatte yapıldı.
Reaksiyon sonucunda; 2,4,6–trikloro–1,3,5–triazinin, aljinik asid zincirleri arasında köprü görevi gördüğü ve
eter bağları ile hacimli bir yapı oluşturduğu ve bu reaksiyon şartlarında, β,4,6–trikloro–1,3,5–triazinde bulunan 2
adet Cl atomunun büyük oranda sübstitüe olduğu düşünülmektedir.
Sentezlenen reçinelerin ve aljinik asidin bor tutma miktarları incelendiğinde; aljinik asidin 15. dakikadan sonra
bor tutma miktarının sabit olduğu ve kapasitesinin 0,40 mg B.g-1 aljinik asid olduğu görülmüştür. Sentezlenen
modifiye aljinat reçineleri için deν 1μ1 oranında modifiye edilmiş aljinik asidin γ0. temas dakikasından sonra bor
tutma miktarının sabit olduğu ve kapasitesinin 1,6β mg B.g-1 reçine olduğu, βμ1 oranında modifiye edilmiş
aljinik asidin β0. temas dakikasından sonra bor tutma miktarının sabit olduğu ve kapasitesinin 1,54 mg B.g -1
reçine olduğu görülmüştür. Bu da çalışmada sentezlenen reçinelerin bor tutma kapasitelerinin, aljinik asidin bor
tutma kapasitesine göre 4 kat daha fazla olduğunu göstermektedir. Bu çalışmada sentezlenen reçinelerde bulunan
polimer zincirlerin, rijid bir moleküler yapı oluşturularak, yığışımın önlenmiş olduğu ve böylelikle zincirlerdeki
aktif yüzeylerin korunduğu düşünülmektedir.
Bor tutma amaçlı kullanılan reçinelere göre bu çalışmada sentezlenen reçineler kıyaslandığındaν Diaion CRB 0β,
Purolite S108, Diaion SAN-1, Amberlite IRA 78LC, Amberlite IRA 743, polietilenimin-epiklorhidrin reçinesi ve
2,4,6-trikloro-1,3,5-triazin ile modifiye edilmiş guargum’ ın sentezlenen reçinelerden daha yüksek kapasiteli bor
tutucu reçineler oldukları görülmüştür. Ancak bu çalışmada sentezlenen reçinenin bor tutma kapasitesinin
Nalcite HCR (Dowex 50), Nalcite WBR-Nalcite HCR ve selüloza göre daha fazla olduğu Tablo 1.’ de
görülmektedir. Bu sebeple bu çalışmada sentezlenen modifiye aljinat reçinelerinin bazı bor seçici reçinelere
alternatif olarak kullanılabileceği düşünülmektedir.
TEŞEKKÜR
Bu çalışma Marmara Üniversitesi Bilimsel Araştırma Projeleri Komisyonu (BAPKO) tarafından BSE–
038/210701 numaralı proje ile desteklenmiştir.
KAYNAKLAR
Attardi ME, Falchi A, Taddei M 2000. A Sensitive Visual Test for Detection of OH Groups on Resin.
Tetrahedron Letters, 41: 7395-7399.
Badruk M, Kabay N, Demircioğlu N, Mordoğan H, İpekoğlu U 1λλλ. Removal of Boron from Wastewater of
Geotgermal Power Plant by Selective Ion Exchange Resins. I. Batch Sorption – Elution Studies. Speration
Science And Techonology, 34(13): 2553-2569.
Beker ÜG, Çergel A, Recepoğlu O 1λλ6. Removal of Boron from Geothermal Power Plant Wastewater in
Kızıldere, Turkey. Energy Sources, 18μ 645-654.
Bertoni AF, Bellu SE, Gonzalez JC, Sala LF 2014. Reduction of Hypervalent Chromium in Acidic Media by
Alginic Acid. Carbohydrate Polymers, 114: 1-11.
Bhatnagar R, Mathur NK 1977. A New Boron–Selective Resin Derived from Guar Gum. Talanta, 24:466-467.
Dilek Ç, Özbelge HÖ, Biçak N, Yılmaz L β00β. Removal of Boron from Aqueous Solutions by Continuous
Polymer–Enhanced Ultrafiltration with Polyvinyl Alcohol. Seperation Science And Technology, 37(6):
1257- 1271.
ORAL PRESENTATION
34
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Deniz S, Aydın A β00γ. Aljinik Asidden Yeni Bir Reçine Sentezlenmesi ve Bor İçeren İyonların Alıkonmasının
İncelenmesi. Marmara Üniversitesi Fen Bilimleri Enstitüsü, 1-8pp.
Erdik E 1998. Organik Kimyada Spektroskopik Yöntemler. Ankaraμ Gazi Kitabevi, λ8pp.
Hoog P, Gamez P, Driessen WL, Reedijk J 2002. New Polydentate and Polynucleating N–Donor Ligands from
Amines and 2,4,6–trichloro–1,3,5–triazine. Tetrahedron Letters, 43: 6783-6786.
Mahler J, Rafler G, Stiller B 1999. Modified Melamines and Melamine Resins for E/Z–Isomerization. Materials
Science & Engineering C, 8–9: 407-410.
Menicagli R, Samaritani S, Zucchelli V 2000. 2–Alkyl–4,6–dialkylamine–1,3,5–triazines via Grignard
Alkylation of Cyanuric Chloride: An Aged Reaction Revisited. Tetrahedron, 56: 9705-9711.
Okay O, Güçlü H, Soner E, Balkaş T 1λ85. Boron Pollution in the Simav River, Turkey and Various Methods of
Boron Removal. Water Res.,19(7): 857-862.
Sarri S, Misaelides P, Zamboulis D, Warchoł J 2018. Boron Removal from Aaqueous Solutions by a
Polyethylenimine – Epichlorohydrin Resin. Journal of the Serbian Chemical Society, (accepted
manuscript), http://dx.doi.org/10.2298/JSC170704114S.
Su MH, Ma H.M, Ma QL, Wang ZH, Xiong SX, Liang SC 2001. Fluorescent Labeling of Phenol Using 8–(4,6–
dichloro–1,3,5–triazinylamino)quinoline. Analytica Chimica Acta, 426: 51-56.
ORAL PRESENTATION
35
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Use of Benthic Macroinvertebrate in Water Quality Assessment of Kodi Creek (Turkey,
Tunceli)
Serap Koşal Şahin1*, Esra Albayrak2
1*
2
Istanbul University, Faculty of Aquatic Sciences, Istanbul -Turkey
Istanbul University, Institute of Science, Department of Basic Sciences, Istanbul-Turkey
Corresponding author e-mail: serap@istanbul.edu.tr
Abstract
Kodi Creek is an important running water in the East Anatolian Turkey and is one of the main tributary of
Munzur River. 5 sites were investigated during the summer season using benthic macroinvertebrate fauna and
physicochemical properties to assess ecological quality of Kodi Creek. Various macro invertebrate based
metrics were used to assess water quality of Kodi Creek. Four sites were classified as reference sites with high
ecological status. Only the 5th station is a little polluted.
Keywords: Water quality, Macroinvertebrate, Tunceli, EPT Taxa (%).
1. INTRODUCTION
Benthic macroinvertebrates are accepted the most useful biological indicators of water quality of running water
ecosystems. The benthic macroinvertebrate based assessment of running water quality is prefered because of its
advantages. The benthic macroinvertebrates tend to move slightly, they have long life cycles when compared
with macrophyte and algae. They have short life cycle when compared with fishes enough to react to the changes
in the environment by their community structure (Kazancı et al. ,1λλ7ν Reece and Richardson, 2000). Benthic
macroinvertebrates have high species richness, collection of them is easy and cheap, family and genus
identifications is not problematic in many parts of the world (Rosenberg and Resh, 1993; Bonada et al., 2006).
Due to all of these features, benthic macroinvertebrates are most useful group for water quality studies. The
information on abundance, taxonomic composition of communities, diversity, presence or absence of major taxa
and number of sensitive and tolerant taxa render possible to classify ecological status of running waters.
Especially communities of EPT are usually dominant in rivers and the evaluation of water quality using these
three insects orders are decent enough and satisfactorily accurate.
2. MATERIALS AND METHODS
Tunceli province is located at the upper Fırat River basin in the Taurus orogenic belt of the mountainous district
of the Eastern Anatolia and has a rich position regarding streams. This study was carried out in Kodi Creek of
Tunceli. Kodi Creek is the tributary of Munzur River. A total of five stations were chosen on the creek for this
study. The water samples and benthic macroinvertebrate were gathered from these stations in Jun 2017. Water
temperature (ºC), pH, dissolved oxygen (DO mg/l), and electrical conductivity (EC µs cm-1) were measured
during sampling in situ by using portable multiparameter equipment. Flow velocity was detected by using flow
meter. Ca+2 (mg/l), NO2--N (mg/l), NO3--N (mg/l), PO4--P (mg/l) values were determined based on standard
methods (APHA, 1998). Benthic macroinvertebrates were sampled from each station by using Surber net (475
µm mesh, area of base 0.0λ m2). The samples were taken from an area of nearly 100 m 2 in order to include all
possible microhabitats at each station. The collected material was fixed in formaldehyde (4%) in the field and
then kept in 80% ethylalcohol and sorted in the laboratory. All samples were identified at the lowest possible
level under a stereomicroscope (family, genus or species).
3. RESULTS
During the survey 29 taxa were found, of which 2 taxa belong to Plecoptera (Protonemura sp., Leuctra sp.) 7
taxa belong to Ephemeroptera (Ephemerella ignita, Ephemerella sp, Baetis sp., Electrogena sp., Epeorus
ORAL PRESENTATION
36
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 1. Benthic macroinvertebrates of Kodi Creek of identified from 5 stations
Species List
Trichoptera
Agapetus fuscipes Curtis, 1834
Glossosoma conformis Neboiss, 1963
Goera pilosa Wallengren,1891
Silo sp.
Hydropsyche bulbifera McLachlan, 1878
Hydropsyche fulvipes Curtis, 1834
Hydropsyche instabilis Curtis, 1834
Hydropsyche incognita Pitsch, 1993
Lepidostoma hirtum Fabricius, 1775
Lepidostoma sp.
Drusus simplex Martynov, 1927
Micropterna testacea Gmelin, 1789
Sericostoma sp.
Sericostoma personatum Kirby&Spence,1826
Plecoptera
Protonemura sp.
Leuctra sp.
Ephemeroptera
Baetis sp.
Ephemerella ignita Poda, 1761
Ephemerella sp.
Electrogena sp.
Epeorus sp.
Ecdyonurus sp.
Epeorus magnus Braasch, 1978
Simulium sp.
Mollusca
Ancylus fluviatilis Müller, 1774
Acroloxus lacustrisLinnaeus, 1758
Malacostraca
Gammarus pseudosyriacus Karaman & Pinkster,
1977
Gammarus sp.
Oligochaeta
Bıodıversıty Indıces
BMWP
EPT Taxa %
ORAL PRESENTATION
1
Stations
2
3
*
*
4
5
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
151
86
86
78
75
89,14 88,29 75,98 69,89 69,32
37
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
sp., Epeorus magnus, Ecdyonurus sp.) 14 taxa belong to Trichoptera (Agapetus fuscipes, Glossosoma
conformis, Goera pilosa, Silo sp., Hydropsyche bulbifera, Hydropsyche fulvipes, Hydropsyche instabilis ,
Hydropsyche incognita, Lepidostoma hirtum, Lepidostoma sp. Drusus simplex Micropterna testacea,
Sericostoma sp., Sericostoma personatum) 2 taxa belong to Mollusca (Ancylus fluviatilis, Acroloxus lacustris) 2
taxa belong to Malacostraca (Gammarus pseudosyriacus, Gammarus sp) 1 taxa belong to Simuliidae (Simulium
sp.) and 1 taxa belong to Oligochaeta (Table 1). In also dissolved oxygen (DO mg/l), water temperature (ºC), pH,
electrical conductivity (EC µs cm-1), flow velocity (m/s) , NO2 -N (mg/l), NO3-N (mg/l), PO4-P (mg/l )and Ca
(mg/l) variables were analyzed. The values of measured physical and chemical variables are shown in Table 2.
Table 2. 9 physicochemical variables of Kodi Creek of measured from 5 stations.
Water
DO Temperature
Stations Substrate (mg/l)
(°C)
Stones
8,1
9,3
1
Stones
8,7
9,2
2
Stones
7,7
8,6
3
Stones
8,7
5,4
4
Gravel
7,6
8,2
5
pH
8,07
8,11
7,63
7,16
7,27
EC
Flow
µs cm-1 velocity NO2-N
(mg/l)
m/s
209,3
8,4
0,0001
301,25
3
0,0001
198,9
3,1
0,0001
183,4
2,9
0,0001
285,5
1,4
0,0001
NO3-N
(mg/l)
1,45
1,59
1,23
1,87
3,11
PO4-P
(mg/l)
0,0001
0,0001
0,0001
0,0001
0,0001
Ca
(mg/l)
34,23
42,21
56,31
39,33
59,52
4. DISCUSSION
The highest number of benthic macroinvertebrate taxa indicating highest diversity and highest habitat quality
was found in Site 1 in this study,. EPT taxa values are useful to determine water pollution because of sensitivity
of these taxa to pollution. The highest EPT taxa value was recorded at Site 1, the lowest value was recorded at
Site 5. The scores of Site 1, Site 2, Site 3, Site 4 and Site 5 were higher than 65, so according to BMWP scores,
these sites were slightly contaminated sites.
5. CONCLUSION
The EPT taxa Richness Index is sensitive to environmental impairment as EPT taxa are potentially sensitive to
changes (especially increasing disturbances) in various headwater water parameters. Therefore using the EPT
taxa Richness Index is a relatively accurate biological parameter to detect aquatic disturbances although more
investigation is required to further improve the application of the index. The survival of EPT depends strongly
on the good ranges of the river physicochemical environment that indirectly indicates healthy river status, hence
increases reliability of water quality assessment especially in pristine environments. The reference sites and their
benthic macroinvertebrate communities of Kodi Creek was determined in family level in this study. Reference
sites and their benthic macroinvertebrate communities could be used to evaluate ecological quality of the same
types of streams in East Anatolian Region.
ACKNOWLEDGEMENTS
This research has been supported by Unit of Scientific Research Projects, Istanbul University (Project No: 24781).
We are deeply grateful to them for their financial support.
REFERENCES
American Public Health Association (APHA), 1998. Standard methods for examination of water and wastewater.
Washington, D.C.: American Water Works Association and Water Pollution Control Federation.
ORAL PRESENTATION
38
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Bonada, N, Prat N, Resh VH, Statzner B 2006. Developments in aquatic insect biomonitoring: a comparative
analysis of recent approaches. AnnualReview of Entomology, v. 51, n. 1, p. 495-523.
Kazancı N, Girgin S, Dügel, M, Oğuzkurt D 1λλ7. Türkiye İç Suları Araştırmaları Dizisi II (Ed. N. Kazancı)μ
Akarsuların çevre kalitesi yönünden değerlendirilmesinde ve izlenmesinde biyotik indeks yöntemi, İmaj
Yayınevi, Ankara. 100pp.
Reece PF, Richardson JS 2000. Biomonitoring with the Reference Condition Approach forthe Detection of
Aquatic Ecosystems at Risk. Proceeding of a conference on the biology and managment of species and
habitats at risk. 549-552
Rosenberg D.M, Resh V H 1993. Introduction to freshwaterbiomonitoringandbenthicmacroinvertebrate. –
InRosenberg, D. M. andResh V. H. (eds): FreshwaterBiomonitoringandbenthicmacroinvertebrates: 1-9.Chapman&Hall. 488 pp
ORAL PRESENTATION
39
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Steril Vücut Sıvılarından İzole Edilen Kandida Türlerinin
Antifungal Duyarlılık Oranları
Merih ŞİMŞEK
Afyon Kocatepe Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Afyonkarahisar, Türkiye
Sorumlu yazar e-mail: smerih16@gmail.com
Özet
Çeşitli infeksiyonlardan antifungallere dirençli kandida türlerinin izolasyonunda son yıllarda önemli
derecede bir artış olması, bu infeksiyonlardan izole edilecek kandida suşlarının tür düzeyinde
tanımlanmasını ve antifungallere duyarlılık testlerinin yapılmasını zorunlu hale getirmiştir.
Bu nedenle bu çalışmada, Tıbbi Mikrobiyoloji laboratuvarına son üç yıl içinde gönderilen 1γ1γ7 adet
steril vücut sıvısı örneği sonuçları taranarak, kandida türlerinin dağılımının ve antifungal direnç
profillerinin belirlenmesi amaçlanmıştır.
Çalışmamıza, kan kültürü, beyin omurilik sıvısı, periton, plevra, perikard kültürü örnekleri dahil
edilmiştir. Kan kültürü inkübasyonu için BACTEK FX tam otomatize kan kültür sistemi kullanılmıştır.
Pozitif üreme sinyali veren örneklerin %5 koyun kanlı ve Eozin-Metilen Blue (EMB) agara pasajı
alınmıştır. Rutin laboratuvara mantar kültürü amacıyla gönderilen diğer vücut sıvı örnekleri %5 koyun
kanlı, EMB, Çikolata ve Subaroud Dekstroz (SDA) agara ekilerek β5ºC ve γ7ºC de 48 saat inkübe
edilmiştir. Maya üremesinden şüphe edilen örneklerden gram boyama alınmıştır. İdentifikasyon ve
antifungal duyarlılık testleri için VITEK β Tam Otomatize İdentifikasyon sistemi kullanılmıştır. VITEK
β sistemi ile elde edilen antifungal duyarlılık sonuçlarında dirençli olarak belirlenen antifungal ajanlar
için E-test yöntemi ile doğrulamaya gidilmiştir.
Çalışmamızda elde edilen sonuçlara göre, 1β4 steril vücut sıvısı örneğinde Kandida üremesi olmuştur.
Bunlardan, (67)%54’ünde C.albicans, (β0)%16.1’inde C.parapsilosis, (17)%1γ.7’sinde C.glabrata,
(4)%γ.β’sinde C.tropicalis, (γ)%β.4’ünde C. famata, (β)%1.6’sında C.ciferrii, (β)%1.6’sında C.kefyr ,
(1)%0.8’inde C. lusitaniae, (1)%0.8’inde C.dubliniensis, (1)%0.8’inde C.krusei, (6)%4.8’inde Candida
spp. türleri üremiştir. Flusitozin’e karşı hiçbir kandida suşunda direnç’e rastlanmazken, genel olarak
kandida türleri Flukanozole karşı en yüksek direnci göstermiştir. Flukanozole en yüksek direnci %41.1
oranında C. glabrata gösterirken, bunu %β.λ oranıyla C.albicans takip etmektedir.
Sonuç olarak, steril sıvı örneklerinden izole edilen non-albicans kandida türleri oldukça geniş bir
yelpazede yer almaktadır. Bu da, kandida infeksiyonlarının tedavisinde zorlukların artması anlamına
gelmektedir. Bununla birlikte, flukonazole dirençli suşlarla oluşan infeksiyonların tedavisinde alternatif
ilaç olarak sırasıyla, Flusitozin, Mikafungin, Amfoterisin B, Kaspofungin ve Vorikonazol
kullanılabileceği sonucuna varılmıştır.
Anahtar Kelimeler: Steril vücut sıvıları, Candida türleri, Antifungal duyarlılık
1.GİRİŞ
Kandida türleri doğada oldukça yaygın olarak bulunan mantarlardandır. Sağlıklı bireylerde özellikle
gastro-intestinal sistemde ve vajinal florada kolonizasyonu bulunmaktadır. Kandida türleri arasında özellikle
Candida albicans infeksiyon etkeni olarak sıklıkla görülmektedir. Son yıllarda, kemik iliği, organ nakilleri gibi
tedavi yöntemlerinin yaygınlaşması ile Kandida kaynaklı fırsatçı infeksiyonların oranında ciddi artışlar
yaşanmıştır. Normal florada bulunmaları nedeniyle birçok klinik örnekte bu tür mantarların üretilmesi gereksiz
tedavilere neden olmaktadır. Steril vücut sıvılarından, doku örneklerinden izolasyonları ve üretilmeleri ya da
kültürde fazla sayıda olmaları invaziv kandidiyazis tanısı koymada önemli bir faktördür. (Yücel ve Kantarcıoğlu,
1999 - Kuştimur, 1λλλ)
Günümüzde invaziv fungal infeksiyonların öneminin artışındaν epidemiyolojik faktörler, risk faktörleri,
mortalite, yeni etkenler, tanı zorluğu, antifungal tedavideki gelişmeler (yeni antifungaller, antifungal ajanlara
ORAL PRESENTATION
40
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
direnç gelişimi, kombine tedavi gereksinimlerinin otaya çıkışı) gibi pek çok faktörün katkısı vardır. Antifungal
ilaçlara direnç gelişmesi ve fungal infeksiyonların önemli bir sağlık sorunu haline gelmesi, daha geniş
spektrumlu ve farklı hedefleri etkileyen yeni ilaçlara ve tedavi rejimlerine ihtiyaç oluşturmuştur. Böylece, hem
dirençli suşların saptanması hem de yeni antifungallerin klinik kullanım öncesi değerlendirilmesinde antifungal
duyarlılık testlerinin önemi artmıştır. Bütün bunlar antifungal tedavi seçiminde in vitro duyarlılığı ölçen testlerin
geliştirilmesine yönelik çalışmaları yoğunlaştırmıştır. Antifungal ilaçlar, Cilt ve mukozaların lokal mantar
infeksiyonlarının ve çeşitli sistemik mantar infeksiyonlarının tedavisinde kullanılırlar. (Göller, 1λλλ-Topçu ve
ark., 2002)
Yaptığımız bu çalışmada hastanemizde tedavi gören hastalardan alınmış olan steril vücut sıvısı
örneklerinden izole edilen Kandida türlerinin dağılımının ve antifungal direnç profillerinin belirlenmesi
amaçlanmıştır.
2. MATERYAL VE METOD
2.1 Test Mikroorganizmaları
Çalışmamızda Ocak β015 - Şubat β018 tarihleri arasında Afyon Kocatepe Üniversite hastanesine başvuran
hastalardan alınarak Tıbbi Mikrobiyoloji laboratuvarına gönderilen kan kültürü, beyin omurilik sıvısı, periton,
plevra, perikard kültürü örneklerine ait sonuçlar çalışmaya dahil edilmiştir. Toplam 1γ1γ7 adet steril vücut sıvısı
örneğine ait kültür ve antifungal duyarlılık sonuçları taranmıştır. Bu amaçla, 11.8γ5 kan kültür örneği, 4γ5
periton örneği, 40γ plevral mayi örneği, geriye kalan 464 beyin omurilik sıvısı ve perikard örneklerine ait
sonuçlar taranmıştır.
2.2 Primer İzolasyon
Kan kültürü inkübasyonu için BACTEK FX tam otomatize kan kültür sistemi kullanılmıştır. Pozitif
üreme sinyali veren örneklerin %5 koyun kanlı ve Eozin-Metilen Blue (EMB) agara pasajı alınmıştır. Rutin
laboratuvara mantar kültürü amacıyla gönderilen diğer vücut sıvı örnekleri %5 koyun kanlı, EMB, Çikolata ve
Subaroud Dekstroz (SDA) agara ekilerek β5ºC ve γ7ºC de 48 saat inkübe edilmiştir. Üremeler günlük olarak
kontrol edilerek ve 7β saat sonunda, maya üremesi olmayan örnekler çalışma dışı bırakılmıştır. Maya
üremesinden şüphe edilen örneklerden gram boyama alınmıştır. SDA’da genellikle β-γ günde üreyen, hamur
kıvamında, 0,5-1 mm çapında, beyaz veya krem renkli, genellikle düzgün sınırlı ve kendine özgü maya kokusu
olan kolonilerden gram boyama yapılmıştır. Gram boyamada, gram pozitif, oval veya uzamış tomurcuklu maya
hücreleriyle, tek tek, bazen ikili, üçlü blastospor kümeleri ve pseudohif oluşturan maya hücreleri Candida spp.
olarak tanımlanmıştır. Saf olduğu saptanan kültürlerden, identifikasyonun ileri aşamasında tür tayininde ve
antifungal duyarlılık testinde kullanılmak üzere SDA besiyerine pasaj yapılmıştır. (Yücel ve Kantarcıoğlu, 1999
-Kuştimur, 1λλλ)
İdentifikasyon ve antifungal duyarlılık testleri için VITEK β Tam Otomatize İdentifikasyon sistemi
kullanılmıştır. Bu sistemle identifiye edilmeyenler için germ tüp deneyi kullanılmıştır. Bunun için , test edilecek
koloniden öze ile bir miktar alınıp tüp içindeki 1 ml insan serumu içinde süspansiyon haline getirilmiştir.
γ7ºC’de β,5-γ saat inkübe edildikten sonra süspansiyondan bir damla alınıp lam-lamel arası preparat
hazırlanarak mikroskopta x40 büyütmede incelenmiştir. İncelemede ana hücreden orjin alan ve başlangıç
noktasında boğumlanma yapmaksızın ve uzunluğu boyunca belirgin kabarıklık olmayan, flament şeklinde
uzantılar gösteren yapılar germ tüp olarak değerlendirilip ve incelenen suşun C. albicans olduğuna karar
verilmiştir. Mikroskobik incelemede germ tüpe benzeyen ancak ana hücreden boğumlanarak dışa doğru uzama
gösteren hifal yapıların duvarlarının birbirine paralellik göstermediği yalancı germ tüp oluşumları da
gözlenmiştir. İleri identifikasyonda bu oluşumların C. tropicalis’e ait oldukları saptanmıştır. Antifungal
duyarlılık değerlerinin belirlenmesi sırasında, VITEK β sistemi ile elde edilen antifungal duyarlılık sonuçlarında
dirençli olarak belirlenen antifungal ajanlar için E-test yöntemi ile doğrulamaya gidilmiştir. (Göller, 1λλλ Topçu ve ark., β00β)
3.BULGULAR
Toplam 1γ1γ7 adet steril vücut sıvısı örneği sonuçları taranmıştır. 11.8γ5 kan kültür örneğinden 114, 4γ5
periton kültüründen dokuz ve 40γ plevral mayi örneğinden bir Kandida türü üremesi olmuştur. Çalışmaya dahil
edilen beyin omurilik sıvısı ve perikard örneklerinde Kandida türleri izole edilmemiştir. Çalışmamızda elde
ORAL PRESENTATION
41
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
edilen sonuçlara göre, 1β4 steril vücut sıvısı örneğinde Kandida üremesi olmuştur. Bunlardan, (67)%54’ünde
C.albicans, (β0)%16.1’inde C.parapsilosis,
(17)%1γ.7’sinde C.glabrata, (4)%γ.β’sinde C.tropicalis,
(γ)%β.4’ünde C.famata, (β)%1.6’sında C.ciferrii,
(β)%1.6’sında C.kefyr , (1)%0.8’inde C.lusitaniae,
(1)%0.8’inde C.dubliniensis, (1)%0.8’inde C.krusei, (6)%4.8’inde Candida spp. türleri üremiştir. Bununla
birlikte, Kan kültürü, periton ve plevra sıvısı örneklerinden izole edilen Kandida türlerinin Flukanazol,
Amfoterisin B, Mikafungin, Vorikonazol, Flusitozin ve Kaspofungin’e karşı antifungal duyarlılık oranları
belirlenmiş ve bu verilere göre Flusitozin’e karşı hiçbir kandida suşunda direnç’e rastlanmazken, genel olarak
kandida türleri Flukanozole karşı en yüksek direnci göstermiştir. Flukanozole en yüksek direnci %41.1 oranında
C.glabrata gösterirken, bunu %β.λ oranıyla C.albicans takip etmektedir. Bu sonuçlar, Tablo 1’de ayrıntılı olarak
verilmiştir.
Tablo 1. Kandida türleri ve antifungal direnç oranları
Kandida Türleri
Suşlar
Sa
yı
(n/
%)
67/%54
C.albicans
20/%16.1
C.parapsilosis
17/%13.7
C.glabrata
4/%3.2
C.tropicalis
3/%2.4
C.famata
2/%1.6
C.ciferrii
2/%1.6
C.kefyr
F
Antifungal ilaçlar (n/%)
M
V
C
O
L
A
MP B
2/%2.9
1/%1.4
1/%1.4
F
C
C
S
4/%5.9
0/%0
4/%5.9
0/%0
1/%5
1/%5
0/%0
0/%0
0/%0
7/%41.1
0/%0
0/%0
1/%5.8
0/%0
2/%11.7
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
1/%33.3
0/%0
0/%0
2/%66.6
0/%0
0/%0
1/%50
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
1/%0.8
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
C.lusitaniae
1/%0.8
0/%0
0/%0
0/%0
0/%0
0/%0
0/%0
C.dubliniensis
1/%0.8
1/%100
0/%0
0/%0
0/%0
0/%0
0/%0
C.krusei
6/%4.8
1/%16.6
1/%16.6
0/%0
0/%0
0/%0
0/%0
Candida spp.
124/%100
13/%10.4
3/%2.4
2/%1.6
7%5.6
0/%0
6/%4.8
TOPLAM
FL: Flukanazol, AMP B: Amfoterisin B, MC: Mikafungin, VO: Vorikonazol, FC: Flusitozin, CS: Kaspofungin
4.TARTIŞMA
Mantar infeksiyonlarında görülen artış ve tür çeşitliliği tedavi başarısı açısından kaygı uyandırmaktadır.
Özellikle Kandida kaynaklı infeksiyonlar son yıllarda önemli derecede artış göstermektedir. Nozokomiyal fungal
infeksiyonlarda ilk sırayı C.albicans almakla birlikte antifungal tedaviye daha zor yanıt verdiği bilinen
C.tropicalis, C.lusitaniae, C. krusei, C.glabrata, C.parapsilosis gibi nonalbicans türlerle karşılaşma oranı da
giderek artmaktadır. Bu nedenle türlerin identifikasyonu ve direnç profillerinin belirlenmesi de oldukça önem
taşımaktadır. Böylece, antifungal tedavi direnç gelişimi sorununu da beraberinde getirmektedir. (Ener, 1λλ6 Hospenthal ve ark.,2004)
Kandida türleri, normalde insan deri ve mukoza florasında bulunan mikroorganizmalardır. Normal
bireylerin % 30-50’sinin ağız ve gastrointestinal sisteminde bulunurlar. Mayaların normal flora elemanı olmaları
nedeniyle infeksiyon etkeni olup olmadığı konusunda tanıda zorluklar yaşanabilir ve zaman zaman tanı
konmakta geç kalınmış olabilir. Bu nedenle etkenlerinin doğru tespiti, türlerin ayrımı ve antifungal duyarlılık
testlerinin yapılması gün geçtikçe zorunluluk haline gelmektedir. Ancak tedavide seçilen antifungallerin in vitro
duyarlılığı her zaman in vivo koşullardaki duyarlılık ile uyumlu olmayabilir. (Koç, β00β – Sütçü ve ark., β017)
Çeşitli çalışmalar incelendiğinde, sepsis etkenleri içerisinde kandida türlerinin üçüncü sırada yer aldığı
belirlenmiştir. Ayrıca, kan kültürlerinden izole edilen mikroorganizmaların % 6 ile% 15 arasında değişen
oranlarda kandida türlerinin oluşturduğu bildirilmiştir. Son yıllarda dünyada non albicans kandida türlerinin
sıklığındaki artışa paralel olarak, çalışmamızda izole edilen kandida suşları arasında non albicans türlerin sıklığı
da tedavi zorluğu açısından önemli bir veridir. (İnan ve Çakmakçı, 1λλ7 – Tekerekoğlu ve ark., 1λλ7 Singh,2017)
ORAL PRESENTATION
42
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Amerika kıtasında bir çok merkezde yapılan bir çalışmada, kandida türlerinin, % 5γ.γ’ünü C.albicans,
diğerlerini sırasıyla C. parapsilosis, C.glabrata, C.tropicalis, C.krusei, C.guillermondii ve diğer türler olarak
belirlemişlerdir. ABD’de nonalbicans türler % 4γ.8 oranında, Kanada’da % 47.5 oranında, Güney Amerika’da
ise % 5λ.5 oranında yer aldığı bildirilmiştir. (Pfaller ve ark, 1λλ8 - Pfaller ve ark, 2002)
Yine yapılan bir diğer çalışmaya göre, kan kültürlerinden izole edilen 88 kandida suşundan γ0’unun
(%34.1) C. albicans, β6’sının (%βλ.5) C. tropicalis, 15’inin (%17.1) C. parapsilosis, 8’inin (%λ.1) C. glabrata,
5’inin (%5.7) C. kefyr, 4’ünün (%4.5) C. krusei olduğu görülmüştür. (Karakoç ve ark., β007)
Pfaller ve ark. yine yaptıkları bir çalışmada kan kültürlerinden izole ettikleri β047 kandida suşunun %
54’ünü C. albicans, % 16’sını C. glabrata, % 15’ini C. parapsilosis, % 10’unu C. tropicalis, diğerlerini sırasıyla
C. krusei, C. guillermondii, C. lusitaniae ve diğer suşlar olarak saptamışlardır. (Pfaller ve ark, 1λλ8 - Pfaller ve
ark, 2002)
Çalışmamızda ise, 1β4 steril sıvı örneğinden, (67)%54’ünde C.albicans, (β0)%16.1’inde C.parapsilosis,
(17)%1γ.7’sinde C.glabrata, (4)%γ.β’sinde C.tropicalis, (γ)%β.4’ünde C. famata, (β)%1.6’sında C.ciferrii,
(β)%1.6’sında C.kefyr , (1)%0.8’inde C. lusitaniae, (1)%0.8’inde C.dubliniensis, (1)%0.8’inde C.krusei,
(6)%4.8’inde Candida spp. türleri ürediği belirlenmiştir. Çalışmamızda elde edilen bu verilere göre sonuçların
dünyada yapılan diğer çalışmalar ile uyumlu olduğu belirlenmiştir.
Ülkemizde yapılan çalışmalardan birinde ise, kan kültürlerinden izole ettikleri 50 kandida suşunun %
60’ını C.albicans, % 18’ini C.parapsilosis, % 10’unu C.tropicalis ve C.krusei, C.kefyr, C.lusitaniae, C.famata
ve C.glabrata olarak bildirilmiştir. (Kurt ve ark., β00β) Çalışmamıza göre sonuçlar, ülkemizde yapılan diğer
çalışmalar ile de uyumlu bulunmuştur.
Nawrot ve ark. yaptıkları çalışmada hematolojik rahatsızlığı bulunan çocuk ve erişkin hastaların steril
vücut sıvıları ve kan örneklerinden izole ettikleri kandida suşlarının antifungal duyarlılıklarını araştırmış
Flukonazol için en düşük direnç %4 ile C. albicans’ta, en yüksek direnç ise %44 oranı ile C. krusei’de
saptanmıştır. Aynı çalışmada C. krusei’lerin hiçbirinde flukonazol duyarlılığı saptanmamış, suşların %56 sında
ise orta derecede duyarlılık saptanmıştır. (Nawrot ve ark., β005)
Antunes ve ark. Brezilya’da yaptıkları bir çalışmada kan kültürlerinden izole edilen Kandida suşlarının
hiçbirinde flukonazole direnç saptamamışlardır. (Antunes ve ark., β004)
Buna karşın çalışmamızda Nawrot ve arkadaşlarından farklı olarak Flukonazole karşı en yüksek direnç
oranı C.glabrata’ da saptanırken C.albicans için direnç oranları benzerlik göstermektedir. Antunes ve
arkadaşlarının gerçekleştirmiş oldukları çalışmada Flukonazole karşı direnç saptanmazken bizim çalışmamızda
en yüksek direnç oranına sahip olan antifungal ajan Flukonazol olarak belirlenmiştir.
Çalışmamızda elde edilen sonuçlara göre, steril sıvı örneklerinden izole edilen non-albicans kandida
türleri oldukça geniş bir yelpazede yer almaktadır. Bu da, kandida enfeksiyonlarının tedavisinde zorlukların
artması anlamına gelmektedir. Bununla birlikte, flukonazole dirençli suşlarla oluşan infeksiyonların tedavisinde
alternatif ilaç olarak sırasıyla, Flusitozin, Mikafungin, Amfoterisin B, Kaspofungin ve Vorikonazol
kullanılabileceği sonucuna varılmıştır.
KAYNAKLAR
Antunes AGV, Pasqualotto AC, Diaz MC, d’Azevedo PA, Severo LC β004. Candidemia in a Brazilian
tertiary care hospital: species distribution and antifungal susceptibility patterns. Rev Inst Med Trop Sao Paulo,
46: 239- 41.
Ener B 1λλ6.İnvitro antifungal duyarlılık testleriμ standardizasyon ve klinik önemi. Mikrobiyoloji Bülteni,
30:419-425.
Göller S lλλλ.Klinik örneklerden izole edilen kandidaların tiplendirilmesi ve antifungal ajanlara
duyarlılıkları. Izmir Dokuz Eylül Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı. Uzmanlık tezi.
Hospenthal DR, Murray CK, Rinaldi GM 2004. The role of antifungal susseptibility in the therapy of
candidiasis.Diag Microbiol Infect Dis, 48:153-160.
İnan M, Çakmakçı M 1λλ7. Cerrahi yoğun bakım infeksiyonları. Hastane Infeksiyonları Derg, 1μ λ1-96.
ORAL PRESENTATION
43
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Karakoç E , Yazgı H, Aktaş AE , Uyanık MH β007. Çeşitli Candida Türlerinin İki Farklı Triazole
Duyarlılıklarının Mikrodilüsyon Yöntemi İle Araştırılması.The Eurasian Journal of Medicine,17γ-177.
Koç AN β00β. Tıbbi bakımdan önemi olan candida türlerinin mikolojik özellikleri. Candida
Mikrobiyolojisi ve Infeksiyonları Simpozyumu, Eskişehir, Kongre Kitabı, γ7-50.
Kurt Ö, Kurt H, Bayar B, Memikoğlu KO, Azap A, Tekelli E β00β. Typing and antifungal susceptibility
testing of Candida strains isolated from the blood cultures of candidemia patiens. Clinical Microbiology and
infection, 8: 559.
Kuştimur S 1λλλ. Antifungal duyarlılık testleri. Usataçelebi Ş, eds. Temel ve Klinik Mikrobiyoloji. Öncü
Basımevi. Güneş Kitabevi. 115λ-1165 pp.
Nawrot U, Nowicka J, Juszczak K, Gusin B 2007. Susceptibility to antifungal agents of Candida species
isolated from paediatric and adult patients with haematological diseases. Mycoses, 48: 385-90.
Pfaller MA, Jones RN, Doern GV, Sader HS, Hollis RJ, Messer SA 1998. International survelliance of
bloodstream infections due to Candida species: 107 frequency of occurrence and antifungal susceptibilities of
isolates collected in 1997 in the United States, Canada, and South America for the sentry program. J Clin
Microbiol, 36(7): 1886-1889.
Pfaller MA, Diekema DJ, Jones RN, Messer SA, Hollis RJ 2002. Trends in antifungal susceptibility of
Candida spp. isolated from pediatric and adult patients with bloodstream infections: SENTRY antimicrobial
surveillance program, 1997 to 2000. J Clin Microbiol, 40: 852-856.
Singh M, Chakraborty A. 2017. Antifungal Drug Resistance among Candida albicans and Non-albicans
Candida Species Isolates from a Tertiary Care Centre at Allahabad. J Antimicrob Agents, 3(4): 150.
Sütçü M, Acar M, Erköse Genç G, Kökçü İ, Aktürk H, Atay G, Hançerli Törun S, Salman N, Erturan Z,
Somer A 2017. Evaluation of Candida species and antifungal susceptibilities among children with invasive
candidiasis. Turk Pediatri Ars, 52: 145-53.
Tekerekoğlu MS, Durmaz B, Taştekin N, Otlu B1λλλ. Otomatize kan kültür sistemi ile üç yıllık dönemde
alınan sonuçların değerlendirilmesi. λ. Türk Klinik Mikrobiyoloji ve Infeksiyon Hastalıkları Kongresi, Antalya,
Kongre Kitabı.
Topçu Willke A, Söyletir G, Doğanay M. Infeksiyon Hastalıkları ve Mikrobiyolojisi. İstanbulμNobel Tıp
Kitabevleri, 296 pp.
Yücel A, Kantarcıoğlu S β001. Hastane kaynaklı mantar infeksiyonlarının epidemiyolojisi. Cerrahpaşa J
Med, 32: 259-6980.
ORAL PRESENTATION
44
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
In vitro Cytotoxic Effecct of Metformin on Triple Negative Breast Cancer Cell Line
MDA-MB-231
İdil Çetin
Istanbul University, Faculty of Science, Department of Biology, Istanbul, Turkey
Corresponding author e-mail: idil.cetin@istanbul.edu.tr
Abstract
Breast cancer, which is the most common type of cancer in women, is a heterogeneous disease. Triple
negative breast cancer (TNBC), characterized by absence of estrogen receptor, progesterone receptor and
HER2 gene expression, is known as the most aggressive type. The lack of a specific therapeutic target, as
in other breast cancer types, makes the treatment process of this disease difficult. Oral hypoglycemic
agent Metformin, has drawn attention with its safe use, antiproliferative effect in many types of cancer,
and prolongation of patient survival. In this study, the in vitro cytotoxic effect of Metformin was
evaluated on triple negative breast cancer cell line MDA-MB-231. For this purpose cell viability, cell
index values obtained from xCELLigence RTCA (Real-Time Cell Analysis) DP instrument, mitotic
index (MI) and labelling index (LI) analysis among cell kinetic parameters were used. Three different
concentrations γ0 ηM, 65 ηM and 1γ0 ηM of Metformin were used to determine the IC 50 value. γ0 ηM
concentration was determined as IC50 value. Significant decrease for all parameters was observed.
Metformin offers a promising treatment modality in different breast cancer subtypes especially in TNBC
subtype.
Keywords: Metformin, Breast cancer, MDA-MB-231, In vitro.
1. INTRODUCTION
Metformin is the most commonly prescribed oral hypoglycemic agent for patients with type 2 diabetes mellitus
(Nathan et al., 2009). Metformin is a glucose-lowering agent that improves insulin sensitivity and lowers the
circulating insulin level in patients with type II diabetes mellitus (Steals, 2006). It (N, N-dimethylbiguanide)
belongs to the biguanide class of antidiabetic drugs (containing two linked guanidine rings) originally derived
from galegine (isoamylene guanidine), a guanidine derivative found in the French lilac Galega officinalis.
Among the three biguanides developed for diabetes therapy, metformin has a superior safety profile, and it is
well tolerated (Viollet et al., 2012).
Numerous in vitro and in vivo animal studies have demonstrated growth-inhibiting effects of metformin in
breast, endometrial, lung, liver, gastric, and medullary thyroid cancer cell lines (Rizos and Elisaf).
Antiproliferative effects have also been demonstrated in several hemopoietic cancer cells, including acute
myeloid and promyelocytic leukemia cells. These effects are thought to stem from growth inhibition via cell
cycle arrest and from increased cytotoxicity via the induction of apoptosis (Morales and Morris, 2015).
Metformin has been shown to increase the cytotoxicity of many chemotherapeutic agents, including cisplatin,
carboplatin, doxorubicin, and paclitaxel, and enhance tumor-free remission in vivo (Iliopoulos et al., 2011). The
ability of metformin to prolong tumor remission is believed to be due to the ability of this drug to selectively kill
cancer stem cells (CSCs, also known as tumor initiating cells) that are chemo-resistant and may lead to future
cancer reoccurrence (Hirsch et al., 2009; Ning et al., 2013).
Breast cancer is a heterogeneous disease. Prognosis of this disease is related mainly to stage and biological
characterization, which defines a variety of conditions ranging from a low risk of relapse and indolent clinical
course to a high relapse risk and rapid clinical progression, despite aggressive therapies (Voduc et al., 2010).
ORAL PRESENTATION
45
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Triple negative breast cancer (TNBC) is a particular immunopathological subtype of breast cancer that lacks
expression of estrogen and progesterone receptors (ER/PR) and amplification of the human epidermal growth
factor receptor 2 (HER2) gene (Mendes et al., 2015).
In this study, we investigated the antiproliferative effects of Metformin on MDA-MB-231 cell line which
belongs to triple negative subtype of breast cancer.
2. MATERIALS AND METHODS
Cell line
The MDA-MB-231 cell line used in this study was obtained from European Cell Culture Collection (CCL). Cells
were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (high glucose) (Gibco Lab) containing 10%
fetal bovine serum (FBS, Gibco Lab), 100 ηg/ml streptomycin (Streptomycin sulphate, I. E. Ulugay), 100 IU/ml
penicilin (Pronapen, Pfizer), amphotericin B (Sigma, USA) and 2 mM glutamine at 37 oC in humidified
atmosphere of 5% CO2. The pH of the medium was adjusted to 7.4 with NaHCO 3.
Drug Concentrations
Metformin concentrations that were used in the present study were determined based on previous in vitro and
clinical studies. Stock solution was prepared with methanol. Three different concentrations were prepared by
dilution of stock solution. These concentrations were γ0 ηM, 65 ηM and 1γ0 ηM.
Cell viability analysis
Cell viability was examined using the MTT (Thiazolyl Blue Tetrazolium Bromide, Sigma, Missouri, USA)
colorimetric assay. Briefly, MDA-MB-231 cells were plated in 96-well plates at a density of 3x104 cells per well
and each plate was incubated for 24 hrs. After incubation, drug doses were added to each well. At the end of the
experimental period, the medium in each well was removed and 40 ηl fresh MTT solution (5 mg/ml in PBS)
were added into each well and cells were incubated at 37 oC for 4 hrs. Then, DMSO (Dimethyl Sulfoxide,
Sigma, France) was added into each well and cells were shaked thoroughly for 1 hr on a shaker. Then, the
absorbance of the samples was measured against a background control as a blank using an Elisa reader (ηQuant,
Bio-Tek Instruments Inc Vermont, USA) at 450-690 nm.
Real Time Cell Analyzer (RTCA): Cell Index
Continuous monitoring of cell viability and dynamic changes in cell properties is crucial for cell culture studies.
For this purpose real time cell analyzer (RTCA, xCELLigence, Roche) can be used for label-free and real-time
monitoring of cell properties. This system is impedance-based technology and uses specially designed microtiter
plates containing interdigitated gold microelectrodes to noninvasively monitor the viability of cultured cells
using electrical impedance as the readout In experimental process 100 ηL of cell culture medium was added to
each well for the impedance background measurement. After adding 5000 cells for per wells, the final volume
was β00 ηL. The E-Plates (16 E-Plate) were incubated at γ7°C with 5% CO 2 and monitored on the RTCA
system at 15-minute time intervals for up to 24 hours without treatment and following 72 hours with treatment.
Mitotic index (MI)
MI was determined with the Feulgen method and then stained with 10% Giemsa stain solution (pH 6.8) for a
period of 3 min and washed twice in phosphate buffer. Finally, MI was evaluated by counting cells in different
phases of mitosis for each tested inhibitor concentration and control, and 3000 cells were examined from each
slide for MI at the minimum.
3
H-thymidine labelling index analysis
For 3H-thymidine labeling index analysis, 3H-thymidine was applied at 1 ηCi/mL concentration on control and
test group cells for 20 min.
ORAL PRESENTATION
46
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Autoradiography
After labelling, the cells were fixed with Carnoy’s fixative and the remaining radioactive material was washed
twice with β% perchloric acid at 4°C for a period of γ0 min. Coverslips were coated with K.β gel emulsion
(Ilford, Cheshire, UK). After exposure time autoradiograms were bathed with D-19 b developer (Kodak, New
York, USA) and Fixaj B (Kodak, New York, USA). Labelled cells on each coverslip were counted. 3,000 cells
were examined from each coverslip at the minimum.
Statistics
Statistical analysis of AI, LI, MIν Student’s t-test was used to test significance. Two-tailed p values<0.01 were
considered statistically significant. Values obtained from all experimental groups were analyzed using one-way
ANOVA with Dunnett’s multiple comparison test to test significance.
3. RESULTS
After administration of γ0 ηM, 65 ηM and 1γ0 ηM Metformin concentrations for 24 hrs, the cell proliferation values of
MDA-MB-231 cells decreased significantly. The differences between the control and all experimental groups were
significant (p<0.01). As seen in Figure 1, cell proliferation values decreased from 650,570 x 10-3 to 320,928 x 10-3; 218,725
x10-3 and 209,112 x10-3 at 24 hrs respectively for γ0 ηM, 65 ηM and 1γ0 ηM.
Figure 1. Absorbance values of mitochondrial dehydrogenase activity (450-690 nm) of MDA-MB-231 cells
treated with γ0 µM, 65 µM and 1γ0 µM concentrations of Metformin for 24 hrs (p<0.01).
As seen in Figure β, cell viability values 4λ,γγ %, γγ,6β % and γβ,14 % at β4 h respectively for γ0 ηM, 65 ηM
and 1γ0 ηM according to control group which was taken as 100%. According to these data γ0 ηM concentrations
of Metformin is IC50 concentration.
ORAL PRESENTATION
47
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 2. Percent viability values of MDA-MB-βγ1 cells treated with γ0 µM, 65 µM and 1γ0 µM
concentrations of Metformin for 24 hrs (p<0.01).
Cell index values obtained from the real-time cell analysis system were examined as a result of application of
Metformin to MDA-MB-βγ1 cells. γ0 µM, 65 µM and 1γ0 µM concentrations were used. When the cell index
values were compared with the standard curve (Figure 3), all concentrations have cytoskeletal effect on triple
negative breast cancer cell line (Figure 4).
Figure 3. Standard curve of xCelligence Real-Time Cell Analysis (RTCA) system
ORAL PRESENTATION
48
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 4. Cell index values of MDA-MB-231 cells treated with γ0 µM, 65 µM and 1γ0 µM concentrations of
Metformin obtained from xCelligence Real-Time Cell Analysis (RTCA) system (---Control, --- γ0 µM, --- 65
µM, --- 130).
After administration of 1γ0 ηM Metformin concentration for 0-72 hrs, the mitotic index values of MDA-MB-231 cells
decreased significantly. The differences between the control and all experimental groups were significant (p<0.01). As seen
in Figure 4, mitotic index values decreased from 5,7 to 2,97 at 24 hrs; from 6,8 to 2,18 at 48 hrs and from 7,1 to 1,16 at 72
hrs for γ0 ηM.
Figure 5. Mitotic index values of MDA-MB-βγ1 cells treated with γ0 µM concentration of Metformin for 0-72
hrs (p<0.01).
As seen in Figure 4, labelling index values of MDA-MB-231 cells decreased significantly. After administration of 130
ηM Metformin concentration labelling index values decreased from 6,21 to 4,18 at 24 hrs; from 7,28 to 3,21 at 48 hrs and
from 7,33 to 2,18 at 72 hrs.
ORAL PRESENTATION
49
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 6. Labelling index values of MDA-MB-231 cells treated with γ0 µM concentration of Metformin for 072 hrs (p<0.01).
When all the evaluated parameters are examined, metformin causes statistically significant antiproliferative
effects on MDA-MB-231 cells.
4. DISCUSSION
Metformin is involved in many cancer researches with easy accessibility and safe use. There is substantial
preclinical evidence suggesting that metformin has anti-cancer properties. In vitro and in vivo analysis of
metformin has exhibited anti-proliferative activity by inhibiting intracellular pathways (Chae et al., 2016). Both
AMPK-dependent and independent pathways have been proposed to mediate the anticancer effects of metformin
treatment (Pulito et al., 2013). Remarkably, metformin was reported to reduce cancer incidence (Evans et al.,
2005). Metformin also improved the prognosis of cancers, such as liver cancer, ovarian cancer, colorectal cancer,
pancreatic cancer and breast cancer. Breast cancer patients who were treated with metformin had significantly
higher survival rates than patients who did not receive metformin (Morales DR, Morris, 2015). Metformin
selectively targets breast cancer stem cells, significantly reduces breast tumor growth and prolongs remission
when combined with chemotherapy (Hirsch et al., 2009). TNBC cell lines are more sensitive to metformin than
non-TNBC cell lines (Liu et al., 2009). In a study by Topcul and Cetin, 130 µM concentration of Metformin
reduced
cell
viability
from
100%
to
52%
in
24 hours (Topcul and Cetin, 2015). Our current findings suggest that metformin can be used as a therapeutic
agent for triple negative breast cancer.
5. CONCLUSION
This study focused on antiproliferative effects of Metformin used in the treatment of type 2 diabetes on MDAMB-231 cells originating from the triple negative subtype of the most aggressive type breast cancer. When the
results were evaluated, it has been shown that the drug has a significant antiproliferative effect on these cells.
This study and other in vitro and clinical studies supporting this study have shown that this drug may be
effective in the treatment of cancer. However, it is important to investigate combination of Metformin with
various chemotherapeutic drugs currently used or various inhibitors or extracts currently being investigated.
ORAL PRESENTATION
50
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
REFERENCES
Chae YK1,, Arya A, Malecek MK, Shin DS, Carneiro B, Chandra S, Kaplan J, Kalyan A, Altman JK, Platanias
L, Giles F 2016. Repurposing metformin for cancer treatment: current clinical studies. Oncotarget 7
(26):40767-40780.
Evans JM, Donnelly LA, Emslie-Smith AM, Alessi DR, Morris AD 2005. Metformin and reduced risk of cancer
in diabetic patients. BMJ 330: 1304-1305.
Hirsch HA, Iliopoulos D, Tsichlis PN, Struhl K 2009. Metformin selectively targets cancer stem cells, and acts
together with chemotherapy to block tumor growth and prolong remission. Cancer Res 69: 7507-7511.
Iliopoulos D, Hirsch HA, Struhl K 2011. Metformin decreases the dose of chemotherapy for prolonging tumor
remission in mouse xenografts involving multiple cancer cell types. Cancer Res 71: 3196-3201.
Liu B, Fan Z, Edgerton SM, Deng XS, Alimova IN, Lind SE, Thor AD 2009.Metformin induces unique
biological and molecular responses in triple negative breast cancer cells. Cell Cycle 8: 2031-2040.
Mendes TFS, Kluskens LD, Rodrigues LR 2015. Triple negative breast cancer: Nanosolutions for a big
challenge. Advances Science 2 (11): 1-14.
Morales DR, Morris AD 2015. Metformin in cancer treatment and prevention. Annu Rev Med 66: 17-29.
Nathan DM, Buse JB, Davidson MB, Ferrannini E, Holman RR, Sherwin R, Zinman B 2009. Medical
management of hyperglycemia in type 2 diabetes: a consensus algorithm for the initiation and adjustment
of therapy: a consensus statement of the American Diabetes Association and the European Association for
the Study of Diabetes. Diabetes Care 32:193-203.
Ning X, Shu J, Du Y, Ben Q, Li Z 2013. Therapeutic strategies targeting cancer stem cells. Cancer Biol Ther 14:
295-303.
Pulito C, Sanli T, Rana P, Muti P, Blandino G, Strano S 2013. Metformin: On ongoing journey across diabetes,
cancer therapy and prevention. Metabolites 3: 1051-1075.
Rizos CV, Elisaf MS 2013. Metformin and cancer. Eur J Pharmacol 705: 96-108.
Staels B 2006. Metformin and pioglitazone: Effectively treating insulin resistance. Curr Med Res Opin 22 (2):
S27-37.
Topcul M, Cetin I 2015. Effects of metformin on cell kinetic parameters of MCF-7 breast cancer cells in vitro.
Asian Pacific Journal of Cancer Prevention 16 (6): 2351-2354.
Viollet B, Guigas B, Sanz Garcia N, Leclerc J, Foretz M, Andreelli F 2012. Cellular and molecular mechanisms
of metformin: an overview. Clin Sci 122: 253-270.
Voduc KD, Cheang MC, Tyldesley S, Gelmon K, Nielsen TO, Kennecke H 2010. Breast Cancer Subtypes and
the Risck of Local and Regional Relapse. Journal of Clinical Oncology 28 (10): 1684-1691.
ORAL PRESENTATION
51
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Investigation of Different Potassium Dihydrogen Phosphate(KH2PO4) Quantities on Growth and
Lipid Production of Microalgae Chlorella variabilis
Necla Altın1, Togayhan Kutluk1,2*,Başar Uyar1,2 Nurcan Kapucu 1,2
1
Department of Chemical Engineering, Kocaeli University, 41380 Kocaeli, Turkey
2
Alternative Fuels R&D Center, Kocaeli University, 41040 Kocaeli, Turkey
Corresponding author e-mail:togay71@gmail.com
Abstract
Algae are living organisms that utilize solar energy most effectively, and for this reason, interest in
microalgae production technology is increasingly being explored for the discovery of new components in
different microalgae species. In recent years, oil and fatty acid products obtained from single-celled
algae have attracted considerable attention. In this study, the effects of different potassium dihydrogen
phosphate (KH2PO4) (0.005-0.020-0.080-0.160)g/L concentrations in BG11 medium on
microalgeChlorella variabilis growth and lipid content (%) for biodiesel production were examined.
According to the experimental results, it has been determined that growth in microorganisms in the
nutrient medium prepared with low concentration is better. In the nutrient sample prepared with 0.005
g/L KH2PO4 with the maximum cell concentration Xmax = 1.810 g/L and maximum specific growth rate
ηmax = 0.202 hr-1 was found. The highest amount of oil was reached (12.3%) at the same KH2PO4
concentration. Doubling times of cells were between 34 - 52 hours.
Keywords: biodiesel, Chlorella, microalgae oil, phosphate stress
1. INTRODUCTION
Microalgae are able to produce oil using carbon dioxide and sunlight, so that they can multiply in hours and be
produced throughout the year organisms with higher crop productivity than black plants. These photosynthetic
organisms give oxygen to the photosynthetic outcome center. Immortal they can make changes in their
metabolism against environmental conditions; Selena andHaddadi(2017). Chlorella and Neochloris species
belonging to the class Chlorophyceae have nutritional deficiencies cultures in the medium and 60% of the dry
cell weight oil hey were removed Algae also require elements such as carbon source, nitrogen, phosphorus,
sulfur, potassium, phosphate, magnesium to sustain their growth and development. Limitations of nutrient
elements are important factors affecting the growth of microalgae species Siaut et al. (2007). There are limeted
number of studies with Chlorella variabilis in literature with the aim of raising the fat content. Balcı et al.(β006)
observed that the Scenedesmusobliquus species grow and protein production to different nitrate (8, 12, 16 and 20
mM) and phosphate (0.1, 0.3, 0.5 and 0.7 mM) concentrations. At different pHs (pH: 7 and pH: 8) and cultures
were taken at β0 ± βºC. At both pHs, nitrate and phosphate concentrations significantly affect cell number and
protein production respectively. To the highest cell number (15.5x106) and protein concentration (8.08 mg/L)
pH: 7 12 mM nitrate and 0.γ mM phosphate concentration were determined. Sönmez et al.(β016) obtained the
highest lipid productivity with nitrogen and phosphate under limiting conditions and Micrakinium sp. 85.4 ± β
mg L-1d-1 in P-depleted It was. They also found that the amount of oleic acid increased 8-fold during Pdepletion. This paper clarifies that effects of different KH2PO4 concentrations on Chlorella variabilis microalgae
growth and oil content.
2. MATERIALS AND METHODS
1.1 Materials
Chlorella variabilis is a member of the Chlorellaceae family. Chlorella variabilis was taken from İstanbul
Medeniyet University Department Molecular biology and Genetics. Synthetic growth media (BG11) was used
ORAL PRESENTATION
52
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
in experimantal study. The chemical composition of BG11 medium (g/L); NaNO3, 1.5; KH2PO4, 0.04;
MgSO4.7H2O, 0.075; CaCl2.2H2O, 0.036; H3BO3 0.003; Na2CO3, 0.02; Fe(III)citrate, 0.006; citric acid 0.006.
Chemicals were analytical gradeand were purchased from Merck.
2.2. Microalgae growth
Illumination of the cultures was provided continuously (24 hours) with OSRAM brand LED lambs with a value
of 7W β400K to provide γ.80 klx surface light intensity. the temperature is kept constant at β5 ± β ° C. All
cultures were inoculated with algae up to γ% of their volume. All glassware used was kept at 1β1 ºC for β hours
before sterilization. Microalgae were cultured in 125 mL open flasks. Samples were run in an orbital shaker
incubator running at 145 rpm with natural ventilation. Different potassium dihydrogen phosphate (KH2PO4)
(0.005-0.020-0.080-0.160) g/L concentrations in BG11 medium were added.
2.3. Optic density (OD) and pH measurements
The absorbances of the samples in quartz cuvettes were read with spectrophotometer (Jenway 6800 UV-VIS
spectrophotometer) at a wavelength of 600 nm. pH measurements were done using aMettler Toledo Easy S-20K
pH meter.
2.4. Harvesting of microalgae
Microalgae were centrifuged at 6000 rpm for 10 minutes and dried in oven 60 °C overnight.
2.5. Lipid content analysis
Lipid analysis was performed according to the method of Bligh and Dyer (1959). 0.2 grams of homogenized
algae samples were stored at 105 ºC for β hours in the oven. After these samples were added a mixture of 1β0
mL methanol/chloroform (1/2). 0.4% CaCl2 solution was tadded into a samples. These samples were stirred for 3
hours at 200 rpm on a mechanical stirrer, then filtered through a filter paper. Samples were kept in dark
overnight. The next day the upper layer consisting of the methanol-water mixture was separated. Chloroform
was removed from the media by rotary evaporator. The residual lipid was cooled to room temperature and
weighed.
3. RESULTS
The time-dependent growth and pH changes of Chlorella variabilis in photobioreactorson different
KH2PO4concentrations are shown in Fig. 1 and Fig. 2, respectively. Figure 1 clearly shows that the
microorganism with a concentration of 0.020 g / L KH2PO4showed a steady-state growth up to 237
hours, then continued to grow rapidly until 718 hours. In the presence of 0.005 g/L KH2PO4
concentration sample, a smooth growth curve was observed up to 718 hours. At all concentrations, the
death phase started after 718 hours. The maximum cell concentration (Xmax = 1.810 g / L) and the
specific growth rate (ηmax = 0.β0βh-1) were reached in the nutrient medium prepared at low KH2PO4
concentration. The highest fat content produced in the microorganism is 12.3% at 0.005 g / L
KH2PO4concentration. Doubling times of the cells are determined to be 34, 41, 52 and 48 hours,
respectively. According to the Figure 2 at the beginning of cultures, pH values were measured between
6.00 and 6.50 then increased up to 309 hours and decreased in the following hours. Approximately
after the 500 hours the pH remained constant at 8.50-9.0. The effect of KH2PO4 stress conditions on
microorganism growth rate and lipid content at different concentrations is given in Table 1.
ORAL PRESENTATION
53
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Biomass(gdw/L)
2,0000
1,5000
0.05 g/L
1,0000
0.020 g/L
0.080 g/L
0,5000
0.160 g/L
0,0000
0
100
200
300
400
500
600
Time (h)
Figure 1. Effects of different KH2PO4 concentrations on microalgae growth
10,5
10
9,5
pH
9
8,5
0.005 g/L
8
0.020 g/L
7,5
0.080 g/L
7
0.160 g/L
6,5
6
0
200
400
600
800
1000
Time (h)
Figure 2. pH changes of microalgae growth at different KH2PO4 concentrations
Table 1. Effect of KH2PO4 stress conditions on microorganism growth rate and lipid content
KH2PO4stress
(g/L)
Xmax
(g/L)
µmax
-1
(h )
Lipid
content
(%)
Doubling
time
Lipid
productivity
(h)
(mg/Ld-1)
0.005
1.81
0.020
12.3
34
0.72
0.020
1.61
0.017
11.4
41
0.52
0.080
0.56
0.013
9.6
52
0.40
0.160
0.67
0.014
6.8
48
0.28
ORAL PRESENTATION
54
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
5. CONCLUSION
Forthe first time in literature this study expresses the effect of different KH2PO4 stress conditions on microalgae
growth and lipid accumulation of Chlorella variabilis.
The findings show that the microalgae can be considered as a raw material for biodiesel production applications
in the future.
Low KH2PO4 concentrations must be applied for maximum microorganism groth rate and lipid accumulation.
According to the literature, nitrogen stress is more effecite compared to the KH 2PO4 stress on the microorganism
lipid accumulation.
ACKNOWLEDGEMENTS
The authors thank Dr. Turgay Çakmak from Istanbul Medeniyet University Department of Moleculer Biology
and Genetics for donating microalgae species Chlorella variabilis.
REFERENCES
Siaut, M., Heijde, M., Mangogna, M., Montsant, A., Coesel, S., Allen, A., Bowler 2007. C. Molecular toolbox
for studying diatom biology in Phaeodactylumtricornutum. Gene,406(1), 23-35.
Balcı M., Çelekli A., Deveci A., Eyüboglu F β006. ScenedesmusobliquusTürününGelisimine, Klorofil-a ve
Protein ÜretimKapasitesine pH, NitratveFosfatKonsantrasyonlarınınEtkisi, Türkiye λ. GıdaKongresiν β4β6 Mayıs.
Sonmez, C., Elcin, E., Akın, D., Oktem, H. A., &Yucel, M 2016. Evaluation of novel thermo-resistant
Micractinium and Scenedesmus sp. for efficient biomass and lipit production under different temperature
and nutrient regimes. Bioresource technology, 211, 422-428.
Bligh, E. G., & Dyer, W. J 1959. A rapid method of total lipit extraction and purification. Canadian journal of
biochemistry and physiology, 37(8), 911-917.
HaddaniMH, Aiyelabega HT, Negahdari B 2017. Advanced biotechnology in biorefinery: a new insight into
municipal waste management to the production of high-value products International Journal
Environmental Science Technology. Doi:10.1007/s1376.
Selena D, Miranda M, Daniel F, Arsalon AH, Serdar O, Faisal S,Debalina S, Mahmoud MEH 2017.A review of
biodiesel production from microalgae, Clean Technology Environmental 19:637–668.
ORAL PRESENTATION
55
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Sulu Çözeltilerden Anhidrotetrasiklinin Giderimi İçin Lemna gibba L.’nın Kullanımının
Araştırılması
Murat Topal1*, Erdal Öbek2, Gülşad Uslu Şenel3, E. Işıl Arslan Topal3
*1
Munzur Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Tunceli, Türkiye
2
Fırat Üniversitesi, Mühendislik Fakültesi, Biyomühendislik Bölümü, Elazığ, Türkiye
3
Fırat Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Elazığ, Türkiye
Sorumlu yazar e-mail: murattopal@munzur.edu.tr
Özet
Bu çalışmada, sucul bitkilerden Lemna gibba L. bitkisi kullanılarak farklı konsantrasyonlarda hazırlanan sulu
çözeltilerden anhidrotetrasiklin (ATC) giderimi araştırıldı. Bu amaçla, belirli miktarda Lemna gibba L.
bitkileri cam reaktörlere yerleştirildi. Her bir reaktöre 50, 100 ve γ00 ηg/L içeren anhidrotetrasiklin çözeltileri
eklendi. Farklı hidrolik bekletme sürelerine göre Lemna gibba L. tarafından ATC giderim verimleri belirlendi.
Lemna gibba L. bulunan reaktörler bitkili reaktörler olarak, bulunmayan reaktörler kontrol reaktörleri olarak
kullanıldı. 50 ηg/L ATC içeren bitkili reaktörde en düşük giderim verimi %40,8±β,0, en yüksek giderim
verimi %87,56±4,γ olarak gerçekleşti. 100 ηg/L ATC içeren bitkili reaktörde en düşük ATC giderim verimi
%50,2±β,5 olarak, en yüksek ATC giderim verimi ise %λγ,74±4,7 olarak gerçekleşti. γ00 ηg/L ATC içeren
bitkili reaktörde en düşük ATC giderim verimi %4γ±β,1 olarak, en yüksek ATC giderim verimi ise %λ7,λ±4,8
olarak gerçekleşti. ATC konsantrasyonunun artışıyla Lemna gibba L. tarafından giderilen ATC giderim verimi
de arttı.
Anahtar Kelimeler: Giderim, antibiyotik, su mercimeği, fitoremediasyon
1. GİRİŞ
Modern tıbbi teknolojinin hızla gelişmesi ile antibiyotikler insanların ve hayvanların hastalıklarını tedavi etmek
veya önlemek ve hayvancılık verimliliğini arttırmak için yaygın olarak kullanılmaktadır (Ren ve ark., 2018).
Tetrasiklinler, insan tıbbında ve veteriner hekimlikte kullanılan en eski ve en önemli geniş spektrumlu bir
antibiyotiktir (Xiong ve ark., β018). Bu bileşiklerin çözelti içinde oldukça kararsız olduğu bilinmektedir.
Tetrasiklinlerin tanımlanmış ana bozunum ürünleri arasında bazıları, toksik veya farmakolojik olarak inaktiftir.
Tetrasiklinin parçalanma ürünleri epitetrasiklin, epianhidrotetrasiklin ve anhidrotetrasiklindir. Anhidrotetrasiklin
(ATC), asit ortamında tetrasiklinin en büyük toksik bozunma ürünlerinden biridir. ATC, şiddetli yan etkileri
nedeniyle tedavi edici olarak etkili değildir (Fernández ve Dassie, β008). ATC’in toksikolojik önemi Klimova ve
Ermolova (1λ76) tarafından bildirilmiştir. Klimova ve Ermolova (1λ76) yaptıkları çalışmada tetrasiklinin
anhidro türevlerinin büyüyen piliç embriyoları ve aşılanmış farelerin dalak hücreleri üzerindeki toksik etkisini
araştırmışlardır. Dalak hücreleri üzerindeki tetrasiklin ve ATC etkisinin karşılaştırmalı incelemesi sonucu,
ATC’in tetrasiklinden 40 ila 100 kat daha düşük dozlarda kullanıldığında antikor üreten hücrelerin sayısında
tetrasiklin ile aynı miktar düşüşe neden olduğu görülmüştür. Bu sonuç, ATC’in yüksek toksisitesini ortaya
çıkarmıştır. dos Santos ve ark. (1λλ8), ATC' in toksik etkilerini dimetilamino grubunun (C4 üzerindeki) relatif
konumuna bağlamışlardır.
Son zamanlarda, göl, nehir, toprak ve hatta içme suyu da dahil olmak üzere çevrede antibiyotik kalıntıları
giderek artmaktadır. Tetrasiklin kalıntılarıν genetik değişim, bakterilerde ilaçlara karşı direnç ve sonrasında insan
sağlığına tehdit oluşturabilir (Ren ve ark., β018). Adsorpsiyon, mikrobiyal bozunma ve membran ayırma gibi
arıtmalar tetrasiklin için etkili değildir. Sulu ortamdan tetrasiklin kalıntılarını uzaklaştırmak için çevre dostu,
düşük maliyetli ve etkili bir yöntem bulmaya ihtiyaç vardır (Ren ve ark., β018). Fitoremediasyon, bitkilerin
atıksudan kirletici maddeleri doğal olarak absorplama kabiliyetini kullanan düşük maliyetli ve çevre dostu
iyileştirme tekniği olarak bilinir (Li ve ark., β007ν Yavari ve ark., β017). Makrofitler, doğal karakteristikleri
nedeniyle, atıksuyu arıtmada kullanım potansiyeline sahiptir. Su mercimekleri, hızlı büyüyen bitkilerdir ve
sudaki nutrientleri ve ağır metalleri uzaklaştırmada etkilidirler (Ng ve Chan, β017). Su mercimeği Lemna gibba
L. küçük, monokotiledonlu bir su bitkisidir. Ana frondların torbalarından yavru frondlar (yaprak benzeri yapılar)
ORAL PRESENTATION
56
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
geliştirerek vejetatif ve exponansiyel olarak büyür. Lemna gibba L. tarafından besin maddelerinin emilimi,
bitkinin geniş frond yüzeyi nedeniyle artmaktadır (Majewski ve ark., β017). Bu nedenle, çalışmamızda sucul
bitkilerden Lemna gibba L. bitkisi kullanılmıştır.
Bu çalışmada, Lemna gibba L. (su mercimeği) bitkisi kullanılarak, laboratuvar şartları altında, farklı
konsantrasyonlarda ATC içeren sulu çözeltilerden ATC giderimi araştırıldı.
2. MATERYAL VE METOD
Çalışmamızda materyal olarak anhidrotetrasiklin ve Lemna gibba L. bitkileri kullanıldı. Anhidrotetrasiklin
antibiyotik standardı %λ7 saflıkta olup Agros Organics (New Jersey, USA) firmasından temin edildi. Lemna
gibba L. bitkileri ise Elazığ yöresinden doğal ortamından toplandı. Çalışmamız, laboratuvar şartları altında 600
mL ölçekli cam reaktörlerde kesikli sistem prensibine göre gerçekleştirildi. Her bir reaktöre farklı
konsantrasyonlarda hazırlanan (50, 100 ve γ00 µg/L) ATC çözeltilerinden 400 mL eklendi. Sonra reaktörlere 5g
olacak şekilde Lemna gibba L. bitkileri yerleştirildi. Farklı hidrolik bekletme sürelerine (HBS) göre Lemna
gibba L. bitkisi tarafından ATC giderim verimi araştırıldı. Sulu çözeltilerde ATC konsantrasyonları Jia ve ark.,
β00λ tarafından verilen metot modifiye edilerek gerçekleştirildi. Öncelikle her bir reaktörden alınan su örnekleri
Katı Faz Ekstraksiyonu (SPE) işleminden geçirildi. SPE işleminde Oasis HLB ve Oasis MAX kartuşları
kullanıldı. Söz konusu kartuşlar ön şartlandırma, yükleme, yıkama ve elute işlemlerinden geçirildi. Elde edilen
eluteler β mL’lik viallere alındı ve LC/MS-MS cihazı kullanılarak ATC konsantrasyonları tespit edildi.
3. BULGULAR ve TARTIŞMA
Bu çalışmada, Lemna gibba L.’nın ATC giderimindeki etkinliği belirlenmiş ve elde edilen bulgular aşağıda
tartışılmıştır. Oda sıcaklığında ve farklı HBS’nde ATC konsantrasyonunun Lemna gibba L.’nın giderim verimi
üzerine etkisi 50, 100 ve γ00 µg/L konsantrasyonlarında araştırıldı. 50 µg/L ATC içeren bitkili ve kontrol
reaktörlerde elde edilen giderim verimleri Şekil 1’de verilmiştir.
Giderim verimi (%)
120
100
80
60
Lemna gibba L.'lı
reaktör
40
Kontrol reaktör
20
2s
4s
8s
12s
1.gün
β.gün
γ.gün
4.gün
5.gün
6.gün
7.gün
8.gün
λ.gün
10.gün
0
Zaman
Şekil 1. ATC giderim veriminin değişimi (C o= 50 µg/L ATC)
Şekil 1’e göre, Lemna gibba L.’lı reaktörün en düşük ve en yüksek ATC giderim verimleri sırasıyla, %40,8±β,0
ve %87,56±4,γ olarak gerçekleşmiştir. ATC50 için %81,γ4±4,01 oranında bir giderim 1β. saat sonunda tespit
edilmiştir. Bu nedenle ATC50 konsantrasyonunda Lemna gibba L. için en uygun hasatlama süresi 1β saat olarak
belirlenmiştir. Kontrol reaktöründe ise ATC50 için en düşük ve en yüksek azalma sırasıyla, %6,6±0,γ1 ve
%87,4±4,γ olarak gerçekleşmiştir. 100 µg/L ATC içeren Lemna gibba L.’lı ve kontrol reaktörlerinde farklı
HBS’ne karşı elde edilen giderim verimleri Şekil β’de verilmiştir.
ORAL PRESENTATION
57
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Giderim verimi (%)
120
100
80
60
Lemna gibba L.'lı
reaktör
40
Kontrol reaktör
20
2s
4s
8s
12s
1.gün
β.gün
γ.gün
4.gün
5.gün
6.gün
7.gün
8.gün
λ.gün
10.gün
0
Zaman
Şekil β. ATC giderim veriminin değişimi (C o= 100 µg/L ATC)
Şekil β’den de görüldüğü gibi, Lemna gibba L.’lı reaktörde en düşük ATC giderim verimi %50,β±β,5 olarak, en
yüksek ATC giderim verimi ise %λγ,74±4,7 olarak gerçekleşmiştir. 1β. saatten 10. güne kadar ATC giderim
veriminde çok fazla değişiklik meydana gelmemiştir (%5,γ4±0,βγ). Bu nedenle ATC100 konsantrasyonunda
Lemna gibba L. için en uygun hasatlama süresi 1β saat olarak belirlenmiştir. Kontrol reaktöründe ise ATC100
için en düşük azalma %40,λ±β,1 olarak, en yüksek azalma %λγ,51±4,6 olarak gerçekleşmiştir. ATC100 için
hem Lemna gibba L.’lı hem de kontrol reaktörlerde giderim verimleri γ. günden sonra hemen hemen aynı
olmuştur. Bu durum bize ilk γ günde Lemna gibba L.’ nın ortamda bulunan ATC’yi aktif olarak giderdiğini γ.
günden sonra ise makroorganizmanın aktivitesini kaybettiğini göstermektedir. γ00 µg/L ATC içeren Lemna
gibba L.’lı ve kontrol reaktörlerinde farklı HBS’ne karşı elde edilen giderim verimleri Şekil γ’de verilmiştir.
Şekil γ’e göre, Lemna gibba L.’lı reaktörde en düşük ATC giderim verimi %4γ±β,1 olarak, en yüksek ATC
giderim verimi ise %λ7,λ±4,8 olarak gerçekleşmiştir. ATCγ00 konsantrasyonunda Lemna gibba L. için en
uygun hasatlama süresi 1β saat olarak belirlenmiştir. Kontrol reaktöründe ise ATCγ00 için en düşük azalma
%β,γ+0,1 olarak, en yüksek azalma %λ7,λ+4,7 olarak gerçekleşmiştir.
Giderim verimi (%)
120
100
80
60
Lemna gibba L.'lı
reaktör
40
Kontrol reaktör
20
0
Zaman
Şekil γ. ATC giderim veriminin değişimi (C o= γ00 µg/L ATC)
ORAL PRESENTATION
58
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4. SONUÇ
Bitkili reaktörlerde ATC50, ATC100 ve ATCγ00 için en yüksek giderim verimleri sırasıyla, %87,56±4,3;
%93,74±4,7 ve %97,9±4,8 olarak, kontrol reaktörlerinde ise en yüksek azalma sırasıyla, %87,4±4,3; %93,51±4,6
ve %97,9±4,7 olarak tespit edilmiştir. ATC50, ATC100 ve ATCγ00 konsantrasyonlarında Lemna gibba L. için
hasatlama süreleri 1β saat olarak belirlenmiştir. Sonuç olarak, sucul bir bitki olan Lemna gibba L. bitkisi
kullanılarak sucul çözeltilerden ATC’nin gideriminde kullanılabileceği belirlenmiştir.
TEŞEKKÜR
Bu çalışma, Türkiye Bilimsel ve Teknolojik Araştırma Kurumu (TÜBİTAK Proje No. 11γY0γ5) ve Fırat
Üniversitesi Bilimsel Araştırma Projeleri Yönetimi Birimi (FUBAP Proje No. MF 1βγ6) tarafından
desteklenmiştir.
KAYNAKLAR
dos Santos HF, de Almeida WB, Zerner MC 1998. Conformational Analysis of the Anhydrotetracycline
Molecule: A Toxic Decomposition Product of Tetracycline, Journal of Pharmaceutical Sciences, 87:190–
195.
Fernández RA, Dassie SA 2008. Electroanalytical procedure to resolve a sample solution containing tetracycline
and its toxic degraded product:Anhydrotetracycline, Journal of Electroanalytical Chemistry, 624(1–2):
121-128.
Jia A, Xiaoa, Y, Hua J, Asamib M, Kunikaneb S 2009. Simultaneous determination of tetracyclines and their
degradation products in environmental waters by liquid chromatography–electrospray tandem mass
spectrometry. J. Chromatogr. A, 1216: 4655–4662.
Klimova NE, Ermolova OB 1976. Embryotoxicity and the immunodepressive action of tetracycline and its epiand anhydro- derivatives, Antibiotiki, 21(11): 1018-1022.
Li M, Wu YJ, Yu ZL, Sheng GP, Yu HQ 2007. Nitrogen removal from eutrophic water by floating-bed-grown
water spinach (Ipomoea aquatic Forsk.) with ion implantation, Water Research, 41:3152-3158.
Majewsky V, Scherr C, Schneider C, Arlt SP, Baumgartner S 2017. Reproducibility of the effects of
homeopathically potentised Argentum nitricum on the growth of Lemna gibba L. in a randomised and
blinded bioassay, Homeopathy, 106(3): 145-154.
Ng YS, Chan DJC 2017. Wastewater phytoremediation by Salvinia molesta, Journal of Water Process
Engineering, 15: 107-115.
Ren YN, Xu W, Zhou LX, Zheng YQ 2018. Two new uranyl complexes as visible light driven photocatalysts for
degradation of tetracycline, Polyhedron, 139: 63-72.
Xiong W, Wang M, Dai J, Sun Y, Zeng Z 2018. Application of manure containing tetracyclines slowed down
the dissipation of tet resistance genes and caused changes in the composition of soil bacteria,
Ecotoxicology and Environmental Safety, 147: 455-460.
Yavari S, Malakahmad A, Sapari NB, Yavari S, Khan E 2017. Nutrient balancing for phytoremediation
enhancement of urea manufacturing raw wastewater, Journal of Environmental Management, 202(1): 225231.
ORAL PRESENTATION
59
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Color Removal from Dyeing Wastewater with Chemical Coagulation
Ezgi Oktav Akdemir*, Ahmet Çağrı Aytuna
Dokuz Eylul University, Engineering Faculty, Environmental Engineering Department, İzmir, Turkey
Corresponding author e-mail:ezgi.oktav@deu.edu.tr
Abstract
Nowadays, color removal from wastewaters containing dye is important and the color has been taken into the
regulations as a parameter to be removed. In this study, color removal after chemical treatment of Reactive Red
3B textile dye with ferric trichloride (FeCl3) was investigated. In experimental studies, jar test experiments
were carried out with different concentrations of dye and FeCl 3 with rapid mixing, slow mixing and settling
processes. The efficiency of chemical treatment on color removal efficieny was determined by the Box–Wilson
statistical experiment design. This method was used to investigate the effects of the three independent variables
(dye concentration, FeCl3 concentration and settling time) on the response function (color removal efficiency)
and to determine the optimal conditions maximizing the percent color removals. Dye concentration was
changed between 50-250 mg/l, FeCl3 concentration varied between 50-400 mg/l and settling time was changed
between 30-60 minutes during experimental studies. The Statistica 5.0 computer program was employed and
the correlation coefficient (R2) between the observed and predicted color removals was 0.934. This result
indicated excellent agreement between the observed and predicted values. The optimum conditions at which
the highest color removal efficiency obtained were the dye concentration of 250 mg/l, the FeCl3 concentration
of 200 mg/l and the settling time of 60 minutes. Color removal efficiency obtained in these conditions was
99%.
Keywords: Box-Wilson experimental design, Decolorization, Dye, FeCl3 .
1. INTRODUCTION
Industries that use dyes in their manufacturing processes discharge high concentrations of dyes in their
wastewater effluents. Textile industry is one of the entities where 10–15% of the dye used is washed out into the
wastewater effluent. Dye-contaminated wastewater released to the environment causes numerous problems such
as high chemical oxygen demand (COD), increase in toxicity and a decrease in biodegradability and the growth
of biota. Industries are therefore compelled by environmental legislation to remove dye from their effluents
before they are released into the watercourse (Mohammed et.al., 2014; Karthik et. al., 2014).
In general, dyes are difficult to remove because they are stable to light and oxidizing agents, and with low
biodegradability (Buscio et.al., 2016). The most used technologies to treat wastewater containing dyes are based
on physical–chemical or/and biological processes. Coagulation and sedimentation processes are known to be
effective in eliminating the colors of insoluble dyes such as disperse ones. The well-known conventional
coagulants such as alum, polyaluminum chloride, iron (II) sulfate and lime were widely used in the textile
wastewater treatment (Robinson et.al., 2001).
There are very limited numbers of works available on water treatment with direct use of FeCl 3. Papic et al.
(2000) used the coagulation–flocculation process for the treatment of reactive dye wastewaters,with ferric
chloride hexahydrate employed as the coagulant. They found this process very effective with a more than 99.5%
colour removal. Tian and Wang (2013) used FeCl3 as a coagulant for three different sun-proof dye such as green,
yellow and scarlet. They found the optimum dosages of FeCl3 as 9.6 and 8 ml when the concentration of FeCl3
was 2 g/l. Under theese conditions, the removal rates of turbidity were 86.2%, 83.6%, 93.4% and the removal
rates of color were 82.7%, 61.4%, 79.0% for sun-proof green, yellow and scarlet, respectively. Kim et al. (2004)
examined the decolorization of some of the most commonly used disperse and reactive dyestuffs by combination
of chemical coagulation with FeCl3 and Fenton oxidation. They reported that Fenton oxidation in combination
with Fe3+ coagulation was very effective for COD and dye removal. About 90% of COD and 99% of dye
removals were obtained at the optimum conditions in their study. Debnath et al. (2015) used a systematic study
ORAL PRESENTATION
60
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
of the interaction of FeCl3 with Congo Red (CR) performed with UV-Vis-NIR spectrophotometer. They
obtained an exceptionally high removal rate of 2670 mg/g at 100 mg/L initial CR concentration and they found
enhanced removal rate with increasing initial CR concentration.
In the content of this study FeCl3 was used as a coagulant for the decolorization of Reactive Red HE3B. Box–
Wilson statistical experiment design approach was used by considering the dye concentration, FeCl3
concentration and settling time as independent variables while were the objective functions to be optimized. The
optimal conditions maximizing color removal efficiency were also determined in this study.
2. MATERIALS AND METHODS
2.1. Coagulation-Flocculation Experiments
Experiments on dye coagulation and flocculation were performed using Jar-test equipment (VelpScientifica
Flocculation Test Unit) given in Figure 1. Desired concentration of dye stuff (50-250 mg/L) and FeCl3 (50-400
mg/L) were added to beaker each containing 500 ml volume. The mixture was then stirred at high velocity (200
rpm) for 3 min after which the velocity was decreased to 40 rpm and this slow stirring was maintained for 45
min. Subsequently, the stirring was stopped and different settling time (30-60 min) was applied. Following the
settling time, samples were collected from clear supernatant using a syringe. The collected samples were
analyzed by the spectrophotometer of HACH Lange DR 6000 at 456 nm.
.
Figure 1. Jar Test Equipment
2.2. Design of Experiments
The Box–Wilson design is a response surface methodology, which is an empirical modeling technique, devoted
to the evaluation of the relationship of a set of controlled experimental factors and observed results. Basically
this optimization process involves three major steps: performing the statistically designed experiments,
estimating the coefficients in a mathematical model, and predicting the response and checking the adequacy of
the model (Akdemir and Özer, β011).
Three important operating parameters; dye concentration, FeCl3 concentration and settling time were chosen as
the independent variables and designated as X1, X2 and X3, respectively. Dye concentration was changed
between 50-250 mg/l, FeCl3 concentration varied between 50-400 mg/l and settling time was changed between
30-60 minutes during experimental studies. Color removal efficiency was chosen as system responses. The
experiments consisted of six axial (A), eight factorial (F) and center points (C) totaling 17 experiments.
Experimental conditions determined by the Box–Wilson statistical design are presented in Table 1.
ORAL PRESENTATION
61
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 1. Experimental Conditions According to a Box–Wilson Statistical Design
Dye concentration
FeCl3 concentration
Settling time
(mg/L)
(mg/L)
(min)
Axial point
250
225
45
A1
A2
50
225
45
A3
150
400
45
A4
150
50
45
A5
150
225
60
A6
150
225
30
Factorial points
F1
92
326
54
208
326
54
F2
F3
208
326
36
F4
208
124
36
F5
92
124
54
F6
92
326
36
F7
208
326
54
F8
92
124
36
Center point
150
225
45
C
The predicted color removal efficiency was correlated with the other independent parameters dye concentration
(X1), FeCl3 concentration (X2) and settling time (X3) using Eq. (1).
Y=b0+b1X1+b2X2+b3X3+b12X1X2+b13X1X3+b23X2X3+b11X12+b22X22+b33X32
(1)
where Y is predicted yield; bo is constant; b1, b2 and b3 are linear coefficients; b12, b13, b23 are cross product
coefficients; and b11, b22, b33 are quadratic coefficients.
3. RESULTS AND DISCUSSIONS
3.1. Box–Wilson Experimental Design Method Results
Experimental results found in this study were used to determine the coefficients of the response function
(Eq. (1)) using a statistical regression analysis program “Statistica”. The calculated coefficients are listed
in Table 2 and they were used to calculate the predicted values of color removal efficiency.
Table 2 . Coefficients of the Response Function
Coefficients
b0
b1
b2
b3
b12
b13
b23
b11
b22
b33
ORAL PRESENTATION
Color removal
0,7519125
-0,0003364
0,0036528
-0,0201068
-0,0000068
0,0000468
-0,0000264
-0,0000011
-0,0000015
0,0002508
62
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The coefficients given in Table 2 were used in calculating predicted values of color removal efficiencies. All
efficiencies obtained from experiments and calculated by the Statistica are given in Table 3. The correlation
coefficient (R2) between the observed and predicted values was 0.934 indicating a good agreement between the
observed and predicted values of color removal efficiencies.
Table 3. Observed and Predicted Color Removal Efficiencies
Observed color removal (%)
Predicted color removal (%)
83.02
84.46
93.99
66.56
95.76
85.10
95.63
88.65
85.24
72.57
76.63
98.93
91.72
70.34
84.78
80.44
84.47
91.49
66.54
94.75
83.36
98.81
91.87
89.84
71.30
73.94
97.61
91.22
78.75
84.92
A1
A2
A3
A4
A5
A6
F1
F2
F3
F4
F5
F6
F7
F8
C
3.2. Color Removal
The effects of dye concentration, FeCl3 concentration and settling time on the color removal efficiencies have
been investigated in this study. First of all, the variation of the FeCl3 and dye concentrations on the color removal
efficiency at constant settling time was investigated and the results are given in Figure 2. For all the dye
concentrations examined, the increase in FeCl3 concentration up to 250 mg/l also increases the color removal
efficiency. At FeCl3 concentrations above 250 mg/l, the color removal efficiency decreases with increasing FeCl3
concentration for high dye concentrations At high dye concentrations such as 200 mg/l, 93%, 99% and 91%
color removal efficiencies were obtained for 50 mg/l, 250 mg/l, and 400 mg/l FeCl3 concentration, respectively.
At low dye concentration such as 50 mg/l and for the same FeCl3 concentrations the efficiencies obtained were
65%, 91% and 99%, respectively.
Color removal efficiency (%)
100
90
80
70
60
0
100
200
300
400
FeCl3 concentration (mg/l)
Figure 2. Variation of Color Removal Efficiency with FeCl3 Concentration. Settling Time: 60 min.
Dye Concentration: (♦) 50 mg/l, (▲)100 mg/l, ()150 mg/l, (■) 200 mg/l:
ORAL PRESENTATION
63
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
In the second part of experiments, variation of color removal efficiency with dye concentration at different
settling time was investigated. FeCl3 concentration was kept constant at 100 mg/l. Results are given in Figure 3.
The increase in dye concentration also increases the color removal efficiency. 71% color removal efficiency was
obtained at a dye concentration of 50 mg/l for 60 minute settling time, while the efficiency reached 99% when
the dye concentration was increased to 250 mg/l. Color removal efficiency was not changed much during 30
minutes and 40 minutes settling time. However, when the settling time went up to 60 minutes, 99% color
removal efficiency was reached.
In the last part of experiments, variation of color removal efficiency with settling time as a function of FeCl3
concentration was investifated and results are given in Figure 4. As it can be seen from figure, color removal
efficiency at low settling times is not effective. When the settling time reaches 60 minutes, the efficiency for all
the concentrations of FeCl3 investigated. The highest color removal efficiency was achieved as 99% at the
concentration of 250 mg/l FeCl3 and 60 minutes settling time.
Color removal efficiency (%)
100
90
80
70
60
50
0
100
200
300
Dye concentration (mg/l)
Figure 3. Variation of Color Removal Efficiency with Dye Concentration. FeCl3 Concentration: 100 mg/l,
Settling Time () 60 min, (▲) 50 min, (■) 40 min, (♦) 30 min.
Color removal efficiency (%)
100
90
80
70
60
50
20
30
40
50
60
70
Precipitation time (minute)
Figure 4. Variation of Color Removal Efficiency with Settling Time. Dye Concentration: 100 mg/l,
FeCl3 Concentration: () 250 mg/L, (x) 200 mg/L,( ▲) 150 mg/L, (■) 100 mg/L, (♦) 50 mg/L
5. CONCLUSION
In this study, color removal by chemical treatment method using FeCl3 from wastewater containing dye was
investigated. The experiments were carried out according to Box-Wilson experimental design method. The
ORAL PRESENTATION
64
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
parameters of dye concentration (X1), FeCl3concentration (X2) and settling time (X3) were used to determine
color removal efficiency in wastewater containing dye in jar test experiments.
When the Box-Wilson experimental design method was applied for the color removal, the correlation coefficient
(R2) between the color values measured in the experiments and the color values calculated by the Statistica
program was found to be 0.934. This demonstrates a good agreement between the measured and calculated
values and proves the applicability of the method.
The optimum conditions at which the highest color removal efficiency is obtained at the end of the experimental
runs are the dye concentration of 250 mg/l, FeCl3 concentration of 200 mg/l and the settling time of 60 minutes.
The obtained color removal efficiecy in these conditions is 99%.
REFERENCES
Akdemir EO, Ozer A 2011. Efficiency of filtration process in the pretreatment of olive oil mill wastewaters
(OMWW). Fresenius Environmental Bulletin, (20): 597-602.
Buscio V, Crespi M, Gutierrez-Bouzan C 2016. Application of PVDF ultrafiltration membranes to treat and
reuse textile wastewater. Desalination and Water Treatment, (57): 8090–8096.
Debnath A, Thapa R, Chattopadhyay KK, Saha B 2015. Spectroscopic studies on ınteraction of congo red with
ferric chloride in aqueous medium for wastewater treatment. Separation Science and Technology, 501(11):
1684-1688.
Karthik V, Saravanan K, Bharathi P, Dharanya V, Meiaraj C 2014. An overview of treatments for the removal of
textile dyes. Journal of Chemical and Pharmaceutical Sciences, 7(4): 1215–1220.
Kim T H, Park C, Yang J, Kim S 2004. Comparison of disperse and reactive dye removals by chemical
coagulation and Fenton oxidation. Journal of Hazardous Material, 112: 95-102.
Mohammed MA, Shitu A, Ibrahim A 2014. Removal of methylene blue using low cost adsorbent: A review.
Research Journal of Chemical Sciences, 4 (1): 91– 102.
Papic S, Koprivanac N, Bozic AL 2000. Removal of reactive dyes from wastewater using Fe (III) coagulant.
Coloration Technology, 116: 352-360.
Robinson T, McMullan G, Marchant R, Nigam P 2001. Remediation of dyes in textile effluent: A critical review
on current treatment technologies with a proposed alternative. Bioresource Technology, (77): 247–255.
Tian Y P, Wang B 2013. Experimental study of optimal coagulation effect on three kinds of direct sun-proof
dyes by FeCl3. Advenced Material Research, 690: 1504-1510.
ORAL PRESENTATION
65
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The Detailed Chromosome Measurements and B-Chromosomes in Salvia virgata
Hülya Doğan1*, Halil Erhan Eroğlu2, Belgin Coşge Şenkal3, Cüneyt Cesur3, Tansu Uskutoğlu3, Uğur
Özkan4, Derya Altay5
*1
Bozok University,Technical Sciences Vocational School, Deparment of Seed Science, Yozgat, Turkey
2
Bozok University, Faculty of Science and Art, Deparment of Biology, Yozgat, Turkey
3
Bozok University, Agriculture Faculty, Deparment of Field Crops, Yozgat, Turkey
4
Ankara University, Agriculture Faculty, Deparment of Field Crops, Ankara, Turkey
5
Ankara University, Graduate School of Natural and Applied Sciences, Deparment of Biology, Ankara, Turkey
Corresponding author e-mail: hulya.dogan@bozok.edu.tr
Abstract
Salvia virgata Jacq., popularly known as erysipelas, is used as wound healing and spreads naturally in
Anatolia. The purpose of this study is to determine the diploid chromosome number, detailed chromosome
measurements, B chromosomes and karyotype asymmetry of S. virgata. The results showed that the diploid
chromosome number is 2n = 32 + 0-2B in S. virgata. The karyotype formula is 2n = 4x = 32 = 24m + 6sm +
2st. The length of chromosomes varied from 0.56 to 1.65µm. Total haploid length and mean haploid length are
18.10 and 1.1γ ηm, respectively. The centromeric index values varied from 1λ.54 to 48.57. The
intrachromosomal asymmetry value (MCA) and interchromosomal asymmetry value (CV CL) are 20.28 and
28.68, respectively. The karyotype of S. virgata close to symmetric type. As a result, detailed chromosome
measurements and 0-2B chromosomes of S. virgata were showed for the first time. The species has small
chromosomes shaped median, submedian and subterminal.
Keywords: Asymmetry index, B chromosome, Karyotype, Lamiaceae, Salvia virgata.
1. INTRODUCTION
The genus Salvia L. (sage) belongs to the subfamily Nepetoideae of the family Lamiaceae. It is the largest genus
of Lamiaceae with approximately 1000 species. The species which are herbaceous, shrubby or woody and
annual, biennial or perennial, spread mainly in temperature and tropical areas of Eastern Asia, Western Asia,
Central America and South America. The distribution centers of the species are Mediterranean region, Central
Asia, Mediterranean region, Andean mountains of South America and highlands of Mexico (Alberto et al., 2003;
Martin et al., 2011; Gedik et al., 2016).
The Salvia species are used in traditional folk medicine as herbal tea and food in perfumery, cosmetics and
pharmaceutical industry due to antibacterial, antitumoral, antidiabetic, antiseptic and antioxidant activities
(Alberto et al., 2003; Martin et al., 2011; Gedik et al., 2016; Ben Khedher et al., 2017).
S. virgata Jacq., popularly known as erysipelas, is used as wound healing and spreads naturally in Anatolia. This
species is used against the skin diseases and blood cancer (Bayram et al., 2016). It grows at altitudes from 1 to
2400 m. in all regions of Turkey (Martin et al., 2011).
Karyological studies may contain valuable information for phylogenetic and morphological studies in organisms.
It was reported that genus Salvia had diverse chromosome numbers ranging from 2n = 12 to 2n = 88 (Patudin et
al., 1λ75ν Markova and Ivanova, 1λ8βν Nakipoğlu, 1λλγν Alberto et al., β00γν Martin et al., β011ν Gedik et al.,
2016). Some species of Salvia have 0-γ B chromosome (Nakipoğlu, 1λλγν Alberto et al., β00γν Martin et al.,
2011). B chromosomes are supernumerary or accessory chromosomes, which do not follow Mendelian rules of
inheritance. The purpose of this study is to determine the diploid chromosome number, detailed chromosome
measurements, B chromosomes and karyotype asymmetry of S. virgata.
ORAL PRESENTATION
66
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS AND METHODS
The seeds of S. virgata were collected from in Yozgat (Turkey). The information regarding the collection is
given below.
Salvia virgata – TURKEY. Yozgat: Yozgat-Ankara way, γλ° 48' γ46'' Nν γ4° 46' 408'' E, 1216 m, 05-VII-2017.
The seeds were germinated at room temperature in petri dishes. The root tips were fixed in a fixative solution (3
part glacial acetic acid – 1 part ethanol at β4 h. The roots were stored at 4ºC in ethanol (70%). The samples were
hydrolysed for 10 min at 60ºC in HCl (1N). The samples were stained in aceto-orcein for 2 h and squashed in
acetic acid (45%) (Eroğlu et al., β01γν Martin et al., β015ν Şahin et al., β016ν Altay et al., 2017).
Karyotypes were determined using KaryoType software on a personal computer (Altınordu et al., β016). The
long arm length (L), short arm length (S), total chromosome length (TCL = L + S), arm ratio (L/S), centromeric
index (CI = S/[L + S] × 100) were measured. The karyotype formula was determined using the nomenclature of
Levan et al. (1964).
For analysis of karyotype asymmetry, two known methods were used. Peruzzi and Eroğlu (β01γ) reported the
MCA parameter for intrachromosomal asymmetry index, as shown in Eqs. (1) - (2) below.
A=
�−�
�+�
�
MCA = A × 100
(2)
Paszko (2006) reported that the CVCL parameters for interchromosomal asymmetry index, as shown in Eqs. (3) (4) below.
A =
�
��
�
������
ℎ � � �
��ℎ
CVCL = Aβ × 100
(4)
3. RESULTS
The metaphase chromosomes, monoploid ideogram and chromosomal measurement data are given in Figure 1AB, Figure 2 and Table 1, respectively. Karyotype formula, ploidy level, MCA and CVCL are given in Table 2. The
measurement reports showed that the diploid chromosome number is 2n = 32 + 0-2B in S. virgata. The
karyotype formula is 2n = 4x = 32 = 24m + 6sm + 2st. All chromosomes are almost median type outside
submedian chromosomes 12, 15, 16 and subtelocentric chromosome 13. In the chromosomes, no satellite was
observed.
The length of chromosomes varied from 0.56 to 1.65µm. Total haploid length and mean haploid length are 18.10
and 1.1γ ηm, respectively. The centromeric index values varied from 1λ.54 to 48.57. A centromere with median
zone has low centromeric index, unlike a centromere with telocentric zone has high centromeric index.
The intrachromosomal asymmetry value (M CA) and interchromosomal asymmetry value (CVCL) are 20.28 and
28.68, respectively. The values of MCA and CVCL increase up to 100 with centromeric shift. This value refers to
the most asymmetrical karyotype. Unlike the values of M CA and CVCL can be at least zero. This value refers to
the most symmetrical karyotype. The karyotype of S. virgata close to symmetric type.
ORAL PRESENTATION
67
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure1. Metaphase chromosomes of Salvia virgata: (A) 2n = 32 + 2B (arrowhead) (B) 2n = 32
Figure 2. Monoploid ideogram of Salvia virgata
4. DISCUSSION
The results showed that the chromosome number is 2n = 32 and basic chromosome number is x = 8 in S. virgata.
The Salvia species have the different levels of ploidy as x = 7, 8, 9, 10, 11, 13 (Alberto et al., 2003; Martin et al.,
2011). It was reported that the diploid chromosome numbers are 2n = 16 (Markova and Ivanova, 1982;
Nakipoğlu, 1λλγ) and βn = 32 (Patudin et al., 1975; Martin et al., 2011) in S. virgata. In this study, the detailed
chromosome measurements of S. virgata were given for the first time.
B chromosomes, which are also known as supernumerary chromosomes, are a major source of intraspecific
variation in nuclear DNA. In natural plant populations, B chromosomes support large genomes and cause DNA
polymorphisms (Jones et al., 2008). The B chromosomes have been observed in Salvia species (Nakipoğlu,
1993; Alberto et al., 2003; Martin et al., 2011). In this study, we observed B chromosomes in S. virgata (Figure
1A), which is the first report of S. virgata.
Karyotype asymmetry was determined by using MCA (intrachromosomal) and CVCL (interchromosomal)
methods. Acoording to the MCA and CVCL values, the karyotype of S. virgata close to symmetric type.
ORAL PRESENTATION
68
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 1. The measurement data of chromosomes of Salvia virgata
Chromosome
L/S
CI
TCL
L
S
Chromosome
Pair
(μm)
(μm)
(μm)
Type
1
1.65
1.04
0.61
1.70
m
36.97
2
1.60
0.88
0.72
1.22
m
45.00
3
1.40
0.72
0.68
1.06
m
48.57
4
1.37
0.80
0.57
1.40
m
41.61
5
1.35
0.78
0.57
1.37
m
42.22
6
1.30
0.69
0.61
1.13
m
46.92
7
1.18
0.66
0.52
1.27
m
44.07
8
1.17
0.62
0.55
1.13
m
47.01
9
1.12
0.63
0.49
1.29
m
43.75
10
1.10
0.62
0.48
1.29
m
43.64
11
1.08
0.57
0.51
1.12
m
47.22
12
1.05
0.68
0.37
1.84
sm
35.24
13
0.87
0.70
0.17
4.12
st
19.54
14
0.73
0.43
0.30
1.43
m
41.10
15
0.57
0.42
0.15
2.80
sm
26.32
16
0.56
0.40
0.16
2.50
sm
28.57
Abbreviations: total chromosome length (TCL), long arm length (L), short arm length (S), arm ratio (L/S),
centromeric index (CI), median (m), submedian (sm), subterminal (st)
Table 2. The karyotype formula, ploidy level and asymmetry values of Salvia virgata
Karyotype formula
Ploidy level
MCA
CVCL
2n = 32 + 0-2B
24m + 6sm + 2st
4x
20.28
28.68
5. CONCLUSION
As a result, detailed chromosome measurements and 0-2B chromosomes of S. virgata were showed for the first
time. The species has small chromosomes between 0.56-1.65 µm shaped median, submedian and
subterminal. The chromosomal can support morphological characters. The genus Salvia has many taxa
unknown detailed chromosomal data. More chromosomal data are needed to contribute to the
cytotaxonomy of Salvia.
ACKNOWLEDGEMENTS
This work was financially supported by Scientific Research Projects Fund of Bozok University (Project No:
6602A-ZF/17-75).
REFERENCES
Alberto CM, Sanso AM, Xifreda CC 2003. Chromosomal studies in species of Salvia (Lamiaceae) from
Argentina. Botanical Journal of the Linnean Society, 141: 483-490.
Altay D, Eroğlu HE, Hamzaoğlu E, Koç M β017. Karyotype analysis of some taxa of Dianthus section
Verruculosi (Caryophyllaceae, Sileneae). Turkish Journal of Botany, 41: 367-374.
Altınordu F, Peruzzi L, Yu Y, He XJ β016. A tool for the analysis of chromosomesμ KaryoType. Taxon, 65μ 586592.
ORAL PRESENTATION
69
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Bayram M, Yılar M, Özgöz E, Kadıoğlu İ β016. Ada Çayı (Salvia virgata Jacg.) tohumlarının bazı fiziksel
özelliklerinin belirlenmesi. Nevşehir Bilim ve Teknoloji Dergisi, 5: 325-331.
Ben Khedher MR, Ben Khedher S, Chaieb I, Tounsi S, Hammami M 2017. Chemical composition and biological
activities of Salvia officinalis essential oil from Tunisia. EXCLI Journal,16: 160-173.
Eroğlu HE, Şimşek N, Koç M, Hamzaoğlu E β01γ. Karyotype analysis of some Minuartia L. (Caryophyllaceae)
taxa. Plant Systematics and Evolution, 299: 67-73.
Gedik O, Kıran Y, Emre İ, Kürşat M β016. Karyological notes for seven Salvia L. taxa grown in Turkey.
Cytologia, 81: 395-402.
Jones RN, Viegas W, Houben A 2008. A century of B chromosomes in plants: so what? Annals of Botany, 101:
767-775.
Levan AK, Fredga K, Sandberg AA 1964. Nomenclature for centromeric position on chromosomes. Hereditas,
52: 201-220.
Markova ML, Ivanova PS 1982. Karyological study of the genus Salvia L. in Bulgaria. Filologija (Sofia), 20: 319.
Martin E, Çetin Ö, Kahraman A, Celep F, Doğan M β011. A cytomorphological study in some taxa of the genus
Salvia L. (Lamiaceae). Caryologia,64: 272-287.
Martin E, Karaman SE, Aytaç Z β015. Karyological studies on Oxytropis (Fabaceae) from Turkey. Caryologia,
68: 357-362.
Nakipoğlu M 1λλγ. Türkiye'nin Salvia L. türleri üzerinde karyolojik araştırmalar II. S. viridis L., S. glutinosa L.,
S. virgata Jacq., S. verbenaca L., S. argentea L. Türk Botanik Dergisi, 17μ 157-161.
Patudin AV, Yurtsev VN, Pakaln DA 1975. Chromosome number in some species of Salvia L. (Lamiaceae).
Botaničeskii Žhurnal (Moscow & Leningrad), 60μ 5βλ-534.
Paszko B 2006. A critical review and a new proposal of karyotype asymmetry indices. Plant Systematics and
Evolution, 258: 39-48.
Peruzzi L, Eroğlu HE β01γ. Karyotype asymmetryμ again, how to measure and what to measure? Comparative
Cytogenetics, 7: 1-9.
Şahin E, Eroğlu HE, Hamzaoğlu E, Koç M β016. Karyotype analysis of four species of Dianthus section
Fimbriati (Caryophyllaceae, Sileneae). Caryologia, 69: 267-272.
ORAL PRESENTATION
70
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Kentsel Çevrelerdeki Biyoçeşitlilik Çalışmaları
Meryem Bingül Türk*, Salih Doğan
Erzincan Üniversitesi, Fen Edebiyat Fakültesi, Biyoloji Bölümü, Erzincan, Türkiye
Sorumlu yazar e-mail: mbingul@erzincan.edu.tr
Özet
Yaşam alanları olarak kentler birer insan ekosistemleridir. Kentler, insanların toplu ve sosyal yaşam isteğine
bağlı olarak oluşan bir yaşam biçimi ve mekânı olarak kabul edilmektedir. Kentlerin yaşanabilir olmasında göz
ardı edilemeyen unsurdan birisi de biyoçeşitliliktir. Kent içerisinde yer alan bitki ve hayvan türlerinin sayıca
zenginliği ve bolluğu, o kentin biyolojik çeşitliliği olarak değerlendirilir. Günümüzde, sürdürülebilir nitelikte
kent ekosistemlerinin geliştirilmesi ve koruma bilincinin oluşturulması için kentlerin biyolojik çeşitliliğinin
belirlenmesi gerekmektedir. Bu çalışmada, kentsel biyoçeşitliliğe dayalı araştırmalar irdelenmiştir. Yapılan
literatür taraması sonucunda kentsel çevrelerdeki biyoçeşitlilik çalışmalarının belli organizma grupları ile sınırlı
kaldığı ve bu çalışmaların az sayıda olduğu ortaya konmuştur. Kentsel ekosistem özelliği taşıyan çevrelerdeki
biyolojik çeşitliliğinin ortaya çıkarılarak, yerel biyolojik zenginliği desteklemek ve sürdürülebilir yaşam alanları
oluşturmak amacıyla bu konudaki çalışmalara hız verilmesi gerektiği düşünülmektedir. Kentsel çevreler nesli
tehlike altında olan çok sayıda türü içlerinde barındırabilmektedir. Günümüzde dünya nüfusunun yarıdan fazlası
şehirlerde yaşamaktadır ve gelecekte bu oranın daha da artacağı düşünüldüğünde kentsel yaşam alanlarının
önemi daha da artacaktır.
Anahtar Kelimeler: Biyoçeşitlilik, Çeşitlilik Kaybı, Kent, Yaşam Alanı.
1. GİRİŞ
Kentler yaşam alanı olarak, doğal ve kültürel birçok ögenin etkileşim içinde olduğu insan ekosistemleridir
(Karadağ, β00λ). Uygarlık tarihinin başlangıcı olarak kabul edilen kentsel mekânlar, insanların toplu veya sosyal
yaşam isteğini ortaya koyan bir yaşam şekli ve mekânı olarak değerlendirilmektedir (Gül ve Küçük, β001).
Kentsel yeşil alanlar, kente estetik kazandırıp değer katan, doğru kullanıldığı zaman kente kimlik kazandırıp
karakterini ve yaşanabilirliğini etkileyen önemli yerlerdir. Kentsel çevreler, yarı doğal habitatlardan, açık
alanlara, parklara ve insanlardan yoğun şekilde etkilenen çevrelere kadar değişen birçok doğal alanı barındır
(Atabeyoğlu ve Bulut, β01βν Bingül ve ark., 2016).
Bir kentin genel karakterini, mimari yapıları, açık-yeşil alanları, bunların etkileşimi ve bütünlüğü belirler. İnsan
ve doğa arasındaki bozulan ilişkileri dengelemede ve kentsel yaşam şartlarının iyileştirilmesinde açık-yeşil
alanların önemli bir yeri vardır (Gül ve Küçük, β001). Biyoçeşitlilik, kentlerin yaşanabilir olmasında görmezden
gelinmesi mümkün olmayan unsurlardan birisidir. Kent içerisinde yer alan bitki ve hayvan çeşitliliği ve bolluğu,
o kentin biyolojik çeşitliliği hakkında bilgi vermektedir. Günümüzde, etkin yeşil alan ve tabiattan yoksun olan
kentlerdeki sınırlı sayı ve çeşitteki bitki ve hayvan varlığı, hızlı nüfus artışı, kirlilik ve kentleşmenin neden
olduğu diğer çevre sorunları nedeniyle olumsuz etkilenmektedir (Uslu ve Shakouri, 2013).
Biyoçeşitlilik, genetik olarak farklı olan ve değişik işlevlere sahip canlı türlerinden oluşan, çeşitli ekosistemlere
dağılmış, sayı ve tür bakımından zengin canlı topluluklarının oluşturduğu yaşam dünyalarıdır. Çevremizde var
olan çeşitlilik bir değişimin sonucudur ve bu değişim γ,β milyar yıldan beri devam etmektedir (Doğan ve ark.,
2010). Bu ekolojik miras üzerinde insanoğlunun çok fazla olumsuz etkisi vardır. Öyle kiν son β00 yıl içerisinde
yok olan tür sayısı, 65 milyon yıl öncekine kıyasla çok daha fazla olmuştur. Kentsel yeşil alanlarda
biyoçeşitliliğin desteklenmesi kentlerin ekolojik kalitelerinin gelişmesini sağlamaktadır (Uslu ve Shakouri,
2013).
Kentsel alanlar hızlı nüfus artışına bağlı olarak hızla genişlemektedir. Bu kentsel genişleme, doğal kaynakları
büyük oranda etkilemekte ve başlıca tarım arazilerini tüketmekte, dolayısıyla ekosistemleri ve biyoçeşitliliği
olumsuz yönde etkilemektedir (Pouya ve Pouya, 2017). Kentsel gelişimim biyoçeşitlilik üzerindeki en büyük
ORAL PRESENTATION
71
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
etkisi, yaşam ortamları üzerinedir. Kentleşme nedeniyle doğal vejetasyonun yok olması, egzotik türlerin
yaygınlaşması, doğal mekânların kaybı veya parçalanması ya da izole edilmesi, birçok canlının yaşam
ortamlarına olan zararlardır (Uslu ve Shakouri, β01γ). Kentleşmenin en büyük sorunlarından birisi habitat
parçalanmasıdır. Habitat parçalanması, genellikle habitat kaybı ve habitatın başka bir yere ayrılmasını kapsayan
geniş arazi ölçeğindeki oluşum olarak tanımlanmaktadır. Bugüne kadar yapılan çalışmalar habitat kaybının
biyolojik çeşitlilik üzerinde sürekli olarak olumsuz etki yaptığını ortaya konmuştur (Karakaş, β017).
Kentsel Biyoçeşitlilik İle İlgili Çalışmalar
Günümüzde küresel iklim değişikliği, çevre kirliliği, doğal habitatların hızla bozulması ve yok olması, ekonomik
yönü olan türlerin aşırı kullanımı ve istenmeyenlerin yok edilmesi gibi nedenlerle canlılık dünyası ciddi tehdit
altında bulunmaktadır. Bazı doğaseverler insanoğlunun geçmişte gerçekleşen yok oluşlara eşit düzeyde kitlesel
yok oluşa neden olduğunu söylemektedir. Diğer bazıları, bu süreci tersine çevirmek için bir şeyler yapılmazsa
insanoğlu ile beraber diğer tüm canlıların yok olacağını, dünyada yaşamın sonunun geldiği öngörüsünde
bulunmakta tereddüt etmezler (Lévêque ve Mounolou, β008). Bu nedenle, biyoçeşitliliğin belirlenmesi,
izlenmesi ve koruma altına alınarak gelecek nesillere bir miras olarak bırakılması önem taşımaktadır (Bingül ve
ark., 2016).
Ülkeler için doğal ortam özelliklerinin ve bu doğal ortamların barındırdıkları biyolojik zenginliklerin
belirlenmesi ve bunlar ile insanlar arasındaki etkileşimin açıklanması son derece önem arz etmektedir.
Dolayısıyla biyolojik zenginliklerin tespiti öncelikli konular arasında yer almaktadır. Zenginlik, aslında hangi
boyutlarda sahip olunduğunun farkına varılarak, sürdürülebilir kılınmasına bağlıdır. Bu nedenle, her ülke kendi
biyolojik zenginliğini belirlemek ve korumak zorundadır (Bingül ve ark., 2016). Aşağıda yurt içi ve dışında
yapılmış kentsel biyoçeşitlilik çalışmaları kronolojik sırayla sunulmuştur.
Savard vd. (2000), çalışmalarını kuşlarla sınırlı tutarak biyoçeşitlilik ve kentsel ekosistemler üzerinde durmuştur.
Mckinney (2002), kentsel gelişmenin yerel ekosistemlere nasıl zarar verdiğini değerlendirmiş ve bunu iki şekilde
açıklamıştır. Birincisi, doğal habitat alanlarının korunması gerektiğiν ikincisi ise ekolojik olarak toplum bilincini
geliştirmeye yönelik hizmetler verilmesi gerektiğini savunmuştur.
Mckinney (β008), kentleşmenin bitki ve hayvanlar üzerindeki etkilerini araştırmış ve sonuçta tür zenginliğinin
aşırı şehirleşmeye sahip alanlarda yani kent merkezlerinde düşük olduğunu ancak kırsal çevrelerde anlamlı
farklılıklar gösterdiğini belirlemiştir.
Goddard vd. (2009), kentsel biyolojik çeşitliliği artırmak için yeşil alanların yönetiminden ve arazi
kullanımlarından bahsetmiş ve uygun ölçekte bahçe ve yönetimlerinin nasıl olması gerektiğini açıklamıştır.
Strohbach vd. (β00λ), Almanya’daki kuş çeşitliliğini nüfus yoğunluğu, hane halkı geliri, işsizlik ve kentsel yeşil
alanlar gibi çeşitli açılardan açıklamaya çalışmış ve yüksek statüye sahip semtlerde, orman kalıntıları, parklar ve
nehir boyunca daha yoğun olduklarını ortaya çıkarmışlar ve bu türlerin geleceği açısından zengin yeşil alanların
korunması gerektiğini savunmuşlardır.
Kowarik (β011), biyoçeşitliliğin kentleşme üzerindeki etkisi ve farklı koruma yaklaşımları üzerinde durmuş ve
kentsel ekosistemlerin tüm farklılıklarını dikkate alarak incelemiştir.
Barrico vd. (β01β) tarafından yapılan çalışmada, Portekiz’in Coimbra kentindeki vasküler bitki ve makromiset
çeşitliliği araştırılmış ve sonuçta bitkilerden β87, makromisetlerden λ6 takson kaydedilmiştir.
Bennett ve Lovell (β014) tarafından hem çim hem de çayırlık alana sahip altı Şikago parkında yararlı
eklembacaklı türleri (avcı hayvanlar ve arılar) ve avcılık faaliyetleri karşılaştırılmıştır. Çalışmada arıların
bolluğunun, Ağustos ayına kadar çimene kıyasla çayırda önemli ölçüde daha yüksek ve yaz boyunca avcılığının
daha yüksek olduğu tespit edilmiştir. Yırtıcılık hizmetlerinin Haziran ayında çim ve çayır arasında belirgin bir
farklılık göstermezken, yaz mevsiminde çayırda sürekli artarak Ağustos ayına kadar belirgin olduğu
belirtilmiştir. Kentlerdeki çim sahası ve çayırlık alanların eklembacaklı bolluğunu ve ekosistem hizmetlerini
desteklediği tespit edilmiştir.
Doğan vd. (β015), Amsterdam şehir merkezindeki Flevopark’tan topladıkları oribatid akar türlerini
değerlendirmiş ve 1β akar türü kaydetmiştir.
ORAL PRESENTATION
72
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Carrus vd. (2015), Bari, Floransa, Roma ve Padua’da kent içi ve çevresindeki yeşil alanların biyolojik çeşitliliğe
etkilerini araştırmış ve insanların refahı için böyle alanların daha fazla korunması gerektiği sonucuna
varmışlardır.
Akimov ve Nebogatkin (β016), kentsel peyzaj alanlarındaki sert keneler ile ilgili çalışmaların tarihini gözden
geçirerek bir derleme yapmışlar ve sonuçta 68 ülke ve 7λγ şehirdeki kenelerle ilgili çalışmaları bibiliyografik
olarak sunmuşlardır.
Gunnarsson vd. (β017) biyoçeşitlilik ve çevreyle ilgili tutumların kentsel yeşil alanın görsel ve işitsel
algılamalara etkilerini araştırmıştır. Çalışmayı kapsamında araştırmacılar İsveç’in Göteborg kentinde yüksek,
orta ve düşük olmak üzere üç biyoçeşitlilik kategorisi oluşturmuş ve çalışmayı altı alanda yürütmüşlerdir. Hane
halklarına kentsel yeşil alanın estetik algısı, ses algısı ve kuş türlerinin algılanmasında ağaçların ve bitkilerin
önemi üzerine anket yapmış ve çevreyle ilgili tutumların yeşil alan algılamalarını etkilediği sonucuna
varmışlardır.
Borysiak vd. (β017) Polonya'nın Poznań kentindeki bahçelerinin doğal vasküler florasını değerlendirerek tür
çeşitliliğini belirlemeye çalışmıştır. Çalışmada hisseli bahçelerin kentsel yeşil altyapı içindeki özel konumu
ortaya çıkarılarak kullanıcıların yerel biyoçeşitliliği şekillendirmedeki rolü araştırılmıştır. Çalışma kapsamında
11 tahsisli bahçe mülkünden 358 doğal bitki türü kaydetmiştir.
Gallo vd. (β017) kentsel yeşil alanların, yaban hayatı yaşam alanı olarak nasıl işlev gördüğünü değerlendirmek
için ABD’nin Illinois eyaletine bağlı Şikago bölgesi boyunca şehir parkları, mezarlıklar, golf sahaları ve doğal
alanlardaki memelilerin çeşitliliği ve kommunite dinamiklerini tahmin etmeye çalışmıştır. Sonucunda kentsel
yeşil alanların, şehirlerde biyolojik çeşitliliğin korunması ve sürdürülebilirliği için farklı katkılar sağladığını ve
kolektif etkili önemli habitatlar oluşturduğunu belirtmiştir.
Xu vd. (β018) Çin Şanghay'daki Yeni Jiangwan yerleşim yerinde, β00β yılından β01γ yılına kadar olan arazi
örtüsü verileri ve kuş kayıtlarını toplamış ve analiz etmiştir. Kentsel gelişim nedeniyle çalılık ve sulak alanların
β01γ sonuna kadar sırasıyla % 87,γ ve % 8β,4 oranında düştüğünü ortaya koymuş ve sonuç olarak habitat kaybı
ve parçalanmasının kuşların çeşitlilik üzerindeki etkilerinin değişik kuş popülasyonlarında farklılık gösterdiğini
saptamışlardır.
Ülkemizdeki kentsel biyoçeşitlilik çalışmalara bakıldığındaν Alaoğlu (1λ84) Erzurum ve Erzincan’daki meyve
ağaçları ve asmalar başta olmak üzere diğer ağaç ve çalılardan eriophyoid akarları belirlemiş ve sonucunda
Eriophyidae familyasından 17 tür, Rhncaphytoptidae familyasından ise 1 tür tespit etmiştir.
Zengin (2001), Erzincan ilinin açık ve yeşil alanlarını incelemiş, bu alanların erişilebilirlikleri, niteliksel ve
niceliksel özelliklerini irdelemiş ve sonucunda kent için uygun açık ve yeşil alan sistemi önermiştir.
Ortaçeşme vd. (β005) tarafından Antalya ilinde, Büyükşehir Belediyesi ve alt belediyeler olan Muratpaşa, Kepez
ve Konyaaltı belediyeleri düzeyinde aktif yeşil alanların mevcut durumu araştırılmış ve kent genelinde γλγ aktif
yeşil alanın varlığı saptanmıştır.
Doygun ve Ok (β006) ve Kahramanmaraş kentinin açık-yeşil alanlarının ağaçlandırma çalışmalarını
değerlendirmiş ve bu konuda öneriler sunmuştur. Yine Sandal ve Karademir (β01γ) Kahramanmaraş’ta yeşil
alanların yeterliliği ile halkın beklentilerinin ve bilinç düzeylerinin belirlenmesine yönelik çalışmalar
yürütmüştür.
Acar vd. (β007) Trabzon’un peyzaj alanlarındaki bitki türlerinin dağılımına bakıp bunlara ilişkin sayısal verileri
kaydetmişlerdir.
Avcı (β008) ve (2014) İstanbul’u doğal bitki örtüsü ve faunistik özellikleri bakımından değerlendirmiş ve
İstanbul’un doğal alanlarını tehdit eden en önemli unsurun beşerь faktörler olduğunu ortaya koymuştur.
Uslu ve Shakouri (β01γ), kentsel alanlarda biyolojik çeşitliliği destekleyen, kent ekolojisini zenginleştiren peyzaj
tasarım araçlarını açıklamış ve bu maksatla yapılan projeleri, uygulamaları ve yöntemleri irdelemiştir.
Yeşilayer ve Çobanoğlu (β01γ), İstanbul’da park ve süs bitkilerinden toplanan rafignathoid akarları
değerlendirmiş ve iki familyaya ait 7 tür tespit etmişlerdir.
ORAL PRESENTATION
73
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Selim vd. (2015) kentsel alanlardaki biyoçeşitliliği destekleyici olanakları tartışmış, koruma ve kullanma
dengesini sağlamaya yönelik öneriler sunmuştur. Çalışmada, kentlerde biyoçeşitliliğin devamlılığı için öncelikle
nadir ve endemik türlere yönelik koruma yaklaşımlarının uygulanması, kentsel arazi kullanımlarının
belirlenmesinde ekolojik odaklı yaklaşımların geliştirilmesi, yeşil altyapı sistemlerinin tasarlanması gibi
uygulamaların gerekliliği üzerinde durulmuştur.
Bursalı ve Keskin (β016) tarafından yapılan çalışmada Erzincan il genelinde 16 kene türünün varlığı rapor
edilmiştir.
Bingül vd. (β016) ve Doğan vd. (β016) Erzincan il merkezinde kent yaşamına uyum sağlamış olan bazı akar
türlerini CBS ile analiz etmiş, konuma dayalı analiz tekniklerini kullanarak kent merkezindeki familya ve tür
seviyesindeki dağılışlarını dijital haritalar üzerinde göstermiş ve farklı habitatların barındırdığı akar çeşitliliğini
ortaya çıkarmıştır.
Bingül vd. (β017) kent yenileme faaliyetlerinin arttığı Erzincan şehir merkezinden akarlar için uygun yaşam
alanlarından toprak, döküntü ve yosun numuneleri almış ve Oribatida içerisinde yer alan β0 familyaya ait toplam
β5 akar türünü belirlemiştir. Bunlardan iki oribatid türünü Türkiye akar faunası için yeni kayıt olarak belirlemiş
ve mevcut çalışmada bu türlerin kısa tanımlarını yapıp, dünyadaki dağılımlarına yer vermiştir.
Çalışkan vd. (β017) Mersin ili park ve peyzaj alanlarında bulunan süs bitkilerindeki unlubit (Hemipteraμ
Pseudococcidae) türlerini saptamayı amaçlamış ve çalışma sonucunda toplanan 108 örnekten β cinse ait 4 tür
tespit etmiştir.
Ayalp (β017), birinci derecede arkeolojik sit kategorisine giren Küçükyalı Arkeopark’ın (İstanbul) doğal
florasını incelemiş, 4λ familyaya ait 14β cins içinde β08 damarlı bitki ile 16 kültür/egzotik türü olmak üzere
toplam ββ4 takson tespit etmiştir.
Sever Mutlu vd. (2017), Antalya ilinin bazı ana yol güzergâhlarındaki ağaç çeşitliliğini belirleyerek, yürütülen
ağaçlandırma faaliyetlerini değerlendirmişler ve bu faaliyetlerden sorumlu kent ormancıları ve belediye
çalışanlarına önerilerde bulunmuşlardır.
Yücekaya ve Kocatürk (β017) Kilis ili imar planı üzerinde kentsel yeşil alanların büyüklüklerini hesaplayarak,
imar mevzuatında öngörülen standartlara göre niceliksel yeterlilikleri incelemiş, sonraki aşamada, Kilis’te
bulunan 51 parktan belirli bir büyüklüğün üzerinde olan 16 parkı niteliksel ölçütler doğrultusunda incelemiş ve
bu parklar arasından seçilen γ parkta anket uygulaması yapmışlardır. Bu doğrultuda, niceliksel
değerlendirmelerde, Kilis’te kişi başına yeşil alan miktarının γ,71 m2 düştüğünü, bu değerin imar mevzuatında
belirtilen kişi başına düşen 10 m2 yeşil alan standardının çok altında kaldığını belirtmişlerdir. Niteliksel
değerlendirmelerde ise Kilis kentinde parklar ve yeşil alanların, kent makroformu içerisinde dengeli bir dağılım
göstermediğini saptamışlardır. Elde edilen veriler ve yapılan değerlendirmeler birbirleriyle karşılaştırıp,
sentezlenerek Kilis kenti yeşil alanlarının dengeli dağılımı, yapılaşmış çevrelerle bir bütünlük oluşturabilmesi ve
kentin yaşam kalitesini yükseltmesi açısından niteliksel ölçütleri odak noktasına alarak çeşitli öneriler
sunmuşlardır.
Yücesu vd. (β017) Kırklareli kent merkezine ait açık ve yeşil alanları mevcut ve plandaki durumlarıyla analiz
etmişlerdir. Araştırma sonucundaν Kırklareli kent merkezi genelinde kişi başına 1,6 m 2 yeşil alan düştüğü
saptanmış ve bu değerin yürürlükte olan imar mevzuatında öngörülen standardın çok altında olduğunu
belirtmişlerdir. Diğer taraftan, kentsel alanda bulunan 1β mahallenin yeşil alan miktarlarında önemli
değişiklikler saptanmış ve yeşil alanların kentsel alanın tamamında mekânsal dağılımının düzenli olmadığını
belirtmişlerdir. Araştırma ile kentin mevcut açık ve yeşil alan varlığının korunmasına ve iyileştirilmesine dikkat
çekerek kent ve yakın çevresindeki açık ve yeşil alanlarını peyzaj planlama ilkeleri çerçevesinde ele alarak bir
sistem önerisi getirmişlerdir.
Zencirkıran ve Seyidoğlu Akdeniz (β017), Bursa’da dört kent parkın odunsu taksonlarını ekolojik tölerans
kriterlerini dikkate alarak değerlendirmiştir. Araştırmacılar Bursa kent parkları tasarımında kullanılan odunsu
taksonların 5γ familya içerisinde yer aldıklarını tespit etmiş, Reşat Oyal Kültür Parkında 54, Soğanlı Botanik
Parkta 182, Merinos Kent Parkında 4λ, Hüdavendigar Kent Parkında ise 76 odunsu taksonun kullanıldığını
belirtmişlerdir. Çalışmada odunsu bitki taksonları su tüketimleri, ışık istekleri ve ekolojik toleransları yönünden
analiz edilmiş ve sonuçta Reşat Oyal Kültür parkının en eski park olmasına rağmen tüm faktörler bakımından
ORAL PRESENTATION
74
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
uygun tasarım bitkilerinin kullanıldığı, su tüketimleri düşük ve ekolojik töleransı yüksek bitki taksonları dikkate
alınarak tasarlandığı ortaya konmuştur.
Son yıllarda, insanın doğaya olan özlemini gidermek ve kentsel yaşam kalitesini yükseltmek için kentlerde kişi
başına düşen yeşil alan miktarını artırma çabaları kent için önemli bir konu haline gelmiştir. Bu amaçla kentlerde
yeşil alan oluşturmak üzere binaların çatılarını ve duvarları yeşillendirme çalışmaları artmıştır. Yaşayan çatılar
veya ekolojik çatılar olarak da tanımlanan bitkilendirilmiş çatılarν mikroorganizmalar, eklembacaklılar ve kuşlar
için uygun kentsel yaşama alanları oluşturmaktadır. Özellikle Avrupa’da son yıllarda yaygınlaşan yeşil çatıların
biyolojik çeşitliliği üzerine sınırlı sayıda çalışma yapılmıştır. Bu çalışmalarda, yeşil çatıların toprağa göre düşük
olsa da örümcek, akar ve böcek gibi eklembacaklı çeşitliliği barındırdığı ve bu eklembacaklı türlerinin çoğunun
kuraklığa dayanıklı sıçrarkuyruklu ve kserofilik akarlardan oluştuğu bildirilmiştir (Doğan, β00λ).
Schrader ve Böning (β006), Almanya’daki eski ve yeni çatılardan numune alıp, kollembol bolluğu ve türlerini
belirlemeye çalışmış, sonuçta eski çatılarda kollembol yoğunluğunun yeni çatılara oranla daha fazla olduğunu
ortaya koymuştur.
Rumble ve Gange (β01γ), Londra’da 14 ay boyunca yeşil çatılardaki mikro eklembacaklı topluluklarını takip
etmiş ve sonuçta kuraklığa toleranslı kollembol ve kserofillik akarların olduğunu ve toprak biyoçeşitliliğini
desteklemek ve sürdürülebilir yaşam alanları oluşturmak amacıyla, çatılara ve peyzaj çalışmalarına daha dikkat
edilmesi gerektiği sonucuna varmıştır.
2. SONUÇ
Kent çevrelerindeki yaşam koşulları genel olarak nispeten istikrarlıdır ve bu ortamlarda çok sayıda canlı türü
yaşamını sürdürmektedir. Kentsel çevrelerdeki canlı yaşam alanları (habitat)ν ‘domestik, peridomestik ve doğal
alanlar’ olmak üzere üçe ayırılır. Domestik yaşam alanları meskenlerin ve mekânların içi ve kapalı alanlardır.
Yapıların dışı ve çevresi peridomestik yaşam alanlarını kapsar. Kentlerdeki doğal yaşam alanları ise ormanlar ve
nehirler gibi kalıntılardır. Peridomestik habitatlar insan yapımı barınakların ve yapıların çevresi ve civarıdır. Bu
alanlar binaların dış yüzeylerini, çatıları, bahçeleri, çevredeki süs bitkileri ve ağaçlarını, parkları ve insan yapımı
tüm yeşil alanları kapsar. Kentsel biyoçeşitlilik aslında peridomestik ve doğal alanlarda yaşamlarını sürdüren
canlı varlığı ile kent çevrelerindeki farklılıkları ifade etmektedir. Birçok tür kent koşullarına uyum sağlamış
olup, bu yaşam alanlarının fauna bileşenleri arasında kuşlar, kemirgenler, böcekler, örümcekler, akarlar ve
çokayaklılar sayılabilir (Doğan ve ark., β016).
Biyoçeşitliliğin ve kentsel ekosistemlerin sağlığı, doğal, kültürel ve sosyal çevrenin uyum içinde gelişmesiyle
sağlanabilir. Bu sebeple biyolojik unsurlara dair çalışmalar özellikle kentsel çevrelerde önem kazanmaktadır.
Yeşil alanlar estetik açıdan kente katkıda bulundukları gibi birçok canlı için de yaşama alanı olarak hizmet eder.
Günümüzde, kentsel yaşam kalitesini artırmaya yönelik kentsel alanlarda yapılan fiziksel planlama çalışmaları
doğal kaynakları olumsuz etkilemektedir. Doğal ve kültürel süreçlerin sürdürülebilirliği için insanoğlunun
yaşadığı ekosistemler ile uyumlu ve dengeli bir ilişki geliştirmesi gerekmektedir.
Biyoçeşitliliğin önem derecesi ve ağırlığı kişiden kişiye değişse de, özellikle kent merkezinde yaşayan insanların
ruhsal ve duygusal gereksinimlerini karşılamada ve bu gereksinimlerinin sürekliliğinin sağlanmasında önemli bir
unsurdur (Demir, 2009). Günümüzde, sürdürülebilir nitelikte kent ekosistemlerini geliştirme ve koruma
bilincinin oluşması, kentlerin biyolojik çeşitliliğinin belirlenmesini ve korunmasını zorunlu kılmaktadır.
Yapılan literatür taraması sonucunda kentsel çevrelerdeki biyoçeşitlilik çalışmalarının belli organizma grupları
ile sınırlı kaldığı ve bu çalışmaların az sayıda olduğu ortaya konmuştur. Ülkemizde gerçekleştirilen belli
sayıdaki çalışmalar genellikle kentlerdeki açık-yeşil alanların belirlenmesi, ağaçlandırma çalışmaları ve peyzaj
tasarım faaliyetleri üzerinedir. Kentlerdeki hayvan varlığı ve fauna bileşenlerinin tespitine yönelik ise sınırlı
sayıda çalışma bulunmaktadır. Kentsel ekosistem özelliği taşıyan çevrelerdeki biyolojik çeşitliliğinin ortaya
çıkarılarak, yerel biyolojik zenginliği desteklemek ve sürdürülebilir yaşam alanları oluşturmak amacıyla bu
konudaki çalışmalara hız verilmesi gerekmektedir. Kentler, doğal özelliklerini giderek kaybeden çevreler haline
gelmektedir. Günümüzde dünya nüfusunun yarıdan fazlası, ülkemizde ise neredeyse %80’e yakını şehirlerde
yaşamaktadır ve gelecekte bu oranın daha da artacağı düşünüldüğünde kentsel yaşam alanlarının önemi daha da
artacaktır.
ORAL PRESENTATION
75
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
KAYNAKLAR
Acar C, Acar H, Eroğlu E β007. Evaluation of ornamental plant resources to urban biodiversity and cultural
changing: A case study of residential landscapes in Trabzon city (Turkey). Building and Environment, 42:
218-229.
Akimov IA, Nebogatkin IV 2016. Ixodid ticks (Acari: Ixodidae) in urban landscapes (history of research,
Countrıes). Ukrainska Entomofaunistyka, 7 (2): 1-34.
Alaoğlu Ö 1λ84. Erzurum ve Erzincan yörelerindeki bazı bitkilerde bulunan Eriophyoidea (Acarinaμ Actinedida)
akarların sistematiği ve zarar şekli üzerinde çalışmalar. Atatürk Üniversitesi Ziraat Fakültesi Dergisi, 15 (γ4): 1-16.
Atabeyoğlu Ö, Bulut Y β01β. Ordu kenti mevcut yeşil alanlarının değerlendirilmesi. Akademik Ziraat Dergisi, 1
(2): 67-76.
Avcı M β008. Kentsel biyoçeşitlilik açısından bir değerlendirmeμ İstanbul örneği. Urban Ecology and Livable
Cities Syposium, 81-105.
Avcı M β014. Kentsel Biyolojik Çeşitlilik Açısından İstanbul. İstanbul Ormanlarının Sorunları ve Çözüm
Önerileri, Türkiye Ormancılar Derneği Yayınıμ 87-124.
Ayalp Ş β017. Küçükyalı Arkeopark’ta floristik incelemeler. Anadolu Orman Araştırmaları Dergisi, γ (2) 139166.
Barrico L, Azul AM, Morais MC, Coutinho AP, Freitas H, Castro P 2012. Biodiversity in urban ecosystems:
Plants and Macromycetes as indicators for conservation planning in the city of Coimbra (Portugal).
Landscape and Urban Planning, 106: 88-102.
Bennett AB, Lovell ST 2014. A comparison of arthropod abundance and arthropod mediated predation services
in urban green spaces. Insect Conservation and Diversity, 7 (5): 405-412.
Bingül M, Doğan S, Ayyıldız N 2017. Two newly recorded species of oribatid mites (Acari, Oribatida) for the
Turkish fauna from the Erzincan urban center. Ecology 2017 International Symposium, Kayseri, 380.
Bingül M, Doğan S, Dilkaraoğlu S, Kesik OA 2016. Kent akarlarının (Acari) belirlenmesi ve Coğrafi Bilgi
Sistemi (CBS) kullanılarak haritalandırılmasıμ Erzincan Örneği. Uluslararası Erzincan Sempozyumu, 28
Eylül-01 Ekim, Erzincan, 3: 943-954.
Borysiak J, Mizgajski A, Speak A 2017. Floral biodiversity of allotment gardens and its contribution to urban
green infrastructure. Urban Ecosystems, 20 (2): 323-335.
Bursalı A, Keskin A β016. Erzincan ili biyolojik çeşitliliğiμ Kene türleri üzerine bir envanter çalışması.
Uluslararası Erzincan Sempozyumu, Erzincan, kabul edilmiş bildiri.
Çalışkan AF, Ulaşlı B, Ulusoy MR β017. Mersin ili park ve peyzaj alanlarında tespit edilen unlubit (Hemipteraμ
Coccomorphaμ Pseudococcidae) türleri. Türkiye Entomoloji Bülteni, 7 (1): 75-80.
Carrus G, Scopelliti M, Lafortezza R, Colangelo G, Ferrini F, Salbitanoe F, Agrimi M, Portoghesi L, Semenzato
P, Sanesi G 2015. Go greener, feel better? The positive effects of biodiversity on the well-being of
individuals visiting urban and peri-urban green areas. Landscape and Urban Planning, 134: 221-228.
Demir A β00λ. Ekonomik açıdan biyolojik çeşitliliğin önemi. İstanbul Ticaret Üniversitesi Fen Bilimleri Dergisi,
8 (15): 55-68.
Doğan S β00λ. Akaroloji Ders notları. Atatürk Üniversitesi, Kazım Karabekir Eğitim Fakültesi, Erzurum.
Doğan S, Ayyildiz N, Faraji F, Dilkaraoğlu S, Zeytun E, Ersin F β015. Oribatid mites in the Flevopark in
Amsterdam (Acari: Oribatida). Nederlandse Faunistische Mededelingen, 45: 91-96.
Doğan S, Bingül M, Ayyıldız N, Kesik OA β016. An evaluation in terms of urban mite (Acari) diversity: some
mites in peridomestic habitats of Erzincan city (Turkey). 8th Symposium of the European Association of
Acarologists (EURAAC-2016), 11–15 July, Valencia, Spain, 40-41.
Doğan S, Özçelik S, Dolu Ö, Erman O β010. Küresel ısınma ve biyolojik çeşitlilik. İklim Değişikliği ve Çevre,
3: 63-88.
Doygun H, Ok T β006. Kahramanmaraş kenti açık-yeşil alanlarında ağaçlandırma çalışmalarının
değerlendirilmesi ve öneriler. Kahramanmaraş Sütçü İmam Üniversitesi Fen ve Mühendislik Dergisi, λ (β)μ
94-103.
ORAL PRESENTATION
76
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Gallo T, Fidino M, Lehrer EW, Magle SB 2017. Mammal diversity and metacommunity dynamics in urban
green spaces: implications for urban wildlife conservation. Ecological Applications. 27 (8): 2330-2341.
Goddard MA, Dougill AJ, Benton TG 2009. Scaling up from gardens: biodiversity conservation in urban
environments. Trends in Ecology and Evolution, 25 (2): 90-98.
Gül A, Küçük V β001. Kentsel açık-yeşil alanlar ve Isparta kenti örneğinde irdelenmesi. Süleyman Demirel
Üniversitesi Orman Fakültesi Dergisi, Seriμ A, ISSNμ 1γ0β-7085, 2: 27-48.
Gunnarsson B, Knez I, Hedblom M, Ode Sang A 2017. Effects of biodiversity and environment-related attitude
on perception of urban green space. Urban Ecosystems, 20: 37-49.
Karadağ A β00λ. Kentsel ekolojiμ kentsel çevre analizlerinde coğrafi yaklaşım. Ege Coğrafya Dergisi, 18 (1-2):
31-47.
Karakaş T β017. Hızlı kentsel değişimin doğala yakın habitatlara etkisinin değerlendirilmesiμ Ankara ili Bağlıca
ve Yapracık mahallesi örneği. Ormancılık Araştırma Dergisi, 4 (1)μ 77-89.
Kowarik I 2011. Novel urban ecosystems, biodiversity, and Conservation. Environmental Pollution, 159: 19741983.
Mckinney ML 2002. Urbanization, biodiversity, and conservation. BioScience, 52 (10): 883-890.
Mckinney ML 2008. Effects of urbanization on species richness: a review of plants and animals. Urban Ecosyst,
11: 161-176.
Ortaçeşme V, Yıldırım E, Manavoğlu E β005. Kentsel yeşil alan fonksiyonları düzleminde Antalya kenti yeşil
alanlarına bir bakış. Akdeniz Üniversitesi, Ziraat Fakültesi Peyzaj Mimarlığı Bölümü, Antalya.
Pouya S, Pouya S β017. Biyolojik çeşitliliğe ve ekosistem hizmetlerine katkı sağlayan kentsel projeler. Kent
Akademisi. Kent Kültürü ve Yönetimi Hakemli Elektronik Dergi, 10 (3): 306- 322.
Rumble H, Gange AC 2013. Soil microarthropod community dynamics in extensive green roofs. Ecological
Engineering, 57: 197-204.
Sandal EK, Karademir N β01γ. Kahramanmaraş’ta yeşil alanların yeterliliği ile halkın beklentilerinin ve bilinç
düzeyinin belirlenmesi. Doğu Coğrafya Dergisi, 18 (βλ)μ 155-176.
Savard J.-PL, Clergeau P, Mennechez G 2000. Biodiversity concepts and urban ecosystems. Landscape and
Urban Planning, 48: 131-142.
Schrader S, Böning M β006. Soil formation on green roofs and its contribution to urban biodiversity with
emphasis on Collembolans, Pedobiologia, 50: 347-356.
Selim C, Sever Mutlu S, Selim S, β015. Kentsel alanlarda biyolojik çeşitliliğin sürdürülebilirliği ve koruma
yaklaşımları. Türk Bilimsel Derlemeler Dergisi, 8 (1): 38-45.
Sever Mutlu S, Selim C, Ün G β017. Plant biodiversity of urban roadside trees in Antalya, Turkey. Kastamonu
University, Journal of Forestry Faculty, 17 (1): 80-87.
Strohbach MW, Haase D, Kabisch N 2009. Birds and the City: Urban Biodiversity, Land Use, and
Socioeconomics. Ecology and Society, 14 (2): 31.
Uslu A, Shakouri N β01γ. Kentsel peyzajda yeşil altyapı ve biyolojik çeşitliliği destekleyecek olanaklar. Türk
Bilimsel Derlemeler Dergisi, 6 (1): 46-50.
Xu X, Xie Y, Qi K, Luo Z, Wang X 2018. Detecting the response of bird communities and biodiversity to
habitat loss and fragmentation due to urbanization. Science of the Total Environment, 624: 1561-1576.
Yeşilayer A, Çobanoğlu S β01γ. Determination of Raphignathoid mites (Acari: Prostigmata: Raphignathoidea)
ornamental plants of Istanbul (Turkey). Turkish Journal of Entomology, 37 (1): 93-103.
Yücekaya M, Kocatürk F β017. Kilis’te açık yeşil alanlar ve park nitelikler. İnönü Üniversitesi Sanat ve Tasarım
Dergisi, 7 (16): 80-94.
Yücesu Ö, Korkut A, Kiper T β017. Kırklareli kent merkezinin açık ve yeşil alanların analizi ve bir sistem
önerisi. Artium, 5 (β)μ ββ-37.
Zencirkıran M, Seyidoğlu Akdeniz N β017. Bursa kent parkları odunsu bitki taksonlarının ekolojik tölerans
kriterleri açısından değerlendirilmesi. Bartın Orman Fakültesi Dergisi, 1λ (β)μ 11-19.
Zengin M β001. Yeniden yapılanma süreci içerisinde Erzincan kentinin açık-yeşil alanları. Yüksek Lisans Tezi,
Atatürk Üniversitesi, Fen Bilimleri Enstitüsü, 1-140.
ORAL PRESENTATION
77
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Atıksu Arıtma Tesisi Çıkış Sularında Bulunan Kalayın Su Mercimekleri Tarafından
Akümülasyon Kapasitelerinin Araştırılması
Murat Topal1, Erdal Öbek2*, Şule Tatar1, E. Işıl Arslan Topal3
1
Munzur Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Tunceli, Türkiye
2
Fırat Üniversitesi, Mühendislik Fakültesi, Biyomühendislik Bölümü, Elazığ, Türkiye
3
Fırat Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Elazığ, Türkiye
Sorumlu yazar e-mail:eobek@firat.edu.tr
Özet
Bu çalışmada, Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan su mercimeklerinde
(Lemna minor L. ve Lemna gibba L.) kalayın akümülasyonu araştırıldı. Su mercimeklerinden Lemna minor
L. ve Lemna gibba L. İstanbul Üniversitesi Botanik Bahçesinden temin edildi. Temin edilen sucul bitkiler 4
adet reaktöre (üst çapı 50 cm, alt çapı 40 cm, su yüksekliği 1β cm) yerleştirildi. Reaktörlerin ikisine Lemna
minor L., diğer ikisine Lemna gibba L. bitkileri 200 gr olacak şekilde eklendi. Elazığ Belediyesi Atıksu
Arıtma Tesisi çıkış suları reaktörlere yaklaşık 0,0β L/dk olacak şekilde verildi. Bitkili reaktörler 7 gün
boyunca işletildi. Su mercimekleri her gün olmak üzere hasatlandı ve hasatlanan bitkiler ICP- MS (PerkinElmer ELAN 9000) ile analizlendi. Çalışma sonucunda elde edilen verilere göre, Lemna minor L. bitkilerinde
en yüksek kalay konsantrasyonu 6. gün 1,β8±0,06 ppm olarak, en düşük kalay konsantrasyonu 1. gün
0,57±0,0β ppm olarak tespit edildi. Lemna gibba L. bitkilerinde ise en yüksek kalay konsantrasyonu 2. gün
β,λ8±0,14 ppm olarak, en düşük kalay konsantrasyonu 5. gün 1,04±0,05 ppm olarak tespit edildi. Sonuç
olarak, Lemna minor L. ve Lemna gibba L. sucul bitkilerinin atıksu arıtma tesisi çıkış sularında bulunan
kalayı akümüle etme kapasitesine sahip olduğu belirlendi.
Anahtar Kelimeler: Akümülasyon, kalay, Lemna minor L., Lemna gibba L. su mercimeği
1. GİRİŞ
Kalay yumuşak, beyaz, gümüşsü bir metal olup suda çözünmez. Kalay, yiyecek, içecek kutuları ve bunun gibi
malzemelerde kullanılır. Kalay çeşitli bileşikler oluşturmak için diğer kimyasallarla birleşebilen bir metaldir.
Kalay, klor, kükürt veya oksijen ile birleştiğinde inorganik kalay bileşiği olarak adlandırılır. İnorganik kalay
bileşikleri, yerkabuğunda az miktarda bulunurlar. Ayrıca diş macunu, parfüm, sabun, renklendirme maddeleri,
gıda katkı maddeleri ve boyalarda bulunurlar. Kalay, organik kalay bileşiklerini oluşturmak için karbon ile
birleşebilir. Bu bileşikler plastikler, gıda paketleri, plastik borular, zirai ilaçlar, boyalar, odun koruyucuları ve
kemirgen kovucu maddelerin yapımında kullanılır (USHH, β005). Kalay metali yerkabuğunda (kayaçlar, maden
ocakları vb. gibi) bulunmaktadır. Bu nedenle, kalay metali yağışlar ve madencilik faaliyetleri sonucunda yeraltı
ve yerüstü sularına ulaşabilir. Söz konusu su kaynaklarının kullanılması sonucu (içme, sulama ve kullanma suyu
olarak) kalay metali besin zinciri yoluyla canlıların bünyesine taşınır. Yiyeceklerle veya solunum yoluyla kalayı
vücuda almak göz ve cilt tahrişleri, baş ağrısı, mide ağrısı, hastalık ve baş dönmesi, şiddetli terleme, nefes darlığı
ve idrar problemleri gibi akut etkilere neden olabilir. Ayrıca, kalay metali depresyonlar, karaciğer hasarı,
bağışıklık sistemlerinin bozulması, kromozomal hasar, alyuvarların yetersizliği, kızgınlığa neden olan beyin
hasarı, uyku bozuklukları, unutkanlık ve baş ağrısı gibi uzun süreli etkilere de neden olabilir (Niknezhadi ve
Nezamzadeh-Ejhieh, 2017). Farklı endüstrilerde metallerin işlenmesi sonucu açığa çıkan kalay metali ya
doğrudan alıcı ortamlara verilmekte yada kanalizasyon sistemleri vasıtasıyla arıtma tesislerine ulaşmaktadır.
Özellikle, kentsel atıksu arıtma tesislerinde metaller yeterli düzeyde arıtılamadığından çıkış sularında farklı
konsantrasyonlarda bulunabilir. Bu durum, arıtma tesisi çıkış sularında bulunan metallerin ileri arıtma yöntemi
kullanılarak arıtımını gerektirir. Metallerin gideriminde doğal arıtma, adsorpsiyon, iyon değiştirme, membran vb.
gibi arıtma yöntemleri kullanılmaktadır. Doğal arıtma yöntemlerinden biri olan fitoremediasyon teknolojisi,
fiziksel ve kimyasal arıtma yöntemlerine alternatif olarak düşük maliyetli bir yöntem sunar ve çok çeşitli organik
ve inorganik kirleticiler için uygundur (Jiang ve ark., 2015). Fitoremediasyonda değişik sucul bitkiler
kullanılabilir. Bu çalışmada, sucul bitkilerden su mercimekleri (Lemna minor L. ve Lemna gibba L.)
ORAL PRESENTATION
78
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
kullanılmıştır. Su mercimekleri, doğal sularda yaygın olarak bulunan ve ağır metallerin, nutrientlerin,
mikrokirleticlerin gideriminde kullanılan yüzen sucul bitkilerdir. Bu çerçevede, çalışmamızda Elazığ Belediyesi
Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan su mercimeklerinde kalayın akümülasyonu araştırılmıştır.
2. MATERYAL VE METOD
Çalışmamızda materyal olarak kullanılan su mercimeklerinden Lemna minor L. ve Lemna gibba L. İstanbul
Üniversitesi Botanik Bahçesinden temin edildi. Temin edilen sucul bitkiler 4 adet reaktöre (üst çapı 50 cm, alt
çapı 40 cm, su yüksekliği 1β cm) yerleştirildi (Şekil 1). Reaktörlerin ikisine Lemna minor L., diğer ikisine
Lemna gibba L. bitkileri 200 gr olacak şekilde eklendi. Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış suları
reaktörlere yaklaşık 0,0β L/dk olacak şekilde verildi. Bitkili reaktörler 7 gün boyunca işletildi. Su mercimekleri
her gün olmak üzere hasatlandı ve hasatlanan bitkilerde kalay konsantrasyonları ICP- MS (Perkin-Elmer ELAN
9000) ile tespit edildi.
Şekil 1. Çalışmada kullanılan reaktörler
3. BULGULAR ve TARTIŞMA
Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan Lemna minor L.’de tespit edilen kalay
konsantrasyonları Şekil β’de verilmiştir.
Konsantrasyon (ppm)
Lemna minor L.
1,6
1,4
1,2
1
0,8
0,6
0,4
0,2
0
0
1
2
3
4
5
6
7
Zaman (gün)
Şekil β. Lemna minor L.’de tespit edilen kalay konsantrasyonu
Şekil β’ye göre, çalışmanın başlangıcında Lemna minor L.’de tespit edilen kalay konsantrasyonu 0,β±0,01 ppm
düzeyindeydi (0. gün). Lemna minor L.’de en yüksek kalay konsantrasyonu 6. gün 1,β8±0,06 ppm olarak, en
düşük kalay konsantasyonu ise 1. gün 0,57±0,0β ppm olarak tespit edildi. Lemna minor L.’de başlangıç
konsantrasyonu göz önüne alındığında Lemna minor L. tarafından kalayın alımı 1. günden 6. güne kadar arttı ve
6. günden sonra azalmaya başladı.
Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan Lemna gibba L.’da tespit edilen kalay
konsantrasyonları Şekil γ’de verilmiştir.
ORAL PRESENTATION
79
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Konsantrasyon (ppm)
Lemna gibba L.
3,5
3
2,5
2
1,5
1
0,5
0
0
1
2
3
4
5
6
7
Zaman (gün)
Şekil γ. Lemna gibba L.’da tespit edilen kalay konsantrasyonu
Şekil γ değerlendirildiğinde, Lemna gibba L.’da 0. gün kalay konsantrasyonu 0.4±0,0β ppm olarak tespit edildi.
Lemna gibba L.’da en yüksek kalay konsantrasyonu β. gün β,λ8±0,14 ppm olarak, en düşük kalay
konsantasyonu ise 5. gün 1,04±0,05 ppm olarak tespit edildi. Lemna gibba L.’da başlangıç konsantrasyonu göz
önüne alındığında Lemna gibba L. tarafından kalayın alımı 1. günden β. güne kadar arttı, β. günden 5. güne
kadar azaldı ve 6. ve 7. günlerde hemen hemen aynı değerler aldı (1,7γ±0,08 ve 1,8β±0,0λ ppm).
Elazığ Belediyesi Atıksu Arıtma Tesisi çıkış sularına maruz bırakılan Lemna minor L. ve Lemna gibba L.’da
tespit edilen kalay konsantrasyonlarının karşılaştırılması Şekil 4’de verilmiştir.
Lemna minor L.
Lemna gibba L.
Sn Alım Düzeyi (%)
1000
800
600
400
200
0
1
2
3
4
5
6
7
Zaman (gün)
Şekil 4. Sucul bitkilerde kalay alım düzeylerinin karşılaştırılması
Şekil 4’e göre, Lemna minor L.’de tespit edilen kalay konsantrasyonları 4, 5 ve 6. günlerde Lemna gibba L.’den
daha fazla konsantrasyonlardaydı. 1, β, γ ve 7. günlerde ise Lemna gibba L.’da tespit edilen kalay
konsantrasyonları Lemna minor L.’den daha yüksekti.
4. SONUÇ
Atıksu arıtma tesisi çıkış sularına maruz bırakılan sucul bitkilerden Lemna minor L. ve Lemna gibba L. bitkileri
farklı hidrolik bekletme sürelerine göre farklı konsantrasyonlarda kalayı akümüle ettiği tespit edilmiştir. Bu
nedenle, söz konusu sucul bitkilerin atıksu arıtma tesisi çıkış sularının arıtılmasında ileri bir arıtıma yöntemi
olarak kullanılabileceği belirlendi.
ORAL PRESENTATION
80
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
KAYNAKLAR
USHH 2005. Toxicological Profıle for Tin and Tin Compounds. US. Department of Health and Human Servıces
Public Health Service Agency for Toxic Substances and Disease Registry, Atlanta, Georgia, p.426.
Niknezhadi A, Nezamzadeh-Ejhieh A 2017. A novel and sensitive carbon paste electrode with clinoptilolite
nano-particles containing hexadecyltrimethyl ammonium surfactant and dithizone for the voltammetric
determination of Sn(II), Journal of Colloid and Interface Science, 501: 321-329.
Jiang Y, Lei M, Duan L, Longhurst P 2015. Integrating phytoremediation with biomass valorisation and critical
element recovery: A UK contaminated land perspective Biomass and Bioenergy, 83: 328-339.
ORAL PRESENTATION
81
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Koroner Arter Hastalığı, Yaşam Tarzı ve Genetik Faktörler
Songül Budak Diler
Niğde Ömer Halisdemir Üniversitesi, Fen Edebiyat Fakültesi, Biyoteknoloji Bölümü, Niğde, Türkiye
Sorumlu yazar e-mail:budakdiler@gmail.com
Özet
Koroner Arter Hastalığı (KAH), kalp adalesini besleyen ve koroner arterler olarak adlandırılan, atar
damarların daralma veya tıkanması ile kan akımının kısmi ya da tam kesilmesine bağlı olarak ortaya çıkan bir
kalp hastalığıdır. KAH, tüm dünyada ve Türkiye'de ölüm nedenleri arasında ilk sırada yer alması ve bireylerin
sosyal gelişimlerini negatif yönde etkilemesinden dolayı, kompleks bir hastalık olarak genetik araştırmaların
ilgi odağını oluşturmaktadır. Bu hastalığa yol açan risk faktörlerinin başında genetik yatkınlık ve yaşam tarzı
gelmektedir.
Birinci derece yakınlarında KAH olan kişilerin bu hastalığa yakalanma riskinin, diğer bireylere göre daha
fazla olduğu ve bu risk üzerine olumsuz yaşam tarzı da eklendiğinde, hastalığın kaçınılmaz hale geldiği
belirlenmiştir. Bir ailede KAH oluşumunda genetik risk taşıyor olmak için o ailede bir erkek bireyin 55
yaşından önce ya da kadın bireyin 65 yaşından önce kalp krizi geçirmiş olması gerektiği bildirilmektedir.
Ayrıca sigara, beslenme alışkanlığı, tansiyon, şeker hastalığı ve hareketsiz bir yaşam tarzının da hastalığın
oluşumunda genetik yapı ile birlikte etkili olduğu gösterilmiştir. Dolayısıyla bu tip aile gruplarında, genetik
KAH hastalığı olanları tespit edip, çocuklarına veya birinci derce yakınlarına uyarıda bulunmak ve bireylerin
genetik test yaptırmalarını sağlamak önemlidir.
Son yıllarda KAH’a sebep olan genleri ve bu genlerde meydana gelen mutasyonları tespit etmek mümkün
olmakla birlikte, bunlara yönelik tedavi edici teknoloji henüz gelişme aşamasındadır. Günümüzde, hastalığa
sebep olan genleri engelleme teknolojisi olmasa da, bu genler erken teşhis edilerek, bireylerin yaşama şansı
ve kalitesi artırılmaya çalışılmaktadır.
Koroner arter hastalığı en önemli ölüm nedenleri arasında bulunmakla birlikte, genetik çalışmaları diğer
hastalıkların gerisinde kalmaktadır. Bu derleme çalışması ile son zamanlarda kaydedilen genetik faktörlerdeki
gelişmelerin gözden geçirilmesi hedeflenmiştir.
Anahtar Kelimeler: Koroner Arter Hastalığı (KAH), genetik faktörler, mutasyonlar.
1. GİRİŞ
Koroner Arter Hastalığı (KAH), gelişmiş ülkelerde önde gelen ölüm nedenleri arasında ilk sırada yer almaktadır.
Ayrıca KAH risk faktörlerine maruziyetin artması nedeniyle gelişmekte olan ülkelerde de KAH prevalansının
hızla arttığı bildirilmiştir. KAH, birden fazla genetik faktörün, çevresel faktörlerin ve bu faktörler arasındaki
etkileşimlerin neden olduğu düşünülen, en yaygın kalp hastalığıdır (Weng ve ark., 2005). Bu genetik ve çevresel
faktörlerin (özellikle yaşam tarzının) tanımlanması KAH'ın önlenmesi ve kontrolü için değerli bilgiler
sağlayacaktır (Wang, β005a). Genetik çalışmalar, KAH’ın patogenezinde yeni fikirler ortaya koymaktadır.
Gelecekteki çalışmalar, hastalık yapan yeni genlerin ve duyarlılık genlerinin tanımlanması, KAH’a neden olan
mutasyonların moleküler mekanizmaların araştırılması ve hastalar için gen spesifik tedavilere odaklanacaktı
(Wang, 2005b).
KAH’ın, kalp adalesini besleyen ve koroner arterler olarak adlandırılan, atar damarların daralma veya tıkanması
ile kan akımının kısmi ya da tam kesilmesine bağlı olarak ortaya çıktığı ve nedeni de halk arasında damar sertliği
olarak bilinen "ateroskleroz" olduğu bilinmektedir. Koroner aterosklerozun, iskemik kalp hastalığına yol
açabileceği ve arteryal lezyonlara trombus eklendiğinde, iskemik kalp hastalığının en ağır formu olan miyokard
enfarktüsü (ME) gelişebileceği rapor edilmiştir (Ercan ve ark., β00β).
Bu çalışmada, sanayileşmiş toplumlarda ölümlerin bir numaralı nedeni olan KAH’ın, bu güne kadar araştırılmış
genetik alt yapısının derlenmesi hedeflenmiştir.
ORAL PRESENTATION
82
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
1.1 KAH Kimlerde Görülür?
KAH çeşitli etkenlere bağlı olarak özellikle aile hikayesi olan bireylerde genç yaşlarda başlar ve bu hastalığa ait
bulgular genellikle 40 yaş sonrasında görülür. Türkiye’de yılda, γ7 yaş ve üzeri yetişkin bireylerden yaklaşık
γ40 bin kişinin KAH sebebiyle hayatını kaybettiği ve 400–4β0 bin kişiye ise yeni KAH tanısı konduğu tespit
edilmiştir (Onat ve ark., 2014; Kasapoğlu ve Enç, 2017). KAH’ın erkeklerde, kadınlara göre yaklaşık dört kat
daha fazla görülmesi, kadınlardaki östrojen hormonunun bu hastalık açısından koruyucu olduğu yönündedir. Bu
nedenle kadınlarda görülme sıklığının östrojen hormonunun azaldığı menopoz sonrası dönemde arttığı tespit
edilmiştir. KAH tanısı sıklıkla erkeklerde 50-60 yaşları arasında, kadınlarda ise 60-70 yaşları arasında
konulmaktadır (Cassar ve ark., 2009).
Ani kalp ölümlerinin % 80'inden fazlasının aterosklerotik KAH’dan, kalan vakaların % 20'sinin ise
kardiyomiyopati, sol ventrikül hipertrofisi, aort kapak hastalığı ve diğer kardiyak bozukluklardan kaynaklandığı
belirlenmiştir (Wang β005b).
1.2 KAH İçin Risk Faktörleri
Risk faktörlerinin tanımlanması ve bunların tedavi edilmesi, belirlenmiş hastalığı olan bireylerde tekrarlayan
olayların önlenmesi önemlidir. Klinik ve popülasyon temelli çalışmalar, genetik faktörlerin KAH ve ME’de
önemli roller oynadığını göstermiştir. 1λγ0'ların başında, KAH'ın bir genetik bileşeni ve bunun kolesterol ile
olan ilişkisi hakkında erken ipuçları sağladığı rapor edilmiş ve aile kümelenme olgusu da, 1950'lerde ve
1λ60'larda araştırılmıştır. Daha sonra, KAH ve ME'nin aile kümelenmesi iyi tanımlanmış ve belgelenmiştir.
İkizlerle yapılan çalışmalarda KAH’ın kalıtsallığının, yaklaşık olarak %50-%60 arasında olduğu hesaplamıştır
(Dai ve ark., 2016).
Günümüzde, KAH’ın belli bir genetik altyapı ve bu yapıdan kaynaklanan riske sahip kişilerde, çevresel risk
faktörlerinin etkisiyle ortaya çıktığı gösterilmiştir. Ulusal Kolesterol Eğitim Programı’nın (NCEP) β002’de
yayınlanan III. yetişkin tedavi panelinde (ATP III), KAH için risk faktörleri şu şekilde sınıflandırılmıştır. (NCEP
ATP ΙΙΙ, 2002)
1. Lipid risk faktörleri
a. LDL,
b. Trigliseridler,
c. Non-HDL Kolesterol,
d. HDL düşüklüğü,
e. Aterojenik dislipidemi
β. Nonlipid risk faktörleri
A. Modifiye edilebilen risk faktörleri
a. Hipertansiyon
b. Sigara içiyor olmak
c. Diyabetes Mellitus
d. Fazla kiloluluk/Obezite
e. Fiziksel inaktivite
f. Aterojenik diyet
g. Trombojenik/ hemostatik durum
B. Modifiye edilemeyen risk faktörleri
a. Yaş
b. Erkek cinsiyeti
c. Ailede erken koroner kalp hastalığı öyküsü (Genetik Yatkınlık)
Ayrıca KAH İçin bağımsız risk faktörleri de belirlenmiş ve aşağıdaki gibi gösterilmiştirν
1. Yaş (erkeklerde ≥45, kadınlarda ≥55 )
2. Ailede erken KAH öyküsü yani genetik yatkınlık (birinci derece akrabalardan erkekte 55, kadında 65 yaşından
önce KAH bulunması)
ORAL PRESENTATION
83
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3. Sigara içiyor olmak
4. Hipertansiyon ( Kan basıncı ≥140/λ0 mmHg veya antihipertansif ilaç kullanımı )
5. Düşük HDL kolesterol ( HDL <40 mg/dl )
6. Yüksek LDL kolseterol ( LDL ≥1γ0 mg/dl ) (NCEP ATP ΙΙΙ, β00β)
1.3 KAH ve Genetik Faktörler
Dünyada, β0. yy’ın başlarında kardiyovasküler hastalıklardan ölümler %10’dan daha az iken, β1. yüzyılın
başlangıcında, gelişmiş ülkelerde ölümlerin yaklaşık yarısına ve gelişmekte olan ülkelerde ise %β5’ine bu
hastalıkların neden olduğu rapor edilmiştir (Durusoy ve ark., β010).
Mortalitenin en büyük sebeplerinden biri olan KAH, kompleks bir hastalık olarak genetik araştırmaların ilgi
odağını oluşturmaktadır. Kalp hastalıklarına yol açan risk faktörleri arasında yer alan genetik yatkınlığın önemli
olduğu ve birinci derece yakınlarında kalp ve damar hastalığı olan kişilerin bu hastalıklara yakalanma riskinin,
diğer bireylere göre 1β kat daha fazla olduğu belirlenmiştir (McPherson R ve Tybjaerg-Hansen 2016).
KAH için en güçlü aile hikayesi, birinci derece bir yakında erken yaşta koroner arter hastalığı öyküsü olmasıdır.
Baba veya diğer birinci derece erkek akrabalarda 55 yaşından önce, anne veya diğer birinci derece kadın
akrabalarda 65 yaşından önce erken KAH gelişimi, KAH riskini iki katına çıkarttığı, ancak bildirilen göreceli
riskin 1.3-11.γ arasında değiştiği saptanmıştır (Myers ve ark.,1990; Yusuf ve ark., 2004; Kaikkonen ve ark.,
2006). Erken yaşta KAH’a sahip yakın sayısı arttıkça veya ailede KAH’a yakalanma yaşı azaldıkça, aile
öyküsünün önemli olduğu rapor edilmektedir (Dai ve ark., 2016).
KAH’ın önlenmesi, β1. yüzyıl için uygun bir hedeftir. Bununla birlikte, KAH’a yatkınlığın % 40-60'ını
oluşturduğu tahmin edilen genetik risk, yakın zamana kadar bilinmiyordu. β1. yüzyıl teknolojisi, ilk genetik risk
varyantını β007 yılında saptamış ve bu varyant λpβ1’dir (McPherson ve ark., 2007). Daha sonraki çalışmalarda
KAH için 60’a yakın genetik risk faktörü keşfedilmiştir. Şaşırtıcı bir keşif, bu faktörlerin üçte ikisinin bilinen
risk faktörleri veya mekanizmaları yoluyla davranmadığı yönündedir. Genom-wide (Genome-wide association
studies, GWAS) çalışmaları, KAH kalıtımının % 6'sını açıklayan yaklaşık 40 lokus tanımlamıştır (Roberts,
2014). Bu genetik risk faktörlerinin nüfusta beklenenden daha sık görüldüğü ve bunların yarısından fazlasının
nüfusun % 50'sinde, daha azının (10) ise nüfusun % 75'inde ortaya çıktığı belirlenmiştir (Dai ve ark., 2016).
KAH gibi yaygın, karmaşık hastalıkların genetik belirleyicilerinin belirlenmesinde çeşitli zorluklar mevcuttur.
Bu zorluklar arasında, fenotipik ve genetik heterojenlik, gen-gen ve gen çevre etkileşimleridir. Ayrıca diğer
önemli bir faktör de, etiyolojik spektrumun, küçük etkilere sahip yaygın genetik varyantlardan, geniş etkilere
sahip nadir görülen genetik varyantlara kadar değişebileceği gerçeğidir (Wang 2005b). İkiz ve aile çalışmaları,
KAH'nın ailelerde kümelendiğini ortaya çıkartmıştır. Kanıtlar, aile öyküsünün bilinen risk faktörlerinden
bağımsız olarak, KAH riskinde artışa katkıda bulunduğunu da göstermektedir (Marenberg ve ark., 1994).
KAH ile ilişkili mutasyonlar aşağıda belirtildiği gibi üç ana başlık altında toplamış (Ercan ve ark., 2002) ve
günümüzde bu mutasyonların mekanizmaları ile ilgili ileri moleküler çalışmalar farklı araştırmacılar tarafından
yapılmıştır (Ercan ve ark., 2002; Wang ve ark., 2003; McPherson ve ark., 2007; Stein ve ark., 2012). Silva ve
ark., (2010) tarafından KAH’lı olgularda HFE mutasyonları araştırılmış ve bu mutasyonların, kadınlarda KAH
riski artış ile anlamlı derecede ilişkili olduğu bulunmuştur.
1.Koagülasyon ile ilişkili mutasyonlar
- Glikoprotein IIb/IIIa
- PIA2 mutasyonu
- Faktör V leiden
- Protrombin G20210A
- Metilentetrehidrofolat redüktaz (MTHFR).
β. Lipoproteinler ile ilişkili Mutasyonlar
-Apo AI
ORAL PRESENTATION
84
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
-Apo AIV
-CETP (Kolesterol ester transfer protein)
-LPL (Lipoprotein lipaz)
-Apo B-100
-Apo CII, Apo E, LDLR (low density lipoprotein reseptör)
γ. Kanbasıncının regülasyonu ile ilişkili mutasyonlar
- Angiotensin converting enzim (ACE)
- Angiotensin II tip I reseptör (AT1R)
- Endotelyal nitrik oksit sentaz (eNOS) (Ercan ve ark., 2002).
KAH, birden fazla genetik faktörün, çevresel faktörlerin ve bu faktörler arasındaki etkileşimlerin neden olduğu
düşünülen en yaygın kalp hastalığıdır. Bu genetik ve çevresel faktörlerin tanımlanması KAH'ın önlenmesi ve
kontrolü için değerli bilgiler sağlayacaktır (Wang 2005b). Son yıllarda KAH, miyokard enfarktüsü (ME) ve
iskemik inmeye yatkınlık genlerinin tanımlanmasında önemli ilerlemeler gerçekleştirilmiştir. Mevcut
araştırmalardaki en büyük zorluklar, hangi genlerin ve hangi genetik varyantların genel olarak kompleks
hastalıklara ve özellikle de KAH neden olduğunu tanımlamaktır. Bu hastalıktan sorumlu genin saptanmasına
yönelik yaklaşımlardan en yaygın olarak kullanılanları, DNA markırlarının hastalıkla ilişkisini test eden bağlantı
(linkage studies) ve ilişkilendirme çalışmalardır (association studies) (Wang 2005b; Roberts, 2014).
Bağlantı analizi ile aynı kromozom üzerinde birbirine yakın iki genetik lokusun anne-babadan çocuğa
aktarılırken bir arada geçiş olasılığı hesaplanmaktadır (Örenay Boyacıoğlu S and Dündar M β01β). KAH
genlerinin kromozomal yerlerini haritalamak için iki farklı bağlantı analizi kullanılmıştır (Wang Q 2005a).
Bunlardan ilki model tabanlı bağlantı analizi olup, parametrik metot olarak da bilinen bu analizde, lokalizasyonu
belirlenecek genin, herhangi bir kromozomda bulunma olasılığının, o kromozomda bulunmama olasılığına
oranının logaritması (Logarithm of Odds ratio, LOD Score) alınarak hesaplanır. Bu analizinde başarı
sağlanabilmesi için, hastalığın kalıtımının kesin olarak bilinmesi, markır alleli ile hastalık allelinin, bir arada
kalıtılıp kalıtılmadığının yeterince gözlenebileceği büyük aileler (üç ve daha fazla kuşaklı) kullanılmaktadır
(Örenay Boyacıoğlu S and Dündar M β01β). Bu analiz ile KAH’lı olgularda, ALOX5AP (koroner ve
serebrovasküler hastalık), MEFβA (KAH ile ilişkili varyantların tanımlanması ve varyasyonu) ve PCSKλ
(kolestrol metabolizmasıyla alakalı bir gen) mutasyonlarının tanımlanmasında kayda değer bir başarı
sağlanmıştır (Wang 2005a). Model tabanlı bağlantı analizi özellikle Mendelyan kalıtım gösteren birçok hastalık
geninin tanımlanmasında başarılı olmuştur. Ancak bu analizin KAH gibi kompleks hastalıklarla ilişkili genlerin
tanımlanmasında daha az başarılı olduğu saptanmıştır (Wang 2005a; Dai ve ark., 2016). Bu nedenle de KAH
gibi Mendelyan kurallarının uygulanamadığı kompleks hastalıklarda daha çok İkinci analiz olan modelsiz
(Parametrik olmayan) bağlantı analizi kullanılmakta ve bu analiz genel olarak ilişkilendirme analizleri olarak da
bilinmektedir. İlişkilendirme çalışmalarında hastalıktan etkilenmemiş bireylerin dikkate alınmadığı, fakat
etkilenen bireylerde tespit edilen aynı kromozom segmentinin diğer bireylerde de araştırılması gerektiği tespit
edilmiştir. Bu metotta, markır ve örnek sayısı çok olmalı ve kontrol bireyleri iyi belirlenmelidir. Ayrıca modelsiz
bağlantı analizi ile yapılan çalışmalarda, araştırılan hastalıktan en az iki etkilenmiş kardeşi olan yüzlerce küçük
aile kullanılmaktadır. Gerek ilişkilendirme gerekse bağlantı analizi sonucu elde edilen bilgi, bir hastalığın belli
bir kromozomun hangi bölgesinde olduğunun olasılığını verecek değerdir (Örenay Boyacıoğlu S and Dündar M
2012; McPherson R ve Tybjaerg-Hansen 2016).
Son yıllarda, genom boyu ilişkilendirme çalışmaları (genome wide association studies-GWAS) ile yeni genetik
belirteçlerin bulunması ve kişiye özgü tedavinin oluşturulması amaçlanmaktadır. Burada amaç, tek bir hastanın
belirli bir hastalığa yatkınlığının derecesini belirlemekten çok, bireyin yüksek risk taşıdığı durumları
belirlemektir. KAH ve ME ile ilişkili bulunan 9p21 lokusu, gen bakımından zengin olmasa da transkripsiyon
aktivasyonunu arttırıcılar açısından zengin bir bölgedir. Bu bölgeden bağımsız olarak KAH ile ilgili 1γ SNP
tespit edilmiş ve bu riskli allel taşıyıcıları %β0’sinin hastalığı geçirme olasılığının 1.7 kat arttığı rapor edilmiştir.
KAH’a yönelik GWA çalışmalarının kardiyovasküler çalışmalara getirisi, hastalık fenotipinin bağlı olduğu
patogenezde rol oynayan yeni lokuslar ve yeni yolakları belirlemektir. Ancak GWA çalışmalarının epigenetik
ilişkileri saptamada yetersiz kalması, vaka-kontrol çalışmalarında kontrol grubunun seçiminin problemli olması
ve genetik-çevresel etkenlerin her hasta için değişen ağırlıkta etki göstermesi, genotipik ve fenotipik
ORAL PRESENTATION
85
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
heterojenite, etnik gruplar arası farklar gibi etkenlerden dolayı, KAH çalışmalarında genetik açıdan hızlı ilerleme
sağlanamamaktadır (Wang, 2005b; Roberts, 2014, Dai ve ark., 2016)
2. SONUÇ
Sonuç olarak, çevresel faktörlerden yaşam tarzının da rol oynadığı kompleks hastalıklarda, genetik yatkınlığın
teknoloji ve tıp alanındaki gelişmelerle belirlenebileceği, fakat tek gen hastalıklarında belirleyici rol oynayan
mutasyonların bakıldığı genetik testlerin, yakın geçmişteki başarısına rağmen, KAH gibi kompleks hastalıklarda
aynı başarıyı sağlayamadığı yapılan araştırmalarla gösterilmiştir. Dolayısıyla, genetik bulguları, biyolojik
süreçler ve genler arasındaki işlevsel etkileşimler bağlamında yorumlayarak, KAH’ın genetik mimarisine dair
yeni anlayışlar elde edilmelidir. Bu anlamda KAH genetiği alanında yapılacak araştırmalarla; 1) Bu hastalığa
neden olan yeni genlerin ve duyarlılık genlerinin tanımlanmasıν β) Yeni tanımlanan KAH genlerinin moleküler
karakterizasyonu ile bu hastalığın patogenezindeki moleküler mekanizmaların saptanması; 3) Genotip-fenotip
korelasyon çalışmaları ve KAH hastaları için gene spesifik tedaviler de dahil olmak üzere temel bulguların klinik
uygulamalara aktarılması hedeflenmelidir.
KAYNAKLAR
Cassar A, Holmes DR, Rihal CS, and Gersh BJ 2009. Chronic Coronary Artery Disease: Diagnosis and
Management. Mayo Clin Proc., 84(12):1130-1146.
Dai X, Wiernek S, Evans JP, Runge MS 2016. Genetics of coronary artery disease and myocardial
infarction.
World J Cardiol, 26; 8(1): 1-23.
Durusoy E, Yıldırım, Altun A β010. Koroner Arter Hastalığı Poliklinik Takibi. Trakya Univ Tıp Fak Derg, β7
(1):13-18.
Ercan B, Tamer L, Atik U β00β. Koroner arter hastalığı ile ilişkili genetik risk faktörleri. MEÜ Tıp Fak. Dergisi,
2:213-219.
Kasapoğlu ES, Enç N β017. A Guide for Coronary Artery Patients. Journal of Cardiovascular Nursing, 8(15)μ17.
Kaikkonen KS, Kortelainen ML, Linna E, Huikuri HV 2006. Family history and the risk of sudden cardiac death
as a manifestation of an acute coronary event. Circulation, 114: 1462-1467.
Marenberg ME, Risch N, Berkman LF, Floderus B, de Faire U 1994. Genetic susceptibility to death from
coronary heart disease in a study of twins. N Engl J Med, 330:1041–1046.
McPherson R, Pertsemlidis A, Kavaslar N, Stewart A, Roberts R, Cox DR, Hinds DA, Pennacchio LA,
Tybjaerg-Hansen A, Folsom AR, Boerwinkle E, Hobbs HH, Cohen JC. 2007. A common allele on
chromosome 9 associated with coronary heart disease. Science, 316:1488–1491.
McPherson R and Tybjaerg-Hansen A 2016. Genetics of Coronary Artery Disease. Circ Res. 118:564-578.
Myers RH, Kiely DK, Cupples LA, Kannel WB 1990. Parental history is an independent risk factor for coronary
artery disease: the Framingham Study. Am Heart J, 120: 963-969.
NCEP ATP ΙΙΙ, β00β. Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on
Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) Final
Report. National Cholesterol Education Program National Heart, Lung, and Blood Institute. National
Institutes of Health, September 2002, NIH Publication No. 02- 5215.
Onat A, Karakoyun S, Akbaş T, Özpamuk Karadeniz F, Karadeniz Y, Çakır H, Şimşek B, Can G β015.
TEKHARF 2014 taraması ve Türkiye’de coğrafi bölgelere göre ölüm oranı ile koroner hastalık insidansı.
Türk Kardiyol Dern Arş., 4γ(4)μγβ6–332.
Örenay Boyacıoğlu S and Dündar M β01β. Gene Mapping Strategies. Journal of Health Sciences, β1(1)μ50-60.
Roberts R 2014. Genetics of Coronary Artery Disease. Circ Res., 114:1890-1903.
Silva MCP, Njajou OT, Alizadeh BZ, Hofman A, Witteman JCM, van Duijn CM, Janssens ACJW 2010. HFE
gene mutations increase the risk of coronary heart disease in women. Eur J Epidemiol, 25:643–649.
ORAL PRESENTATION
86
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Stein EA, Mellis S, Yancopoulos GD, Stahl N, Logan D, Smith WB, Lisbon E, Gutierrez M, Webb C, Wu R, Du
Y, Kranz T, Gasparino E, Swergold GD 2012. Effect of a monoclonal antibody to PCSK9 on LDL
cholesterol. N Engl J Med, 366:1108–1118.
Wang Q 2005a. Advances in the Genetic Basis of Coronary Artery Disease. Curr Atheroscler Rep, 7(3):
235–
241.
Wang Q 2005b. Molecular genetics of coronary artery disease. Curr Opin Cardiol, 20(3): 182–188.
Wang L, Fan C, Topol SE, Topol EJ, Wang Q 2003. Mutation of MEF2A in an inherited disorder with features
of coronary artery disease. Science, 302:1578–1581.
Weng L, Kavaslar N, Ustaszewska A, Doelle H, Schackwitz W, Hébert S, Cohen JC, McPherson R, and
Pennacchio1 LA 2005. Lack of MEF2A mutations in coronary artery disease. J. Clin. Invest., 115:1016–
1020.
Yusuf S, Hawken S, Ounpuu S, Dans T, Avezum A, Lanas F, McQueen M, Budaj A, Pais P, Varigos J, Lisheng
L 2004. Effect of potentially modifiable risk factors associated with myocardial infarction in 52 countries (the
INTERHEART study): case-control study. Lancet, 364: 937-952.
ORAL PRESENTATION
87
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Thyroid Pathology in Rats Induced by Bisphenol-A: Protective Effects of Taurine and Curcumin
Fatma Gökçe Apaydin1*, Suna Kalender2 , Yusuf Kalender1
*1
2
Gazi University, Faculty of Science, Department of Biology, Ankara, Turkey
Gazi University, Faculty of Gazi Education, Department of Science, Ankara, Turkey
Corresponding author e-mail: fguzun@gmail.com
Abstract
Bisphenol A (BPA)is a chemical that has endocrine-disrupting properties. The present study aimed to examine
the possible protective roles of curcumin and taurine against BPA-induced toxicity on thyroid tissue in rats. For
this purpose, forty-two adult albino male rats were divided seven equal groups: control, olive oil, curcumin (100
mg kg-1 daily), taurine (100 mg kg-1 daily), BPA (130 mg kg-1 daily), BPA plus curcumin, BPA plus taurine.
After four weeks on treatment thyroid glands were examined for histopathological examinations. BPA caused
seriously toxicity such as follicular cell hyperplasia on thyroid tissues, but curcumin and taurine did not have
completely protective effects of this damage.
Keywords: Thyroid, Bisphenol A, Taurine, Curcumin, Rat, Histopathology
1. INTRODUCTION
The thyroid is an essential endocrine gland of animal bodies, and its secretions are metabolically pertinent. It is
known that environmental chemicals can disrupt endocrine systems. Thyroid gland is also very effected by these
chemicals. Many environmental chemicals have a high degree of structural similarity to the THs thyroxine (T4)
and triiodothyronine (T3), and therefore interfere with binding of THs to receptors or transport proteins (Boats et
al., 2006).
Bisphenol A (BPA, 4,40-isopropylidenediphenol) is widely used in plastic products such as plastic bottles, water
dispenser, electronic products, epoxy resins (Ortiz-Villanueva et al., 2017; Tarapore et al., 2017). BPA exposure
may induce several toxic effects like obesity, diabetes, organ dysfunctions (Tarapore et al., 2017). It has been
reported that BPA induces reproductive toxicity, nephrotoxicity, hepatotoxicity and also neurotoxicity in
experimental animals (Mahmoudi et al., 2015; Tarapore et al., 2017; Zhou et al., 2017).
Curcumin is a phenolic compound which a member of the ginger family (Zingiberaceae) (Anamika, 2012). It has
therapeutic effects on many toxic changes on different organs. It has anti-arthritic, anti-rheumatic, analgesic and
gastro-protective effects (Kaur et al., 2017). Taurine has also antioxidant properties like anti-inflammation, Ca2+
modulation, cell membrane stabilization and neuromodulator effect (Feng et al., 2017). Therefore, the purpose of
our study is to investigate the possible toxic effects of BPA and related mechanisms of taurine and curcumin on
the thyroid tissues in rats.
2. MATERIALS AND METHODS
2.1. Chemicals and Experimental Design
Taurine (≥λλ% purity) and Curcumin (from Curcuma longa (Turmeric)) were purchased from Sigma. Bisphenol
A (≥ λλ% purity) was provided by Aldrich. Adult male albino rats (weighing 250-300g) were obtained from
GUDAM and were housed in cages, at room temperature β0±β oC, relative humidity 40%, and 12h light/dark
cycle. Food (pellet rat chow) and water available ad libitum. Experimental studies were confirmed by University
of Gazi Animal Ethics Committee (G.U.ET–14.075). After acclimatization, animals were divided seven groups
(n=6) categorized as follows:
ORAL PRESENTATION
88
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Group 1 (control group): received distilled water (1.0 ml kg-1 bw daily).
Group 2 (olive oil group): received olive oil (1.0 ml kg-1 bw daily).
Group 3 (curcumin group): received curcumin (100 mg kg-1 bw daily in olive oil).
Group 4 (taurine group): received taurine (100 mg kg-1 bw daily in distilled water).
Group 5 (BPA group): received bisphenol A (130 mg kg-1 bw daily in olive oil).
Group 6 (BPA + curcumin group): received curcumin and bisphenol A (100 mg kg-1 bw daily + 130 mg kg-1
bw daily, respectively).
Group 7 (BPA + taurine group): received taurine + bisphenol A (100 mg kg-1 bw daily + 130 mg kg-1 bw daily,
respectively).
Both solutions were administrated via gavage during 28 days. BPA and other solutions were freshly prepared.
After the treatment period, animals were sacrificed under the anesthesia and thyroid glands removed quickly.
2.2. Histopathological Examination
For light microscopy, thyroid glands were dissected free of connective tissues and then fixed in 10% neutral
formalin and processed for paraffin sections of 5-7η thickness. Sections were stained with hematoxylin and eosin
(H&E) for routine histological investigations. Then the tissues were evaluated under a light microscope
(Olympus BX51, Tokyo, Japan) and photographed with a camera (Olympus E-330, Olympus Optical Co., Ltd.,
Japan). Ten slides were prepared from each tissues.
3. RESULTS
In our study histopathological examination of rat thyroids were investigated using light microscope. Histological
examinations of thyroid glands of the control, olive oil, taurine and curcumin-treated rats indicated normal
arrangement with no histological alterations of the four groups. Thyroid follicles in control rats were lined by a
single uniform layer of short cuboidal epithelial cells and contained abundant thyroglobulin colloid within the
lumen (Figure 1). In contrast, BPA treated groups we showed that follicular cell hyperplasia () in adjacent
follicles is characterized by masses of follicular epithelial cells filling the lumens, microscopic images also
revealed desquamated irregularly shaped follicles with reduced colloidal space () and follicular degenerations
(), (Figure 2-4). In BPA plus curcumin treated groups showed that () follicular cell hyperplasia (Figure 5). In
BPA plus taurine treated groups we showed that () degenerations of follicle and () follicular cell hyperplasia
(Figure 6).
Figure 1. Photomicrographs of thyroids of the control group (group 1) at low magnification, showing normal,
evenly spaced follicles. H&E, x200.
ORAL PRESENTATION
89
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 2. Thyroid sections of BPA treated rats, : follicular cell hyperplasia, : degenerations of follicles, :
showing desquamated follicles. H&E, x400.
Figure 3. Thyroid sections of BPA treated rats, : follicular cell hyperplasia, : degenerations of follicles, :
showing desquamated follicles. H&E, x400.
Figure 4. Thyroid sections of BPA treated rats, : follicular cell hyperplasia, : degenerations of follicles, :
showing desquamated follicles. H&E, x400.
ORAL PRESENTATION
90
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 5. Thyroid sections of BPA plus curcumin treated rats, : follicular cell hyperplasia. H&E, x200.
Figure 6. Thyroid sections of BPA plus taurine treated rats, : degenerations of follicles, : follicular cell
hyperplasia. H&E, x200.
4. DISCUSSION
BPA exposure may cause several pathological changes because of its estrogenic-like effects. It is very important
for role of BPA toxicity. Humans be exposed to BPA with different ways (El-Tabaa et al., 2017). BPA has been
founded in maternal serum, amniotic fluid, fetal cord blood, and breast milk (Vandenberg et al., 2007).
Galyon et al., reported that in their study, maternal bisphenol A exposure should be limited during pregnancy
and lactation (Galyon et al., 2017). Guignard et al., reported that Bisphenol A alters the maternal thyroid status
in pregnant ewe (Guignard et al., 2017). Many researches have focused on reproductive functions based on the
estrogen mimetic properties of BPA. However, accumulated evidence suggests that BPA might have toxic
effects on other endocrine systems including thyroid function (Guignard et al., 2017). The thyroid system is a
primarily target of the endocrine disrupting chemicals (Tebourbi et al., 2010). In addition, previous investigators
have reported that BPA cause alterations in antioxidant enzyme activities in several rat tissues (Eid et al. 2015).
Various xenobiotic have also been caused to cellular damage in tissues related to inhibition of antioxidant
mechanism (Apaydın et al. β015; Santamaria et al. 2015).
In the present study, we examined that the effects of BPA exposure on thyroid tissues histological structure. The
oral LD50 of BPA for male rats is 3250 mg/kg body weight (Michalowicz, 2014). In the present study, BPA was
given at 1/25 of oral LD50 and none of the rats died during the experimental period. We determined that serious
ORAL PRESENTATION
91
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
histopathological changes in BPA-treated rats such as follicular cell hyperplasia, desquamated irregularly shaped
follicles with reduced colloidal space and follicular degenerations.
Curcumin and taurine protects several tissues against environmental toxicants and these preventive effects
possibly are due to their antioxidant properties (Kaur et al., 2017; Feng et al., 2017). In conclusion, previous
studies BPA caused histopathological effects on thyroid glands. It may be due to its xenoestrogen properties
and/or increased reactive oxygen species production which caused oxidative stress. It has been shown that
protective effects of taurine and curcumin because of their antioxidant properties. However, in this study we
haven’t show protection on thyroid glands. This results may be related to their doses that used in this study. They
may be lower or higher doses against of BPA. However, we show fever histopathological changes in antioxidant
supplementation groups than only BPA treated group.
REFERENCES
Anamika, B., 2012. Extraction of curcumin. Journal of Environmental Science Toxicology and Food
Technology. 1: 1–16.
Apaydin FG, Kalender S, Bas H, Demir F, Kalender Y, 2015. Lead nitrate induced testicular toxicity in diabetic
and non-diabetic rats: protective role of sodium selenite. Brazilian Archives of Biology and Technology.
58: 68-74.
Boas M, Feldt-Rasmussen U, Skakkebæk NE, Main KM, 2006. Environmental chemicals and thyroid function.
European Journal of Endocrinology. 154: 599–611.
Eid JI, Eissa SM, El-Ghor AA, 2015. Bisphenol A induces oxidative stress and DNA damage in hepatic tissue of
female rat offspring. The Journal of Basic and Applied Zoology. 71: 10–19.
El Tabaa MM, Sokkar SS, Ramadan ES, Abd El Salam IZ, Zaid A, 2017. Neuroprotective role of Ginkgo biloba
against cognitive deficits associated with Bisphenol A exposure: An animal model study. Neurochemistry
International. 108:199-212.
Feng Y, Sun F, Gao Y, Yang J, Wu G, Lin S, Hu J, 2017. Taurine decreased uric acid levels in hyperuricemic
rats and alleviated kidney injury. Biochemical and Biophysical Research Communications. 489: 312-318.
Galyon KD, Farshidi F, Han, G, Ross MG, Desai M, Jellyman JK, 2017. Maternal bisphenol A exposure alters
rat offspring hepatic and skeletal muscle insulin signaling protein abundance. American Journal of
Obstetrics & Gynecology. 216:290-299.
Guignard D, Gayrard, V, Lacroix MZ, Puel S, Picard-Hagen N, Viguie C, 2017. Evidence for bisphenol Ainduced disruption of maternal thyroid homeostasis in the pregnant ewe at low level representative of
human exposure. Chemosphere. 182: 458-467.
Kaur M, Singh A, Kumar B, Singh SK, Bhatia A, Gulati M, Prakash T, Bawa P, Malik AH, 2017. Protective
effect of co-administration of curcumin and sildenafil in alcohol induced neuropathy in rats. European
Journal of Pharmacology. 805: 58–66.
Mahmoudi A, Ghorbel H, Bouallegui Z, Marrekchi R, Isoda H, Sayadi S, 2015. Oleuropein and hydroxytyrosol
protect from bisphenol A effects in livers and kidneys of lactating mother rats and their pups.
Experimental and Toxicologic Pathology, 67: 413-425.
Michalowicz J, 2014. Bisphenol A-Sources, toxicity and biotransformation. Environmental Toxicology and
Pharmacology. 27: 738-758.
Ortiz-Villanueva E, Navarro-Martín L, Jaumot J, Benavente F, Sanz-Nebot V, Pina, B, Tauler R, 2017.
Metabolic disruption of zebrafish (Danio rerio) embryos by bisphenol A. An integrated metabolomic and
transcriptomic approach. Environmental Pollution. 231: 22-36.
Santamaria C, Durando M, de Toro MM, Luque EH, Rodriguez HA, 2015. Ovarian dysfunction in adult female
rat offspring born to mothers perinatally exposed to low doses of bisphenol A. The Journal of Steroid
Biochemistry and Molecular Biology. 158:220-230.
Tarapore P, Hennesy M, Song D, Ying J, Outang B, Govindarajah V, Leung Y, Ho S, 2017. High butter-fat diet
and bisphenol A additively impair male ratspermatogenesis. Reproductive Toxicology. 68: 191–199.
ORAL PRESENTATION
92
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tebourbi O, Hallègue D, Yacoubi MT, Sakly M, Rhouma KB, 2010. Subacute toxicity of p,p-DDT on rat
thyroid: Hormonal and histopathological changes. Environmental Toxicology and Pharmacology. 29:
271–279.
Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV, 2007. Human exposure to bisphenol A (BPA).
Reproductive Toxicology. 24: 139-77.
Zhou Y, Wang Z, Xia M, Zhuang S, Gong X, Pan J, Li C, Fan R, Pang Q, Lu S, 2017. Neurotoxicity of low
bisphenol A (BPA) exposure for young male mice: Implications for children exposed to environmental
levels of BPA. Environmental Pollution. 229: 40-48.
ORAL PRESENTATION
93
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Comparative Study the Production of Silver Nanoparticles with the Cultural Supernatant and
Biomass of Yeast Candida guillermondii bdu-217
Khudaverdi Ganbarov., Mirmusa Jafarov., Khadija Bozkurt., Sanam Huseynova.,
Aygun Israyilova., Gulshan Suleymanova., Zokhrab Agamaliyev., Goncha Eyvazova
Baku State University, Faculty of Biology/Department of Microbiology
Baku AZ 1148, Azerbaijan
cafarov.67@mail.ru
Abstract
The presented article is devoted to the comparative study of the production of silver nanoparticles with the
cultural supernatant and biomass of yeast Candida guillermondii BDU - 217. It has been determined that the
cultural supernatant and biomass of this strain has the Ѕapability to form silver nanoparticles. Its ability to
produce silver nanoparticles was initially detected by the coloring of the reaction mixture into dark color. The
colloidal silver nanoparticles solutions were monitored by ultraviolet – visible (UV) spectroscopy, and the
obtained nanoparticles were characterized by Scanning Electron Microscopy (SEM) and Energy Despersive
spectroscopy (EDAX). UV – vis spectrophotometric analysis nanoparticles produced with culture supernatant
showed an absorbance peak at 390 nm and with biomass – at 410 nm wavelength. In the SEM it was clearly
seen that these nanoparticles have spherical form. Moreover, nanoparticles, produced with culture supernatant
were 20,0 – 35,5 nm and that, produced with biomass, were 34,2 – 37,5 nm. EDAX confirmed the presence of
elemental silver by the sharp signals.
Keywords: yeast, silver nanoparticles, Candida guillermondii BDU – 217, cultural supernatant, biomass.
1. INTRODUCTION
Production of nanoparticles by physical and chemical methods is considered ecologically unfavorable.
The application of the mentioned methods requires chemical reagents, that can cause environmental pollution
[3]. Therefore, greater attention is paid to the synthesis of nanoparticles with biological objects. In the biological
synthesis process, yeasts and mold fungi, bacteria and plant extracts are used as producers [1, 5 - 7, 11-14].
Usage of the yeast fungi created favorable conditions to obtain metal nanoparticles such as silver, gold,
zinc, selenium, titanium and platinum [6]. Metal nanoparticles are characterized by various properties. For
example, silver nanoparticles have their own characteristic features compared to other metal nanoparticles; the
greater surface area, the more unique physical, chemical and biological features. The possibility of obtaining
silver nanoparticles using yeast genus Candida is shown [8,10, 15].
The previous research was devoted to the study of the production of silver nanoparticles by Candida
macedoniensis BDU - MY44. In addition, the dependence of the nanoparticles formation on the quantity of
biomass, was also researched [2, 3, 9].
The main purpose of the investigation was the comparative analysis the formation of silver nanoparticles
in the cultural supernatant and biomass of Candida guilliermondii BDU – 217 yeast fungus.
2. MATERIALS AND METHODS
Candida guilliermondii BDU - 217 strain taken from the culture collection of the Microbiology Department of
Baku State University was used as a research object.
For the acquisition of biomass, Candida guilliermondii BDU - 217 were planted in a liquid medium with the
following ingredients: yeast extract - 10 g, sucrose - 20 g, pepton - 20 g, distilled water - 1 liter. The fungus was
cultivated at 300C for 5 days. Biomass and cultural supernatant were used separately for the production of silver
nanoparticles.
ORAL PRESENTATION
94
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The obtained yeast fungus biomass was separated from the cultural medium by centrifugation (5000 rpm / min.
20 min). 10 ml of 10-3 M AgNO3 solution was added to 90 ml of cultural supernatant and the mixture was
incubated in the thermostat at 300C for 7 days. During the inkubation, color change was observed.
The biomass was washed 3 times with 100 ml of sterile distilled water. 20 grams of biomass was introduced into
sterile distilled water, 10 ml of 10-3 molar AgNO3 solution was added and the mixture volume was increased up
to 100 ml. The obtained mixture was incubated in thermostat for 7 days at 30 0C.
At the end of the experiment, both the cultural supernatant and biomass were filtered. Afterwards, presence of
silver nanoparticles in the filtrate was analyzed. The existence of nanoparticles was determined primarily by the
color of the reaction mixture. Silver nanoparticles were analyzed in spectrophotometer "UV - VIS specord 250
plus". The shape and size of silver nanoparticles were determined in the scanning electron microscope (SEM,
JEOL 7600F, Japan). Energy – dispersive X – ray (EDAX) spectroscopy analysis for the confermation of
elemental silver was carried out for the detection of elemental silver.
3. RESULTS AND DISCUSSIONS
As a result of studies, it was found that the color of the reaction mixture was dark when the Candida
guilliermondii BDU - 217 cultural supernatant (Fig. 1) and biomass (Fig. 2) were incubated for 7 days at 300C
with silver nitrate solution. No color change has been observed in the tubes without silver nitrate solution. The
color black – out of the reaction mixture is regarded as one of the indications of the formation of silver
nanoparticles.
Figure 1. Visible observation of silver nanoparticles biosynthesis with cultural supernatant of Candida
guilliermondii BDU - 217: a - control; b –experiment
Figure 2. Visible observation of silver nanoparticles biosynthesis with biomass of Candida
guilliermondii BDU - 217: a - control; b – experiment
ORAL PRESENTATION
95
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The colloidal solution obtained by filtration of black – out reaction mixture was analyzed in UV
spectrophotometer. As a result, it was detected that it has a 390 nm wavelength absorption which is
characteristic of silver nanoparticles (Fig. 3).
Figure 3. UV – visible absorption spectra of produced silver nanoparticles in 390 nm wavelength
using cultural supernatant (1) and in 410 nm wavelength using biomass (2) of Candida guilliermondii
BDU – 217
The analysis of the samples taken from the cultural supernatant in the scanning electron
microscope showed that silver nanoparticles have a spherical form and a size of 20,0 to 35,5 nm (Fig.
4).
Figure 4. The SEM micrograph of silver nanoparticles produced with the cultural supernatant of
Candida guilliermondii BDU – 217
The analysis of nanoparticles by the EDAX spectrum has shown that silver particles possess the
specific (Ag La1) peak (Fig. 5).
ORAL PRESENTATION
96
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 5. EDAX spectrum of silver nanoparticles produced by the cultural supernatant of
Candida guilliermondii BDU – 217
The colloidal solution, obtained by filtration of black – out reaction mixture with biomass was
analyzed by UV spectrophotometer. This analysis has resulted in a fact that the solution has a 410 nm
wavelength absorption, which is characteristic of silver nanoparticles (Fig. 3).
The analysis of the sample in scaning electron microscope showed that silver nanoparticles have
a spherical form and a size of 34,2 – 37,5 nm (Fig. 6).
Figure 6. The SFM micrograph of silver nanoparticles produced with the biomass of Candida
guilliermondii BDU – 217
Analysis of nanoparticles by EDAX spectrum shows that silver particles have the specific (Ag
La1) peak (Fig.7).
ORAL PRESENTATION
97
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 7. EDAX spectrum of silver nanoparticles produced by the biomass of Candida
guilliermondii BDU – 217
Thus, it has been determined that Candida guilliermondii BDU - 217 has the ability to produce
silver nanoparticles in both cultural supernatant and biomass. Its ability to produce silver nanoparticles
was initially determined by color change of the reaction mixture and absorbing wavelengths of 390 and
410 nm in the UV spectrophotometer. Silver nanoparticles, produced both with the biomass and
cultural supernatant , have a spherical shape. Nanoparticles, produced with cultural supernatant are at
the range of 20,0 – 35,5 nm, and with the biomass - of 34,2 – 37,5 nm.
ACKNOWLEDGEMENTS
The authors wish to thank the head of Nanoreseach laboratory prof. M.A.Ramazanov for
providing the possibility of UV and SEM analysis of samples.
BIBLIOGRAPHY
1. QənbərovX.Q., Musayev E.M. Nanohissəciklər əmələ gətirən mikroorqanizmlər // AMEA – nın
Mikrobiologiya İnstitutunun elmi əsərləri, 2012, c. 10, s. 78 – 84.
2. Qənbərov X.Q., Cəfərov M.M., Haciyeva F.T., Bozkurt H.C., Ramazanov M.A., Eyvazova Q. M.,
Ağamaliyev Z.Ə., Əhmədov İ.S., Abdülhəmidova S.M. Candida macedoniensis BDU-Mİ 44 maya
göbələyi ştamının gümüş nanohissəcikləri əmələ gətirmə xassələrinin öyrənilməsi. // Journal of Qafqaz
University Chemıstry and Biology, β015, s.1γλ – 142
3. Qənbərov X.Q., Cəfərov M.M., Haciyeva F.T., Bozkurt H.C., Ramazanov M.A., Eyvazova Q. M.
Candida macedoniensis BDU-Mİ 44 maya göbələklərində gümüş nanohissəciklərin əmələ gəlməsinin
biokütlənin miqdarından aslılığı.// Konfrans Ümummilli lider H. Əliyevin anadan olmasının 93 – ci
ildönümünə həsir olunub. Müasir kimya və biologiyanın aktual problemləri Beynəlxalq elmi konfrans
Gəncə, β016, s. 161 – 165
4. .ϕϴЄϴЁЂ϶ϴ Е.Ϟ., ϠЇϿВϾϼЁ ϔ.ϟ. ϞЂϻϿЂ϶ϴ ϔ.ϡ., ϤϹ϶ϼЁϴ ϔ.ϔ., ϱϿА-ϤϹϷϼЅІϴЁ ϗ.И.
ϖϻϴϼЀЂϸϹϽЅІ϶ϼϹ ϼЂЁЂ϶ ϼ ϾϿϴЅІϹЄЂ϶ ЅϹЄϹϵЄϴ ϶ ϶ЂϸЁЏЉ ϼ ϶ЂϸЁЂ-ЂЄϷϴЁϼЋϹЅϾϼЉ ЄϴЅІ϶ЂЄϴЉ Ѕ
ϾϿϹІϾϴЀϼ Candida utilis ϼ Saccharomyces cerevisiae // ϡϴЇϾЂϹЀϾϼϹ ІϹЉЁЂϿЂϷϼϼ. β005, Ϧ.6,
№ 5, c.33 – 37
5. ϤϹ϶ϼЁϴ ϔ.ϔ., ϕϴЄϴЁЂ϶ϴ Е.Ϟ., ϠЇϿВϾϼЁ ϔ.ϟ., ϥЂЄЂϾϼЁ ϖ.ϖ. "ϡϹϾЂІЂЄЏϹ ЂЅЂϵϹЁЁЂЅІϼ
϶ЂϻϸϹϽЅІ϶ϼГ ϾϿϴЅІϹЄЁЂϷЂ ЅϹЄϹϵЄϴ Ёϴ ϸЄЂϺϺϹ϶ЏϹ ϾϿϹІϾϼ Candida utilis" // ϱϿϹϾІЄЂЁЁЏϽ
ϺЇЄЁϴϿ "ИЅЅϿϹϸЂ϶ϴЁЂ ϶ ϤЂЅЅϼϼ", β005, І.1γλ, Ѕ. 140γ – 1409
6. ϞЄЇІГϾЂ϶ ϲ.ϟ. ϥϼЁІϹϻ ϼ Ѕ϶ЂϽЅІ϶ϴ ЁϴЁЂЊϴЅІϼЊ ЅϹЄϹϵЄϴμ ϸЂЅІϼϺϹЁϼГ ϼ ЃϹЄЅЃϹϾІϼ϶Џ //
ϧЅЃϹЉϼ ЉϼЀϼϼ, β008, І.77, Ѕ. β4β – 269
7. Anal K. Jha, K.Prasad and A.R.Kulkarni. Yeast Mediated Synthesis of Silver Nanoparticles //
International Journal of Nanoscience and Nanotechnology, v.4, No.1, 2008, p.17 – 21.
ORAL PRESENTATION
98
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
8. Bharde A., Rautaray D., Bansal V., Ahmad A., Sarkar I., Mohammad Yusuf S., Sanyal M., Sastry M.
Extracellular Biosynthesis of Magnetite using Fungi // Biosynthesis of nanoparticles, 2006, v.2, №1,
p.135
9. Ganbarov Kh.G., Jafarov M.M., Hajiyeva F.T., Huseynova S.I., Bozkurt Kh. J., Ramazanov M.A.,
Agamaliyev Z.A., Eyvazova G.M., Akhmedov I.S. Mycogenic Formation of Silver Nanoparticles by
the Azerbaijanese environmental isolate Candida macedoniensis BDU-MI44.// International Journal of
Research Studies in Biosciences Volume 4, İssue 5, May β016, p. 1 – 5
10. E. M. Radwan, Hassan, A. A. and Refai, M. K. Correlation between virulence factors and
pathogenesis of Candida albicans // Egypt. Vet. Med. Assoc, 2003, 65(5) p. 239 – 247
11. Meenal Kowshik, Shriwas Ashtaputre, Sharmin Kharrazi, W. Vogel, J.Urban, S.K. Kulkarni and K.M.
Paknikar. Extracellular synthesis of silver nanoparticles by a silver-tolerant yeast strain MKY3 //
Nanotechnology, β00β, v.14, №1, p.λ5 – 100
12. Muthupandian Saravanan, Tsehaye Amelash, Letemichael Negash, Araya Gebreyesus, Arokiyaraj
Selvaraj, VinothRayar and Karthik Dheekonda. Extracellular biosynthesis and biomedical application
of silver nanoparticles synthesized from baker’s yeast // International Journal of Research in
Pharmaceutical and Biomedical Sciences, β01γ, v.4, № γ, p. 8ββ – 828
13. Sastry M, Ahmad A, Khan MI and Kumar: Biosynthesis and application of silver and gold
nanoparticles. Current Sci 2003, v.85, p.162-70
14. Sadowski Z. Synthesis of silver nanoparticles using microorganisms // Materials Science Poland,
2008, v.26, p.420 – 424
15. Xiangqian Li, HuizhongXu, Zhe-Sheng Chen and Guofang Chen. Biosynthesis of Nanoparticles by
Microorganisms and Their Applications // Journal of nanomaterials, β011, v.β011, № 8, p. 1 – 17
ORAL PRESENTATION
99
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Comparison of Different Treatment Methods For Cr (III) Adsorption Onto Borax Sludge
Emek Moroydor Derun1*, Meral Yildirim1, Nevin Karamahmut Mermer1, Fatma Tugce Senberber1,2
*1
Yildiz Technical University, Faculty of Chemical and Metallurgical Engineering, Department of Chemical
Engineering, Turkey
2
Atasehir Adiguzel Vocational School of Higher Education, Programme of Occupational Health and Safety,
Turkey
Corresponding author e-mail:moroydor@yildiz.edu.tr
Abstract
Heavy metal pollution, which causes adverse health effects besides environmental problems, has been of great
concern and should be eliminated. In the present study, borax production sludge was used to remove trivalent
chromium (Cr (III)) by different stirring methods of magnetic and ultrasonic mixing. The adsorption of Cr (III)
in aqueous solution was investigated for various experimental parameters. The adsorption temperature were
kept constant as 40°C. The residual Cr (III) concentration in aqueous solution was determined by Inductively
Coupled Plasma- Optical Emission Spectrometry (ICP-OES). The experimental data were fitted to the many
isotherm and kinetic models. According to results, it was clearly determined that ultrasonic mixing accelerated
the removal of Cr (III).
Keywords: Borax sludge, Cr (III), Adsorption isotherm, Adsorption kinetic
1. INTRODUCTION
Heavy metal pollution can occur in water, air, and soil due to the industrial wastes, radioactive and
microbiological contamination (Holdgate, 1979). Especially in recent years, the pollution in environment has
been increasing with industrial developments (Yilmaz et al., 2015). Metal processes, mining operations,
tanneries, electroplating industry, textile, wood preservatives, paint and pigments, petroleum, are some industrial
sources of heavy metal pollution (Yilmaz et al., 2015; Bailey et. Al., 1999; Gode and Pehlivan, 2004; Inglezakis
et al., 2002). According to the information obtained from World Health Organization (WHO), the most toxic
metals are identified as aluminium, chromium, magnesium, iron, cobalt, nickel, copper, zinc, cadmium, mercury
and lead. Since the late 1950s, studies about the removal of heavy metals from aqueous solutions have received
significant attention by researchers and health committees due to their harmful effects on living beings and
environment (World Health Organization, 1988).
After the discovery of chromium by Vauquelin in 1797 chromium compounds such as catalysts, fungicides,
corrosion inhibitors extensively used. The increase of chromium usage in many application areas due to the
industrial development led to give a priority to the element and in later times the effects on health were being
discovered (Baruthi, 1992). The intake modes of chromium can be ingestion, dermal contact and inhalation
which can cause acute (14 days or less), intermediate (15 to 364 days), and chronic (365 days or more) effects.
Although Cr (III) is an essential element in humans (daily intake of 50 to β00 µg/d for adults), exposure of
chromium compounds can cause immunological, neurological and geneotoxic problems and also can induce
cancer in livings (Guertin, 2004; Assem and Zhu, 2007).
Several methods are utilized for the removal of Cr (III) from the industrial waste water such as filtration, ion
exchange, solvent extraction co-precipitation, membrane filtration, and biosorption (Pehlivan et al., 2009).
These treatment methods are not preferred, because they cause the formation of secondary toxic sludge which
also has toxic effects. Adsorption, as a separation process has been widely used due to the low cost, efficiency,
ease of operation (Pehlivan et al., 2009, Albadarina et al., 2012). In adsorption process the using of cheap and
easily available adsorbents are particularly preferred. In recent years, the adsorbents such as activated carbon,
soya cake, neem leaves, Turkish brown coals and bentonite were used to remove of hexavalent and trivalent
ORAL PRESENTATION
100
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
chromium ions from waste water (Gode and Pehlivan, 2005;Utrilla and Polo, 2003; Daneshvar et al., 2002; Babu
et al., 2008; Tahir et al., 2007).
Boron compounds have wide usage areas including glass, detergent, textile, pesticide, ceramic industries which
causes the consumption of huge amount of boron compounds. Turkey possesses 47.2% of total world boron
production. In Turkey, annually 400 000 tons of process waste (borax sludge) form in the production of sodium
borates from tincal (Özdemir and Kıpçak, β010). In terms of economics and environment, the evaluation of the
occurred borax sludge in different application is significant.
In this study, borax sludge was aimed to evaluate for Cr (III) removal from the wastewater by different stirring
methods. Besides classical magnetic stirring method, ultrasonic stirring was used to observe effects of changed
adsorption conditions on the treatment of Cr (III) containing wastewater. Ultrasonic mixing increases the
interaction of materials by producing shock waves, thus, ensure a more effective adsorption process. In the
current study, the influence of adsorption time, initial Cr (III) concentration and stirring methods on Cr (III)
adsorption onto borax sludge were investigated and the experimental data were applied to various adsorption
isotherm and kinetic models.
2. MATERIALS AND METHODS
2.1. Experimental Procedure
Borax sludge used in this study was obtained from Eti Mine Bandirma Boron Works (Balikesir, Turkey). Prior to
experimental usage, dolomite was subjected to a preparation process and characterized as a mixture of dolomite
(pdf. no: 00-005-0622; CaMg(CO3)2) and tincalconite (pdf. no: 00-008-0049; Na2B4O7·5H2O) phases according
to X-ray diffractometer (XRD) analysis. The BET surface area of borax sludge was determined as 5.54 m 2/g
(Senberber et al., 2017). The aqueous Cr (III) solutions used in the experiments were prepared from standard Cr
(III) solution (Merck KGaA, Darmstadt, Germany).
The experiments were performed by classical stirring method and ultrasound treatment to compare their effects
on the adsorption performance of borax sludge. For classical stirring method, the agitation time was varied as 15,
30, 60, 90, 120 and 180 minutes when the stirring speed were set to 200 rpm. The experiments conducted by
ultrasonic probe (Bandelin Sonopuls HD 2070) were carried out for 5, 15, 30, 45 and 60 minutes of contact time.
For each experimental set, 0.02 g of the borax sludge was mixed with 20 ml of the aqueous solutions of Cr (III)
and temperature was set to 40 °C. Also, to obtain adsorption equilibrium isotherms, the initial Cr (III)
concentration was changed between 10-30 mg/L.
At the end of the adsorption period, the mixture was filtered (using Whatman filter paper, blue ribbon) and Cr
(III) concentration in the supernatant solution was analysed by using Inductively Coupled Plasma- Optical
Emission Spectrometry (ICP-OES).
2.2. Theoretical Background
Basically, adsorption can be called with the interaction between adsorbent and adsorbate (1).
Adsorption
Adsorbate( A) Adsorbent ( B)
AB
(1)
The change in the adsorption capacity of adsorbent according to varied adsorption parameters was calculated
through Eq. (2):
q
Ci C f
m
xV
(2)
where q is the removal capacity of adsorbent at equilibrium (mg/g), V is the volume (mL), m is the weight of
adsorbents (g), Ci and Cf are initial and final concentration of Cr (III) (mg/L), respectively.
ORAL PRESENTATION
101
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The isotherm methods of Langmuir, Freundlich, Temkin and Harkin-Jura were used to explain the adsorption
process and reaction mechanism between Cr (III) and borax sludge. Langmuir isotherm assumes that the
adsorption occurs in a mono layer and homogeneous surface. The adsorption of this kind of surface continues
until the equilibrium point. Hence, the maximum amount of adsorption is reached at the moment of equilibrium.
Langmuir equation is expressed by Eq. (3):
qe
q max K L C e
xV
1 K L Ce
(3)
where qe (mg/g) is amount of adsorbate adsorbed per unit mass of adsorbent, q max maximum adsorption
capacity of adsorbent (mg/g), Ce is concentration of adsorbate in suspension at equilibrium (mg/L) and K L is
Langmuir constant related to the affinity of the binding sites. The values of KL and qmax can be obtained from
slope and intercept of 1/qe versus 1/Ce plot. In Langmuir isotherms, separation factor of R L is used to indicate the
essential features of the isotherm. When R L is between 0 and 1, it expresses that the adsorption is favorable Eq.
(4).
RL
1
1 K LCi
(4)
Temkin isotherm assumes that the indirect adsorbate / adsorbate interactions on the adsorption process are
effective and the heat of adsorption (Δ�ads) of all molecules in the layer decreases linearly with the increasing
surface coverage. The equations for Temkin isotherm method are given in Eq. 5 and 6:
qe BT ln AT BT ln Ce
(5)
BT
(6)
RT
bt
where BT is the Temkin constant related to the heat of adsorption (kJ/mol), AT is the equilibrium binding
constant, R is the gas constant (8.314 J/mol K), T is the temperature (K). The values for A T, BT and bt are
calculated from the plot of qe versus lnCe (Senberber et al., 2017).
Harkin-Jura isotherm assumes the possibility of multilayer adsorption on the surface of adsorbents having
heterogeneous pore distribution (Nimibofa et al., 2017). The equation for Harkin-Jura isotherm method is given
in Eq. 7:
qe
AH
BH log C e
(7)
The adsorption constants of AH and BH are calculated from the plot of 1/qe2 versus logCe.
The Lagergren pseudo-first order kinetic method, pseudo-second order kinetic method and intraparticle diffusion
method were fitted to experimental data for investigation of the kinetic parameters and adsorption mechanism.
The Lagergren pseudo-first and second order kinetic methods can be expressed by Eq. 8 and 9, respectively:
dqt
k1 (q e qt )
dt
(8)
dqt
k1 (qe qt ) 2
dt
(9)
where k1 and k2 are the rate constants for the pseudo-first and second order methods (min-1), qt and qe are
amounts of adsorbed Cr (III) per unit mass of adsorbent at time t and equilibrium time (mg/g), respectively.
ORAL PRESENTATION
102
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The intraparticle diffusion kinetic model which gives information about the adsorption mechanism is formulated
as Eq. (10).
dqt kid t 0.5 A
(10)
In Eq. (10), qt is amount of adsorbed Cr (III) per unit mass of adsorbent at time t (mg/g), t is contact time (min),
kid is the intraparticle diffusion rate constant (mg/g.min1/2) and A is a constant.
3. RESULTS
The effects of contact time on the Cr (III) removal from aqueous medium are shown in Figure 1. As seen in
Figure 1, the treatment method significantly changed the equilibrium time for Cr (III) adsorption.
Figure 1. The effects of different treatment methods on Cr (III) adsorption depend on the contact time
The calculated isotherm constants and correlation coefficients (R2) of Langmuir, Temkin and Harkins-Jura
models are given in Table 1. The fitting equilibrium data to adsorption isotherms is important to explain the
interaction between adsorbates and adsorbents. For all applied isotherm models, high R2 values were
obtained.
Table 1. The adsorption isotherm constants for adsorption of Cr (III) by borax sludge
Isotherm
Plot
Langmuir
1/qe vs 1/Ce
Temkin
qe vs lnCe
Harkins-Jura
1/qe2 vs logCe
ORAL PRESENTATION
Parameter
Ultrasonic stirring
Magnetic stirring
qmax
KL
RL
R2
BT
AT
bt
R2
AH
BH
R2
19.418
46.8182
0.0021 - 0.0007
0.9253
3.1962
765.629
0.8142
0.9288
0.0082
2.407
0.984
5.192
87.55
0.0011 - 0.0004
0.9998
16.023
251.764
0.1624
0.9415
3.5474
2.084
0.9823
103
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The experimental results were employed to find out the kinetic parameters using the three different models and
the calculated kinetic parameters are listed in Table 2. The highest R2 was found for pseudo-second order kinetic
model as 1 for both stirring methods and initial Cr (III) concentrations.
Table 2. The calculated kinetic parameters for Cr (III) adsorption onto borax sludge
Kinetic model
Parameter
Pseudo-first order
Pseudo-second
order
Intraparticle
diffusion
qe
K
R2
qe
K
R2
Kid
A
R2
Ultrasonic stirring
Initial Cr (III) concentration
(mg/L)
Magnetic stirring
Initial Cr (III) concentration
(mg/L)
10
20
30
10
20
30
0.6223
0.0806
0.9694
3.998
19.5469
1
0.0009
3.9906
0.967
0.0715
0.0953
0.9609
8.000
3.3967
1
0.0064
7.9499
0.9272
0.0055
0.0276
0.9655
12.019
0.3328
1
0.0643
11.513
0.9618
0.0098
0.015
0.8428
4
4.3104
1
0.0008
3.9877
0.9519
0.0849
0.023
0.9191
8.006
0.7091
1
0.0079
7.9039
0.7312
0.1165
0.0299
0.9647
12.005
0.6672
1
0.007
11.913
0.9139
4. DISCUSSION
In adsorption process, the initial uptake of Cr (III) was rapid for both stirring method and in the following
periods the adsorption took place slowly. Due to the higher interaction during the ultrasonic stirring, the
adsorption system reached the equilibrium faster than magnetic treatment.
In isothermal studies, RL values obtained from Langmuir isotherms for both of methods were in the range of 0 –
1. RL values indicate the adsorption to be unfavourable when R L>1, linear when RL=1, favourable when 0<
RL<1, and irreversible when RL=0 (Nimibofa et al., 2017). Adsorption mechanism was favourable for both of
methods, however ultrasound effects promoted Cr (III) adsorption on borax waste. Also, the calculated q max
values for ultrasonic stirring was approximately four times bigger than qmax values of magnetic stirring method.
On the other hand, the qmax value showed a decrease when compared with previous study in which the adsorption
temperature was selected as β0°C (Senberber et al., β017). The higher R 2 values of Temkin isotherm explained
that the heat of the adsorption of all Cr (III) molecules in a layer increase with the surface coverage of the
adsorbate-sorbate interaction. The higher R2 values obtained in Harkins-Jura method showed the existence of
heterogeneous pore distribution (Melvin et al., 2015).
The highest correlations factors were determined for Pseudo-second order kinetic model. This indicated that the
adsorption of Cr (III) adsorption on borax sludge was a chemisorption process. K constants were found in the
range of 19.5469 – 0.3328 and 4.3104 – 0.6672 for ultrasonic stirring and magnetic stirring, respectively.
5. CONCLUSION
Borax waste was used as an adsorbent for removal of Cr (III) from aqueous solutions. The adsorption was
influenced by such parameters initial Cr (III) concentration and treatment method. The Cr (III) removal
efficiency was increased with an increase in the initial Cr (III) concentrations. The experiments indicated that
borax waste was suitable for Cr (III) adsorption and ultrasonic stirring contributed the maximum adsorption
capacity of adsorbent. All the attempted isotherm models showed satisfactory correlation with experimental data.
The kinetic calculations for Cr (III) removal were obtained and fitted to various kinetics models. According to
the calculations, the adsorption mechanism of Cr (III) onto the borax waste was explained by the pseudo-second
order kinetic model (R2=1) which showed the chemisorption controlled process.
ORAL PRESENTATION
104
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
References
Albadarina AB, Mangwandi C, Al-Muhtasebb AH, Walker GM, Allena SJ, Ahmad MNM 2011. Kinetic and
thermodynamics of chromium ions adsorption onto low-cost dolomite adsorbent, Chemical Engineering
Journal, 179: 193-202.
Assem L, Zhu H 2007. Chromium, Toxicological Overview, Zhu Institute of Environment and Health Cranfield
University.
Ayawei N, Ebelegi AN, Wankasi D 2017. Modelling and interpretation of adsorption isotherm, 2017: Article ID
3039817, doi: 10.1155/2017/3039817.
Babu BV, Gupta S 2008. Adsorption of Cr(VI) using activated neem leaves: kinetic studies, Adsorption, 14: 85–
92.
Bailey SE, Olin TJ, Brick RM, Adrian DD 1999. A review of potentially low-cost sorbents for heavy metals,
Water Research, 33: 2469-2479.
Baruthi F 1992. Toxic effects of chromium and its compounds, Biological Trace Element Research, 32: 145-153.
Daneshvar N, Salari D, Aber S 2002. Chromium adsorption and Cr(VI) reduction to trivalent chromium in
aqueous solutions by soya cake, Journal of Hazardous Materials. B94: 49–61.
Gode F, Pehlivan E 2005. Adsorption of Cr(III) ions by Turkish brown coals, Fuel Processing Technology, 86:
875– 884.
Guertin J 2004. Toxicity and Health Effects of Chromium (All Oxidation States). In: Guertin J, Jacobs JA,
Avakian CP (eds), Chromium (VI) Handbook. Florida: CRC Press, pp. 215-235.
Holdgate MW 1979. A perspective of environmental pollution. Cambrige: Cambridge University Press.
Inglezakis VJ, Loizidou MD, Grigoropoulou HP 2002. Equilibrium and kinetic ion exchange studies of Pb 2+,
Cr3+, Fe3+ and Cu2+ on natural clinoptilolite, Water Research, 36: 2784–2792.
Melvin Samuel S, Evy Alice Abigail M, Chidambaram R 2015. Isotherm Modelling, Kinetic Study and
Optimization of Batch Parameters Using Response Surface Methodology for Effective Removal of Cr(VI)
Using Fungal Biomass. PLoS ONE, 10(3): e0116884, doi:10.1371/journal.pone.0116884.
Özdemir M, Kıpçak I β010. Recovery of boron from borax sludge of boron industry, Minerals Engineering βγμ
685–690.
Pehlivan E, Özkan AM, Dinc S, Parlayi S β00λ. Adsorption of Cu2+ and Pb2+ ion on dolomite powder, Journal of
Hazardous Materials, 167: 1044–1049.
Sari Yilmaz M, Dere Özdemir O, Kasap S, Piskin S β015. The kinetics and thermodynamics of nickel adsorption
from galvanic sludge leachate on nanometer titania powders, Research on Chemical Intermediates, 41:
1499–1515.
Senberber FT, Yildirim M, Karamahmut Mermer N, Moroydor Derun E 2017. Adsorption of Cr(III) from
aqueous solution using borax sludge, Acta Chimica Slovenica, 64: 654–660.
Tahir SS, Naseem R 2007, Removal of Cr(III) from tannery wastewater by adsorption onto bentonite clay,
Separation and Purification Technology, 53: 312–321.
Utrilla JR, Polo MS β00γ. Adsorption of Cr(III) on ozonised activated carbon. Importance of Cπ—cation
interactions, Water Research. 37: 3335–3340.
World Health Organization, 1988. IPCS International Programme on Chemical Safety, Environmental Health
Criteria.
ORAL PRESENTATION
105
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Evaluation of Mg Wastes in Hydrothermal Synthesis of Magnesium Phosphate
Fatma Tugce Senberber1* And Emek Moroydor Derun2
*1
Atasehir Adiguzel Vocational School, Program of Occupational Health and Safety, Istanbul, Turkey.
2
Yıldız Technical University, Department of Chemical Engineering, Istanbul, Turkey.
Corresponding author e-mail: tugcesenberber@adiguzel.edu.tr
Abstract
The aim of the experiments is the evaluation of magnesium (Mg) wastes in magnesium phosphate synthesis.
Mg wastes are reacted with phosphoric acid (H3PO4) at different mole ratios at the constant reaction
temperature and time. For the identification and characterization, X-Ray Diffraction (XRD) and Fourier
Transform Infrared Spectroscopy (FT-IR) are applied to synthesized minerals. The samples are identified as
the mixtures of MgHPO4·γH2O and Mg3PO4·ββH2O phases. According to the Scherrer equation, the crystal
sizes of synthesized compounds were in the range of 58.6 – 70.5 nm. Through FT-IR spectroscopy, the
characteristic phosphate bands were observed. The characteristic band values between P and O atoms were
good agreement with literature.
Keywords: Mg wastes, magnesium phosphate, hydrothermal synthesis, characterization
1. INTRODUCTION
The increase in the waste formation that require storage and disposal with developing technology is a problem
for the whole world. Some kinds of waste would be hazardous for both people and environment. One of the
dangerous wastes is metal wastes and scraps. Distribution of waste per person in the United States and Turkey
are 8.9% and 7% of metal waste, respectively (T.R. Ministry of Education, 2009). Because of the increase in
waste amount, the waste hierarchy was developed. It includes the steps of prevent, re-use, recycling, recovery
and disposal (Nilsen, 2017).
Metal wastes are 9.7% of solid wastes and the recycling of metal waste is aimed to increase to 60% by 2023.
Stages of metal waste recycling process are a separate collection, magnetic extraction, smelting factory, recycled
metal, comprises the steps of the new metal products (T.R. Ministry of Environment and Civilization, 2016).
Magnesium wastes and scraps are produced by many industrial activities, all over the world. Most of the
magnesium wastes and scraps occurs from the die casting part of vehicles or molds. Several types of magnesium
waste have identified according to the content of metal and impurity such as high grade clean scrap, chip and
fines etc. Magnesium wastes are combustible and oxidizing materials, therefore it should be careful in usage
(Brown, 2000; Kramer 2002).
Metal phosphates are the useful compounds that have unique applications in industry according to the metal ion
in phosphate structure. Magnesium phosphates especially preferred as catalysts in the process of organic
transformations, and bonding materials in refractors or mortars. Also they can be used in pharmacy, agricultural,
textile or construction industry. Magnesium phosphates can be prepared in hydrates or non-hydrous forms. They
have hydrate types such as MgHPO4·γH2O, Mg2PO4OH·4H2O, Mg3PO4·5H2O, Mg3PO4·8H2O and
Mg3PO4·ββH2O or anhydrous types such as Mg3(PO4)2 and Mg2P2O7 (Aramendia et al., 1999a; Aramendia et al.,
1999b; Kongshaug et al., 2001; Golubev et al., 2001; Sadiq et al., 2008; Boonchom, 2009; Britvin et al., 2002;
Liu et al., 2012; Metres and Ginebra, 2011).
The chemical and physical properties of these compounds depend on the synthesis procedure. Formation of a
compound affected from many factors such as the synthesis method, raw material selection, mole ratio of raw
materials, precipitation agent, pH, reaction temperature and time. In these experiments, the magnesium wastes
were evaluated in the magnesium phosphate synthesis in hydrothermal conditions without using precipitation
agent or additives. The effects of mole ratio on the characterization of synthesized structure was studied.
ORAL PRESENTATION
106
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS AND METHODS
2.1. Materials and Characterization
Metallic Mg wastes are obtained from local gold factory in Turkey. These wastes are formed at the instance of
plastic molding in the manufacturing processes and they are to be stored in the factory. Element content of Mg
wastes were identified with the X-Ray Fluorescence analysis by Philips PANanalytical brand Minipal Model 4
with silicon drift detector (Kipcak, 2012).
Phosphoric acid (H3PO4) is supplied from Merck. Raw materials are used without any pre-treatment.
2.2. Synthesis and Sample Characterization
Synthesis procedure can be explained with the reaction of Mg waste with H 3PO4 at the certain mole ratios in
liquid medium. In these experiments, mole ratios of Mg/H 3PO4 were determined as 1:2, 1:1, 3:2, 2:1. The
magnesium and Samples were synthesized at room temperature without using precipitation agent. The reaction
time of 1 hour was used. After the reaction time ended, the slurry was filtered and dried at 40°C for β4 hours.
The experimental flowchart is shown schematically in Figure 1.
Figure 1. The experimental setup
The possible synthesis reaction is given in Eqs. (1):
3Mg 2H 3 PO4 3H 2 O Mg 3 ( PO4 ) 2 3H 2 O 3H 2( g )
(1)
Samples were identified with the X-Ray Diffraction (XRD) analysis with Philips PANanalytical brand where in
this equipment X-rays are produced from Cu-Kα tube at the parameters of 45kV and 40mA. The particle size of
samples can be calculated from the highest peak in XRD pattern by using Scherrer equation which can be given
in Eqs. (2):
K
t cos( )
(2)
where ί is the line broadening at half the maximum intensity (FWHM), K is a dimensionless shape factor (0.8λ),
ζ is the X-ray wavelength, t is the average particle size of sample and θ is the Bragg angle (Özbay and Gülce,
2014).
The characteristic band values of samples were detected by a Perkin Elmer FT-IR supplied with a universal
attenuation total reflectance (ATR) sampling accessory accommodated with a diamond/ZnSe crystal. The
measurement range was 4000 cm-1 - 400 cm-1.
3. RESULTS
3.1. XRF Results of Magnesium Waste
Element content of magnesium wastes was given in XRF results, in Table 1. According to XRF analysis results;
the major element in the waste composition is magnesium (93.36%) and the minor element is aluminium
(3.67%).
ORAL PRESENTATION
107
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 1. XRF results of the magnesium waste (Kipcak, 2012)
Elements
Content (%)
Mg
93.36
Al
3.67
Fe
0.93
Mn
0.90
Zn
0.88
Cu
0.14
S
0.08
Cr
0.03
Ca
0.01
3.2. XRD Results
As a result of the experiments, no solid precipitate was observed at 1: 2 mole ratio. XRD patterns of samples
synthesized at the mole ratios of 1:1, 3:2, 2:1 were presented in Figure 2.
Figure 2. XRD patterns of samples
According to the XRD results, synthesized samples were identified as the “Newberyite” mineral with the
chemical formula of MgHPO4·γH2O and powder diffraction file number of 01-075-1714. According to the XRD
analyses, waste of Mg could be used in newberyite (MgHPO4·γH2O) synthesis. The characteristic peaks [h k l
(dspacing)] of newberyite are seen at the βθ positions of 14.λβ ° [1 1 1 (5.λ4Å)], 16.6β° [0 β 0 (5.γ4 Å)], 17.γ8° [β
0 0 (5.10 Å)], 18.8γ° [0 β 1 (4.71 Å)], 1λ.77° [1 0 β (4.4λ Å)], β1.45° [1 1 β (4.14 Å)], β4.λ0° [β 0 β (γ.57 Å)],
β5.74° [β β 1 (γ.46 Å)], β8.01° [1 γ 1 (γ.1λ Å)], β8.λ6° [γ 1 1 (γ.08 Å)], γ0.10° [β β β (β.λ7 Å)], γβ.λβ° [γ 1 β
(β.7β Å)], γ4.78° [0 4 1 (β.58 Å)], and γ5.60° [1 4 1 (β.50 Å)] (Sivakumar, β000).
ORAL PRESENTATION
108
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3.3. FT-IR Results
FT-IR spectra of synthesized magnesium phosphates are shown in Figure 3. The characteristic band values over
the 3200 cm-1 can be explained with the OH-1 vibration in the hydrate structure. Vibrational band of θ(PO 2(OH))
is observed in the region of 3100–2800 cm-1. The band values between 1700 and 1600 cm -1 are assigned to the
H-O-H vibration. The symmetrical stretching of PO3- and PO4-3 are seen in the ranges of 1200 – 1100 cm-1 and
1100 – 1000 cm-1, respectively. The bending of PO2(OH) is generally seen at 885 cm-1. The band values lower
than 700 cm-1 can be explained with the out of plane of phosphate ions. (Aramendia et al., 1999a; Boonchom,
2009).
Figure 3. FT-IR spectra of samples
4. DISCUSSION
Reuse of Mg waste is possible according to its purity (Kramer, 2002). In XRF analysis result, its high
magnesium content indicates that the waste is suitable for use as a magnesium source. The absence of a white
precipitate at a molar ratio of 1:1 indicated that the production could occur at higher waste rates. The final pH
values of solution at the end of the reaction can be seen in Table 2. According to the Table 2, pH value of
reaction medium increases with the increasing Mg amount in solution. Therefore, it can be said that ratio of 1:2
is not suitable for the synthesis procedure.
Table 2. The final pH values of reaction medium after the reaction
Mole Ratio (Mg/H3PO4)
pH
1:2
3
1:1
5
3:2
5.2
2:1
5.5
ORAL PRESENTATION
109
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The Scherrer equation is applied on a sharp peak with a narrow width at 100% density. The particle sizes were
calculated for the peak at around β5.74° for each sample. The minor changes were obtained with changing mole
ratios. The average particle size of samples were found as 63.02 nm, 58.61 nm and 70.47 nm for mole ratios of
1:1, 3:2 and 2:1, respectively.
Characteristic stretching of phosphate ions generally seen in the range of 2100 – 700 cm-1. These vibrations are
the symmetrical and asymmetrical stretching of PO3- and PO4-3 anions. Obtain band values from FT-IR are in
good agreement with the literature (Aramendia et al., 1999a; Boonchom, 2009).
5. CONCLUSION
Reuse of waste is a step which is favourable for both the waste hierarchy and environmental health. These
experiments showed that higher mole ratios than 1:1 of Mg/H 3PO4 could be suitable for Magnesium phosphate
preparation without using any pH adjustment or precipitation agent. Prepared phase was identified as the
“Newberyite” mineral with the chemical formula of MgHPO4·γH2O and powder diffraction file number of 01075-1714. Characteristic band values between the P and O atoms were compatible with the literature.
REFERENCES
Aramendia MA, Borau V, Jimenez C, Marinas JM, Romero FJ 1999. Synthesis and Characterization of
Magnesium Phosphates and Their Catalytic Properties in the Conversion of 2-Hexanol. Journal of Colloid
and Interface Science, 217: 288–298.
Aramendia MA, Borau V, Jimenez C, Marinas JM, Romero FJ 1999. Synthesis, Characterization, and Catalytic
Uses of Mg3(PO4)2/MgO Systems. Journal of Colloid and Interface Science, 217: 201–209.
Boonchom B 2009. Kinetic and thermodynamic studies of MgHPO 43H2O by non-isothermal decomposition
data. Journal of Thermal Analysis and Calorimetry, 98:863–871.
Britvin SN, Ferraris G, Ivaldi G, Bogdanova AN, Chukanov NV 2002. Cattiite,Mg 3(PO4)2 · ββH2O, a new
mineral from Zhelezny Mine (Kovdor Massif, Kola Peninsula, Russia). Neues Jahrbuch für Mineralogie,
pp. 160-168.
Brown RE 2000. Magnesium Recycling Yesterday, Today, Tomorrow, Fourth International Symposium on
Recycling
of
Metals
and
Engineered
Materials,
pp.
1317–1329.
http://library.nmlindia.org/FullText/RMEM20007.pdf
Golubev SV, Pokrovsky OS, Savenko VS 2001. Homogeneous precipitation of magnesium phosphates from
seawater solutions. Journal of Crystal Growth, 223:550–556.
Kipcak AS, Senberber FT, Moroydor Derun E, Piskin S 2012. Evaluation of the magnesium wastes with boron
oxide in magnesium borate synthesis. World Academy of Science, Engineering and Technology,
67(1):887-891.
Kongshaug KO, Fjellvag H, Lillerud KP 2001. The synthesis and crystal structure of a hydrated magnesium
phosphate Mg3(PO4)2·4H2O. Solid State Sciences, 3:353–360.
Kramer D. 2002, Magnesium Recycling in the United States in 1998, Flow Studies For Recycling Metal
Commodities In The United States, Available at: https://pubs.usgs.gov/of/2001/of01-166/of01-166.pdf
[Erişim 17.0β.β018]
Liu YH, Kumar S, Kwag, JH, Ra CS 2012. Magnesium ammonium phosphate formation, recovery and its
application as valuable resources: a review. Journal of Chemical Technology & Biotechnology, 88: 181–
189.
Metres G, Ginebra MP 2011. Novel magnesium phosphate cements with high early strength and antibacterial
properties. Acta Biomaterialia 7:1853–1861.
ORAL PRESENTATION
110
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Nilsen H 2017. The Hierarchy of Resource Use in a Sustainable Circular Economy, University of Oslo Faculty
of Law Research Paper, Available at http://dx.doi.org/10.2139/ssrn.2981673 [Erişim 17.0β.β018]
Özbay E, Gülce H β014. Çinko Oksit Nanopartikülleri Sentezi ve Karakterizasyonu, Selcuk University of
Journal of Engineering Science and Technology, 2(4):1-5.
Sadiq M, Bensitel M, Lamonier C, Leglise J 2008. Influence of the nature of precipitating basic agent on the
synthesis of catalytic magnesium phosphate materials. Solid State Sciences, 10:434-437.
Sivakumar GR 2000. Investigations on The Crystallization and Characterization Of Bio-minerals: Calcium and
Magnesium Phosphate, PHD Thesis, Crystal Growth Centre Anna University, Chennai – India. Available
at: http://hdl.handle.net/10603/76888 [Erişim 17.0β.β018]
T.R. Ministry of Education 2009. Environmental protection, solid waste collection, Ankara.
T.R. Ministry of Environment and Civilization 2016. National Waste Management and Action Plan 2023,
Ankara.
ORAL PRESENTATION
111
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Advanced Oxidation of Phenol Derivatives with Fenton and Photo-Fenton Treatment Processes:
Effect of the Surface Water Matrix on Removal Rates, Degradation Products and Acute Toxcity
of 2,4-DCP
Idil Arslan-Alaton1*, Tugba Olmez-Hanci1, Miray Bekbolet2
*1
Istanbul Technical University, School of Civil Engineering, Department of Environmental Engineering,
Istanbul, Turkey
2
Bogazici University, Institute of Environmental Sciences, Department of Environmental Chemistry, Istanbul,
Turkey
Corresponding author e-mail: arslanid@itu.edu.tr
Abstract
In this study the effect of Fenton and Photo-Fenton treatment on the degradation intermediates and acute
toxicity of 2,4-dichlorophenol (0.46 mM), a model phenol derivate and industrial pollutant, was investigated in
pure and simulated surface water. Fenton and Photo-Fenton (optimized treatment conditions: 10 mM H 2O2; 0.2
mM Fe2+, pH=3, t=120 min) processes ensured complete removal of 2,4-dichlorophenol in both pure water and
simulated surface water. Hydroquinone, maleic and formic acids were identified as the common degradation
products of the examined chemical/photochemical treatment processes. The Photo-Fenton process resulted in
faster target pollutant and toxicity removal rates than Fenton treatment. The inorganic constituents (chloride,
sulfate, phosphate, etc.) present in the simulated surface water did not inhibit 2,4-dichlorophenol degradation
under the studied experimental conditions.
Keywords: Phenol derivatives, advanced oxidation processes, Fenton and Photo-Fenton treatment,
degradation products, acute toxicity, synthetic surface water.
1. INTRODUCTION
Phenol derivatives are a diverse group of industrially important chemicals with high production and consumption
rates. At the same time, effluent discharge containing chlorinated compounds is difficult to treat by conventional
methods and in some cases very biotoxic (Sharma et al., 2013; Zazo et al., 2007). Hence, it is expected that
chlorinated pollutants found in water and wastewater have detrimental effects on aquatic and terrestrial
environments (Pimentel et al., 2008). For example, chlorophenols such as 2,4-dichlorophenol (2,4-DCP) are
listed as “priority toxic substances” by the US EPA in the Clean Water Act (USEPA, β016). Considering these
issues, the treatment and control of phenol derivatives in water and wastewater is a major, challenging task and a
vast variety of biological, physical and chemical treatability studies have been reported in the scientific literature
so far (Zazo et al., 2010). Among these, advanced oxidation process (AOPs) deserve special attention, since they
rely on the formation and intermediacy of free radicals (mainly HO ●, HO2●) that strongly and almost nonselectively attack organic and inorganic pollutants found in water and wastewater (Gogate and Pandit, 2004).
Among these, in particular iron-based AOPs have received special attention due to their high performance and
hence superiority in terms of reaction kinetics and removal rates (Neyens and Baeyens, 2003). By UV, near-UV
and even visible light irradiation, it is possible to enhance the Fenton’s reagent and thus accelerate free radical
production. The aqueous ligand-to-metal charge transfer (LMCT) processes in which Fe3+ is reduced and HO is
formed are shown below (Legrini et al., 1993);
Fe(OH)2+* + h → Fe2+ + HO●
photoreduction at 200 < < 450 nm
(1)
*the dominant complex at pH = 2.8.
The intermediacy of Fe3+ complexes is important in the dark (thermal) as well as photo-induced Fenton reactions
(Detomaso, 2003);
ORAL PRESENTATION
112
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Fe2+ + H2O2 → Fe3+ + HO● + OHFe3+ + H2O2 → Fe2+ + HO2● + H+
Fenton’s reagent,
Fenton-like process,
k=63 M-1 s-1
k=2.0 10-3 M-1 s-1
(2)
(3)
UV-C photolysis of H2O2 also contributes to HO● formation (Legrini et al., 1993);
H2O2 → βHO●
(at < 300 nm)
(4)
Due to the fact that iron-based AOPs are very fast and difficult-to-control reactions, it is important to follow
degradation products and aquatic toxicity during their application by employing product analysis and conducting
bioassays. Besides, the presence of different anions (carbonate, bicarbonate, chloride, sulfate, nitrate, etc.)
typically found in real waters, may inhibit AOPs due to competitive/scavenging reactions between these ions and
reactive oxygen species (HO●, HO2●, etc.).
Considering the above mentioned facts, in the present study it was aimed at investigating the degradation of 2,4DCP, which was selected as the model chlorophenol derivate and industrial pollutant, with the Fenton and
Photo-Fenton treatment processes under previously optimized reaction conditions. Experiments were conducted
in pure and simulated (synthetically prepared) surface water to mimic real water / wastewater treatment
conditions. In order to examine the ecotoxicological effect of Fenton and Photo-Fenton treatments on 2,4-DCP,
bioassays were also conducted employing the marine photobacteria Vibrio fischeri (V. fischeri) which is
routinely used standardized procedure to determine and evaluate the acute toxicity of pollutants and their
degradation products.
2. MATERIALS AND METHODS
All chemicals required for the analytical and experimental procedures were at least of analytical grade and
purchased from Merck (Germany) or Riedel-de Haën (Germany). Aqueous β,4-DCP solutions were prepared
with distilled water, whereas for mobile phases, stock and standard solutions doubly distilled water with a
conductivity of 0.055 ηS cm-1 was used (Arium 611UV, Sartorius AG, Germany).
Fenton and Photo-Fenton experiments were performed in pure (distilled) water (PW) and synthetic surface water
(SSW) that was prepared in accordance with Standard Methods (APHA/AWWA/WPCF, 2005) and composed of
a mixture of inorganic salts at typical concentrations encountered in moderately hard freshwaters. The SSW
simulates the potential inhibitory/scavenging effects being expected from common inorganic components of
surface waters. In the Fenton and Photo-Fenton experiments, SSW was spiked with 2,4-DCP prepared from a
stock solution of 4 g L-1 (6 mM) under constant agitation.
2.1 Fenton and Photo-Fenton Experiments
Fenton and Photo-Fenton experiments were conducted in a 3250 mL capacity, cylindrical stainless steel
photoreactor (length: 84.5 cm; diameter: 8.0 cm). The UV-C light source was a 40 W low pressure mercury
vapor lamp being located in a quartz sleeve in the center of the photoreactor. The batch-operated photoreactor
was mixed by means of a peristaltic pump at a flow rate of 25 mL min -1. The incident photon flux at 253.7 nm
was determined as 0.066 ηeinstein cm -2 s-1 by H2O2 actinometry (Nicole et al., 1990).
Fenton and Photo-Fenton experiments were carried out under previously optimized reaction conditions (Karci et
al., 2012). At the beginning of these experiments, the initial pH of the aqueous 2,4-DCP solutions (0.46 mM)
was adjusted to 3.0 using 2 to 6 N H2SO4. The pH was not controlled throughout the experiments. 10 mM H2O2
was introduced from a 35% w/w stock solution to the pH-adjusted, aqueous 2,4-DCP solution. Thereafter, the
photoreactor was filled with the reaction solution by means of a peristaltic pump. FeSO 4·7H2O from a 10%, w/v
(0.36 M) stock solution was also added as the Fe2+ source at a concentration of 0.2 mM as soon as the
photoreactor was completely filled with the reaction solution. Sample aliquots were periodically withdrawn from
the photoreactor and the reactions were immediately quenched upon addition 10 N NaOH solution and filtered
through 0.45 ηm PVDF syringes (Millipore Corp., USA). In this way, iron catalyst was removed from the
solution in the form of Fe(OH)3.
ORAL PRESENTATION
113
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2.2 Analytical and Instrumental Procedures
2,4-DCP, its aromatic (hydroquinone; HQ) and aliphatic (maleic and formic acids) oxidation products were
monitored by HPLC (Agilent 1100 Series, Agilent Technologies, USA) equipped with a diode array detector
(DAD). Operating conditions of the HPLC for the quantification of the selected target compound and its
degradation intermediates have been described elsewhere in more detail (Karci et al., 2012).
Changes in acute toxicity during the application of Fenton and Photo-Fenton treatment processes were measured
by using a commercial assay kit (BioTox™ν Finland) in accordance with an ISO test protocol (ISO, β008). The
reagent was a lyophilised preparation of the marine photobacterium V. fischeri (NRRL B-11177). The assay is
based on the decrease in light emission of V. fischeri resulting from its exposure to the toxicant. Prior to the
assay the pH of all samples was adjusted to 7.0 ± 0.2 with NaOH or H2SO4 solutions. NaCl was added to obtain
a final chloride concentration of 2% (w/v) in the samples. In order to eliminate its positive effect on the toxicity
test results, any unreacted H2O2 remaining in the samples was catalytically decomposed with catalase made from
Micrococcus lysodeikticus (200181 AU mL-1, Fluka, Sweden). The percent relative luminescence inhibition was
measured after 15 min contact time at 15°C and expressed as the percent relative inhibition.
3. RESULTS and DISCUSSION
3.1 2,4-DCP Removals
Figure 1 (a) and (b) presents percent 2,4-DCP removals in PW (a) and SSW (b) being compared for the Fenton
and Photo-Fenton treatment processes, respectively. From Figure 1 it is evident that the photochemically
enhanced Fenton (Photo-Fenton) process is superior in terms of 2,4-DCP removal which was complete in 20
min. In the case of Fenton treatment on the other hand, 2,4-DCP removal was slower and hence achieved at the
later stages of the reaction. 2,4-DCP removal was complete after 40 and 70 min in SSW and PW, respectively.
Surprisingly, in SSW, 2,4-DCP degradation occurred appreciably faster and the difference in 2,4-DCP abatement
rates was particularly evident at the 20-40th min of treatment, where 2,4-DCP removals were obtained in the
range of 40-60% in PW and 80-99% in SSW. Speculatively, secondary radicals such as chloride (Cl●) might
form from the reaction between Cl - and HO● and continue the oxidation of 2,4-DCP and its degradation products
in a more selective and thus less competitive way (Munoz et al., 2012). That depending on the nature and
concentration of the organic/inorganic water components, no negative effect or even an enhancement can be
expected during treatment of micropollutants with AOPs, has already been evidence in former related work
(Parvez et al., 2006).
Apparently, there was no difference between 2,4-DCP removal rates in PW and SSW during Photo-Fenton
treatment, indicating that water constituents were not affecting the target pollutant removal rates. Hence, the
effect of inorganics such as chloride, sulfate or phosphate could be tolerated when 2,4-DCP was exposed to
Photo-Fenton or Fenton treatments. It should also be emphasized here that due to the carbonic acid-bicarbonatecarbonate equilibrium, not significant effect was expected from bicarbonate at pH3.
3.2 Hydroquinone Formation
HQ was one of the common aromatic oxidation intermediates that were identified during Fenton and PhotoFenton treatments of 2,4-DCP. Figure 2 depicts HQ evolutions during Fenton and Photo-Fenton treatment of
2,4-DCP in PW and SSW. As is apparent in Figure 2, HQ evolution started a bit earlier during Photo-Fenton
treatments (at the 6th min of treatment), probably due to the fact that 2,4-DCP removal was faster during the
photochemically enhanced Fenton process. The highest HQ evolution was observed as 0.75 mg/L at the 20 th min
of Fenton treatment in PW. For all studied iron-based AOPs, HQ formed and disappeared within 4 min and 1420 min during Photo-Fenton and Fenton processes, respectively. Obviously, HQ formation and abatement is
closely linked to the water matrix and the studied treatment process.
ORAL PRESENTATION
114
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
100
2,4-DCP Removal, %
80
60
40
PW
(a)
20
0
0
10
20
30
40
50
60
Time, min
Photo-Fenton
Fenton
2,4-DCP Removal, %
100
80
60
40
SSW
(b)
20
0
0
10
20
30
Time, min
Photo-Fenton
40
50
60
Fenton
Figure 4. Percent 2,4-DCP removals obtained during Fenton and Photo-Fenton treatments in pure water (a) and
synthetic surface water (PW, SSW). Experimental, initial treatment conditions: 0.46 mM 2,4-DCP; 10 mM
H2O2; 0.2 mM Fe2+, pH=3, t=120 min.
ORAL PRESENTATION
115
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
0.9
Fenton-PW
Fenton-SSW
Photo-Fenton-PW
Photo-Fenton-SSW
0.8
0.7
HQ, mg/L
0.6
0.5
0.4
0.3
0.2
0.1
0.0
0
10
20
30
Time, min
40
50
60
Figure 2. Hydroquinone (HQ) formation during Fenton and Photo-Fenton treatment of 2,4-DCP in pure and
synthetic surface water (PW, SSW) samples. Experimental conditions are as in Figure 1.
3.3 Maleic and Formic Formation
Maleic and formic acids were the only common aliphatic oxidation intermediates being quantified during Fenton
and Photo-Fenton treatments of 2,4-DCP. Figures 3 and 4 display maleic and formic acid evolution profiles for
2,4-DCP treatment in PW and SSW for the iron-based AOPs, respectively. Generally speaking, maleic acid
evolution occurred faster (within the first 20 min of treatment) during Photo-Fenton treatment, whereas maleic
acid formation and abatement was slightly delayed and continued for as long as 80 min (between 10th and 90th
min of oxidative treatment) during the Fenton process. In the case of formic acid evolution, similar profiles and
trends were obtained as for maleic acid; formic acid formation and subsequent abatement was complete in a few
min (between 1-10th min of treatment) during Photo-Fenton treatment, but occurred later (after 10 min
treatment) and took 80 min for the Fenton process. Former researchers have already demonstrated that Fenton
and Photo-Fenton processes kinetically and mechanistically differ appreciably from each other thus affecting
degradation intermediate evolution profiles (Pérez-Moya et al., 2007) as was also the case in the present study.
3.4 Acute Toxicity Changes
Figure 5 shows changes in percent relative photoluminescence inhibition rates being observed during Fenton and
Photo-Fenton treatment of 2,4-DCP in PW and SSW. From Figure 5 it is clear that the original (t=0 min) acute
toxicity of the sample changed with water matrix and SSW was more toxic to V. fischeri than PW (80% for PW
and 100% for SSW). Acute toxicity results were also in parallel to 2,4-DCP removals since detoxification could
be achieved during Fenton treatment of 2,4-DCP in SSW, but not in PW, where 2,4-DCP removals were also
slower in PW than in SSW. Photo-Fenton treatment generally speaking resulted in quite promising results since
practically complete detoxification could be reached which were quite in line with the 2,4-DCP removal profiles.
Fenton treatment in PW resulted in a relatively poor detoxification rate where relative inhibition decreased from
80% to 55% after 90 min oxidation.
ORAL PRESENTATION
116
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Fenton-PW
Photo-Fenton-PW
3.5
Fenton-SSW
Photo-Fenton-SSW
Maleic Acid, mg/L
3.0
2.5
2.0
1.5
1.0
0.5
0.0
0
20
40
60
80
100
Time, min
Figure 3. Maleic acid formation during Fenton and Photo-Fenton treatment of 2,4-DCP in pure and synthetic
surface water (PW, SSW) samples. Experimental conditions are as in Figure 1.
Fenton-PW
Photo-Fenton-PW
Fenton-SSW
Photo-Fenton-SSW
Formic Acid, mg/L
8.0
6.0
4.0
2.0
0.0
0
20
40
60
80
100
Time, min
Figure 4. Formic acid formation during Fenton and Photo-Fenton treatment of 2,4-DCP in pure and synthetic
surface water samples. Experimental conditions are as in Figure 1.
ORAL PRESENTATION
117
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
100
Inhibition, %
80
60
40
20
0
0
10
20
30
Fenton-PW
Photo-Fenton-PW
40
50
Time, min
60
70
80
90
Fenton-SSW
Photo-Fenton-SSW
Figure 5. Changes in per cent relative V. fischeri inhibition during Fenton and Photo-Fenton treatment of 2,4DCP in pure and synthetic surface water samples. Experimental conditions are as in Figure 1.
4. CONCLUSION AND RECOMMENDATIONS
In the present study, the effect of water matrix being prepared to simulate surface water, was investigated for the
treatment of 2,4-DCP, an industrially important and representative phenol derivative, by two iron-based
advanced oxidation processes, namely the Fenton and Photo-Fenton processes. Results were comparatively
assessed in terms of 2,4-DCP abatement, evolution of hydroquinone (selected as the commonly quantified
aromatic oxidation intermediate), maleic and formic acids (selected as the commonly quantified aliphatic
oxidation intermediates) as well as acute toxicity towards the marine photobacteria V. fischeri. Obtained
experimental findings revealed that Photo-Fenton treatment was superior to the Fenton’s process in terms of β,4DCP removal rates and efficiencies and the simulated surface water sample did not exhibit any
negative/inhibitory affect the treatment performance of the selected chemical and photochemical oxidation
processes. However, the original (initial) acute toxicity increased for the synthetic surface water. Conclusively,
Photo-Fenton but also dark Fenton treatment appeared to be promising and high performance treatment and
detoxification options for the industrial pollutant and phenol derivative 2,4-DCP even in real water samples.
ACKNOWLEDGEMENTS
The authors thank Dr. Akin Karci for his contribution to the experimental work as well as the Scientific
and Technological Research Council of Turkey for their financial support under Project Nr. 111Y145.
REFERENCES
American Public Health Association/American Water Works Association/Water Environment Federation 2005.
Standard methods for the examination of water and wastewater. 21 st Edn., APHA/AWWA/WPCF,
Washington, DC.
Detomaso A, Lopez A, Lovecchio G, Mascolo G, Curci R 2003. Practical applications of the Fenton reaction to
the removal of chlorinated aromatic pollutants. Environmental Science and Pollution Research, 10:379384.
ORAL PRESENTATION
118
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Gogate PR, Pandit AB 2004. A review of imperative technologies for wastewater treatment I: oxidation
technologies at ambient conditions. Advances in Environmental Research, 8:501-551.
International Organisation for Standardization 2008. Water quality: Determination of the inhibitory effect of
water samples on the light emission of Vibrio fischeri (luminescent bacteria test) Part 3: Method using
freeze-dried bacteria, ISO 11348-2, Geneva.
Karci A, Arslan-Alaton I, Olmez-Hanci T, Bekbölet M β01β. Transformation of 2,4-dichlorophenol by
H2O2/UV-C, Fenton and photo-Fenton processes: oxidation products and toxicity evolution. Journal of
Photochemistry and Photobiology A: Chemistry, 230: 65-73.
Legrini O, Oliveros E, Braun AM 1993. Photochemical processes for water treatment. Chemistry
Reviews, 93:671-698.
Munoz M, de Pedro ZM, Pliego G, Casas JA, Rodriguez JJ 2012. Chlorinated byproducts from the Fenton-like
oxidation of polychlorinated phenols, Industrial Engineering Chemistry Research, 51:13092-13099.
Neyens E, Baeyens J 2003, A review of classic Fenton’s peroxidation as an advanced oxidation technique,
Journal of Hazardous Materials, B98:33-50.
Nicole I, de Laat J, Dore M, Duguet JP, Bonnel C 1990. Use of UV-radiation in water treatment-measurement of
photonic flux by hydrogen-peroxide actinometry. Water Research, 24:157-168.
Parvez S, Venkataraman C, Mukherji S 2006. A review on advantages of implementing luminescence inhibition
test (Vibrio fischeri) for acute toxicity prediction of chemicals. Environment International, 32:265-268.
Pérez-Moya M, Graells M, del Valle LJ, Centelles E, Mansilla HD 2007. Fenton and photo-Fenton degradation
of 2-chlorophenol: multivariate analysis and toxicity monitoring. Catalysis Today, 124:163-171.
Pimentel M, Oturan N, Dezotti M, Oturan MA 2008. Phenol degradation by advanced electrochemical oxidation
process electro-Fenton using a carbon felt cathode. Applied Catalysis B: Environmental, 83:140-149.
Poulopoulos SG, Nikolaki M, Karampetsos D, Philippopoulos CJ 2008. Photochemical treatment of 2chlorophenol aqueous solutions using ultraviolet radiation, hydrogen peroxide and photo-Fenton reaction.
Journal of Hazardous Materials, 153:582-587.
Sharma S, Mukhopadhyay M, Murthy ZVP 2013. Treatment of chlorophenols from wastewaters by advanced
oxidation processes. Separation and Purification Reviews, 42:263-295.
Stalter D, Magdeburg A, Weil M, Knacker T, Oehlmann J 2010. Toxication or detoxication? In vivo toxicity
assessment of ozonation as advanced wastewater treatment with the rainbow trout. Water
Research, 44:439-448.
Zazo ZA, Casas JA, Molina CB, Quintanilla A, Rodriguez JJ 2007. Evolution of ecotoxicity upon Fenton’s
oxidation of phenol in water. Environmental Science and Technology, 41:7164-7170.
United States Environmental Protection Agency 2016. Effluent Guidelines-Toxic and Priority Pollutant under
the Clean Water Act. Available at: https://www.epa.gov/eg/toxic-and-priority-pollutants-under-cleanwater-act [Erişim 14.0β.β018]
ORAL PRESENTATION
119
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Extraction and Purification of Extracellular Glucosyltransferase (GTFs) from Streptococcus mutans
Serotype C Isolate (H5)
1
Essam F. A. Al-Jumaily *, Hashim M. Z. AL-Seubehawy2 and Faris A. Al-Toraihy2
*
Biotechnology Dept. Genetic Engineering and Biotechnology Institute for post graduate studies, Baghdad
University- Baghdad-Iraq
2
Veterinary Medicine Research Center-Industry and Mineral Ministry, Baghdad-Iraq
Corresponding author e-mail:Samgen992003@Yahoo.com
Abstract
The Streptococcus mutans isolates were tested for production of extracellular Glucosyltransferase (GTF) through
determination of their enzyme specific activity. All isolates were able to produce the enzyme; Streptococci
isolate (H5) which identified as Streptococcus mutans serotype C was selected as the best producible isolate for
GTF with a specific activity of 2.6 U/mg. It was found that GTF of the chosen isolate (H5) was produced during
the middle stationary phase (18-35 hr.) and its maximal productivity was reached at 22 hr. Purification of S.
mutans serotype (C) H5 GTF were done by ammonium sulfate, ion-exchange chromatography (DEAE-Sephacel
column), and gel-filtration chromatography using Sepharose 6B column. The best percent saturation use for
precipitating GTF by ammonium sulfate was 20-40% with specific activity 2.4 U/ml. Two purified GTF
enzymes (GTF-I and GTF-II) were detected with specific activity 35.5 U/mg, 8.3 U/mg after 96.1, 22.6 fold of
purification respectively with yield 17.2%. Determination of purified GTF (GTF-I, GTF-II) molecular weight
was done by using gel-filtration chromatography (Sepharose 6B) column with presence of standards proteins. It
was found that the molecular weight of GTF-I, GTF-II was 125819, 112201 dalton, respectively.
Keywords: Glucosyltransferase, DEAE-Sephacel column, molecular weight, Sepharose 6B.
1.Introduction
S. mutans synthesis exocellular polysaccharide (EPS) i.e. glucan, from the glucosyl residuse of sucrose by
secretion glucosyltransferase (GTFs). It is well known that S.mutans has at least three GTFs (GTF-B, C, and D)
(Nishimura, et al., 2012). GT-B and D mainly synthesize water-insoluble α-(1-3) - and water soluble α-(1-6)glucan. GTF-C associates with insoluble and soluble glucan synthesis, which is controlled by the genes gtfB,
gtfC, and gtfD (Koo et al., 2010). The gtfB and gtfC genes are tandomly arranged on S. mutans chromosomal
DNA. (Ueda and Kuramitsu, 1988). The nucleotide sequences of gtf genes from different oral streptococci
comply with the same basic pattern. The GTFs are very large proteins of approximately 1300- 1700 amino acids
long (Devulapalle et al., 1997). Streptococcal GTFs have two common functional domains. The amino-terminal
portion, the catalytic domain, is responsible for the cleavage of sucrose, and the carboxyl-terminal portion, the
glucan binding domain, is responsible for glucan binding (Colby and Russell, 1997). In addition the two genes
share extensive nucleotide sequence homology. The primary amino acid sequences of the streptococcal GTF
enzymes are highly homologous. The synthesis of extracellular water-insoluble glucans from sucrose is
necessary for the formation of dental plaque by S. mutans (Hamada and Slade, 1980). It is generally understood
that this polymerization is catalyzed by two types of extracellular glucosyltransferase one synthesizing a watersoluble product from sucrose (GTF-S) and another synthesizing water-insoluble product from sucrose (GTF-I).
These two types of GTF, when combined, synthesize a complex, highly branched, adherent, water-insoluble
glucan (Walker, 1978). The development of dental caries has been an important topic in oral microbiology
research for several decades. In both experimental animals and man, this role is mediated by the ability of these
microorganisms to produce extraellular and cell-associated glucosyltransferase (GTF;EC 2.4.1.5) enzymes,
which in turn, synthesize water-soluble and insoluble glucan from sucrose (Kuramitsu, 1975). The insoluble
glucans that are involved in the adherence of S. mutans to the surface of the teeth. The attachment of S.mutans to
smooth surfaces is primarily a consequence of the ability of these organisms to synthesize insoluble glucan
products from sucrose therefore, the enzymes involved in this conversion glucosyltransferase GTF, play a key
role in the initiation of dental plaque formation and subsequent caries development (Kurmatsu and Ingersoli
1976). Therefore recent studies to develop new strategies these are using specific drug vaccine. S.mutans
possesses various cell-surface substances, which it is including serotype specific polysaccharide antigens,
lipoteichoic acid, glucosyltransferase, glucan- binding protein, antigen D,A,C. These cell-surface molecules are
thought to play important roles in interaction between the organism and its host and have been given much
ORAL PRESENTATION
120
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
attention as vaccine candidates agent dental caries (Kruger, 2004). Glucosyltransferase and fragment of the
molecules have been used as immunogenic agent (Culshaw et al.,2007).
The aim of the study was to Purification and description of two kinds of glucosyltransferase enzyme from the
local isolate Streptococcus mutans (serotype C) for the purpose of preamble as immunogens.
2.MATERIALS AND METHODS
Extraction GTF of Streptococcus mutans
It was prepared by modification the method was described by Hamada et al. (1989) and as followed: Bacterial
isolates was grown on the brain heart infusion agar medium and incubated anaerobically at γ7 ᵒC for 48 hrs. A
stock culture suspension was prepared by a separated loopful colony in 10 ml brain heart infusion broth and
incubated anaerobically at γ7 ᵒC to reach the optical density of spectrophotometer to 0.75. A 1ml % of this stock
culture was inoculated in to 180 ml Todd-Hewitt broth, supplemented with 1.8 % glucose and incubated
anaerobically for β4 hrs. at γ7ᵒC, after this period broth culture was cooling centrifuge at 1000 xg for β0 minutes
at 4ᵒC. The culture supernatant was precipitated with Ammonium sulfate at 40% saturation and kept overnight at
5Cᵒ. The sediment obtained by centrifugation was dissolved in β5 ml of distilled water and dialyzed in one liters
of 0.05 M phosphate buffer pH 6.8 overnight. Total protein had measured by the Bradford (1976). Then the GTF
activity estimated.
GTF Activity Assay
GTF activity had estimated according to the modification method described by Al-Hebshi et al (2005): The
-fold
dilutions of the crud bacterial enzyme (final concentration 1–0.01% w/v). The mixture was incubated at γ7ᵒCfor
2 hrs. Water-insoluble glucans were precipitated by centrifugation at 10,000g for 5 min. The supernatant was
then transferred to another tube and water-soluble glucans precipitated by adding 1 ml 100% ethanol followed by
n and
centrifugation as above. The glucan pellet was hydrolyzed by boiling in 300–
then neutralized by addition of an equal amount of 1 M NaOH. Finally, glucans were quantified using the
phenol-sulphuric acid method.
Purification of GTFs by Ion Exchange Chromatography
The exchanger DEAE sephacel was prepared and packed into a column according to the recommendation of the
manufacturing company (Sigma-Germany) as follows: DEAE sephacel is supplied pre-swollen in 24% ethanol.
Prepare a slurry by decanting the 24% ethanol solution and replaced it with starting buffer in a ratio of 75%
settled medium to 25% 20 mM tris-bis buffer pH 8.2 after this step degassing the medium and pour the slurry in
to the column 7.5x3.5 cm, then the column equilibrated with the same buffer overnight. Partially purified
concentration GTF 15ml were separately passed after loaded onto the column carefully. Then 100 ml of 20 mM
Tris-bis buffer pH 8.2 was added. Flow rate estimated as 50 ml / hr. proteins were eluted by using 200 ml of a
gradient from 0.5-1 M sodium chloride. Fractions of 5ml were collected and absorbency was monitored at 280
nm. The GTFs were estimated from each fraction of the major peaks as in (3.2.10) then protein concentration
and specific activities were determined for the collected active fraction.
Purification of GTFs by Gel Filtration Chromatography
Sepharose 6B column 75 x 1.5cm was prepared and packed according to the instruction of the manufacturing
company (Fluka) the column was equilibrated with 50mM phosphate buffer PH 7.5 at a flow rate of 50 ml / hr.
A 10 ml sample of each concentrated partially purified GTFs was added to the column. Elutions of proteins were
done with the application of 150 ml of 50 mM phosphate buffer PH 7.5. A 5 ml fraction was collected for each
GTF then protein concentration was estimated by measuring the absorbency at 280 nm. GTF activity was
determined for each fraction of the major peaks. Protein concentration and specific activities were also
determined.
Determination of Molecular Weight of GTFs by Gel Filtration Chromatography:
1.Determination of the Void Volume of the Column
It was prepared by using Sepharose - 6B column 70 × 1.5 cm and peaked according to the recommended of the
manufacturing company. The column was equilibrated with 50 mM phosphate buffer pH 7.5and with a flow rate
of 48 ml / hr. blue dextran 2000 solution, was passed through the column then 200 ml of 50 mM phosphate
buffer pH 7.5 was added to the column. Fractions of 5 ml were collected. The absorbency at 280 nm for each
ORAL PRESENTATION
121
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
fraction was measured. The void volume (V o) was determined by the estimation of total volume of fraction as
characterized with start point movement of the blue dextran to that of climax of absorbency of the blue dextran.
2.Determination of GTFs Elution Volumes (Ve)
A 5 ml of partial purified GTFs samples were passed separately through Sepharose- 6B column 70 × 1.5 cm, and
200 ml of 50 mM phosphate buffer pH 7.5 with a flow rate 48 ml / hr. were passed through the column.
Fractions of 5 ml were collected. The elution volumes (V e ) were estimated separately for each separated and
dissolved fractions of purified GTFs by following the absorbency at 280 nm.
3.Mesurment of Standard Proteins Elution Volumes (V e)
It was prepared by using several standard proteins ( Inulin with MW 5000 Dalton, Casein with 32500 Dalton,
Bovine serum albumin with MW 67000Dalton and Catalase with 232000 Dalton )were passed through
Sepharose 6B column, and then eluted with (50 mM) phosphate buffer (pH 7.5) with a flow rate of (48 ml / hr.).
The elution volume was calculated for each standard protein by following the absorbency for the separated
fraction at wave length 280 nm then the ratio of (V e / Vo) was calculated for each standard protein and for the
dissolved and separated fractions of partial purified GTFs , then standardization was done, by plotting the elution
volume of each standard protein to the void volume of the blue dextran 2000 versus the log of each standard
protein molecular weight (Stellwagen, 1990) and thus the molecular weight of GTFs were accordingly
calculated.
3.RESULTS
The production of the enzyme from the streptococcus species of the isolates has done. From seventeenth isolates
only twelve isolates is selected which depending on their productivity. It’s appeared from the results show in
table (2) that all selected isolates are capable of producing an extracellular GTF enzyme and cell-associated GTF
enzyme. Protein concentration and activity of GTF for isolates are made, and it’s found that specific activity of
GTF are ranged between (0.54 - 2.6 U/mg protein). The specific activities of GTF of isolates (H1, H2, H3, H5, H6,
H16, H21, and H28) are very approached to each other thus the conformation is made according to the choose the
highest GTF producible bacteria among them.
Table (2) GTF Production from Different Mutants Streptococci Isolate
Enzyme
Protein
No
Symbols
Serotype
Activity
Conc.
(U/ml)
Specific Activity
(U/mg)
1
H1
Other
32.8
20
1.64
2
H2
Other
27.8
22.3
1.24
3
H3
C
55.6
22.2
2.5
4
H5
C
65.7
25
2.6
5
H6
C
45.6
33.2
1.37
6
H9
Other
42.6
44.8
0.95
7
H10
Other
22.9
35.8
0.63
8
H16
Other
32.9
19.3
1.7
9
H17
C
19.4
23.5
0.82
10
H21
C
36.2
31.9
1.13
11
H24
C
26.9
33.9
0.79
12
H28
Other
44.2
39.8
1.11
ORAL PRESENTATION
122
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Specific activity
(Unit / mg )
The extraction of GTF from these isolates is repeated for them in 10 ml BHI broth medium and again determined
protein concentration, specific activity. Result has shown in figure (1) indicate that all isolates are capable to
produce an extracellular GTF enzyme and the specific activities of GTF for all isolates are ranged between
(0.54-2.6 U/mg protein) and the isolate (H5 )serotype C has the highest GTF specific activity (2.6 U/ mg protein),
wherefore it is chosen H5 for large scale production and other characterization of GTF enzyme.
3
2
1
0
1
H1
2 H5 3
4
5 H76
H6
7H15 8
9
10 H21
H16
H28
ISOLATES
Figure (1): The
Abilities
of
the
Mutans Streptococci
Bacterial Isolates to
Express GTF
Production Phase of GTF
2
1,8
1,6
1,4
1,2
1
0,8
0,6
0,4
0,2
0
3
Absorbance
2,5
2
1,5
1
0,5
Enzyme Activity U/ml
Absorbance at 600 nm
In order to determine production phase for the isolate H 5 growth curve. Figure (2) appeares that no change in
Absorbance through the first 6 hrs. This happenes ordinary because the lag phase of bacterium need to
normalized the nutrition of medium. After this period absorbance began to rise in term 9 hrs. This period
represented the log phase still the bacteria no produced the enzyme target, in the middle of stationary phase it is
shown the first GTF activity exactly in the 18 hrs. The figure (2) has shown that the maximum production of
GTF activity is in the hour (22).
0
0
10
20
30
Incubation Time (hrs)
40
50
Figure (2): Production Phase and GTF Activity of Streptococcus mutans (H5) Serotype C.
Purification of GTF by Ammonium Sulfate
The result has shown in table ( 3 ) indicated that best percent saturation used for precipitate GTF enzyme
by ammonium sulfate was 20-40 % , it is estimated specific activity 2.4 U/ml while 60% saturation gave 0.6
U/ml and 20% saturation no activity is shown.
Purification of GTF by Ion-Exchange Chromatography
Purification of GTF enzyme by using ion- exchange chromatography DEAE-Sephacel. The concentrated
sample from previous step (crud) 15 ml is passed separately through the DEAE Sephacel column. Two peaks are
shown which represented by fraction peak I 39-42 and fraction peak II 45-47. Each fraction obtained from all
fraction of enzyme sample which represented the peaks after washing and elution processes are tested for GTF
ORAL PRESENTATION
123
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
activity and thus its clearly that only fraction peak I 39-42 and fraction peak II 45-47 are able to appeared GTF
activity 4.2 and 7.2 U/ml respectively. (Figure 3)
These two peak fraction of enzyme sample are collected each separately and named GTF-I and GTF-II
respectively. Protein concentration, GTF activity and specific activity are estimated for each one of them. Result
has shown in table (3) indicated that the amount of 85.7 U/ml, 54.7 with a Protein concentration of 19.5 mg/ml,
7.5 mg/ml and specific activity of 4.3 U/mg, 7.8 U/mg with purification fold of 6.1, 11.1 and yield of 10.4, 6.6
are obtained respectively for GTF- I (peak I) and GTF-II (peak II). According to these result two GTF enzymes
(GTF-I, GTF-II) are obtained after purification with ion-exchange chromatography.
Elution
Washing
0,125
0.25 M
0,1
8
7
6
5
4
3
2
1
0
1M
0. 5 M
0,075
0,05
0,025
0
0
5
10
15
20
25
30
35
40
45
50
55
Enzyme Activity U/ml)
Absorbancu at 280 nm
Absorbance
Fraction No.
Figure (3): Purification of GTF Enzyme by Ion-Exchange Chromatography DEAE- Sephacel Column 12 x 3
cm. The Column Was Washed by Using 50mM Phosphate Buffer pH 7.5 and then Eluted by Using a Gradient of
0.25 M to 1 M NaCl .
Purification of GTF by Gel-Filtration Chromatography
Purification of GTF enzyme by gel-filtration chromatography Sepharose- 6B column. A 10 ml of
concentrated partially purified GTF-I and GTF-II has taken from the purification previous step both is added
separately to the column, the elution of proteins is done by 200 ml of 50mM phosphate buffer pH 7.5. Results
have shown in figure ( 4 , 5 ) indicate clearly two peaks (one for GTF-I and one for GTF-II) represented by
fraction 23-27, 25-29 respectively. It is determined GTF activity for two peaks which indicate that two fraction
are able to produced GTF enzyme. Two fractions are pooled separately for each enzyme then GTF activity;
protein concentration and specific activity are estimated. Result has shown in table ( 3 ) indicate that GTF-I and
GTF-II are able to reflect GTF activity, protein concentration and specific activity of 27.2 U/ml, 97.8 U/ml; 3.25
mg/ml, 2.75 mg/ml, 8.3 U/mg, 35.5 U/mg after 11.8, 50.7 fold of purification and yield of 1.6%, 5.9% of GTF
respectively.
ORAL PRESENTATION
124
Absorbanc at 280 nm
0,35
9
8
7
6
5
4
3
2
1
0
protein con.
Enzyme activity
0,3
0,25
0,2
0,15
0,1
0
10
20
30
40
Fraction No.
Enzyme activity (U/ml
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
50
Figure (4): Purification of GTF-I by Gel Filtration Chromatography Sepharose 6B.
40
35
protein con.
1
30
Activity
0,8
25
0,6
20
15
0,4
10
0,2
5
0
Enzyme Activity U/mg
Absorbanc at 280 nm
1,2
0
0
10
20
Fraction No.
30
40
Figure (5): Purification of GTF-II by Gel-Filtration Chromatography Sepharose- 6B.
Table (3): Purification Scheme and Yield of GTF Enzyme from Streptococcus mutans (Serotype
C)
Volume
(ml)
Enzyme
Activity
(U/ml)
Total
Activity
(U)
Protein con.
mg/ml
Specific
activity
(U/mg)
Yield
(%)
Fold
500
21.6
10800
57.3
0.37
100
1
40
165
6600
48.2
3.4
61.1
9.25
Peak I
20
108.5
2170
26.4
4.1
20.09
11.08
Peak II
20
54.7
1094
7.5
7.2
10.1
19.7
Peak I
15
27.2
408
3.25
8.3
3.7
22.6
Peak II
15
97.8
1467
2.75
35.5
13.5
96.1
Step
Crude Enzyme GTF
Culture Supernatant
Ammonium Sulfate
20-40 %
DEAE-Sephacel
Column
Chromatography
Gel- Filtration
Sepharose 6B
ORAL PRESENTATION
125
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Estimation of Molecular Weight of Glucosyltransferase
The purified two GTFs GTF-I, GTF-II are obtained from applied Sepharose- 6B. The void volume (Vo) of the
column is estimating by determined the void volume of blue dextran 2000 and the elution volume (Ve) for each
standard protein and then for the separated fraction of GTF-I, GTF-II and CA-GTF each separately. It is
calculated the ratio of Ve of each standard protein and separated fraction of each partial purified GTF-I, GTF-II
to the void volume of the blue dextran 2000. GTF-II are about 1.60, 1.73 and 1.82 respectively. GTF-I and
GTF-II have approached Ve / Vo ratio which located between bovine serum albumin 67000 Dalton and catalase
232000 Dalton and thus it is appeared that the molecular weight of purified GTF-I and GTF-II is determined as
125891 Dalton and 112201 Dalton figure (6 ). Streptococcus mutans H5 (serotype C) is able to produce two
glucosyltransferase enzymes GTF-I and GTF-II and has different molecular weight and it is supposed that the
lower-molecular-weight fraction synthesized water soluble glucan, whereas the higher molecular weight
fractions synthesized water-insoluble glucans.
protein standard
5,5
▲ GTF-I
MW 112201 Dalton▲
Log Molecular wight
5
● GTF-II
MW 125891 Dalton
4,5
Catalase MW 232000 Dalton
■
Bovine serum albumin
Casein MW 23500 Dalton
4
Inulin MW 5000 Dalton
3,5
3
0
1
2
3
4
5
Ve / Vo ratio
Figure (6 ): Standardization of GTF Enzymes Accordance to The Ratio of Void and Elution
volume (Ve / Vo) Ratio .
4. DISCUSSION
According to the table (3) all isolates bacteria of mutans streptococci and serotype belonged this
bacteria are capable to secret GTF, this result applied with numerous reports that confirmed mutans
streptococci serotypes (A,B,C,D,F and G), S. salivarias and S. sanguis are capable to express several
GTF types (Hamada et al., 1989).
Form the Figure (1) AL-Jumaily et al (2009) indicated also that all isolates (mutans streptococci)
are capable to produce an extracellular GTF enzyme but the specific activities of GTF for all isolates
are ranged between 0.083-0.51U/mg protein as well as they indicated that all serotypes of mutans
streptococci bacteria are capable to express GTF. Al- Mudallal, (2008) found that GTF activity
extracted from S. sobrinus is noticed after 20 hrs and reached its maximum production during late
stationary phase 24 hrs. The GTF activity continues until the 35 hrs. Then no activity is noticed. The
expression and activity of the GTF enzymes can be influenced by several environmental conditions,
including pH, ion concentration, availability of acceptor molecules and oxidation reduction potential
(Narisawa, 2010). In the batch culture case as in this experiment the carbohydrate sources present in the
ORAL PRESENTATION
126
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
medium beian to degradation, when the growth curve reaches to the late stationary phase, converting to
the lactic acid during the Embeden Myerhove Pathway (EMP), therefore the pH of medium is
decreased and reached to (3-4), this pH value is inconvenient for the GTF production then the
production of GTF is detracted because the optimum condition to produce this enzyme approximately
about pH 6-7.
There are numerous reports and studies have been suggested that different strains of MS
produced at least two kinds of extracellular GTF enzymes as Streptococcus mutans and it has been
described on the basis of the formation of glucosyl linkages catalyzed by them (Fukui et al., 1983).
Yamashita et al , (1988) obtained three major GTF fraction from the supernatant fluid of culture of
strain S.mutans (serotype g), also AL-Mudallal et al. (2010) described three type of glucosyltransferase
obtained after purification with ion exchange chromatography.When comparative with result of ALHayali, (β00β) who’s conclude that Streptococcus sobrinus has the ability to produce three types of
GTF after the purification step by using Sepharose C1-6B and his evaluate of purification of this step
for the third GTF reflected that GTF activity, protein concentration and specific activity of 0.20 U/ml,
0.09 mg/ml and 2.3 U/ml after 153.3 fold of purification with yield of 20.8% respectively. ALMudallal, (2006) described three kind of GTF of S. sobrinus (serotype g) and she determined molecular
weight by using Sephacryl S-200, two of them are isozyme (same molecular weight) 128882 Dalton
and the third has186208 Dalton.
5. CONCLUSION
We can conclude from this study that the S.mutans (serotype C) is the most isolated bacterial
species of mutans streptococci from the human dental plaque, and also other serotypes of mutans
streptococci bacteria are able of producing two types of glucosyltransferase, extracellular GTF and cellassociated.
REFERENCES
Al-Hayali AM 2002. Isolation and purification of glucosyltransferase from mutans streptococci and
the relation to dental caries, dental plaque and parameters of saliva. Ph.D. Thesis, College of
Dentistry, University of Baghdad.
AL-Hebshi NN, Nielsen Q, Skaug N 2005. In vitro effects of crude khat extracts on the growth,
colonization, and glucosyltransferases of Streptococcus mutans. Acta Odontologica
Scandinavica,; 63: 136–142.
AL-Jumaily EF, AL-Mudallal NH, AL-Muhimen NA, AL-Shaibany AW 2009. Evaluation of mutans
streptococci local strains for production of glucosyltransferase enzyme. J. Duhok Univ. V.12, (1):
227-232.
Al-Mudallal, Nada Hisham Abd Al-Lateef (2006). Characterization of glucosyltransferase of mutans
Streptococcus sobrinus (serotype G):Functional and immunological assessment. Thesis, college
of Science, Al-Nahrain University.
AL-Mudallal, N. H., AL-Jumaily, E. F., Abdul-Muhymen, N. and AL-Shaibany, A. W. (2010).
Isolation and purification of glucosyltransferase from mutans streptococcus Sobrinus (serotype g)
local isolate. Iraq J. of Medical Science V. 8 ( 4): 10-18
Barrientos S, Rodriguez A 2011. Production of glucosyltransferase B and glucans by Streptococcus
mutans strains isolated from caries-free individuals.Acta Odontal. V. 24 (3): 258-264.
Bradford MM 1976. A rapid and sensitive method for the quantitation of microorganism's protein
utilizing the principleof protein-dye binding. Analytical Bioch. V. 72: 248-254.
Colby SM, Russell RRB 1997. Sugar metabolism by mutans streptococci. J. Appl. Microbiol. V.83:
80-85.
Culshaw S, Larosa K, Tolani H,Han X, Eastcott JW, Smith DJ, Taubman MA 2007.Immunogenic and
protective potential of mutans streptococcul glucosyltransferase peptide constructs selected by
major histocompatibility complex class II allele binding . Infect.Immun.V.75:915-923.
ORAL PRESENTATION
127
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Devulapalle KS, Goodman SD, Ann Hemsley Q, Mooser G 1997. Knowledge-based model of a
glucosyltransferase from the oral bacterial group of mutans streptococci. J.protein science V. 6:
2489-2493.
Fujiwara T, Tero Y, Hoshino T, Kawabata S, Ooshima T, Sobue S, K[mura S, Hamada S 1989.
Molecular analysis of glugosyltransferase genes among strain of streptococcus mutans. FEMS
Microbiol. Lett. V.161: 331-336.
Fukui K, Kokeguchi S, Kato K, Miyake Y, Nogami R, Moriyama T 1983. Immunochemical properties
of glucosyltransferase from Streptococcus mutans. Infection and Immunity, V. 39: 762-766.
Hamada S,Slade HD 1980.Biology.Immunology, and cariogenicity of Sreptococcus
mutans.Microbiological Reviews. V.44:331-384.
Hanada N, Takehara T, Saeki E 1987. Purification and characterization of third glucosyltransferase
from Streptococcus mutans serotype g . J. of General Microbiology. V. 133: 1351-1358.
Islam B, Khan SN, Khan AU 2007. Dental caries: From infection to prevention. Med. Sci. Monit.
V.13(11): 196-203.
Koo H, Duarte S, Murata R, Scott-Anne K, Gregori S,Watson G, Singh A, Vorsa N 2010. influence of
the carenberry proanthocyanidins on formation of biofilm by Streptococcus mutans on salivacoated apatitic surface and on dental caries development in vivo. Caries Res. V. 44:116-126.
Kruger C,Pearson SK, Kodama Y, Vacca-Smith A, Bowen WH 2004. The effects of egg derived
antibodies to glucosyltransferases on dental caries in rats. Caries Res. V.38: 9-14.
Kuramitsu HK 1975. Characterization of extracellular glucosyltransferase activity of streptococcus
mutans. Infect. Immun. V.12: 738-749.
Kuramitsu H, Ingersoli L 1976 .Immunological relationships between glucosyltransferase from
streptococcus mutans serotyps .Infection and Immunity, 636-644.
McCabe MM 1985. Purification and characterization of a primer-independent glucosyltransferase from
Streptococcus mutans 6715-13 mutant 27. Infection and Immunity, V.50 (3): 771-777.
Monchois V, Willemot RM, Manson P 1999. Glucan-sucrases: mechanism of action and structurefunction relationships. FEMS Microbiology review, V. 23: 131-151.
Nishimura J, Saito T, Yoneyama H, Bai LL, Okumura K, Isogai E 2012. Biofilm formation by
streptococcus mutans and related bacteria. Advanced in Microbiology. V2 :208-215.
Narisaw N 2010. Development characterization and ecological implication of a smooth colony variant
forming cariogenic streptococcus mutans . J.Oral Biosei. V.52(3) 245-251.
Stellwagen K 1λλ0. Gel filtration. Inμ “Methods in Enzymology” (Dentscher) M.P. (edt.) Academic
Press, New York V. 182:327-328..
Takada K, Fukushima K 1986. Effect of certain salts on glucosyltransferase synthesis by streptococcus
mutans strain PS-14. J. Dent. Res.No. V.3: 452-455.
Ueda S, Kuramitsu HK..1988. Molecular basis for the spontaneous generation of colonization –
defective mutans of streptococcus mutans. Mol. Microbiol.V. 2: 135-140.
Walker GJ 1978. Dxtrans. Int. Rev, Biochem. V.16: 75-126.
Yamashita Y, Shigeoka T, Hanada N, Takehara T 1988. Immunological properties of the primerindependent glucosyltransferase of Streptococcus mutans serotype d and g. J. of General
Microbiology, V. 134, 1232-1227.
ORAL PRESENTATION
128
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Sediment Yapısının Tubifex tubifex’in Biyokimyasal Kompozisyonu Üzerine Etkisi
Pınar ÇELİK*
Çanakkale Onsekiz Mart Üniversitesi, Deniz Bilimleri ve Teknolojisi Fakültesi, Çanakkale, Türkiye.
*
Sorumlu yazar e-mail: pinarcelik@comu.edu.tr
Özet
Tubifex tubifex oligochaeta alt sınıfına dahil olan bir tatlısu solucanı türüdür. Aynı zamanda, T. tubifex tatlısu
akvaryum balıklarının beslenmesinde yaygın olarak kullanılan bir canlı yem türüdür. Balıkların büyümesinde
ve üremesinde oldukça etkili ve verimli bir protein kaynağıdır. Günümüzde tüketiciye sunulan T. tubifex’in
neredeyse tamamı doğadan toplanmaktadır. Bu türün kontrollü şartlarda yoğun bir şekilde kültüre alınması ile
ilgili deneysel çalışmalar devam etmektedir. Bu çalışmada, kültür şartları hakkında pek fazla bilgi
bulunmayan T. tubifex solucanları farklı sediment ortamlarında tutulmuşlar ve besin kompozisyonlarındaki
değişimler gözlenmiştir. Bunun için, volkanik toprak, zeolit, 0.5-1mm kuartz kum, 1-3mm kuartz kum, 35mm kuartz kum, normal deniz kumu ve yumurta kartonu gibi yedi farklı materyal sediment olarak
kullanılmıştır. Kapalı devre çalışan akvaryumlarda yapılan deneme 60 gün sürmüştür. 60 günün sonunda
grupların biyokimyasal kompozisyonları, amino asit ve yağ asit seviyeleri ölçülmüş ve gruplar arasında
karşılaştırma yapılmıştır. Denemelerin sonunda en yüksek protein (%5β,57±0,67) ve en yüksek yağ
(11,67±0,γ1) içeriğinin, sediment olarak γ-5mm kuartz kumun kullanıldığı grupta olduğu tespit edilmiştir.
Doymamış yağ asit seviyelerinin bütün gruplarda benzer ve sabit değerlerde olduğu görülmüştür. Toplam
amino asit seviyelerine göre ise en yüksek değerlerin γ-5mm kuartz kumun kullanıldığı grupta olduğu
belirlenmiştir (22,07 g/100g).
Anahtar Kelimeler: Tubifex tubifex, biyokimyasal kompozisyon, akvaryum balıkları, canlı yem.
1. GİRİŞ
Balık beslemede özellikle de süs balıkları beslemede yaygın olarak kullanılan Tubifex tubifex, ekonomik olduğu
kadar balık büyüme ve üremesine doğrudan etkili bir canlı yem türüdür. İçermiş olduğu ω-γ ve ω-6 serisi yağ
asitleri, esansiyel aminoasit ve karotenoid pigmentleri dolayısıyla, özellikle tatlı su akvaryum balıklarının
beslenmelerinde ihtiyaç duydukları besin maddeleri bakımından zengin bir besin kaynağıdır. Yapılan
denemelerden elde edilen sonuçlarla, profesyonel üreticilerin istediği miktarlarda ve hastalık yapıcı etmenlerden
arındırılmış, besin değeri optimum seviyelerde T. tubifex üretimi yapılabildiği takdirdeν işletmelerin balık üretim
performansı artacağı gibi T. tubifex ticaretinde üretici-toptancı-perakendeci-tüketici döngüsü yeniden çalışmaya
başlayabilir ve sadece kurt (T. tubifex) yetiştiriciliği yapan, yeni işletmelerin ortaya çıkması söz konusu olabilir.
Bu sebeple, yoğun T. tubifex kültürü için farklı ortam şartlarının denenmesi ve bu ortamlardan elde edilen
kurtların besin kompozisyonlarının belirlenmesininν sosyal, ekonomik ve hatta bilimsel alanda birçok pozitif
çıktı elde edilmesine neden olacağı düşünülmektedir. Bu amaçla yaptığımız çalışmalarda yedi farklı sediment
ortamının T. tubifex kurtlarının besin kompozisyonuna etkisine bakılmıştır. Çıkan sonuçlara göre, T. tubifex ana
yaşam alanlarını oluşturan sedimentin yapısı besin büyüme, üreme ve biyo kimyasal kompozisyonları ile ilişkili
olduğunu söylenebilir. Bundan dolayı da kültür ortamları için en uygun materyalin bulunması için bu çalışmada
sunulan bulgular önem arz edebilir.
2. MATERYAL VE METOD
Bu çalışma da uygulanan araştırma yöntemine daha önce başka bir bilimsel kaynakta rastlanmamış olup,
tamamen bu çalışmaya özgü yöntemler kullanılmıştır.
2.1 Canlı Materyal Temini ve Deneyin Kurulumu
T. tubifex pek çok ülkede olduğu gibi ülkemizde de hala doğal kaynaklardan toplanarak tüketiciye sunulmaya
devam edilmektedir. Bundan dolayı da, ilk olarak geleneksel toplama yöntemini kullanan bir toplayıcıdan canlı
deneme materyal temin edilmiştir. Deneme üniteleri kurulmuştur. T. tubifex’ler deneme ünitesine getirildikten
sonra β hafta süre karantinada tutulmuş, akabinde β hafta süre ile deneme ortamına adapte edilmeleri
sağlanmıştır. Bu süre zarfında 18°C sıcaklık ve 1β/1β fotoperiyot koşulları altında ticari balık yemi ile canlı
ORAL PRESENTATION
129
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
ağırlığın %5’i oranında yemleme yapılmıştır. Denemede 1 adet β50 L filtre tankı ve 4 adet 100 L hacimli
akvaryumlardan oluşan UV filtre düzeneği ilaveli kapalı devre sistemler kullanılmıştır. Filtre tanklarında azot
türevi bileşiklerin ortamdan uzaklaştırılması için biyolojik filtrasyon yapılmış ve su daimi olarak hava motoru
yardımı ile havalandırılmıştır. Su sıcaklıkları, filtre tanklarına yerleştirilen merkezi bir ısıtıcı/soğutucu yardımı
ile ayarlanmış, günlük ¼ oranında su değişimi yapılmıştır. Denemede şebeke suyu kullanılmıştır. Doğal
aydınlanma koşullarına uygun olarak tüm gruplara ait gerçekleştirilen uygulamalar, γ’er tekerrürlü olarak
yürütülmüştür.
2.2 Sediment Materyali
Bu aşamada, T. tubifex solucanlarının farklı sediment ortamlarındaki büyüme ve üreme performnasları
gözlenmiş, besin kompozisyonlarındaki değişimler tespit edilmeye çalışılmıştır. Bunun için, volkanik toprak,
zeolit, 0.5-1mm kuartz kum, 1-3mm kuartz kum, 3-5mm kuartz kum, normal deniz kumu ve yumurta kartonu
gibi yedi farklı materyal sediment olarak kullanılmıştır. Kapalı devre çalışan akvaryumlarda yapılan deneme 60
gün sürmüştür. 60 günün sonunda grupların biyokimyasal kompozisyonları, amino asit ve yağ asit seviyeleri
ölçülmüş ve gruplar arasında karşılaştırma yapılmıştır. Denemelerin sonunda elde edilen değerler hem deneme
başı değerlerle hem de birbirleriyle karşılaştırılmıştır. Tercih edilen zeminler, ticari formda olup her daim temin
edilebilecek özelliktedirler. Kapalı devre akıntılı sisteme tartılarak yerleştirilen zeminlerden sonra su sıcaklığı
sabitlenmiştir. Geçmiş yıllarda T. tubifex ile yapılan bilimsel çalışmalara bakıldığında pek çoğunda su sıcaklığı
β1ºC olarak kullanılmıştır. Bu sıcaklığın uygun sıcaklık olduğuna dair gözlemler bildirilmiştir. Bunlara istinaden
bu deneme de su sıcaklığının β0ºC olmasına karar verilmiştir. 60 gün süren deneme boyunca su sıcaklığı β0ºC’
de sabit tutulmaya çalışılmıştır. Ancak oda sıcaklığındaki değişimlerden dolayı su sıcaklığı β0±1ºC olarak
kaydedilmiştir. Canlı ağırlık miktarlarındaki değişimi görebilmek için deneme başında ve deneme sonunda yaş
canlı ağırlık tartımları yapılmıştır. Deneme başında her bir tekerrür tankına ortalama 50’şer gr T. tubifex
stoklanmıştır.
2.2 Analiz ve Ölçümler
Besin kompozisyonunun belirlenmesi aşamasında, farklı sediment ortamlarında tutulan kurtların besin
kompozisyonlarına bakılarak en iyi sonucun hangisinde alındığı ortaya konulmaya çalışılmıştır. Bu amaçla T.
tubifex’in toplam yağ, kül, ham protein analizleri yapılmıştır. Yağ asitleri kompozisyonu ve toplam aminoasit
tayini gerçekleştirilmiştir.
Örneklerde toplam yağ analizi Erickson (1λλγ)’e göre metanol/kloroform ile ektrakte edilmiştir. Ektrakte edilen
örneklerden rotary evaporator ile çözücüler uzaklaştırılmış ve elde edilen tartım sonuçları ile toplam yağ miktarı
belirlenmiştir.
Kül miktarı AOAC (β000)’e göre yapılmıştır. Belirli miktarda tartımı alınmış örnekler, kül fırınında 5β5 oC’de 1β
saat yakılıp sabit tartıma getirilerek kül miktarı belirlenmiştir.
Protein analizi Kjeldahl metoduna göre yapılmıştır (AOAC, β000). Örnekler 6,β5 faktörü ile çarpılarak toplam
protein miktarı belirlenmiştir.
Yağ asitleri kompozisyonu, gaz kromotografisi ile belirlenmiştir. Toplam yağ miktarından elde edilen
örneklerin, öncelikle metal ester türevleri hazırlanmıştır. Bunun için örneklerden elde edilen ham yağlar, 0.5 N
metanolik NaOH çözeltisi ve BFγ/MeOH ile esterleştirilmiştir. Esterleştirme işleminden sonra yağ asitleri sıvısıvı ekstraksiyon ile hekzan fazına alınarak gaz kromotografisi için hazır hale getirilmiştir. Elde edilen
esterleştirilmiş yağ örneklerinin içerikleri gaz kromotografisi ile belirlenmiştir.
Toplam amino asit için hidroliz işlemi yapılırken, öncelikle protein içerikleri belirlenmiş, her örnek içinde % γ0
düzeyinde protein olacak şekilde tartım yapılmıştır. Etüv 1101 C’ye ayarlanmış, sıcağa dayanıklı cam şişelere
konulan örnekler üzerlerine β0 ml 6 N HCl ilave edilip azot gazından geçirilerek etüve konulmuştur. β4 saat
sonra alınarak 0.β0 µm PTFE şırınga filtrelerinden süzülmüştür. Örnekler rotary evaporatörün balonuna
koyularak su banyosu 65C’ye ayarlanarak hidroklorik asit uçurulmuştur. Uçurma sonrası balonda kalan
örnekler sitrat–sodyum sitrat tamponu (0.1 M, pH β.β) ile seyreltme çözeltisine alınarak amino asit analizine
hazır hale getirilmiştir (Srivastava ve diğ., 2006; Chi ve diğ.., 2008).
Serbest amino asitlerin belirlenmesinde, kuru örneklerden belirli miktarda tartım yapılarak metafosforik asit
çözeltisi ile 4 saat manyetik karıştırıcı ile ekstraksiyon işlemi yapılmıştır. Daha sonra elde edilen çözelti gaz
kromotografisi ile tayin edilmiştir.
ORAL PRESENTATION
130
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3. SONUÇ
Deneme başında her bir tekerrürüne 50’şer gr T.tubifex stoklanan gruplarda 60 gün sonunda, en fazla canlı
ağırlığın yumurta kolisi (Koli) grubunda olduğu tespit edilmiştir. Bütün gruplarda başlangıç ağırlığına göre canlı
ağırlık bakımından bir azalma gözlenirken, sadece yumurta kolisi grubunda az da olsa bir artış olmuştur. Diğer
gruplarda ise birbirlerine benzer sonuçlar elde edilmiştir.
Besin kompozisyonu değerlerine bakıldığında, deneme sonunda 7 grupta da toplam protein değerleri ilk gelen
canlıların toplam protein değerinin altında kalmıştır. Deneme sonunda en yüksek toplam protein değerine sahip
iki grubun 3 – 5 mm kuartz kum grubu (%5β,57) ile koli grubu (%54,55) olduğu tespit edilmiştir (Tablo 1). Kül
oranlarının ilk örneğe göre fazla çıkmasını ayıklama esnasında T. tubifex’leri zemin maddesinin tamamen ayırt
edilememesine bağlanabilir. Nem oranlarında istatistiksel olarak farklılığa rastlanmamıştır (Tablo 1).
Tablo 1. Toplayıcıdan Gelen İlk Örnek ile Farklı Sediment Denemesi Sonunda Elde Edilen Bireylerin
Besin Kompozisyonu Değerleri (%Protein, %Yağ, %Kül ve %Nem).
Protein
Yağ
Kül
Nem
65,55±5,0γ
13,32
4,58±0,γ5
80,0γ±0,γλ
İlk Örnek
41,70±0,18
10,16
γ1,70±0,γ1
81,λ5±1,8γ
Volkan Top.
40,β8±0,λβ
8,92
γ1,14±0,γ0
8β,86±1,γ1
Zeolit
0,5-1mm
46,57±1,γ5
9,91
β5,λ6±4,γ5
80,λ7±1,5λ
Kuartz Kum
1-3mm
46,64±γ,8λ
10,82
β0,56±1,05
81,65±1,βγ
Kuartz Kum
3-5 Kuartz
5β,57±0,67
11,67
16,86±0,06
84,β6±1,0γ
Kum
γ6,76±1,γ4
10,5
γ6,γ1±0,5γ
78,61±γ,41
Normal Kum
54,55±0,β5
9,07
5,07±0,0λ
88,60±0,λλ
Koli (Karton)
Doğadan toplanan ilk örnekte toplam yağ yüzdesi 1γ,γβ olarak bulunmuştur. Deneme sonunda dört grupta
(volkan toprağı (VOL), 1 – 3mm kuartz kum, 3 – 5mm kuartz kum ve normal kum) toplam yağ yüzdesi 10’un
üzerinde tespit edilmiştir (Tablo 1).
Tablo 2. Toplayıcıdan Gelen İlk Örnek ile Farklı Sediment Denemesi Sonunda Elde Edilen Bireylerin
Yağ Asidi Kompozisyonları.
İlk
Vol
Zeolit 0,5-1mm 1-3mm 3-5mm
Kum
Koli
Örnek
C4:0
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
C6:0
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
C8:0
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
C10:0
0,34
0,00
0,09
0,00
0,00
0,11
0,13
1,09
C11:0
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
C12:0
2,40
0,40
0,62
0,33
0,42
0,53
0,54
9,17
C13:0
0,54
0,17
0,22
0,13
0,13
0,15
0,16
0,64
C14:0
6,86
4,07
4,72
4,01
3,82
4,15
3,93
6,83
C14:1
1,70
0,45
0,53
0,37
0,36
0,61
0,36
0,94
C15:0
0,60
0,41
0,44
0,39
0,45
0,39
0,39
0,65
C15:1
0,17
0,11
0,10
0,00
0,11
0,00
0,09
0,08
C16:0
5,36
4,05
4,39
2,88
3,39
3,82
2,40
5,26
C16:1
7,18
4,04
4,26
2,73
3,51
3,80
2,39
5,04
C17:0
1,03
0,82
0,85
0,80
0,80
0,70
0,75
1,27
C17:1
0,23
0,09
0,10
0,14
0,13
0,18
0,14
0,08
C18:0
5,64
6,99
6,39
6,15
6,23
6,74
5,49
5,18
C18:1n9C+T
13,09
8,85
9,63
9,45
9,13
9,45
8,94
11,14
ORAL PRESENTATION
131
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
C18:2n6c
C18:2n6t
C18:3n6
C18:3n3
C20:0
C20:1n9
C20:2
C20:3n6
C21:0
C20:3n3
C20:4n6
C20:5n3
C22:0
C22:1n9
C22:2
C23:0
C22:6n3
C24:1n9
Doymamışlık
(UNSAT)
Doymuşluk
(SAT)
UNSAT/SAT
Σ Sat
Σ MUFA
Σ PUFA
ALA
EPA
DHA
DHA/EPA
10,93
0,00
0,49
1,86
9,69
0,62
6,24
1,96
0,00
7,18
0,11
11,31
1,61
0,21
0,38
1,32
0,96
0,00
10,75
0,00
0,83
2,12
12,61
0,28
7,55
1,00
0,00
10,51
0,32
13,29
1,95
0,50
0,72
1,63
5,19
0,32
11,16
0,00
0,91
2,30
12,57
0,11
7,48
1,02
0,00
9,73
0,32
13,22
1,77
0,22
0,70
1,56
4,58
0,00
12,43
0,00
0,96
2,19
13,47
0,29
7,88
1,18
0,00
10,54
0,32
13,78
1,80
0,17
0,77
1,76
5,09
0,00
12,03
0,00
0,92
2,18
13,70
0,28
7,72
1,09
0,00
10,72
0,33
13,60
1,96
0,21
0,78
1,71
4,26
0,00
11,44
0,00
0,73
2,15
12,77
0,21
6,97
1,01
0,00
10,28
0,28
13,81
1,83
0,72
0,58
1,60
4,86
0,13
11,91
0,00
0,86
2,18
13,04
0,32
7,70
1,08
0,00
12,21
0,29
14,86
1,74
0,19
0,83
1,89
5,16
0,00
8,63
0,00
0,33
1,49
10,40
0,19
4,93
1,24
0,00
7,83
0,18
13,05
1,29
0,22
0,25
1,32
1,26
0,00
64,61
66,90
66,37
68,28
67,39
67,21
69,52
56,90
35,39
33,10
33,63
31,72
32,61
32,79
30,48
43,10
1,83
35,39
23,19
41,42
1,86
11,31
0,96
0,09
2,02
33,10
14,64
52,27
2,12
13,29
5,19
0,39
1,97
33,63
14,95
51,42
2,30
13,22
4,58
0,35
2,15
31,72
13,15
55,14
2,19
13,78
5,09
0,37
2,07
32,61
13,73
53,65
2,18
13,60
4,26
0,31
2,05
32,79
15,10
52,11
2,15
13,81
4,86
0,35
2,28
30,48
12,43
57,09
2,18
14,86
5,16
0,35
1,32
43,10
17,69
39,21
1,49
13,05
1,26
0,10
Sediment denemesi sonunda elde edilen yağ asitleri değerleri Tablo β’da verilmiştir. Doymamış yağ asitleri
oranı deneme sonunda değişmese de DHA oranında bariz bir artma gözlemlenmiştir (Tablo β). Koli grubu hariç
diğer bütün gruplarda, deneme sonu DHA oranı 4-5 kat seviyesinde artmıştır. EPA oranları bakımından hem
gruplar arasında hem de ilk ölçüm seviyesine göre önemli derecede bir değişiklik olmadığı görülmektedir.
Tablo 3. Toplayıcıdan Gelen İlk Örnek ile Farklı Sediment Denemesi Sonunda Elde Edilen Bireylerin
Esansiyel Amino Asit(EAA) ve Esansiyel Olmayan Amino Asit (NEAA) Değerleri (g/100g).
Esansiyel Amino Asitler
İlk
0,5-1
1-3
3-5
Vol. Zeolit
Kum
Koli
(EAA)
Örnek
mm
mm
mm
Histidin (HIS)
1,00
1,06 1,09
1,14
1,07
1,34
0,83
1,09
Isolösin (ILE)
4,21
2,65 3,24
3,41
3,46
4,05
2,76
4,96
Lösin (LEU)
0,70
0,38 0,00
0,00
0,00
0,00
0,00
0,00
Lizin (LYS)
1,40
2,25 0,70
0,63
0,64
0,67
0,21
0,46
Metionin (MET)
3,51
2,22 2,71
3,02
2,88
2,99
2,46
4,40
Fenilalanin (PHE)
3,82
2,07 2,82
2,50
2,76
3,44
2,38
3,90
Treonin (THR)
6,34
4,27 5,12
5,41
5,02
6,13
3,96
6,96
Valin (VAL)
4,86
2,68 0,00
3,40
3,56
3,45
2,85
0,00
25,84 17,58 15,67 19,50
19,39
22,07
15,43
21,78
Toplam
Esansiyel Olmayan
İlk
0,5-1
1-3
3-5
Vol Zeolit
Kum
Koli
Amino Asitler (NEAA) Örnek
mm
mm
mm
ORAL PRESENTATION
132
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Alanin (ALA)
Aspartik Asid (ASP)
Glutamik Asid (GLU)
Glisin (GLY)
Serin (SER)
Tyrosin (TYR)
Cystine (C-C)
Hydroxylysine (HLY)
Toplam
EAA/NEAA
1,18
5,56
7,26
1,21
2,60
6,99
3,04
0,18
28,00
0,92
0,77 1,36
3,73 4,36
4,95 5,50
1,19 0,78
2,07 2,20
5,26 5,44
3,28 2,88
0,12 0,25
21,37 22,79
0,82 0,69
1,57
4,52
5,86
0,84
2,37
6,72
3,23
0,31
25,42
0,77
1,34
4,27
5,46
0,83
2,14
5,99
3,04
0,28
23,35
0,83
1,33
5,81
6,91
0,93
2,84
7,17
3,38
0,32
28,69
0,77
1,19
3,57
4,49
0,50
1,79
4,70
2,83
0,16
19,23
0,80
1,39
5,96
7,27
0,97
2,81
7,44
2,95
0,21
29,01
0,75
Doğadan toplanıp laboratuvara getirilen ilk örneklerde esansiyel amino asitlerden en fazla değere sahip olanların
treonin (6,γ4), ısolösin (4,β1) ve valin (4,86) olduğu tespit edilmiş, deneme sonunda da durum değişmemiştir
(Tablo 3). Toplam esansiyel aminoasit değerlerinde ise deneme sonunda en yüksek değer γ – 5mm kuartz
grubunda ββ,07 g/100g olarak tespit edilmiştir (Tablo 3).
T. tubifex‘lerin 7 farklı zeminde gösterdikleri büyüme ve hayatta kalma performansının gözlendiği bu denemede,
bu kurtların zemin tercihlerinin nasıl oluğuna yönelik ilk veriler elde edilmiştir. Bu ilk verilere göre en azından
burada kullanılan zeminlerin T. tubifex yetiştiriciliğinde işe yaramayacağını söylemek mümkündür. Bu deneme
sonunda “T. tubifex yetiştiriciliği için en uygun zemin hangisidir?” Sorusuna net bir yanıt verilememiştir. Ancak
kullanılacak zeminin yumuşak, sık gözenekli ve organik yük oranı fazla olması gerektiği bulgularına ulaşılmıştır.
Ulaşılan en önemli bulgu iseν ortamdaki sediment yapısının üreme, büyüme ve besin kompozisyonundaki
değişim ile doğrudan ilişkisi vardır. Uygun sediment materyalinin seçiminde bu canlıların doğadaki kaynaklarda
olduğu gibi çamurumsu balçık gibi bir sediment taklit edilerek, daha da başka materyallerin denenmesi
gerekmektedir. Diğer yandan bu çalışmadaki gruplarda canlı sayısının beklendiği oranlarda artmamasının en
önemli nedeninin, doğrudan zemin kaynaklı olmadığı, verilen besinin yeterli olmamasının daha önemli bir etken
olduğunu söylemek mümkündür. Ortamda yeteri kadar besin olmaması canlı biomasını doğrudan etkilemiştir.
4. TARTIŞMA
Denemeler için Ekim ve Aralık aylarında toplayıcıdan T. tubifex alınmıştır. Ekim (%50,λγ±0,7β) ve Aralık
(%65,55±5,0γ) aylarında gelen numuneler arasındaki protein değeri farklarının mevsimsel ve substrat
özelliklerinden kaynaklandığı düşünülmektedir. Ekim ayında gelen T. tubifex’lerin kuru maddedeki protein
değeri %50,λγ±0,7β ölçülmüştür. Yanar ve diğ. (β00γ) (%58,68) ile Bouguenec (1992) (%65)’e göre düşük,
Bernard ve diğ. (1λλ7) (%46,1)’e göre daha yüksek bulunmuştur. Ekim ayında gelen canlılarla başlatılan
sıcaklık denemesi sonucunda en yüksek üç grup β0°C (%55,18±1,4β), β8°C (%46,71± 0,7β) ve 16°C
(%45,01±0,γγ) bulunmuştur. Aralık ayında gelen T. tubifex’lerin kuru maddedeki protein değeri %65,55±5,0γ
bulunmuştur. Bu değer daha önceki yapılan çalışmalarla karşılaştırıldığında Bouguenec (1992)’nin bildirimine
(%65) yakın değerlerde, Yanar ve diğ. (β00γ)’ün bildirimine göre (%58,68) daha yüksek değerde bulunmuştur.
Aralık ayında gelen T. tubifex’ler ile yapılan sediment denemesi sonuncunda 7 grupta da (volkan toprağı, zeolit,
0,5-1mm kuartz kum, 1-3mm kuartz kum, 3-5mm kuartz kum, normal deniz kumu ve yumurta kolisi (karton))
kuru maddedeki protein değeri ilk örneğe göre düşük tespit edilmiştir. Bunun nedeni olarak ta denemede
kullanılan yemin kuru maddedeki protein değerinin %45,51±0,45 olması neden gösterilebilir. Sediment
denemesinde kuru maddedeki lipit değerleri 4 grupta (γ-5mm, 1-γmm, kum ve volkan toprağı) Yanar ve diğ.
(β00γ)’ünde tespit ettiği gibi %10’un üzerinde çıkmıştır (sırasıylaν %11,67, 10,8β, 10,5 ve 10,16).
Farklı sediment denemesi bulgularında EPA ve DHA omega-γ yağ asitleri ilk örneklerden daha yüksek
bulunmuştur. Yanar ve diğ. (β00γ)’te yaptıkları çalışmada T. tubifex’lerde DHA’ya rastlamadıklarını ve
zooplanktonik ve bentik organizmalarda yok denecek kadar az bulunduklarını rapor etmişlerdir. Amino asit
değerlerine bakıldığında Yanar ve diğ. (β00γ)’te yaptığı çalışma ile bu deneme sonuçları arasında neredeyse tüm
kalemlerde bariz farklılıklar tespit edilmiş olup yukarıdaki tablolarda sunulmuştur.
Sonuç olarak, farklı sediment maddelerinde kültüre alınan Tubifex tubifex’in kuru maddedeki % protein
değerlerinde azalma olmasına rağmen et verimi, yumurta kalitesi, büyüme gibi yaşamsal faaliyetlerde olmazsa
olmaz yağ asitlerinde bariz artışlar gözlemlenmiştir. Özellikle de DHA yağ asidinin miktarı deneme sonunda en
az 4 katına çıkmıştır. Sediment materyalinin yapısı T. tubifex yetiştiricilik performansını doğrudan
etkileyebilecek bir unsurdur. Kullanılan sedimentin kurtların kendilerini rahatlıkla gömebilecekleri, zemin
ORAL PRESENTATION
133
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
içerisinde kolay hareket etmelerine olanak sağlayan bir yapıda olması gerektiği bulgusuna ulaşılmıştır. Diğer
yandan kullanılan sediment bu canlıların besin kompozisyonu da etki edebilmektedir.
TEŞEKKÜR
Bu çalışma, Çanakkale Onsekiz Mart Üniversitesi Bilimsel Araştırma Projeler Koordinasyon Birimi tarafından
desteklenmiştir “Proje Numarası: FBA-2014-403.”
KAYNAKLAR
AOAC 2000. Official Methods of Analysis of AOAC International (17th ed.). AOAC International Suite 500,
481 North Frederick Avenue Gaithersburg, Maryland 20877-2417 USA
Bernard, J.B., Allen, M.E. and Ullrey, D.E., 1997. Feeding captive insectivorous animals: Nutritional aspects of
insects as food. Nutrition Advisory Group Handbook. Fact Sheet 003, August: 1-7.
Bouguenec V. 1992. Oligochaetes (Tubificidae and Enchytraeidae) as Food in Fish Rearing: a Review and
Preliminary Tests. Aquaculture. Volume 102, Issue 3, Pages 201-217. https://doi.org/10.1016/00448486(92)90149-F
Chi Z, Yan K, Gao L, Li J, Wang X and Wang L 2008. Diversity of marine yeasts with high protein
content and evaluation of their nutritive compositions. Journal of the Marine Biological Association of
the United Kingdom,88(7): 1347-1352.
Erickson M. C.1993. Lipid Extraction From Channel Catfish Muscle: Comparison of Solvent Systems Journal
Of Food Science Volume 58, Issue Pages 84–89 Doi:10.1111/J.1365-2621.1993.Tb03217.X
Srivastava A, Hamre K, Stoss J, Chakrabarti R and Tonheim SK (2006). Protein content and amino acid
composition of the live feed rotifer (Brachionusplicatilis): With emphasis on the water soluble fraction.
Aquaculture 254: 534-543.
Yanar, M., Yanar, Y. & Genç, M. A. (2003). Tubifex tubifex Müller, 1774 (Annelidae)’in Besin Kompozisyonu,
E.Ü. Su Ürünleri Dergisi, β0, 1-2, 103-110.
ORAL PRESENTATION
134
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
EST-SSR Marker Identification in Cirsium arvense L. EST Databases
Ebru Derelli Tufekci1*, Behcet İnal2, Ali Riza Tufekci3
*1
Cankiri Karatekin University, Yapraklı Vocational High School, Department of Field Crops, Cankiri, Turkey
2
Siirt University, Faculty of Agriculture, Department of Agricultural Biotechnology, Siirt, Turkey
3
Cankiri Karatekin University, Faculty of Sciences, Department of Chemistry, Cankiri, Turkey
Corresponding author e-mail: ebru.derelli@gmail.com
Abstract
Cirsium species known as thistle and these species are rich as biological activities phenolic compounds. Cirsium
arvense extracts and isolated compounds have antimicrobial, antidiabetic, antioxidant, hepatoprotective, antiinflammatory, vasorelaxant, cytotoxic activity toward cancer cells, anticancer activities. EST-SSRs or genic
SSRs have been used usually in analyses of functional diversity, genetic mapping and/or marker-assisted
selection in plants. In present study, 46,807 expressed sequence tags (ESTs) of Cirsium arvense L. were vused to
search for simple sequence repeats (SSRs). A total of 5,062 EST-SSRs, which accounted for 10.9 % of all the
ESTs, were identified. The most abundant EST-SSR types were trimeric repeats (2,147, 42%) followed by
dimeric (1,130, 22%), tetrameric (1,716, 13%), hexameric (963, 19%), monomeric (597, 12%), pentameric (131,
3%) and tetrameric repeats (94, 2%). For SSR motifs, the most prevalent motifs ACC/GGT (509, 23.14%),
followed by A/T (496, 22.55%), AAG/CTT (477, 21.69%), AAC/GTT (149, 6.77%) and AAT/ATT (132,
6.01%). We suppose that the EST-SSR markers provided here can be species-specific markers for taxonomic
identification of C. arvense from other Cirsium species. Thus, the set of EST-SSRs developed in the present
study is a promising resource for the related studies of Cirsium species .
Keywords: Cirsium arvense, EST-SSR, microsatellite, sequence repeats.
1. INTRODUCTION
Around the world, Cirsium species known as thistle. There are about 300 Cirsium species and 71 of them
grows naturally in Turkey, also perennial plant belonging to family Compositae (Ozer et al., 2001). Cirsium
species are believed to be harmful in agricultural areas as they can reproduce and grow uncontrollably. But the
stem and roots of Cirsium genus have been used as food source and food additives in rural areas in Turkey for
years (Demirtas et al., 2017).
These species are rich as biological activities phenolic compounds (Noh et al., 2013) such as silibinin and
silymarine. The compounds that are two of the most famously known examples of flavonoids from Cirsium
species have hepatoprotective effects (Yildiz et al., 2013). The genus have also been used for the treatment of
hemorrhaging (Meng et al., 2011), kidney inflammation and variety of abdominal and intestinal disorders
(Guarrera 2005). Additionally, some recent research studies showed that Cirsium arvense L. extracts and
isolated compounds have antimicrobial (Nazaruk and Jakoniuk, 2005), antidiabetic (Perez et al., 2001),
antioxidant (Jeong et al., β008), hepatoprotective (D’Andrea et al., β005), anti-inflammatory (Lim et al., 2008),
vasorelaxant (Kim et al., 2008), cytotoxic activity toward cancer cells (Lee et al., 2002), anticancer activities
such as liver cancer, uterine cancer, leukaemia (Liu et al., 2007). Than, it can be a source of fiber, vitamins and
minerals (Hossain et al., 2017).
Microsatellites, or simple sequence repeats (SSRs), tandemly repeated nucleotide sequences (1-6 bases in lenght)
and widely distributed across prokaryotic and eukaryotic genomes. SSRs have become the best choice among
markers used in plant breeding programs, as they are practical, convenient, easy to use and inexpensive. Among
all available molecular markers, SSRs are easy to score and have wide genomic distribution, codominant
inheritance and a multiallelic nature (Chen et al., 2015; Han et al., 2016).
ORAL PRESENTATION
135
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Expressed sequence tags (ESTs) are sequenced portions of complementary DNA copies of mRNA, and
represent part of the transcribed region of the genome. they mainly correspond to relatively conserved
sequences. Many applications, ESTderived markers (EST-SSR) can be used to cross-reference genes between
species for enhancing the resolution in comparative genomics studies and identifying conserved genomic regions
among species and genus (Poncet et al., 2006, Cheng et al., 2016). EST-SSRs offer the following advantages, for
example: they should detect variation in the expressed portion of the genome, so that gene tagging should give
‘‘perfect’’ marker-trait associations, they can be developed at no cost from the EST databases [genomic SSRs
(gSSRs) are expensive to develop] and once developed, these markers, unlike genomic SSRs, may be used
across a number of related species (Gupta et al., 2003).
Cirsium arvense L. species of EST sequences was defined within the ‘‘Compositae Genome Project
CGP’’ (http://compgenomics.ucdavis.edu) by next generation sequencing platforms. In current study, we have
mined Cirsium arvense L. transcriptome and characterised genome-wide EST-SSR markers for this species and
developed EST-SSRs serve as a potential marker to allow a clear differentiation of Cirsium arvense L. taxa from
other morphologically similar Compositae and other family plants.
2. MATERIALS AND METHODS
2.1 Data Retrieval and Analysis
Illumina RNA-Seq data for Cirsium arvense L. was obtained from NCBI Short Read Achieve (SRA) database
(https://www.ncbi.nlm.nih.gov/sra) under accession number SRX093410. The sequenced read length for forward
and reverse sequences of paired-end data is 100 bp in length.
All readings were obtained in raw sequence data as “.sra” format and converted to “fastq” format for Illimuna by
the NCBI (National Center for Biotechnology Information) SRA Toolkit. After cutting the low-quality readings
(Phred quality (Q) score <20) and trimming adapters with FASTX toolkit, all clean readings were exposed to
FastQC analysis to control reading qualities in terms of per-base sequence qualities.
All transcript sequences were subject to identify potential microsatellite or SSR motifs using a perl script
called MIcroSAtellite tool (MISA, version 1.0). The parameters for identifying simple repeat motifs were as
follows: (i) the SSR motifs are expected to contain mono-, di-, tri-, tetra-, penta-, and hexa-nucleotides with
minimum repeat numbers of 10, 6, 5, 5, 4 and 3, respectively, (ii) a compound SSR motif was defined if the
number of bases between two adjacent SSR motifs was ≤100.
3.RESULTS
A total of 46,807 expressed sequence tags (ESTs) of Cirsium arvense L. were vused to search for simple
sequence repeats (SSRs). A total of 5,062 EST-SSRs, which accounted for 10.9 % of all the ESTs, were
identified. The EST-SSR contents of C. arvense indicated that the most abundant EST-SSR types were trimeric
repeats (2,147, 42%) followed by dimeric (1,130, 22%), hexameric (963, 19%), monomeric (597, 12%),
pentameric (131, 3%) and tetrameric repeats (94, 2%) (Figure 1).
Among these EST-SSRs, the most dominant motifs were found to be ACC/GGT (509, 23.14%), followed by
A/T (496, 22.55%), AAG/CTT (477, 21.69%), AAC/GTT (149, 6.77%) and AAT/ATT (132, 6.01%). These top
five motifs accounted nearly for 80.17% of total motifs whereas the remaining thirteen motifs accounted for
19.83% (Figure 2).
ORAL PRESENTATION
136
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 1. The frequency and distribution of EST-SSR types
600
500
400
300
200
100
0
Figure 2. Basic characteristics and number of top 18 dominant EST-SSR motifs in Cirsium arvense L.
4.DISCUSSION
EST-SSRs composition and frequency of Cirsium arvense L., which used for phylogenetic studies, genuslevel taxonomy and population genetics, remain poorly defined. A total of 5,062 SSRs were identifed from
46,807 EST databases. These results clearly demonstrated that this species ESTs are a valuable resource for
mining SSR markers.
The densities of SSRs in the coding region were shown to be generally higher than those in the noncoding regions of the genome (Morgante et al., 2002).Thus there is considerable variation not only in the
densities of EST-SSRs in different plant systems, but also between the densities of SSRs in coding and noncoding regions. Since the sample sizes used in different studies differed widely, only future investigations will
resolve the significance of the variation in densities of SSRs in different regions of a genome in the same species
and also among the whole genomes of different plant systems (Gupta et al., 2003). In the present study,
trinucleotide repeats were found to be most abundant, which is in agreement with previous reports on several
crop plants (Cardle et al., 2000; Scott et al., 2000; Varshney et al., 2002).
Trinucleotide repeats are generally the most common motif found in both monocots and dicots (Eujayl et
al. 2004; Varshney et al., 2005). However, they suggested that their result might have been due to the over-
ORAL PRESENTATION
137
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
representation of untranslated regions (UTRs) compared with open reading frames (ORFs). Indeed, because of
the absence of frameshift mutations when there are length variations in tri- and hexanucleotide repeats, these
motifs are found in excess in both coding and noncoding sequences, but other repeat types are much less
frequent in coding regions than in UTRs (Metzgar et al., 2000).
As most microsatellite libraries used for marker development are generally enriched in mono-, di-, tri- and
tetra-nucleotide repeats, computational mining of EST databases mainly involves these types of motifs
(Morgante et al., 2002; Eujayl et al., 2004). The ACC/GGT motif was the most abundant trinucleotide motif
(23.14%) in Cirsium arvense L. ESTs. These motifs were also the most frequently observed SSRs in plants
(Scott et al., 2000; Gao et al., 2003; Thiel et al., 2003; Saha et al., 2004). The most abundant mono-nucleotide
repeat motif detected in the present study was A/T (22.5%), closely followed by AAG/CTT (21.69%). These
results are in agreement with other reports on dicot species (Scott et al., 2000; Eujayl et al., 2004; Kumpatla and
Mukhopadhyay, 2005).
Finally, EST databases provide a valuable resource for the development of SSR-markers, which are
associated with transcribed genes. The EST-SSR identification, development and characterization in the Cirsium
arvense L. very scarce, mainly due to the limited number of transcriptomic and genomic studies. We suppose
that the EST-SSR markers provided here can be species-specific markers for taxonomic identification of C.
arvense from other Cirsium species. The EST-SSR data can also be used for this genus specific markers.
However, EST-SSRs are the preferred method at genome-wide level because of their multi-allelic and codominant nature as well as quite high level of transferability across species/genus.
5.CONCLUSION
EST-derived SSRs, which can easily be extracted from EST databases, can be used successfully and EST
databases provide a valuable resource for the development of SSR-markers, which are associated with
transcribed genes. In addition to mapping ESTs via microsatellite loci for locating the genes of putative
functions, the EST-derived SSRs developed are a useful tool to study the genetic diversity within plants,
although the potential limitations imposed by homoplasy and allele likeness require further attention. In the
present study we comprehensively mined and characterised the publicly available transcriptome data from
C.arvense to identify EST-SSR markers at EST databases. Thus, the set of EST-SSRs developed in the present
study is a promising resource for the related studies of Cirsium species.
KAYNAKLAR
Cardle L, Ramsay L, Milbourne D, Macaulay M, Marshall D, Waugh R 2000. Computational and experimental
characterization of physically clustered simple sequence repeats in plants. Genetics, 156(2): 847-854.
Chen H, Wang L, Wang S, Liu C, Wohlgemuth Blair M, Cheng X 2015. Transcriptome Sequencing of Mung
Bean (Vigna radiate L.) Genes and the Identification of EST-SSR Markers. PLoS ONE, 10(4): e0120273.
Cheng J, Zhao Z, Li B, Qin C, Wu Z, Trejo-Saavedra DL, Luo X, Cui J, Rivera-Bustamante RF, Li S, Hu K
2016. A comprehensive characterization of simple sequence repeats in pepper genomes provides valuable
resources for marker development in Capsicum. Scientific Reports, 6, 18919.
Demirtas İ, Tufekci Ali Riza, Yaglıoglu Sahin Ayse, Elmastas M β017. Studies On The Antioxidant And
Antiproliferative Potentials Of Cirsium Arvense Subsp. Vestitum. Journal of Food Biochemistry, 41(1):
e12299.
Eujayl I, Sledge MK, Wang L, May GD, Chekhovskiy K, Zwonitzer JC, Mian MA 2004. Medicago truncatula
EST-SSRs reveal cross-species genetic markers for Medicago spp. Theor Appl Genet 108(3): 414-422.
Gao LF, Tang JF, Li HW, Jia JZ 2003. Analysis of microsatellites in major crops assessed by computational and
experimental approaches. Mol Breed, 12(3): 245-261.
Guarrera PM 2005. Traditional phytotherapy in Central Italy (Marche, Abruzzo, and Latium). Fitoterapia, 76(1):
1-25.
Gupta PK, Rustgi S, Sharma S, Singh R, Kumar N, Balyan HS 2003. Transferable EST-SSR markers for the
study of polymorphism and genetic diversity in bread wheat. Mol Gen Genomics, 270: 315-323.
ORAL PRESENTATION
138
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Han B, Wang C, Tang Z, Ren Y, Li Y, Zhang D, Dong Y, Zhao X 2016. Genome-Wide Analysis of
Microsatellite Markers Based on Sequenced Database in Chinese Spring Wheat (Triticum aestivum L.). PLoS
ONE, 10(11): e0141540.
Hossain L Md, Monjur-Al-Hossain ASM, Saha S, Sadhu SK 2017. Assessment of Biological Activity on
Cirsium arvense L. Algerian Journal of Natural Products, 5(1): 417-426.
Jeong DM, Jung HA, Choi JS 2008. Comparative antioxidant activity and HPLC profiles of some selected
Korean thistles. Archives of Pharmacal Research, 31, 28-33.
Kumpatla SP, Mukhopadhyay S 2005. Mining and survey of simple sequence repeats in expressed
sequence tags of dicotyledonous species. Genome, 48(6): 985-998.
Lee WB, Kwon HC, Cho OR, Lee KC, Choi SU, Baek NI, Lee KR 2002. Phytochemical constituens of Cirsium
setidens Nakai and their cytotoxicity against human cancer cell lines. Archives Pharmacal Research, 25(5):
628-635.
Morgante M, Hanafey M, Powell W 2002. Microsatellites are preferentially associated with non-repetitive DNA
in plant genomes. Nature Genet, 30: 194-200.
Meng Y, Wang Q, Yang L 2011. Pharmacological effects of Cirsium setosum in Hei Long Jiang. Inf. Tradit.
Chin. Med, 28, 17-18.
Metzgar D, Bytof J, Wills C 2000. Selection against frameshift mutations limits microsatellite expansion in
coding DNA. Genome Res, 10: 72-80.
Noh H, Lee H, Kim E, Mu L, Rhee YK, Cho CW, Chung J 2013. Inhibitory effect of a Cirsium setidens
extract on hepatic fat accumulation in mice fed a high-fat diet via the induction of fatty acid boxidation. Bioscience, Biotechnology and Biochemistry, 77: 1424-1429.
Ozer Z, Tursun N, Onen H β001. Yabancı otlarla sağlıklı yaşamμ (Gıda ve Tedavi). p. 50, 4 Renk Yayınları ve
Tanıtım Matbaacılık, Ankara.
Perez G, Ramirez L, Vargas S 2001. Effect of Cirsium pascuarense on blood glucose levels of normoglycaemic
and alloxan-diabetic mice. Phytotherapy Research, 15(6): 552-554.
Poncet V, Rondeau M, Tranchant C, Cayrel A, Hamon S, Kochko A, Hamon P 2006. SSR mining in coffee tree
EST databases: potential use of EST–SSRs as markers for the Coffea genus. Mol Gen Genomics, 276: 436449.
Saha MC, Mian MA, Eujayl I, Zwonitzer JC, Wang L, May GD 2004. Tall fescue EST-SSR markers with
transferability across several grass species. Theor Appl Genet, 109(4): 783-791.
Scott KD, Eggler P, Seaton G, Rossetto M, Ablett EM, Lee LS, Henry RJ 2000. Analysis of SSRs derived from
grape ESTs. Theor Appl Genet, 100(5):723-726.
Thiel T, Michalek W, Varshney RK, Graner A 2003. Exploiting EST databases for the development and
characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet, 106(3):
411-422.
Varshney RK, Thiel T, Stein N, Langridge P, Graner A 2002. In silico analysis on frequency and distribution of
microsatellite in ESTs of some cereal species. Cell Mol Biol Lett, 7(2002): 537-546.
Varshney RK, Graner A, Sorrells ME 2005. Genic microsatellite markers in plants: features and applications.
Trends Biotechnol, 23(1): 48-55.
Yıldız O, Can Z, Saral O., Yulug E, Ozturk F, Alıyazıoglu R, Canpolat S, Kolaylı S β01γ. Hepatoprotective
potential of chestnut Bee pollen on carbon tetrachloride-induced hepatic damages in rats. Evidence-Based
Complementary and Alternative Medicine, 2013(2013): 9 pp.
ORAL PRESENTATION
139
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Electromagnetic Micromanipulator Designs for Biological Species
Mustafa Böyük, Kutay İçöz, Günyaz Ablay
Abdullah Gül University, Department of Electrical-Electronics Engineering, Kayseri, Turkey
Corresponding author e-mail: gunyaz.ablay@agu.edu.tr
Abstract
Micromanipulation of biological species is significant for biological separation, medical treatment, and
biosensors. While many different actuating techniques have been studied in recent years, the most
promising micromanipulation method is related to magnetic actuators. In this work, design and analysis
of quadrupole magnetic actuators for two dimensional manipulation of biological particles are studied.
Finite element method based numerical methods are used for analysis and magnetic force calculations.
Several different quadrupole electromagnetic actuating systems are designed and analyzed, and an
optimal design is obtained.
Keywords: micromanipulation, magnetic actuators, magnetic tweezers, separation.
1. INTRODUCTION
In recent years, the micromanipulation systems have become an important research area due to their effective
application potentials in many fields. It is expected that the micromanipulators will have a crucial role in many
fields including biotechnology, medicine, electronics, appliances etc. Various actuating mechanisms can be used
for micromanipulation. Electrostatic force can be generated to actuate a micro-electro-mechanical system
(Donald et al. 2006). Dielectrophoresis can be used to trap or manipulate micro particles (Gauthier et al. 2006).
Piezoelectric materials can be used to generate traveling waves in elastic tails as a propulsion method while the
required high voltage currently cannot be developed in micron-level due to technological limitations (Kosa et al.
2007). Thermal actuators (e.g., silicon carbon-nitride) can also be considered for micromanipulation, but they are
not suitable for biological environments (Liew et al. 2002; Cahill et al. 2003). It is also possible to use Bacterial
manipulation through magnetotactic bacteria which can be used to push special microstructures (e.g.,
microbeads) (Martel et al. 2006, 2009). Optical tweezers are able to trap and manipulate micro particles (Onda
and Arai 2012). The optical manipulation is suitable for quasi-static force measurement and dynamic force
sensing (Huang et al. 2011). The optical tweezers are inherently stable, but heating and photo-damage are very
critical problems (Peterman et al. 2003). The most effective results have been obtained when magnetic force is
utilized in different ways such as swimming microrobots and magnetic resonance based micromanipulation (Qiu
et al. 2015; Abbott et al. 2009; Belharet et al. 2010). Magnetic field as a principal force and magnetostrictive
principle as a secondary oscillating mode are used for untethered manipulation of magnetic micro-structures
(Jing et al. 2011). Permanent magnet and electromagnet based magnetic tweezers have been recently developed
for manipulation and quantification of biological species.
One significant application of the magnetic actuation is the magnetic tweezers. They are composed of permanent
magnets or electromagnets to apply controlled forces and torques to biological molecules. There exist different
configurations of magnetic tweezers including various permanent magnet configurations, electromagnet needle,
multi-pole electromagnets. Magnetic tweezer is a single molecule-technique such that in its typical
implementation external magnetic field controlled superparamagnetic bead is used to manipulate bio-molecules.
It is designed and employed to offer an insight into the function and dynamics of bio-molecules, for instance,
extracting properties of DNA, RNA and polymerases (Lipfert et al. 2009; Kriegel et al. 2017). The main
advantages of magnetic tweezers include exerting and measuring from fN level to mN level forces, safe
operations in biological environments, measurements of multiple molecules, and possibility of various robust
designs for different needs and applications (Vlaminck and Dekker 2012).
Permanent magnets offer simple designs without any control action or motorized designs for spatial
manipulations. The selection of permanent magnets are usually based on empirical studies rather than
ORAL PRESENTATION
140
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
quantitative analyses and predictions (Neuman and Nagy 2008). This type of magnetic tweezers can be used for
developing biosensors (İçöz and Mzava β016) and for analyzing the topology of DNA molecules (Strick et al.
1998), and to study topoisomerases (Charvin et al. 2005). Electromagnets, on the other hand, utilize coils, pole
pieces and open-loop control or feedback control mechanisms for complex spatial manipulations. The experience
on manipulation small pieces and maglev trains with electromagnets (Eroğlu and Ablay β016ν Han and Kim
2016) have been modified recently for micromanipulation applications. In the literature, the designed magnetic
tweezers are mostly simple force appliers with open-loop control, namely, the required magnetic forces are
applied to the magnetic particles and the motions are measured (Levi et al. 2005; Zhang et al. 2010). The main
advantage of the electromagnetic tweezers is to control a magnetic particle in three dimensional space with
suitable control mechanisms. While most of the studies have been reported that electromagnetic tweezers
produce lower magnetic forces (or field strengths and gradient forces) compared with permanent magnets,
electromagnetic tweezers can be more powerful with suitable designs and control mechanisms (Hosu et al. 2003;
Neuman and Nagy 2008; Vlaminck and Dekker 2012). The electromagnets in magnetic tweezers must be
designed quantitatively to predict forces on superparamagnetic particles. Due to the complexity of the
geometries, numerical methods are more suitable than the analytical methods. Such a numerical analysis method
allows one to obtain predictive calculations to optimize the selection of electromagnet materials, geometry and
choice of beads for a given specific implementation before performing experiment studies. The numerical
calculations are usually done with finite element methods. The finite element analysis is the most effective
numerical calculation method for solving electromagnetic field problems and there are many commercially
available software packages to apply this powerful method.
Here we compute the specifications of the electromagnetic manipulator, i.e., the required magnetic fields and the
forces applied to superparamagnetic beads, via numerical simulations since the complex geometry do not allow
us to apply analytical Biot-Savart law. The magnetostatic problem is solved numerically in three dimensions
using an effective finite element solver by considering geometry and material properties of magnets, yoke and
magnetic bead. Using this ability to quantitatively predict the magnetic forces, we systematically investigate the
effects of different magnet geometries and of adding an iron yoke to the magnet configuration. By considering a
two-dimensional actuating system, several quadrupole magnetic manipulators are designed and analyzed for
obtaining optimal designs.
2. MATERIALS AND METHODS
The accurate analytical or semi-analytical analysis of magnetic fields of the complex geometries is usually not
possible. Hence, alternatively the magnetostatic problem of the magnetic manipulators can solved numerically
using finite element methods. We use both open source FEMM software for two dimensional analysis and the
AC/DC module of the COMSOL Multiphysics software (COMSOL, Burlington, MA) to solve the partial
differential equations related to Maxwell equations defined by
B A , H J
(1)
where B is the magnetic flux density, A is the magnetic vector potential, H is the magnetic field intensity, J is the
current density and defined by
J E J e , J e NI coil / Acoil
(2)
where E is the electric field intensity, σ is the electrical conductivity, N is the number of turns in the coil, Icoil is
the total coil current, and Acoil is the total cross section area of the coil domain. COMSOL Multiphysics is a very
powerful simulation platform that includes specification of materials and geometry, the physics of the specific
phenomena to be solved, and post-processing models for producing accurate and trustworthy results. From
solutions of magnetic vector potential A, COMSOL computes the magnetic field B and its components in a
region of interest, which can be exported from the program. It requires a powerful computer for time-effective
solutions, so all numerical calculations are performed on a dual processor powerful workstation.
The physical concept of the magnetic force generated by the MTs can be explained as follows. The force on a
superparamagnetic bead in a magnetic field gradient is calculated by (Shevkoplyas et al. 2007)
ORAL PRESENTATION
141
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
F 0.5 m( B) B
(3)
where m(B) is the magnetic moment of the particle and its defined as
= � � /�0 , where � is the
susceptibility and � is the volume of the bead, for small external fields. Then, the force is given by
F Vb B / 20
2
(4)
For large external magnetic fields (under saturation conditions), the force is defined by
F 0.5 (msat B)
(5)
where
� is the saturation value of the magnetic moment. It is clear that the superparamagnetic bead in an
external magnetic field experiences a magnetic force which is proportional to the gradient of the square of the
magnetic field under normal operating conditions.
Normally, magnetic beads have different compositions, sizes and shapes that determine their chemical and
physical properties depending on the related application. Magnetic beads can be coupled with specific ligands to
allow the separation and purification of cells, nucleic acids, proteins, and other molecules in an efficient way.
The main goal of the usage of superparamagnetic bead is because the superparamagnetic particles react similar
to a paramagnet with a much higher susceptibility under external magnetic field while the net magnetic moment
is zero without any external magnetic field. For these reasons, superparamagnetic beads find applications in
manipulation and separation related biological and biomedical studies (Shevkoplyas et al. 2007; Jin et al. 2014).
3. RESULTS
Coil design is one of the most important components in the generation of magnetic force, because the coil design
must be optimal for effectively applying the magnetic force. There are an infinite number of coil design options
by considering multi-dimensional force applications. In this work we considered two dimensional position
control of superparamagnetic bead via external magnetic field generation. Hence, a four-coil based configuration
is considered for symmetric force generations. While many different actuator designs are considered and tested,
for comparison aim only four different magnetic actuator schemes are illustrated in this work as seen in Figure 1.
In the designs, the coil is designed to have 300 copper turns with a height of 70 mm. The core is built with
Nickel-Iron alloy material with a radius of 2.5 mm, because this alloy has a strong magnetic permeability and
high saturation values as seen in Figure 2 (Davis 2001). The applied current is kept constant at 0.5 A. The
superparamagnetic bead has a radius of β.8 µm, and the distance between the bead and coil tip is 50 µm.
Figure 1a shows a four-coil design with circular core tips. Figure 1b displays the sharpened and extended core
tips. Figure 1c displays the four-coil system designed in Figure 1b with a surrounding square yoke. Figure 1d
shows the same coils with a surrounding circular yoke. Our goal is to analyze these different designs in order to
find the optimal design for manipulation of a superparamagnetic bead in two dimensional space. For the
analyses, the COMSOL Multiphysics as an advanced finite element numerical solver is used, since it is not
possible to use analytical tools accurately due to complex geometries.
It is found that while the first design given in Figure 1a produces the weakest magnetic flux on the tip of the
core, the designs illustrated in Figures 1c and 1d produces the strongest magnetic flux density on the sharp tips.
Designs with yokes generate higher magnetic flux density compared with designs without yokes because the
yoke creates a path for magnetic field circulation. We have also found that the yoke shape, that is square or
circular, does not have a considerable effect on the magnetic flux density.
The structure of one electromagnet with magnetic flux density distribution is illustrated in Figure 3. To analyze
the effect of taper length for optimal magnetic flux densities, various taper lengths are considered and the results
are shown in Figure 4. The taper length ranges from 2mm to 16 mm. It is clearly seen in numerical calculations
given in Figure 4 that for the given magnetic actuator design the maximum magnetic flux density is obtained for
a taper length of 6mm. This is well-readable from Figure 5 where magnetic flux density variation for different
taper lengths is shown.
ORAL PRESENTATION
142
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
To sum up, the magnetic actuator generates an external force on the superparamagnetic bead proportional to the
gradient of the square of magnetic field. Large magnets generate strong magnetic fields, but weak field gradient,
and thus slowly changing forces in a large area. It is possible to produce strong magnetic forces and sharp field
gradients with small magnets, but the magnetic force diminishes exponentially fast with distance. Hence, it is
desirable to apply magnetic force in the close neighborhood of the magnets.
Bead
Coil
Core
(a)
(b)
(c)
(d)
Yoke
Figure 5. Various magnetic actuator design concepts.
M
M
ag
ag
net
net
ic
ic
sat
sat
ur
ur
ati
ati
Nickel, %
Figure 6. Magnetic saturation of binary nickel-iron alloys at various field strengths (Davis 2001).
ORAL PRESENTATION
143
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Coil
Taper length
Core
Figure 7. Magnetic flux density in the core.
Bead
D=50um
(a)
(e)
(c)
(b)
(f)
(g)
(d)
(h)
Figure 8. Magnetic flux density calculations for different taper lengths: a) 2mm, b) 4mm, c) 6mm, d) 8mm, e)
10mm, f) 12mm, g) 14mm, h) 16mm.
Figure 9. Magnetic flux density variation for different taper lengths.
ORAL PRESENTATION
144
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4. CONCLUSION
Recent studies of magnetic actuators have been demonstrated that they can be integrated into molecule
manipulation and force spectroscopy techniques efficiently. In this study, design and analysis of quadrupole
magnetic micromanipulators are addressed for optimal solutions. In the designs two dimensional
micromanipulations are considered and possible solutions with electromagnet based magnetic actuators are
investigated. It is found that electromagnets with tip-shaped cores and yokes are able to provide the greater
magnetic flux density and magnetic force for superparamagnetic beads. Magnetic micromanipulators have a high
potential for various applications in various fields due to their biocompatible features, controllability, and lots of
design options.
ACKNOWLEDGEMENTS
This work was supported by Turkish Scientific and Research Council (TUBITAK) under project number
116E168.
REFERENCES
Abbott JJ, Lagomarsino MC, Zhang L, Dong L, Nelson BJ. How Should Microrobots Swim? Int J Robot
Res. 2009 Jul 21;1434–47.
Belharet K, Folio D, Ferreira A. MRI-based microrobotic system for the propulsion and navigation of
ferromagnetic microcapsules. Minim Invasive Ther Allied Technol. 2010 Jun;19(3):157–69.
Cahill DG, Ford WK, Goodson KE, Mahan GD, Majumdar A, Maris HJ, et al. Nanoscale thermal
transport. J Appl Phys. 2003 Jan 15;93(2):793–818.
Charvin G, Strick TR, Bensimon D, Croquette V. Tracking topoisomerase activity at the single-molecule
level. Annu Rev Biophys Biomol Struct. 2005;34:201–19.
Davis JR. Asm Specialty Handbook: Nickel, Cobalt, and Their Alloys. ASM International; 2001.
Donald BR, Levey CG, McGray CD, Paprotny I, Rus D. An untethered, electrostatic, globally controllable
MEMS micro-robot. J Microelectromechanical Syst. 2006 Feb;15(1):1–15.
Eroğlu Y, Ablay G. Cascade sliding mode–based robust tracking control of a magnetic levitation system.
Proc Inst Mech Eng Part J Syst Control Eng. 2016 Sep 1;230(8):851–60.
Gauthier M, Régnier S, Rougeot P, Chaillet N. Analysis of forces for micromanipulations in dry and
liquid media. J Micromechatronics. 2006;3(3):389–413.
Han H-S, Kim D-S. Magnetic Levitation: Maglev Technology and Applications [Internet]. Springer
Netherlands; 2016 [cited 2018 Feb 5]. (Springer Tracts on Transportation and Traffic). Available from:
//www.springer.com/us/book/9789401775229
Hosu BG, Jakab K, Bánki P, Tóth FI, Forgacs G. Magnetic tweezers for intracellular applications. Rev Sci
Instrum. 2003 Aug 20;74(9):4158–63.
Huang Y, Cheng P, Menq CH. Dynamic Force Sensing Using an Optically Trapped Probing System.
IEEEASME Trans Mechatron. 2011 Dec;16(6):1145–54.
İçöz K, Mzava O. Detection of Proteins Using Nano Magnetic Particle Accumulation-Based Signal
Amplification. Appl Sci. 2016 Nov 29;6(12):394.
Jin R, Lin B, Li D, Ai H. Superparamagnetic iron oxide nanoparticles for MR imaging and therapy: design
considerations and clinical applications. Curr Opin Pharmacol. 2014 Oct;18:18–27.
Jing W, Chen X, Lyttle S, Fu Z, Shi Y, Cappelleri DJ. A magnetic thin film microrobot with two operating
modes. In: 2011 IEEE International Conference on Robotics and Automation (ICRA). 2011. p. 96–101.
Kosa G, Shoham M, Zaaroor M. Propulsion Method for Swimming Microrobots. IEEE Trans Robot. 2007
Feb;23(1):137–50.
Kriegel F, Ermann N, Lipfert J. Probing the mechanical properties, conformational changes, and
interactions of nucleic acids with magnetic tweezers. J Struct Biol. 2017 Jan 1;197(1):26–36.
Levi V, Ruan Q, Gratton E. 3-D Particle Tracking in a Two-Photon Microscope: Application to the Study
of Molecular Dynamics in Cells. Biophys J. 2005 Apr 1;88(4):2919–28.
Liew L-A, Bright VM, Dunn ML, Daily JW, Raj R. Development of SiCN ceramic thermal actuators. In:
The Fifteenth IEEE International Conference on Micro Electro Mechanical Systems, 2002. 2002. p. 590–3.
ORAL PRESENTATION
145
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Lipfert J, Hao X, Dekker NH. Quantitative Modeling and Optimization of Magnetic Tweezers. Biophys J.
2009 Jun 17;96(12):5040–9.
Martel S, Mohammadi M, Felfoul O, Lu Z, Pouponneau P. Flagellated Magnetotactic Bacteria as
Controlled MRI-trackable Propulsion and Steering Systems for Medical Nanorobots Operating in the Human
Microvasculature. Int J Robot Res. 2009 Apr 1;28(4):571–82.
Martel S, Tremblay CC, Ngakeng S, Langlois G. Controlled manipulation and actuation of micro-objects
with magnetotactic bacteria. Appl Phys Lett. 2006 Dec 4;89(23):233904.
Neuman KC, Nagy A. Single-molecule force spectroscopy: optical tweezers, magnetic tweezers and
atomic force microscopy. Nat Methods. 2008 Jun;5(6):491–505.
Onda K, Arai F. Parallel teleoperation of holographic optical tweezers using multi-touch user interface. In:
2012 IEEE International Conference on Robotics and Automation (ICRA). 2012. p. 1069–74.
Peterman EJG, Gittes F, Schmidt CF. Laser-induced heating in optical traps. Biophys J. 2003 Feb;84(2 Pt
1):1308–16.
Qiu F, Fujita S, Mhanna R, Zhang L, Simona BR, Nelson BJ. Magnetic Helical Microswimmers
Functionalized with Lipoplexes for Targeted Gene Delivery. Adv Funct Mater. 2015 Mar 1;25(11):1666–71.
Shevkoplyas SS, Siegel AC, Westervelt RM, Prentiss MG, Whitesides GM. The force acting on a
superparamagnetic bead due to an applied magnetic field. Lab Chip. 2007 Oct;7(10):1294–302.
Strick TR, Allemand JF, Bensimon D, Croquette V. Behavior of supercoiled DNA. Biophys J. 1998
Apr;74(4):2016–28.
Vlaminck ID, Dekker C. Recent Advances in Magnetic Tweezers. Annu Rev Biophys. 2012;41(1):453–
72.
Zhang Z, Huang Y, Menq CH. Actively Controlled Manipulation of a Magnetic Microbead Using
Quadrupole Magnetic Tweezers. IEEE Trans Robot. 2010 Jun;26(3):531–41.
ORAL PRESENTATION
146
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Pilot Ölçekli Biyoreaktör Depolama Alanlarında Metal Konsatrasyonlarının Değişimi
Esra Tınmaz Köse1*, İbrahim Demir2
*1
Namık Kemal Üniversitesi, Çorlu Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Tekirdağ, Türkiye
2
İstanbul Teknik Üniversitesi, İnşaat Fakültesi, Çevre Mühendisliği Bölümü, İstanbul, Türkiye
Sorumlu yazar e-mail: etinmaz@nku.edu.tr
Özet
Son yıllarda, depolama alanları ve bu alanlardaki atıkların bozunma prosesleri konusundaki bilgi birikiminin
artması, depolama teknolojileri ile ilgili, bioreaktör depolama yöntemi gibi, gelişmeler üzerinde zorlayıcı
olmuştur. Bioreaktör depolama alanları, atıkların organik kısmının hızlı bir şekilde bozunmasının sağlanarak
kısa sürede stabil atığın oluşmasını öngören kapalı ve kontrollü mikrobiyolojik sistemlerdir. Bioreaktör
depolama alanları (BDA) depolanan atığın minimum sürede stabil hale gelecek şekilde işletilmelerinin yanı
sıra depolamadan doğabilecek çevresel etkilerin de minimuma inmesini amaçlamaktadır.
Bu çalışmada, katı atıkların biyoreaktör depolama alanlarının depolanmasının atığın metal konsantrasyonları
üzerindeki etkinliği incelenmiştir. Reaktörlerden biri konvansiyonel depolamayı simule etmesi amacıyla
anaerobik, sızıntı suyu geri devirsiz (kuru) (Kontrol reaktörü, R1)ν ikinci reaktör (Rβ) anaerobik, sızıntı suyu
geri devirli (ıslak) olarak çalıştırılmıştır. γ. ve 4. reaktörler (Rγ ve R4), aerobik, ıslak olarak çalıştırılmış ancak,
Rγ’te hava girişi alttan yapılırken, R4’te üstten yapılmıştır. 5. reaktör (R5) aerobik, sızıntı suyu geri devirli
(ıslak) olarak çalışmış ve hava girişi reaktör tabanından yapılmıştır. R1, Rβ, Rγ and R4, ham karışık atıkla
doldurulurken, R5 aynı atığın 80 mm’lik elekten elendikten sonar elek altında kalan kısımla doldurulmuştur.
Sızıntı suyu geri devir oranları Rβ, Rγ, R4 ve R5’te sırasıyla 0,5γν 0,4βν 0,56 and 0,β1 l/ton atık-gündür.
Havalandırmalı reaktörlere verilen hava miktarları Rγ, R4 ve R5 için sırasıyla 1,81λν 4,γ5β and 1,565 m 3/ton
atık-gün olarak belirlenmiştir.
Çalışma sonuçlarına göre depolama alanlarının biyoreaktör olarak işletilmesinin atıkların metal
konsantrasyonlarının azaltılmasında etkili olduğu sonucuna varılmıştır.
Anahtar Kelimeler: Atık stabilizasyonu, Biyobozunma, Biyoreaktör, Metal, Sızıntı suyu geri devri.
1. GİRİŞ
Bioreaktör depolama alanları, atıkların organik kısmının hızlı bir şekilde bozunmasının sağlanarak kısa sürede
stabil atığın oluşmasını öngören kapalı ve kontrollü sistemlerdir. Bioreaktör depolama alanları (BDA) depolanan
atığın minimum sürede stabil hale gelecek şekilde işletilmelerinin yanı sıra depolamadan doğabilecek çevresel
etkilerin de minimuma inmesini amaçlamaktadır. Bioreaktör depolama alanlarında uygulanan temel proses, atık
bozunması sırasında oluşan sızıntı suyunun depolama alanı içine geri devrettirilmesidir. Sızıntı suyunun geri
devri, biyolojik olarak parçalanabilen atıkların daha hızlı parçalanabileceği bir ortam oluşmasını sağlamakla
kalmayıp aynı zamanda sızıntı suyunun da kısmen arıtımını sağlamaktadır.
Dizayn ve işletme açısından aerobik, anaerobik ve hibrit (aerobik-anaerobik) olmak üzere üç tip biorektör
depolama alanından sözetmek mümkündür. Aerobik bioreaktör depolama alanlarından oluşan sızıntı suyu
reaktör tabanından alınarak sızıntı suyu toplama tankında toplanır. Toplanan sızıntı suyu, atığın nem muhtevası
ayarlanarak kontrollü bir şekilde alan içine geri devrettirilir. Atık kütlesi içine hava girişi yatay ve/veya düşey
hava boruları ile sağlanır. Anaerobik bioreaktör depolama alanlarında nem ihtiyacı sızıntı suyu geri devriyle
veya su ilavesi ile sağlanır. Bozunma anaerobik ortamda gerçekleşir ve oluşan depo gazının metan içeriği
yüksektir. Hibrit (aerobik-anaerobik) bioreaktör depolama alanlarında aerobik ve anaerobic sistemler ardaşık
olarak uygulanmaktadır. Alanların üst kısmında atığın bozunabilir kısmının hızlı bir şekilde bozunması
sağlanırken alt kısımlarda ise oluşan gaz toplanmaktadır. Aerobik bioreaktör depolama alanlarıyla
karşılaştırıldığında hibrit alanlarda metanojenik aktivitenin daha çabuk başladığı belirlenmiştir (www.epa.gov).
ORAL PRESENTATION
147
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Bioreaktör depolama alanlarınının temel prosesi olarak değerlendirilen sızıntı suyu geri devrinin, sızıntı suyu
kirletici parametrelerinin konsantrasyonlarında düşüş sağladığı gözlenmektedir. Bunun yanı sıra geri devir
sırasında buharlaşmadan dolayı sızıntı suyu miktarı azalmaktadır. Sızıntı suyu kirletici konsantrasyonlarının ve
sızıntı suyunun miktarının azalması, sızıntı suyu arıtma maliyetlerini de düşürmektedir (Quasim ve Chiang,
1λλ4). Atıkların önceden ıslatılması, spreyleme, yüzeyde göllenme, düşey enjeksiyon kuyularının oluştulması,
yüzey altına yatay boruların döşenmesi, sızıntı suyunu geri devrettirilmesi amacıyla uygulanan başlıca
yöntemlerdir (Yuen, 2001).
Son yıllarda yapılan araştırmalarla, katı atıkların konvansiyonel depolama alanları yerine aerobic, anaerobik ya
da hibrit bioreaktör depolama alanlarında atık stabilizasyonunu hızlandırarak (Cossu vd, β016ν Xu ve ark., β014ν
Ni ve ark., β016) çevre sorunlarınının azaltılmasında etkin rol oynadığı belirlenmiştir.
Atıkların anaerobik ortamda bozunarak stabil hale gelmeleri esasına dayalı olan konvansiyonel depolama
alanları, her ne kadar zemin ve üst yüzey geçirimsizliğinin sağlandığı ortamlar olsa da insan ve çevre sağlığı
açısından bir takım risklere de sahiptir. Bu tür alanlarda depolanan atıkların bozunması sonucu oluşan sızıntı
suları, yüksek konsantrasyonlarda organik bileşikler, ağır metaller ve patojenler içermektedir. Konvansiyonel
depolama alanlarında atıkların stabilizasyon sürecinin uzun olması nedeniyle oluşan sızıntı suyunun olumsuz
etkileri uzun süre devam edebilmektedir. Depolama alanının taban geçirimsizliği sağlanmış olsa bile geçirimsiz
taban zamanla tahrip olabilmekte ve bu nedenle sızıntı suyu depolama alanı dışına çıkabilmektedir (es.epa.gov).
Depolama alanında oluşan depo gazı, anaerobik koşullar altında yüksek oranda metan ve VOC içermektedir.
Geçirimsiz tabakada ve gaz toplama sisteminde meydana gelebilecek bir tahribat depo gazının yeraltı suyuna
karışarak su ortamının kirlenmesine neden olabilmektedir.
Bioreaktör depolama sistemlerinde, mikroorganizmaların yaşamsal faaliyetlerinin devamı için gerekli oksijenin
sağlanabilmesi için ortama hava verilirken nem ve besi maddesi ihtiyacı sızıntı suyunun geri devrettirilmesi ile
sağlanır. Katı atıklar, uygun hava ve nem sağlanmış ortamlarda aerobik bozunma ile anaerobik şartlara göre çok
daha kısa sürede stabil hale gelmektedir. Buna ek olarak, sızıntı suyunun atık kütlesi içine geri devrettirilmesi
bozunmayı hızlandırmakta, sızıntı suyu miktarını ve kirletici konsantrasyonlarını azaltmakta, organik asitlerin
inhibitör etkisininin nötralize edilmesini sağlamaktadır (Rhyner ve diğ., 1λλ5).
Atıkların, kontrollü şartların sağlandığı aerobik, anaerobik veya hibrit bioreaktörlerde depolanması,
konvansiyonel metotla depolanması ile karşılaştırıldığında, atık stabilizasyonu, depolama alanının kullanım
süresinin artması, kapatılan alanın rehabilitasyonu maliyetinin düşük olması gibi üstünlükleri mevcuttur
(Adeleke, 2003).
Literatürdeki pekçok çalışmada biyoreaktör depolama alnalrının atıkların metal konsantrasyonunun değişiminde
etkili olduğunu ortaya koymuştur (Xi eve ark., β015ν Qu ve ark., β008, Long ve ark., β00λ)
2. MATERYAL VE METOD
2.1 Reaktör Dizaynı
Çalışma kapsamında, farklı tiplerdeki bioreaktör depolama alanlarını simüle edecek beş adet reaktör
kullanılmıştır. Reaktörlerin özellikleri Tablo 1’de, şematik görünümleri Şekil β’de gösterilmiştir.
Tablo 1. Reaktörlerin Özellikleri
Özellik
Yükseklik (m)
Çap (m)
Çakıl tabakası yüksekliği (m)
Örtü toprağı yüksekliği (m)
Toplam reaktör hacmi (m3)
Ortalama etkin reaktör hacmi (m3)
ORAL PRESENTATION
Değer
5,65
2,50
0,30
0,30
28
22
148
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Reaktörlerden biri konvansiyonel depolamayı simule etmesi amacıyla anaerobik, sızıntı suyu geri devirsiz (kuru)
(Kontrol reaktörü, R1)ν ikinci reaktör (Rβ) anaerobik, sızıntı suyu geri devirli (ıslak) olarak çalıştırılmıştır. γ. ve
4. reaktörler (Rγ ve R4), aerobik, ıslak olarak çalıştırılmış ancak, Rγ’te hava girişi alttan yapılırken, R4’te üstten
yapılmıştır. 5. reaktör (R5) aerobik, sızıntı suyu geri devirli (ıslak) olarak çalışmış ve hava girişi reaktör
tabanından yapılmıştır. Depolama alanı koşullarının simule edilebilmesi amacıyla 4. reaktör hariç tüm reaktörler
üst yüzeyleri açık, havalandırmanın üstten yapıldığı 4. reaktör (R4) ise üstü kapalı olarak dizayn edilmiştir.
Tablo 2. Çalışmada Kullanılacak Reaktör Tipleri, Atık Özellikleri ve Uygulanacak Yöntemler
Reaktör
Tipi
Reaktör
Çalışma
Süresi
(Ay)
R1
9
R2
9
R3
9
R4
9
R5
9
Anaerobik,
Kuru
Anaerobik,
Islak
Aerobik,
Islak
Aerobik,
Islak
Aerobik,
Islak
Uygulanan Yöntem
Havalandırmasız,
Sızıntı suyu geri devirsiz
Havalandırmasız,
Sızıntı suyu geri devirli
Alttan havalandırmalı,
Sızıntı suyu geri devirli
Üstten havalandırmalı,
Sızıntı suyu geri devirli
Alttan havalandırmalı,
Sızıntı suyu geri devirli
Reaktördeki
Ortalama Atık
Miktarı (ton)
Atık Özelliği
11
Karışık Atık
11
Karışık Atık
11
Karışık Atık
11
Karışık Atık
15
Elek Altı Atık
Reaktörlerin yapımı aşamasında öncelikle, siloların iç yüzeyleri zımparalanarak pürüzsüzleştirilmiş ve daha
sonra epoksi boya ile boyanmıştır. Oluşan sızıntı sularının drene edilebilmesi amacıyla reaktör tabanından
yaklaşık 1 metre yükseğe yerleştirilen ızgaranın üzeri tıkanmaların önlenebilmesi amacıyla yaklaşık γ0 cm
yüksekliğinde yıkanmış dere çakılı ile örtülmüştür.
Sızıntı suyu reaktörlerin tabanından drene edildikten sonra reaktör dışında bulunan sızıntı suyu toplama
tanklarında toplanmıştır. Sızıntı suyunun geri devrettirildiği reaktörlerde geri devir, dalgıç pompalar kullanılarak
yağmurlama metoduyla yapılmıştır. Bu amaçla, reaktörlerin üst yüzeylerine spiral şeklinde delikli
yerleştirilmiştir.
Şekil 1. Reaktörlerin Şematik Görünümü
Havalandırma, reaktör tabanından veya üst yüzeyden uygulanacak şekilde β500 mγ /saat kapasiteli fan
yardımıyla yapılmıştır. Reaktörler atıkla doldurulduktan sonra atık yüzeyleri β0-γ0 cm örtü toprağı ile
kapatılmıştır. Örtü toprağı olarak İBB Kompost ve Geri Kazanım Tesisinde üretilen kompostun 15 mm’lik elek
üstü kısmı kullanılmıştır. 50 Reaktörlerin yan yüzeylerinde katı atık numunelerinin alınabilmesi için üç adet
ORAL PRESENTATION
149
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
numune alma gözü yapılmıştır. En üstteki numune alma gözü 40x40 cm, alttaki iki göz ise γ0xγ0 cm
boyutlarındadır.
Reaktörlerdeki atık sıcaklığının ölçülebilmesi amacıyla her bir reaktörün farklı iki noktasına reaktörlerin
ortalarına kadar uzanan ikişer adet sıcaklık probu yerleştirilmiştir.
2.2 Atık Özellikleri
Çalışmada, İstanbul’un Avrupa yakasından toplanarak İBB Kompost ve Geri Kazanım Tesisi’ne getirilen evsel
katı atık kullanılmıştır. Reaktörlerin içindeki atığın homojen olarak havalandırılabilmesi için tesise gelen
atıkların içindeki poşetler açılmış ve içleri boşaltılmıştır. R1, Rβ, Rγ ve R4 reaktörleri bu atıkla (karışık atık)
doldurulmuştur. Atık boyutunun ve karakterizasyonun atık stabilizasyonuna etkisinin gözlenebilmesi için, Tablo
β’de de belirtildiği gibi R5’e tesise gelen atığın 80 mm’lik elekten elenmesiyle elde edilen elek altı atık
doldurulmuştur. R5’e doldurulan atığın yoğunluğu 1040 kg/m 3, diğer reaktörlere doldurulan atığın yoğunluğu ise
670 kg/m3 olarak tespit edilmiştir.
Atıklar reaktörlere doldurulmadan önce karıştırılarak homojen hale getirilmiş ve toplam atık kütlesi içindeki her
bir madde grubunun oranı belirlenmiştir. Reaktörlere doldurulan atık bileşenlerinin yaş ağırlık bazında oranları
Tablo γ’te verilmiştir.
Bu çalışmada geri devrettirilen sızıntı suyu miktarı ve aerobik reaktörlere verilen hava miktarları ortamın nem
muhtevası, sıcaklık ve depo gazı bileşenleri değerlendirilerek ayarlanmıştır.
Çalışma süresince reaktörlere geri devrettirilen su/sızıntı suyu miktarları ve verilen hava miktarları Tablo 4’te
belirtilmiştir.
2.3 Deneysel Çalışma
Çalışma süresince, reaktörlerdeki katı atıkların metal konsantrasyonları aylık periyotta izlenmiştir. Sözkonusu
parametrelerin analizlerinin ICP Optik Emisyon Spektrofotometrik Metot uygulanarak İSTAÇ AŞ’ye ait Çevre
Laboratuarında ve Namık Kemal Üniversitesi Çevre Mühendisliği Bölümü Laboratuarında yapılmıştır.
Tablo 3. Reaktörlerde Depolanan Atıkların Karakterizasyonu
Atık
Bileşeni
Karışık
Atık
Ağırlık (%)
Elek Altı
Altı
Ağırlık (%)
Karışık
Atık
Ağırlık (%)
Elek Altı
Altı
Ağırlık (%)
Organik
57,72
65,55
Taş
2,18
4,35
Tekstil
10,67
3,99
Ambalaj
1,26
-
Kağıt
7,23
10,73
Tahta
0,91
1,19
Cam
4,63
8,65
Pet
0,91
0,06
Teneke
4,00
1,12
Strafor
0,35
0,18
Plastik
3,58
2,28
Tetrapak
0,21
-
Poşet
3,37
1,9
Kemik
0,21
-
Ç.Bezi
2,74
-
Toplam
100,00
100,00
ORAL PRESENTATION
Atık Bileşeni
150
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tablo 4. Geri Devrettirilen Sızıntı Suyu Miktarı ve Hava Miktarı
R2
R3
Sızıntı Suyu Geri Devri
(l/ton atık-gün)
0,53
0,42
Havalandırma Debisi
(m3/ ton atık-gün)
1,819
R4
0,56
4,352
R5
0,21
1,565
Reaktör
3. SONUÇ VE TARTIŞMA
Literatürde yer alan çalışmalar incelendiğinde genel olarak katı atıkların metal konsantrasyonlarının zamanla
arttığı ve bu artışın nedeninin kütle kaybı olduğu belirtilmiştir. Geri devirli sistemlerde sızıntı suyu geri devri
metallerin tekrar atık kütlesine geri verilerek konsantrasyonun artmasına neden olabilmektedir. Ancak oluşan
sızıntı suyunun tamamının geri devrettirilmemesi sonucu metallerin ortamdan uzaklaştırılması da sözkonusudur.
Düşük geri devir oranlarının uygulandığı sistemlerde daha düşük metal konsantrasyonları ölçülmektedir.
Bakır konsantrasyonu tüm reaktörlerde artış göstermektedir. Çalışma başlangıcında 0,7-6,5 mg/l
ölçülen bakır konsantrasyonları çalışma sonunda 10-γ0 mg/l değerlerine kadar yükselmiştir.
arasında
Çinko konsantrasyonu da kurşun gibi çeşitli salınımlar göstermiş olmakla birlikte genel olarak 10-40 mg/l
konsantrasyonları arasında ölçülmüştür.
Kadminyum konsantrasyonları tüm reaktörlerde azalma eğilimi göstermekle birlikte havalandırmalı reaktörlerde
daha düşük konsantrasyon değerleri ölçülmüştür. Cd konsantrasyonunun en düşük olduğu reaktör R4’tür.
Kalsiyum konsantrasyonu tüm reaktörlerde azalma eğilimi göstermiştir. Katı atıkta ölçülen kalsiyum
konsantrasyonlarının zamanla azalması, sızıntı suyundaki Ca konsantrasyonlarında önemli bir değişim
gözlenmemiş olması sonucuyla birlikte değerlendirildiğinde, katı atıktaki Ca konsantrasyonun azalmasının kütle
kaybından kaynaklandığı düşünülmektedir.
Krom konsantrasyonları tüm reaktörlerde aynı artma ve azalma eğilimlerini göstermiştir. Çalışma sonunda tüm
reaktörlerdeki krom konsantrasyonu 5 mg/kg değerinin altında ölçülmüştür.
Kurşun konsantrasyonu, çalışma süresince artış ve azalmalar göstermiş olsa da tüm reaktörlerde, çalışma
başlangıcında ve sonunda birbirine yakın değerler kaydedilmiş ve çalışma süresince tüm reaktörlerdeki kurşun
konsantrasyonu 5 mg/l’nin altında ölçülmüştür.
Magnezyum konsantrasyonu tüm reaktörlerde zamanla az miktarda olsa da azalma göstermiştir. Genel olarak
magnezyum konsantrasyonu 400-600 mg/l arasında değişim göstermiştir.
Nikel konsantrasyonu da krom konsantrasyonuyla eşdeğer zamanlarda paralel değişimler göstermiştir. Özellikle
sızıntı suyunun yoğunluklu olarak geri devrettirildiği zamanlarda sızıntı suyunda bulunanan ağır metallerin
tekrar katı atık kütlesine verilmesi bu zamanlarda krom ve nikel konsatrasyonlarının artmasına neden olmuştur.
Yağışların başladığı Kasım ayından sonra krom ve nikel konsantrasyonlarında önceki aylardaki kadar önemli
miktarda salınımlar gözlenmemiştir.
Potasyum konsantrasyonunda tüm reaktörlerde zaman içinde değişen konsantrasyonlar gözlenmiştir. Genel
olarak potasyum konsantrasyonu 3000-5000 mg/l arasında değişim göstermiştir.
Tüm reaktörlerde sodyum konsantrasyonu zamanla artmıştır. Ancak artış oranının en fazla olduğu reaktör, sızıntı
suyunun tersine Rγ’tür.
Atık kütlelerinin metal konsantrasyonları değişimleri Tablo 5’te verilmiştir.
ORAL PRESENTATION
151
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tablo 5. Reaktörlerdeki katı atık kütlelerinin metal konsantrasyonları değişimleri
45
40
Cu, mg/kg
35
30
R1
25
R2
R3
20
R4
R5
15
10
5
0
Temmuz Ağustos
Eylül
Ekim
Kasım
Aralık
Ocak
Şubat
M art
Aylar
900
800
Mg,mg/kg
700
R1
R2
600
R3
500
R4
R5
400
300
200
Temmuz Ağustos
Eylül
Ekim
Kasım
Aralık
Ocak
Şubat
M art
Aylar
8000
7000
Na, mg/kg
6000
R1
R2
5000
R3
R4
4000
R5
3000
2000
Temmuz Ağustos
Eylül
Ekim
Kasım
Aralık
Ocak
Şubat
M art
Aylar
3,5
80
3
70
60
R1
R1
R2
2
R3
1,5
R4
R5
1
Zn, mg/kg
Pb, mg/kg
2,5
50
R2
R3
40
R4
30
R5
20
0,5
10
0
0
Temmuz Ağustos
Eylül
Ekim
Kasım
Aylar
ORAL PRESENTATION
Aralık
Ocak
Şubat
M art
Temmuz Ağustos
Eylül
Ekim
Kasım
Aralık
Ocak
Şubat
M art
Aylar
152
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4. TARTIŞMA
Bu çalışma kapsamında, havalandırmalı ve havalandırmasız bioreaktör depolama yöntemi simüle bioreaktörlerde
pilot ölçekli olarak denenmiştir. Farklı depolama alanlarını simule eden reaktörlerde, atık boyutunun, sızıntı
suyunun geri devrettirilmesinin, havalandırmanın ve havalandırma yönünün değiştirilmesinin, katı atık kütlesinin
metal konsantrasyonları üzerindeki etkileri değerlendirilmiştir.
Tüm reaktörlerde metal konsantrasyonları zamanla salınım göstermiş olmasına rağmen, bakır ve potasyum
haricindeki metallerin konsantrasyonları zamanla azalma eğilimi sergilemiştir. Sonuçlar literatür verileri ile
benzerlik göstermektedir.
TEŞEKKÜR
Bu çalışma, “Aerobik Düzenli Depolama Yönteminin Ülkemiz Şartlarındaki Uygulanabilirliğinin
Değerlendirilmesi Ve İşletme Esaslarının Belirlenmesi, İ.T.Ü. Araştırma ve Geliştirme Projeleri, Proje Noμ
γ178β, Araştırıcı, β00λ” projesi kağsamında sürdürülmüş ve sonuçlandırılmıştır.
KAYNAKLAR
Adeleke OF 2003. Bioreactor Landfill, Shanghai University, Shanghai
Cossua R, Morellob L, Ragaa R, Cerminarab G 2016. Biogas production enhancement using semi-aerobic preaeration in a hybrid bioreactor landfill, Waste Management, 55: 83-92,
Kim H, Jang YC, Townsend T 2011. The behavior and long-term fate of metals in
simulated landfill bioreactors under aerobic and anaerobic conditions, Journal of Hazardous Materials, 194:
369-377
Long YY, Hu LF, Fang CR, He r, Shen DS 2009. Releasing behavior of zinc in recirculated bioreactor landfill,
Science of The Total Environment: 407(13): 4110-4116
Ni Z, Liu J, Girotto F, Cossu R, Qi G 2016. Targeted modification of organic components of municipal solid
waste
by
short-term
pre-aeration
and
itsenhancement on
anaerobic
degradation
in
simulated landfill bioreactors, Bioresource Technology, 216: 250-259
Qasim SR, Chiang W 1994. Sanitary Landfill Leachate Generation, Control and Treatment, Technomic
Publishing Company, Switzerland.
Qu X, He PJ, Shao LM, Le DJ 2008. Heavy metals mobility in full-scale bioreactor landfill: Initial stage,
Chemosphere, 70(5): 769-777,
Rhyner CR, Schwartz LJ, Wenger RB, Kohrell MG 1995. Waste Management and Resource Recovery, Lewis
Publishers, USA.
US Environmental Protection Agency, 2006, http://es.epa.gov , [Erişim β8.0λ.β007]
US Environmental Protection Agency, 6-7 Ekim 2000. State of the Practice for Bioreactor Landfills Workshop
on Bioreactor Landfills Arlington, Virginia
Yuen, STS 2001. Bioreactor landfills: Do they work?, 2nd ANZ Conference on Environmental Geotechnics,
Newcastle, Australia, 28-30 November
Xie S, Ma Y, Strong PJ, Clarke WP 2015. Fluctuation of dissolved heavy metal concentrations in the leachate
from anaerobic digestion of municipal solid waste in commercial scale landfill bioreactors: The effect of pH
and associated mechanisms, Journal of Hazardous Materials, 299: 577-583
Xu O, Jin X, Ma Z, Tao H, Ko JH 2014. Methane production in simulated hybrid bioreactor landfill, Bioresource
Technology, 168: 92-96,
ORAL PRESENTATION
153
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
An Unsupervised Automated Classification Approach For Discrimination of Ailanthus altissima
Tree Leaves
Çağlar Cengizler
Çukurova University, Faculty of Engineering and Architecture, Department of Biomedical Engineering, Adana,
Turkey.
Corresponding author e-mail: ccengizler@cu.edu.tr
Abstract
An unsupervised machine learning approach is presented for automated classification of Ailanthus altissima
tree leaves in this study. Experimental setup is consist of a total of 390 leaf images taken from leafsnap
dataset where a binary mask is extracted from each of the leaves. There are ten different tree specimens in the
dataset and it was expected from presented methodology to classify Ailanthus Altissima tree leaves among
other tree specimens. Accordingly three features, defining shape and morphology of the leaf is extracted from
binary masks and discrimination process is conducted on these features. Two widely known unsupervised data
clustering methods, Fuzzy C-means and K-Means are utilized for clustering previously extracted features into
two clusters as Ailanthus Altissima group and others. F-Score is utilized for objective evaluation of the
performance. Experiments revealed that presented approach is promising and both of the examined clustering
methods may discriminate Altissima tree leaves with high accuracy and sensitivity.
Keywords: Ailanthus Altissima Classification Unsupervised FCM K-Means.
1. INTRODUCTION
Aailanthus altissima (A. altissima) tree widely known as tree of heaven from the family Simaroubaceae Genus
Ailanthus is a highly invasive and fast growing species which is originating from china (Heisey, 1996).
Automated classification of that tree would be a necessity due to its highly invasive character and applications
in Chinese traditional medicine.
Classification based on examination of leaf images is one of the low-cost solutions. Accordingly imaging leaves
and discriminate them according to extracted measures would be an optimized solution to automated
classification of tree species (Fu et al.,2004). It was aimed to classify A. Altissima according to leaf
characteristics in this study.
Automated discrimination of extracted features defining characteristics of leaves would be accomplished by both
supervised and unsupervised machine learning approaches. For example probabilistic neural networks are
utilized as an supervised approach in the previous literature (Kadir et al., 2013). Also generalized softmax
perceptron model is previously utilized for classification leaves of the sunflowers (Arribas et al., 2011). Most of
the supervised methods require a training stage with an extra teaching dataset (Kotsiantis et al., 2007). An
unsupervised approach which is based on clustering extracted features is utilized in this study. Accordingly
proposed system completes classification of shape and morphology based features without any training. Three
features are extracted from each of the leaves. As an classifier to these features two of the well known clustering
mechanisms, K-means and Fuzzy C-means are utilized to examine and compare the performance of clustering
approaches. Both of them are organizing numerical data into clusters which consist of relatively similar elements
of features (Bezdek at al., 1984) (Jain, 2010). Performance of the methodology is judged by F-score as an
objective criteria. The rest of this paper is organized as follows. Section 2 introduces the utilized data set,
extracted features and discrimination process, Section 3 presents the results of the experimental setup and
Section 4 is consist of discussions of presented results and performance evaluation and finally Section 5 presents
the conclusion.
ORAL PRESENTATION
154
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS AND METHODS
2.1 Utilized Data
Utilized data set consist of 390 leaf images and their binary masks. All data is taken from leafsnap database
which covers tree species from the Northeastern United States (Kumar et al., 2012). Ten species including A.
altissima are included in dataset. Names and image quantities of the species classified in this study is given in
Table 1.
Table 3. Classified species in the study
Species Name
Leaf Count
Abies nordmanniana
35
Acer ginnala
31
Acer palmatum
92
Acer platanoides
20
Acer rubrum
45
Aesculus flava
15
Aesculus glabra
44
Ailanthus altissima
16
Amelanchier arborea
43
Quercus acutissima
49
All leaf images have a binary mask in the data set defining it's area and outline. A sample image and it's mask is
shown in Figure 1.
Figure 10. An A.altissima leaf image from data set (left) and it's binary mask(right)
2.2 Extracted Features
Three features are extracted from each of the binary masks. These features are shape and morphology based
numerical measurements which are defining the shape character of the specimen. First extracted feature is
eccentricity which is a scalar value within a range of 0 and 1. It is measured by division of the distance between
the foci of the ellipse (an ellipse which has the same second-moments as the region) and its major axis length.
Second feature is minor axis length. Following final feature is ratio of major and minor axes.
2.3 Classification Stage
Two clustering approaches are utilized for grouping extracted features into 2 clusters. Each of the method is
experimented with same data. One of the methods is K-means. It is operating for partition n observations into
certain number of clusters where observations belong to the cluster with the nearest mean (Kanungo et al., 2002).
It is possible to formulate all observations by:
ORAL PRESENTATION
155
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
X = {x1,x2,x3,……..,xn}
(1)
and centers by:
V = {v1,v2,…….,vc}
(2)
With respect to (1) and (2) cluster centers are calculated by:
(3)
where ‘ci’ stands for the number of observations in ith cluster.
Clustering process starts with random cluster centers then distance between each observation and cluster centers
is calculated. Following by, each observation is assigned a cluster center according to its distance. Nearest
cluster center should be chosen at that point. Then cluster centers are recalculated. K-means clustering algorithm
repeats the calculating distances until minimizing the within-cluster sum of squares. which is formulated by:
(4)
In addition to K-means another well known clustering approach Fuzzy C-means (FCM) is examined in the study.
FCM algorithm is based on similar principles however, in difference to K-means, FCM operates on membership
degrees of observations (Cannon et al., 1986). Objective function of FCM with membership degree is given
below:
(5)
where, uij is the degree of membership, xi is ith observation of data, and cj is center of the jth cluster.
Accordingly uij is calculated by:
(6)
Where center of the clusters are calculated by:
(7)
3. RESULTS
Actual cluster centers of extracted features for ten species including A. altissima are given in Table 2 and
standard deviations for all centroids are given in Table 3.
ORAL PRESENTATION
156
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 2. Cluster centers for all features are given where A. altissima tree centroids are given under SP8
SP1 SP2 SP3 SP4 SP5 SP6 SP7 SP8 SP9 SP10
1 0,77 0,45 0,57 0,42 0,64 0,58 0,8 0,79 0,94
Eccentricity
31,7 211 278 308 270 326 258 264 234 160
MinorAxisLength
Maj./Min. Axis Ratio 11,3 1,65 1,14 1,24 1,13 1,37 1,34 1,72 1,67 3,04
Table 3. Standard deviations for all clusters where values for A.altissima tree are given under SP8
SP1
0
Eccentricity
13,8
MinorAxisLength
Maj./Min. Axis Ratio 1,59
SP2
0,09
39,7
0,31
SP3
0,13
41,8
0,1
SP4
0,12
27,7
0,11
SP5
0,12
41,3
0,15
SP6
0,14
67,7
0,24
SP7
0,17
65,8
0,33
SP8
0,07
36,4
0,27
SP9
0,05
42,4
0,25
SP10
0,02
18,5
0,4
Clustering performance of both of the methods is measured by several parameters. These are accuracy:
(8)
sensitivity:
(9)
recall:
(10)
and F-Score:
(11)
Where Tp, Tn, Fp, Fn and N are true positive, true negative, false positive false negative and number of
observations respectively. Performance according to given criteria is presented in Table 4. Also total
classification time is given in Table 4. for performance evaluation.
Table 4. Classification Performance of two well known clustering mechanisms and their classification duration
are presented.
FCM
K-Means
ORAL PRESENTATION
Accuracy Sensitivity
0,869
0,906
0,869
0,906
F-Score
0,93
0,93
Classification Time (seconds)
0,069
0,009
157
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4. DISCUSSION
Actual cluster centers in Table 2. are indicating that utilized features for discrimination of A.altissima tree leafs
varies with distinct tree species. According to Table 4, both of the methods are capable of classifying A.altissima
tree with 0.93 F-Score which is indicating clustering approach would be an effective solution for automated
detection of A.altissima. It should be also noted that, FCM approach is relatively more sophisticated than KMeans however results revealed that K-Means would complete classification task much more faster with similar
discrimination success.
5. CONCLUSION
It was aimed to present a novel utilization of basic unsupervised classification and shape and morphology based
salient features for classification of a specific tree species. Results are promising and it would be possible to note
that cost effective basic clustering approaches may be efficient classifiers for fast and reliable applications.
REFERENCES
Arribas, Juan Ignacio, et al. Leaf classification in sunflower crops by computer vision and neural networks.
Computers and Electronics in Agriculture 78.1 (2011): 9-18.
Bezdek, James C., Robert Ehrlich, and William Full. FCM: The fuzzy c-means clustering algorithm. Computers
& Geosciences 10.2-3 (1984): 191-203.
Cannon, Robert L., Jitendra V. Dave, and James C. Bezdek. Efficient implementation of the fuzzy c-means
clustering algorithms. IEEE transactions on pattern analysis and machine intelligence 2 (1986): 248-255.
Fu, Hong, et al. Machine learning techniques for ontology-based leaf classification. Control, Automation,
Robotics and Vision Conference, 2004. ICARCV 2004 8th. Vol. 1. IEEE, 2004.
Heisey, Rod M. Identification of an allelopathic compound from Ailanthus altissima (Simaroubaceae) and
characterization of its herbicidal activity. American Journal of Botany (1996): 192-200.
Jain, Anil K. Data clustering: 50 years beyond K-means. Pattern recognition letters 31.8 (2010): 651-666.
Kadir, Abdul, et al. Leaf classification using shape, color, and texture features. arXiv preprint arXiv:1401.4447
(2013).
Kanungo, Tapas, et al. An efficient k-means clustering algorithm: Analysis and implementation. IEEE
transactions on pattern analysis and machine intelligence 24.7 (2002): 881-892
Kotsiantis, Sotiris B., I. Zaharakis, and P. Pintelas. Supervised machine learning: A review of classification
techniques. Emerging artificial intelligence applications in computer engineering 160 (2007): 3-24.
Kumar, Neeraj, et al. Leafsnap: A computer vision system for automatic plant species identification. Computer
vision–ECCV 2012. Springer, Berlin, Heidelberg, 2012. 502-516.
ORAL PRESENTATION
158
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Mersin İlinde Kan Donörlerinde Leishmania Parazitinin Moleküler Epidemiyolojisinin Araştırılması
Gül Bayram Abiha1, Ender Dinçer2, Sema Erden Ertürk1, Eyüp Naci Tiftik3
Mersin Üniversitesi, Sağlık Hizmetleri Meslek Yüksekokulu, Mersin, Türkiye
Mersin Üniversitesi, İleri Teknoloji Eğitim, Araştırma ve Uygulama Merkezi, Türkiye
3
Mersin Üniversitesi, Tıp Fakültesi, Dahili Tıp Bilimleri, Mersin, Türkiye
Sorumlu yazar e-mail: gulbayram@mersin.edu.tr
1
2
Özet
Amaç: Kan transfüzyonu ile bulaşan paraziter enfeksiyonlar, bakteriyel ve viral enfeksiyonlarla
karşılaştırıldıklarında daha düşük oranda görülmelerine rağmen özellikle primer ya da sekonder enfeksiyon
olarak immün sistemi baskılanmış bireylerde ve sık transfüzyon alan hastalarda önemli bir risk faktörü olarak
ortaya çıkmaktadır. Dünya genelinde kan donörlerinde en çok bildirilen transfüzyon kaynaklı paraziter
enfeksiyonlar Plasmodium spp., Trypanosoma cruzi, Babesia microti, Toxoplasma gondii ve Leishmania
spp.’dir. Bu paraziter enfeksiyonlardan biri olan Leishmaniasis hastalığı ülkemizin de içinde bulunduğu akdeniz
ülkelerinde, Ortadoğu, Orta ve Güney Amerika ve Hindistan’da endemiktir. Bu enfeksiyonla ilgili endemik
bölgelerde kan donörlerinde yapılmış çalışma sayısı çok azdır. Bu çalışmada bölgemizde bu paraziter etkenin
kan donörlerindeki moleküler epidemiyolojisinin ve karakterizasyonunun belirlenmesi amaçlanmıştır.
Gereç ve Yöntem: Mersin Üniversitesi Sağlık Araştırma ve Uygulama Merkezi, Kan Merkezi'nde Haziran
2016- Haziran β017 yıllarını kapsayan 1β aylık bir sürede kan donörü olarak kabul edilen gönüllülerden, rutin
işlemler sırasında elde edilmiş γ00 kan örneği toplanmıştır. Bu örneklerde Leishmania spp. parazitlerinin varlığı
araştırılmıştır. Ayrıca donörlerden enfeksiyonlara maruziyet riskini belirlemek amacı ile hazırlanmış anket
formları hazırlanmıştır. Toplanan γ00 kan örneğinden genomic DNA eldesi High pure Template Preparation Kit
(Roche, Germany) ile yapılmıştır. Parazit DNA’sını saptamak için Taqman problar kullanılarak gerçek zamanlı
PZR yapılmıştır.
Bulgular: Çalışma sonuçları tanımlayıcı istatistik kullanılarak değerlendirilmiştir. Kan donörleri içerisinde
çiftçilikle uğraşanların yüzdesi %5,8 olarak bulunurken bu oran ofis çalışanlarında %γλ,7’dir. Real-time PZR
sonucunda tüm örnekler Leishmania spp. için negatif olarak bulunmuştur.
Tartışma ve sonuç: Bölgemizde daha önce kan donörlerinin Leishmania spp. parazitinin taranmasına dair bir
çalışma yapılmamıştır. Bu sonuçlar ilk edilen veriler olup daha fazla sayıda donörün katıldığı çok merkezli
çalışmaların yapılması gerektiğini düşünmekteyiz.
Anahtar Kelimeler: Kan donörü, transfüzyon, Leishmania spp., polimeraz zincir reaksiyonu.
1. GİRİŞ
Günümüzde kan donörlerinde yapılan çalışmalarda en çok bildirilen transfüzyon kaynaklı paraziter
enfeksiyonlar Plasmodium spp., Trypanosoma cruzi, Babesia microti, Toxoplasma gondii ve Leishmania spp.
olarak sıralanmaktadır (Mansueto ve ark. 2014). Leishmaniasis hastalığı Leishmania cinsi parazitler ile enfekte
dişi kum sineklerinin (Tatarcık, yakarca, Phlebotomus) kan emmesi sırasında insanlara bulaşması ile ortaya
çıkmaktadır. Leishmaniasis, ülkemizin de içinde bulunduğu akdeniz ülkelerinde, Ortadoğu, Orta ve Güney
Amerika ve Hindistan’da endemiktir (Savoia ve ark. 2015). Leishmaniasis'in parazitin türüne ve konağın immün
yanıtına bağlı olarak gelişen asemptomatik (%80-95) enfeksiyonun üç ana klinik sendroma neden olan formları
(5-β0%)ν visseral leishmaniasis (VL), kutanöz leishmaniasis (KL) ve mukokutanöz leishmaniasis (ML) olarak
sıralanmaktadır (Mansueto ve ark. 2007, Thornton ve ark. β010). İnsanlarda üç tip klinik tablo ile seyreden
hastalığın ülkemizde en çok görülen şekli Kutanöz Leishmaniasis (KL) olup, başta Şanlıurfa olmak üzere,
Osmaniye, Adana, Hatay, Aydın, Kahramanmaraş ve Mersin illerimizde endemik olarak görülmektedir
(Koltasve ark β014, Yldız ve ark. β007). L. major ve L. Donovani türleri endemik olarak Türkiye, Irak, İran ve
Suriye gibi ülkelerde görülmektedir. Enfekte kişilerde bu parazit retiküloendotelyal sistem hücrelerinin içinde
kalıp normal kan dolaşım sistemine girmemektedir. Genel olarak, kan bankalarındaki saklama koşullarında +4
C’de saklanan kan torbalarında bu parazitlerin 30 güne kadar canlı kalabildikleri saptanmıştır (Grog ve ark.
1993.).Kan donörlerinde asemptomatik Leishmania enfeksiyonu ile ilgili bildirimler Hindistan (Singh ve ark.
2002, Das ve ark.2011), Nepal (Bhattarai ve ark. 2009), Bangladeş (Huda ve ark. 2013), İran (Fakhar M ve ark.
2008), Irak (Souhaila ve ark. 2010), Türkiye (Ates ve ark . 2012, Ates ve ark 2013), İtalya (Scarlata ve ark. 2008,
ORAL PRESENTATION
159
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Biglino 2010), Yunanistan (Kyriakou DS ve ark. 2013, Kubar J ve ark. 1997, Fichoux Y ve ark. 1999), İspanya
(Martin-Sanchez J, ve ark. 2004, Riera C ve ark. 2004 Riera C ve ark. 2008), Brezilya (Luz KG ve ark. 1997,
Otero AC ve ark.2000, Barao SC ve ark 2007,Clemente WT ve ark.2014) dünya genelinde yapılmıştır.
Ülkemizde kan donörlerinde bu parazitin varlığı ile ilgili yapılan çalışmalar sınırlı sayıdadır. Bundan dolayı, bu
çalışmada bölgemizde bu paraziter etkenin kan donörlerindeki moleküler epidemiyolojisinin ve
karakterizasyonunun belirlenmesi amaçlanmıştır.
2. MATERYAL VE YÖNTEM
Kan Örneklerinin toplanması: Mersin Üniversitesi Sağlık Araştırma ve Uygulama Merkezi, Kan Merkezi'nde
Haziran 2016- Haziran β017 yıllarını kapsayan 1β aylık bir sürede kan donörü olarak kabul edilen gönüllülerden,
donör olarak onaylanan, bilgilendirilmiş onam alınacak kişilerden rutin işlemler sırasında elde edilmiş γ00 kan
örneği toplanmıştır. Bu örneklerde Leishmania spp. ve T. gondii parazitlerinin varlığı araştırılmıştır. Ayrıca
donörlerden enfeksiyonlara maruziyet riskini belirlemek amacı ile hazırlanmış anket formları hazırlanmıştır.
DNA izolasyonuμ Kan donörlerinden elde edilecek kan örneklerinden gDNA ekstraksiyonu High
Template Preparation Kit (Roche, Germany) yardımıyla yapıldı EDTA’lı tüplere alınacak kanlardan santrifüj
işlemi yardımıyla lökosit tabakası ayrılarak, kit prospektüsüne göre gDNA eldesi yapıldı Örneklerdeki DNA
konsantrasyonu CapitalBio NanoQ drop kullanılarak spektrofotometrik ile belirlendi Çalışmanın bu aşaması
Mersin Üniversitesi İleri Teknoloji Eğitim Araştırma ve Uygulama Merkezi laboratuvarlarında yapıldı.
Gerçek zamanlı Polimeraz zincir reaksiyonu (PZR): Leishmania spp. saptamak için Taqman problar
kullanılarak gerçek zamanlı PZR yapılmiştır (Özbel Y ve ark. β016). Yöntemin standardizasyonu için referans
suşlar kullanılmıştır.
3. SONUÇ
Elde edilen gDNA’larda Leishmania türlerinin tespiti için yapılan gertçek zamanlı PZR işlemi sonucunda , kan dönerlerinin
hepsi negative olarak bulunmuştur.
4. TARTIŞMA
Visseral leishmaniasis dünyada 88 ülkenin tropikal ve subtropikal bölgelerinde endemiktir. Dünyada bilinen 1β
milyon leishmaniasis olgusu vardır, her yıl 1.5 -β milyon yeni olgu görülmektedir. Her yıl görülen 500.000 yeni
visseral leishmaniasisun % λ0’ı Nepal, Bangladeş, Hindistan, Sudan ve Brezilya’dadır. Dünyadaki olguların
yaklaşık %50’si Hindistan’da görülmektedir. İnfeksiyon erkeklerde kadından daha fazla görülmektedir (World
Health Organization,β016). İspanya’da kan donörlerinde yapılan çalışmada %8 oranında Leishmania (L.)
infantum, Brezilya’daki kan donörlerinde %11,4 L. braziliensis, yine Brezilya da başka bir bölgede yapılan
çalışmada %1γ,β L. infantum saptanırken Nepal’de %5 oranında leishmanial IgG seropozifiliği bulunmuştur
(Monteiro ve ark. 2016, Braga ve ark.2015, Fukutani ve ark.2014, Perez-Cutillasa ve ark.2015, Timilsana ve
ark.β016.). Türkiye’de visseral Leishmaniasis daha çok Ege ve Akdeniz bölgelerinde görülmekle birlikte hemen
hemen bütün bölgelerimizden bildirilmiş olgular bulunmaktadır (Özbel Y ve ark. β016, Ates ve ark . β01β, Ates
ve ark β01γ) . Hastalığın etkeni olan Leishmania parazitleri hem insandan hem de köpeklerden izole edilmiş,
izoenzim analizi, EF (excreted factor) analizi, monoklonal antikorlar ve PZR ile diğer Akdeniz bölgesi
ülkelerinde olduğu gibi etkenin L. infantum olduğu ve doğadaki rezervuarlığını da köpeklerin yaptığı
epidemiyolojik çalışmalarla kanıtlanmıştır. Ülkemizde β01γ yılında kan donörlerinde yapılan bir çalışma’da
%4,γ oranında Leishmania spp. mikro kültür yöntemi ile pozitif bulunmuştur (Ates ve ark β01γ). Bu çalışmada
elde edilen veriler bölgemize ait ilk verilerdir. Çalışmada çiftçilikle uğraşan donor sayısı az olup donörlerin
büyük bir kısmı ofiste çalışmaktadır ve şehir merkezinde yaşamaktadır. Bu nedenle bu donörlerin vektörlerle
karşılaşma şansı kırsal kesimde yaşayanlara göre azalmaktadır. Sonuç olarak, rutin kan tarama testlerinde bu
paraziter etkenin varlığının araştırılması gerekli olmayıp mevcut tarama testleri yeterlidir.
TEŞEKKÜR
Bu çalışma Mersin Üniversitesi Bilimsel araştırmalar ve proje birimi tarafından 2016-2-AP4-1λβγ no’lu proje
olarak desteklenmiştir.
ORAL PRESENTATION
160
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
KAYNAKLAR
Mansueto P, Seidita A, Vitale G, Cascio A 2014. Transfusion transmitted leishmaniasis. What to do with blood
donors from endemic areas?. Travel Med Infect Dis,12:617-27.
Savoia D 2015. Recent updates andperspectives on leishmaniasis. J Infect Dev Ctries 9(6):588-596.
Mansueto P, Vitale G, Di Lorenzo G, Rini GB, Mansueto S, Cillari E 2007. Immunopathology of leishmaniasis:
an update. Int J Immunopathol Pharmacol, 20:435-45.
Thornton SJ, Wasan KM, Piecuch A, Lynd LL, Wasan EK 2010. Barriers to treatment for visceral leishmaniasis
in hyperendemic areas: India, Bangladesh, Nepal, Brazil and Sudan. Drug Dev Ind Pharm, 36:1312-9.
Koltas IS, Eroğlu F, Alabaz D, Uzun S 2014. The emergence of Leishmania major and Leishmania donovani in
southern Turkey. Trans R Soc Trop Med Hyg, 108:154–158.
Yıldız ZF, Korkmaz M, Ozbel Y 2007. Serodiagnosis of Anthroponotic Cutaneous Leishmaniasis (ACL) caused
by Leishmaniatropica in Sanliurfa province, Turkey, Where ACL is Highly Endemic. Clin Vaccine Immunol,
14: 1409-15.
Grogl M, Daugirda JL, Hoover DL, Magill AJ, Berman JD 1993. Survivability and infectivity of
viscerotropicLeishmaniatropica from Operation Desert Storm participants in human blood products maintained
under blood bank conditions. Am J Trop Med Hyg, 49:308-15.
Singh S, Kumari V, Singh N 2002. Predicting kala-azar disease manifestations in asymptomatic patients with
latent Leishmaniadonovani infection by detection of antibody against recombinant K39 antigen. ClinDiagnLab
Immunol, 9: 568-72.
Das VN, Siddiqui NA, Verma RB, Topno RK, Singh D, Das S et al 2011. Asymptomatic infection of visceral
leishmaniasis in hyperendemic areas of Vaishali district, Bihar, India: a challenge to kala-azar elimination
programmes. Trans R Soc Trop Med Hyg, 105:661-6.
Bhattarai NR, Van der Auwera G, Khanal B, De Doncker S, Rijal S, Das ML, et al 2009. PCR and direct
agglutination as Leishmania infection markers among healthy Nepalese subjects living in areas endemic for
Kala-Azar. Trop Med Int Health, 14:404-11.
Huda MM, Rudra S, Ghosh D, Bhaskar KR, Chowdhury R, Dash AP, et al 2013. Low prevalence of
Leishmaniadonovani infection among the blood donors in kala-azar endemic areas of Bangladesh. BMC Infect
Dis, 13:62.
Fakhar M, Motazedian MH, Hatam GR, Asgari Q, Kalantari M, Mohebali M 2008. Asymptomatic human
carriers of Leishmaniainfantum: possible reservoirs for Mediterranean visceral leishmaniasis in southern Iran.
Ann Trop Med Parasitol, 102:577-83.
Alborzi A, Souhaila MA, Khawla HZ, K YAD 2010. Indirect fluorescent antibody test for serodiagnosis of
visceral leishmaniasis: an epidemiological study in Iraq. J Univ Anbar Pure Sci,4:1-4.
Ates SC, Bagirova M, Allahverdiyev AM, Baydar SY, Koc RC, Elcicek S, et al 2012. Detection of
antileishmanial antibodies in blood sampled from blood bank donors in Istanbul. Future Microbiol, 7:773-9.
Ates SC, Bagirova M, Allahverdiyev AM, Kocazeybek B, Kosan E 2013. Utility of the microculture method for
Leishmania detection in non-invasive samples obtained from a blood bank. Acta Trop, 128:54-60.
ORAL PRESENTATION
161
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Scarlata F, Vitale F, Saporito L, Reale S, Vecchi VL, Giordano S, et al 2008. Asymptomatic Leishmania
infantum/chagasi infection in blood donors of western Sicily. Trans R Soc Trop Med Hyg, 102:394-6.
Colomba C, Saporito L, Polara VF, Barone T, Corrao A, Biglino A, Bolla C, Concialdi E, Trisciuoglio A,
Romano A, Ferroglio E 2010. Asymptomatic Leishmania infantum infection in an area of northwestern Italy
(Piedmont region) where such infections are traditionally nonendemic. J Clin Microbiol, 48:131-6.
Kyriakou DS, Alexandrakis MG, Passam FH, Kourelis TV, Foundouli P, Matalliotakis E, et al 2003. Quick
detection of Transfusion transmitted leishmaniasis 625 Leishmania in peripheral blood by flow cytometry. Is
prestorage leucodepletion necessary for leishmaniasis prevention in endemic areas? Transfus Med, 13:59-62.
Kubar J, Quaranta JF, Marty P, Lelievre A, Le Fichoux Y, Aufeuvre JP 1997. Transmission of L. infantum by
blood donors. Nat Med, 3:368.
Fichoux Y, Quaranta JF, AufeuvreJP, Lelievre A, Marty P, Suffia I, et al 1999. Occurrence of
Leishmaniainfantumparasitemia in asymptomatic blood donors living in an area of endemicity in southern
France. J ClinMicrobiol, 37:1953-7.
Martin-Sanchez J, Pineda JA, Morillas-Marquez F, GarciaGarcia JA, Acedo C, Macias J 2004. Detection of
Leishmania infantum kinetoplast DNA in peripheral blood from asymptomatic individuals at risk for
parenterally transmitted infections: relationship between polymerase chain reaction results KAYNAKLAR
Mansueto P, Seidita A, Vitale G, Cascio A 2014. Transfusion transmitted leishmaniasis. What to do with blood
donors from endemic areas?. Travel Med Infect Dis,12:617-27.
Savoia D 2015. Recent updates andperspectives on leishmaniasis. J Infect Dev Ctries 9(6):588-596.
Mansueto P, Vitale G, Di Lorenzo G, Rini GB, Mansueto S, Cillari E 2007. Immunopathology of leishmaniasis:
an update. Int J Immunopathol Pharmacol, 20:435-45.
Thornton SJ, Wasan KM, Piecuch A, Lynd LL, Wasan EK 2010. Barriers to treatment for visceral leishmaniasis
in hyperendemic areas: India, Bangladesh, Nepal, Brazil and Sudan. Drug Dev Ind Pharm, 36:1312-9.
Koltas IS, Eroğlu F, Alabaz D, Uzun S 2014. The emergence of Leishmania major and Leishmania donovani in
southern Turkey. Trans R Soc Trop Med Hyg, 108:154–158.
Yıldız ZF, Korkmaz M, Ozbel Y 2007. Serodiagnosis of Anthroponotic Cutaneous Leishmaniasis (ACL) caused
by Leishmaniatropica in Sanliurfa province, Turkey, Where ACL is Highly Endemic. Clin Vaccine Immunol,
14: 1409-15.
Grogl M, Daugirda JL, Hoover DL, Magill AJ, Berman JD 1993. Survivability and infectivity of
viscerotropicLeishmaniatropica from Operation Desert Storm participants in human blood products maintained
under blood bank conditions. Am J Trop Med Hyg, 49:308-15.
Singh S, Kumari V, Singh N 2002. Predicting kala-azar disease manifestations in asymptomatic patients with
latent Leishmaniadonovani infection by detection of antibody against recombinant K39 antigen. ClinDiagnLab
Immunol, 9: 568-72.
ORAL PRESENTATION
162
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Das VN, Siddiqui NA, Verma RB, Topno RK, Singh D, Das S et al 2011. Asymptomatic infection of visceral
leishmaniasis in hyperendemic areas of Vaishali district, Bihar, India: a challenge to kala-azar elimination
programmes. Trans R Soc Trop Med Hyg, 105:661-6.
Bhattarai NR, Van der Auwera G, Khanal B, De Doncker S, Rijal S, Das ML, et al 2009. PCR and direct
agglutination as Leishmania infection markers among healthy Nepalese subjects living in areas endemic for
Kala-Azar. Trop Med Int Health, 14:404-11.
Huda MM, Rudra S, Ghosh D, Bhaskar KR, Chowdhury R, Dash AP, et al 2013. Low prevalence of
Leishmaniadonovani infection among the blood donors in kala-azar endemic areas of Bangladesh. BMC Infect
Dis, 13:62.
Fakhar M, Motazedian MH, Hatam GR, Asgari Q, Kalantari M, Mohebali M 2008. Asymptomatic human
carriers of Leishmaniainfantum: possible reservoirs for Mediterranean visceral leishmaniasis in southern Iran.
Ann Trop Med Parasitol, 102:577-83.
Alborzi A, Souhaila MA, Khawla HZ, K YAD 2010. Indirect fluorescent antibody test for serodiagnosis of
visceral leishmaniasis: an epidemiological study in Iraq. J Univ Anbar Pure Sci,4:1-4.
Ates SC, Bagirova M, Allahverdiyev AM, Baydar SY, Koc RC, Elcicek S, et al 2012. Detection of
antileishmanial antibodies in blood sampled from blood bank donors in Istanbul. Future Microbiol, 7:773-9.
Ates SC, Bagirova M, Allahverdiyev AM, Kocazeybek B, Kosan E 2013. Utility of the microculture method for
Leishmania detection in non-invasive samples obtained from a blood bank. Acta Trop, 128:54-60.
Scarlata F, Vitale F, Saporito L, Reale S, Vecchi VL, Giordano S, et al 2008. Asymptomatic Leishmania
infantum/chagasi infection in blood donors of western Sicily. Trans R Soc Trop Med Hyg, 102:394-6.
Colomba C, Saporito L, Polara VF, Barone T, Corrao A, Biglino A, Bolla C, Concialdi E, Trisciuoglio A,
Romano A, Ferroglio E 2010. Asymptomatic Leishmania infantum infection in an area of northwestern Italy
(Piedmont region) where such infections are traditionally nonendemic. J Clin Microbiol, 48:131-6.
Kyriakou DS, Alexandrakis MG, Passam FH, Kourelis TV, Foundouli P, Matalliotakis E, et al 2003. Quick
detection of Transfusion transmitted leishmaniasis 625 Leishmania in peripheral blood by flow cytometry. Is
prestorage leucodepletion necessary for leishmaniasis prevention in endemic areas? Transfus Med, 13:59-62.
Kubar J, Quaranta JF, Marty P, Lelievre A, Le Fichoux Y, Aufeuvre JP 1997. Transmission of L. infantum by
blood donors. Nat Med, 3:368.
Fichoux Y, Quaranta JF, AufeuvreJP, Lelievre A, Marty P, Suffia I, et al 1999. Occurrence of
Leishmaniainfantumparasitemia in asymptomatic blood donors living in an area of endemicity in southern
France. J ClinMicrobiol, 37:1953-7.
Martin-Sanchez J, Pineda JA, Morillas-Marquez F, GarciaGarcia JA, Acedo C, Macias J 2004. Detection of
Leishmania infantum kinetoplast DNA in peripheral blood from asymptomatic individuals at risk for
parenterally transmitted infections: relationship between polymerase chain reaction results and other Leishmania
infection markers. Am J Trop Med Hyg, 70:545-8.
Riera C, Fisa R, Udina M, Gallego M, Portus M 2004. Detection of Leishmania infantum cryptic infection in
asymptomatic blood donors living in an endemic area (Eivissa, Balearic Islands, Spain) by different diagnostic
methods. Trans R Soc Trop Med Hyg, 98:102-10.
ORAL PRESENTATION
163
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Riera C, Fisa R, Lopez-Chejade P, Serra T, Girona E, Jimenez M, et al 2008. Asymptomatic infection by
Leishmaniainfantum in blood donors from the Balearic Islands (Spain). Transfusion, 48:1383-9.
Luz KG, da Silva VO, Gomes EM, Machado FC, Araujo MA, Fonseca HE, et al 1997. Prevalence of antiLeishmaniadonovani antibody among Brazilian blood donors and multiply transfused hemodialysis patients. Am
J Trop Med Hyg, 57: 168-71.
Clemente WT, Rabello A, Faria LC, Peruhype-Magalhaes V, Gomes LI, da Silva TA, et al 2014. High
prevalence of asymptomatic Leishmania spp. infection among liver transplant recipients and donors from an
endemic area of Brazil. Am J Transplant: Official Journal of the American Society of Transplantation and the
American Society of Transplant Surgeons, 14:96-101.
Özbel Y, Karakuş M, Arserim SK, Kalkan ŞO, Töz S 2016. Molecular detection and identification of
Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyiadentata in a focus of human and
canine leishmaniasis in western Turkey. Acta Trop, 155:89-94.
World Health
12.06.2016).
Organization.
httpμ//www.who.int/leishmaniasis/resources/Cutaneous_leish_cm_.
(Erişimμ
Monteiro DCS, Sousa AQ, Lima DM, Fontes RM, Praciano CC, Frutuoso MS 2016. Leishmania infantum
Infection in Blood Donors, North eastern Brazil.Emerg Infect Dis,4(22):739-40.
Braga LS, Navasconi TR, Leatte EP, Skraba CM, Silveira TGV, Ribas-Silva RC, 2015. Presence of antiLeishmania (Viannia) braziliensisantibodies in blood donors in the West-Central region of theState of Parana,
Brazil. Rev Soc Bras Med Trop, 448(5):622-625.
Fukutani KF, Figueiredo V, Celes FS, Cristal JR, Barral A, Barral-Netto, M 2014. Serological survey of
Leishmania infection in blood donors in Salvador, Northeastern Brazil. BMC Infect Dis, 14(422):1-8.
Perez-Cutillasa P, Goyenab E, Chitimiab L, Ruac P, Bernald LJ, Fisae R 2015. Spatial distribution of human
asymptomatic Leishmania infantum infection in southeast Spain: A study of environmental, demographic and
social risk factors. Acta Trop, 46: 127–134.
Timilsina S, Bhattarai N, Khanal B, Rijal S 2016. Serological Assessment for Leishmaniadonovani Infection in
Blood Donors of Sunsari District, Dharan, Nepal. Indian J Hematol Blood Transfus, 32(1):95-9.
and other Leishmania infection markers. Am J Trop Med Hyg, 70:545-8.
Riera C, Fisa R, Udina M, Gallego M, Portus M 2004. Detection of Leishmania infantum cryptic infection in
asymptomatic blood donors living in an endemic area (Eivissa, Balearic Islands, Spain) by different diagnostic
methods. Trans R Soc Trop Med Hyg, 98:102-10.
Riera C, Fisa R, Lopez-Chejade P, Serra T, Girona E, Jimenez M, et al 2008. Asymptomatic infection by
Leishmaniainfantum in blood donors from the Balearic Islands (Spain). Transfusion, 48:1383-9.
Luz KG, da Silva VO, Gomes EM, Machado FC, Araujo MA, Fonseca HE, et al 1997. Prevalence of antiLeishmaniadonovani antibody among Brazilian blood donors and multiply transfused hemodialysis patients. Am
J Trop Med Hyg, 57: 168-71.
Clemente WT, Rabello A, Faria LC, Peruhype-Magalhaes V, Gomes LI, da Silva TA, et al 2014. High
prevalence of asymptomatic Leishmania spp. infection among liver transplant recipients and donors from an
ORAL PRESENTATION
164
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
endemic area of Brazil. Am J Transplant: Official Journal of the American Society of Transplantation and the
American Society of Transplant Surgeons, 14:96-101.
Özbel Y, Karakuş M, Arserim SK, Kalkan ŞO, Töz S 2016. Molecular detection and identification of
Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyiadentata in a focus of human and
canine leishmaniasis in western Turkey. Acta Trop, 155:89-94.
World Health
12.06.2016).
Organization.
httpμ//www.who.int/leishmaniasis/resources/Cutaneous_leish_cm_.
(Erişimμ
Monteiro DCS, Sousa AQ, Lima DM, Fontes RM, Praciano CC, Frutuoso MS 2016. Leishmania infantum
Infection in Blood Donors, North eastern Brazil.Emerg Infect Dis,4(22):739-40.
Braga LS, Navasconi TR, Leatte EP, Skraba CM, Silveira TGV, Ribas-Silva RC, 2015. Presence of antiLeishmania (Viannia) braziliensisantibodies in blooddonors in the West-Central region of theState of Parana,
Brazil. Rev Soc Bras Med Trop, 448(5):622-625.
Fukutani KF, Figueiredo V, Celes FS, Cristal JR, Barral A, Barral-Netto, M 2014. Serological survey of
Leishmania infection in blood donors in Salvador, Northeastern Brazil. BMC Infect Dis, 14(422):1-8.
Perez-Cutillasa P, Goyenab E, Chitimiab L, Ruac P, Bernald LJ, Fisae R 2015. Spatial distribution of human
asymptomatic Leishmania infantum infection in southeast Spain: A study of environmental, demographic and
social risk factors. Acta Trop, 46: 127–134.
Timilsina S, Bhattarai N, Khanal B, Rijal S 2016. Serological Assessment for Leishmaniadonovani Infection in
Blood Donors of Sunsari District, Dharan, Nepal. Indian J Hematol Blood Transfus, 32(1):95-9.
ORAL PRESENTATION
165
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Microwave- and Ultrasound-Assisted Extraction of Pectin From Mandarin Peel
Pinar Karbuz, Meral Yildirim, Azmi Seyhun Kipcak, Emek Derun, Nurcan Tugrul*
Yildiz Technical University, Faculty of Chemistry - Metallurgical, Chemical Engineering, İstanbul Turkey
Corresponding author e-mail: ntugrul@yildiz.edu.tr
Abstract
Pectin was extracted from mandarin peel using ultrasound and microwave assisted extraction methods to
investigate mandarin as an alternative source of pectin production. Hydrochloric acid (HCl) was used as
an extracting agent. In this work, the effect of sonication time (15, 30, 45 min) and temperature (60, 75
°C) on the yield for ultrasound assisted extraction (UAE) was studied. Additionally, the parameters of
microwave power 360, 600 W) and irradiation time (1, 2, 3 min) were investigated for microwave
assisted extraction (MAE). The highest yield of pectin was found to be 20.01 % (w/w) for 2 min of
extraction at 600 W. The results showed that the use of microwave promoted a better yield of pectin
when compared to the ultrasound method and product yields in other extraction conditions were showed
almost similar characteristics. Therefore, these results suggested that MAE could be used as an efficient
and rapid technique for the extraction of pectin from mandarin peel. The chemical structure of the pectin
obtained from mandarin peel was found to be similar in the two different extraction methods.
Keywords: Mandarin waste, pectin, ultrasound, microwave, extraction.
1. INTRODUCTION
In recent years, concerns about the transformation of resources and environmental awareness have been
increasing. Therefore, the use of natural resources as an alternative to non-renewable resources is interested.
Especially, the processing of fruits in the food industry leads to a large amount of by-products (Minjares-Fuentes
et al., 2014)
Pectin is a complex polysaccharide located on the cell wall of plants. Pectin is a linear chain structure formed by
the α-1,4 bonds of galacturonic acid units. Pectin is widely used as a stabilizing, thickening and gelling agent in
food industry such as jams, jellies and fruit juice. In addition, it possesses various activities such as wound
healing, lipase inhibition, induction of cancer cell, anti-ulser and cholesterol decreasing effects in pharmaceutical
industry (Wang et al., 2015). Carboxyl groups in the pectin molecule are partially esterified with methyl alcohol.
Pectin can be classified as high methoxyl pectin (HMP) or low methoxyl pectin (LMP) according to amount of
esterification of methanol and galacturonic acid. If the rate of the esterified galacturonic acid is below or above
50 % , it is called LMP and HMP, respectively (Espitia et al., 2014). The degree of esterification is an indication
of the conditions and speed of gelling. HMP can only form gel in the environments where a large amount of
sugar and acid is present, while LMP can form gel in low sugar concentrations or sugar-free but multivariate
cations such as Ca, Mg (Güzel and Akpınar, β017). There are many different sources for pectin production and it
can be extracted from peels of fruits (Freitas de Oliveira et al., 2016). However, commercially, the production of
pectin is made of apple pomace and citrus peels. In dried peels of citrus fruits such as oranges, grapefruits and
lemons contain 25-30 % pectin (Bagherian et al., 2011). The other plant sources of pectin extraction such as
banana peels (Swamy et al., 2017), tomato waste (Grassino et al., 2016) and pomelo peels have been reported
(Liew et al., 2016).
Extraction is an important technique that is used for the isolation of bioactive products from natural sources for
use in food systems (Bayar et al., 2017). Chemical extraction methods are widely used, but they can lead to
serious environmental problems as they produce acidic waste water (Yang et al., 2017). Ultrasound
fundamentally generates bubble cavitation in the biological matrix (Kadam et al., 2015). Ultrasonic waves create
a cavitation effect in the solvent, causing the molecules to move faster and the solvent to higher penetrate the
target material (Moorthy et al., 2016). The cavitation can destroy the cell wall of plant, increase mass transport
and minimize particle sizes (Zhang et al., 2016). Ultrasound assisted extraction (UAE) is a clean, efficient and
eco-friendly technique which can be completed in minutes and giving higher purity of the final product (Maran
ORAL PRESENTATION
166
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
et al., 2016). Reducing extraction time, reducing energy consumption and a relatively lower use of solvent are
some advantages of UAE (Chemat et al, 2016). Ultrasound system conditions contain temperature, pressure,
frequency, sonication time and the solvent-biomass ratio (Chen et al., 2015).
Microwave is an electromagnetic wave that contains electric and magnetic fields and microwave assisted
extraction (MAE) is known as green technology (Adetunji et al., 2017). Microwave is an energy that used to
extract the desired components from plants (Agarwal et al., 2015). MAE is an extraction technique that increases
the mass transfer to the solvent from the sample by heating it with the microwave power and consists of
irradiation of the samples (Valdes et al., 2015). MAE efficiency depends on several factors, such as pH,
irradiation time, microwave power and sample/solvent ratio (Lefsih et al., 2017). MAE enables shorter extraction
times, more efficient product and less solvent usage than conventional extraction techniques (Criminna et al.,
2016). Therefore, this method provides low production cost, high efficiency and laboratory scale working
(Hosseini et al., 2016).
The purpose of this study is to determine and compare the qualitative and quantitative characteristics of pectin
obtained by ultrasound and microwave assisted extraction methods from mandarin peels. Effect of extraction
parameters such as temperature and sonication time for UAE were studied. The influences of microwave power
and irradiation time on the pectin yield were investigated. This work reports the effects of microwave on the
yield and quality of extracted pectin in comparison with ultrasound method. The product yield and
morphological structure of pectin were performed.
2. MATERIALS AND METHODS
Mandarins were collected from local market in Istanbul in January 2018. Mandarin peels were washed to remove
dusts and dried in a hot air oven at 60°C overnight. The dried peel was grinded and the peel powder was stored
in low density polyethylene bag at room temperature.
a
b
c
Figure 11. Mandarin peels a. wet, b. dry, c. powder
2.1 Ultrasound assisted extraction (UAE) of pectin from mandarin peels
2 g dried mandarin powder was weighed with SCALTEC SPB31 (Scaltec Instruments GmbH, Goettingen,
Germany) and mixed with 0.5 M HCl (TEKKİM, Bursa, Turkey). The extraction process was performed using
the following conditions: powder/solvent ratio 1:30 (g/ml) and pH 1.5 (0.5 M HCl). Then the samples were
heated in a ultrasonic water bath (ISOLAB, Wertheim, Germany) at 60 and 75 °C and were simultaneously
sonicated at 15, 30 and 45 min.
ORAL PRESENTATION
167
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
a
b
Figure 12. a. Ultrasonic bath, b. extraction solution
After extraction, the extraction mixture was transferred into centrifugal tubes after cooled at the room
temperature. The centrifuge was carried out using a SCILOGEX DM0412 Centrifuge (SCILOGEX, Rocky Hill,
United States). Then the mixture centrifuged at 2500 rpm 15 min and the filtrate was coagulated using three
volumes of ethanol (180 ml) for overnight at 4 °C. The precipitated pectin was separated by vacuum filtration
and rinsed three times with ethanol (Merck KGaA, Darmstadt, Germany). The pectin extracted ultrasonically
was dried in an oven (MMM Ecocell 111, Munich, Germany) at 60 °C until a constant weight was attained.
a
b
c
Figure 13. a. Centrifuge, b. vacuum filtration, c. pectin
2.2 Microwave assisted extraction (MAE) of pectin from mandarin peels
The dry mass (2g) of mandarin peels was mixed with 0.5 M HCl (60 ml, pH 1.5) as extracting agent. The
mixture was placed in the center of microwave oven (Bosch HMT72G420, Stuttgart, Germany). The solution
was then extracted 360 and 600 W for three times, 1, 2, 3 min. After the extraction, the mixture allowed to cool
down to room temperature, and after cooling, the mixture was centrifuged at 2500 rpm for 15 min. The next
steps are similar with UAE.
a
b
c
Figure 14. a. Microwave oven, b. precipitated pectin with ethanol, c. pectin product before drying
ORAL PRESENTATION
168
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3. RESULTS AND DISCUSSION
After extraction process, the product yield was calculated using (1) and the chemical structure of pectin was
analyzed by FTIR (IRPrestige21, SHIMADZU CORPORATION, Kyoto, Japan). Pectin particles were mixed
with KBr (1:100) and pressed into KBr pellets before FTIR analysis. Pectin yield (%) was expressed as the ratio
of dried pectin mass (Wp) obtained after extraction to the initial mass of dried mandarin powder (Wm) used for
extraction:
��
3.1. Yield of pectin
� % =� �
�
(1)
After ultrasound assisted extraction process, results of pectin yield of samples shown in Table 1.
Table 4. Pectin yields of ultrasound assisted extraction at different parameters
Extraction temperature
Sonication time
60 °C
75 °C
Pectin yield
15 min
13.61 %
15.12 %
30 min
16.85 %
17.43 %
45 min
15.80 %
16.74 %
According to Table 1, the highest pectin yield was found as 17.4γ % at 75 °C and γ0 min extraction conditions.
The increased in temperature was increased product yield and the maximum amount of pectin was obtained in
about 30 min by UAE. The results of pectin yield by microwave assisted extraction shown in Table 2.
Table 5. Pectin yields of microwave assisted extraction at different parameters
Microwave power
Irradiation time
360 W
600 W
Pectin yield
1 min
11.30 %
17.62 %
2 min
18.61 %
20.01 %
3 min
17.57 %
16.50 %
According to Table 2, the highest pectin yield was found as 20.01 % at 600 W microwave power and 2 min
extraction conditions. The increased in microwave power was increased product yield and the maximum amount
of pectin was obtained in about 2 min by MAE.
Depends on the results of experiments, UAE and MAE techniques are efficient methods which give almost the
same yield values for pectin extraction from mandarin peels. The maximum yield of UAE was obtained at 30
min and 75 °C. It was found that the optimum value of the sonication time was around 30 min, while the
temperature increased the extraction efficiency. On the other hand, maximum product values for the MAE were
observed at 2 min and 600 W parameters and these results have shown that the raise in microwave power
increases the efficiency by shortening the extraction time.
3.2. Chemical structure analysis by FTIR
The FTIR spectra of pectin samples obtained from mandarin peels by two different extraction methods were
given in Figure 5 and Figure 6.
ORAL PRESENTATION
169
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
60 °C – 15 min
60 °C – 30 min
60 °C – 45 min
75 °C – 15 min
75 °C – γ0 min
75 °C – 45 min
Figure 15. FTIR analysis for pectin samples by UAE
360 W – 1 min
ORAL PRESENTATION
360 W – 2 min
170
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
360 W – 3 min
600 W – 1 min
600 W – 2 min
600 W – 3 min
Figure 16. FTIR analysis for pectin samples by MAE
For mandarin peel pectin, the peaks at around 3780 cm -1, which are the characteristics absorption peaks of
polysaccharides, are attribute to the stretching vibrations of hydroxyl (O-H) groups and these peaks are
indicative of a large number of OH- bonds in pectin molecule. The adsorption bands at about 2900 cm -1 related
to C-H (-CH, -CH2 and CH3) stretching of galacturonic acid. An absorption at ~ 1745 cm -1 is cause by C=O
stretching vibration of methylesterified carboxyl groups while the absorption at ~ 1600 cm -1 is cause by C=O
stretching vibration of free carboxyl group. The peaks about 1100 cm -1 are cause by C-O stretching vibration and
the presence of these bands supports the presence of methyl esters in pectin. The wavelengths and intensities of
the FTIR spectra have characteristics peaks to the pectin, confirming that the obtained polysaccharide is pectin.
FTIR analysis showed that different extraction methods had little influence on the chemical structure of pectin.
4. CONCLUSION
In this study, the effect of extraction type of pectin production from mandarin peels on product yield was
investigated. Two different methods were implemented and effects of various extraction parameters were
investigated. These parameters improved the qualitative and quantitative characteristics of extracted pectin. The
results obtained indicated that MAE was an efficient and time saving technique for pectin extraction from
mandarin peels. The highest yield (20.01 %) was obtained when the microwave power and irradiation time were
600 W and 2 min, respectively. Besides, the 1 min MAE period was enough to extract the same amount of pectin
as obtained from the 30 min UAE period. Consequently, MAE may be preferred in terms of time and energy
savings, although UAE is efficient. On the other hand, when FTIR analysis were examined, it was seen that
pectin with the same chemical structure was obtained by both extraction methods.
ORAL PRESENTATION
171
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
REFERENCES
Adetunji L.R, Adekunle A, Orsat V, Raghavan V 2017. Advances in the pectin production process using novel
extraction techniques. Food Hydrocolloids 62: 239-250.
Agarwal A.K, Goyal P, Desai P, Singh G.K 2015. Isolation of pectin from emblica officinalis & linum
unitatissimum using microwave assisted extraction technique and compare with conventional extraction
method. International Journal of Pharma Research & Review 4(2): 16-20.
Bagherian H, Ashtiani F.Z, Fouladitajar A, Mohtashamy M 2011. Comparisons between conventional,
microwave- and ultrasound-assisted methods for extraction of pectin from grapefruit 50: 1237-1243.
Bayar N, Bouallegue T, Achour M, Kriaa M, Bougatef A, Kammoun R 2017. Ultrasonic extraction of pectin
from Opunta ficus indica cladodes after mucilage removal: Optimization of experimental conditions and
evaluation of chemical and functional properties. Food Chemistry 235: 275-282.
Chemat F, Rombaut N, Sicaire A, Meullemiestre A, Fabiano-Tixier A, Abert-Vian M 2016. Ultrasound assisted
extraction of food and natural products. Mechanisms, techniques, combinations, protocols and
applications. Ultrasonics Sonochemistry 34: 540-560.
Chen C, You L, Abbasi A.M, Fu X, Liu R.H 2015. Optimization for ultrasound extraction of polysaccharides
from mulberry fruits with antioxidant and hyperglycemic activity in vitro. Carbohydrate Polymers 130:
122-132.
Criminna R, Carnaroglio D, Delisi R, Arvati S, Tamburino A, Pagliaro M 2016. Industrial feasibilty of natural
product extraction with microwave technology. ChemistrySelect 3: 549-555.
Espitia P.J, Du W, Avena-Bustillos R, Soares N, McHugh T 2014. Edible films from pectin: Physicalmechanical and antimicrobial properties. Food Hydrocolloids 35: 287-296.
Feritas de Oliveira C, Giordani D, Lutckemier R, Gurak P.D, Cladera-Olivera F, Marczak L.D.F 2016.
Extraction of pectin from passion fruit peel assisted by ultrasound. LWT-Food Science and Technology
71: 110-115.
Grassino N, Brncic M, Vikic-Topic D, Roca S, Dent M, Brncic S.R 2016. Ultrasound assisted extraction and
characterization of pectin from tomato waste. Food Chemistry 198: 93-100.
Güzel M, Akpınar Ö β017. Turunçgil kabuklarından elde edilen pektinlerin karakterizasyonu ve karşılaştırılması.
Akademik Gıda, 15(1)μ 17-28.
Hosseini S.S, Khodaiyan F, Yarmand M.S 2016. Optimization of microwave assisted extraction of pectin from
sour orange peel and its physicochemical properties. Carbohydrate Polymers 140: 59-65.
Kadam S.U, Tiwari B.K, Alvares C, O’Donnell C.P β015. Ultrasound fort he extraction, identification and
delivery of food proteins and bioactive peptides. Trends in Food Science & Technology 46: 60-67.
Lefsih K, Giacomazza D, Dahmoune F, Mangione M.R, Bulone D, Biagio P, Passantino R, Costa M.A, Guarrasi
V, Madani K 2017. Pectin from opuntia ficus indica: Optimization of microwave-assisted extraction and
preliminary characterization. Food Chemistry 221: 91-99.
Liew S.Q, Ngoh G.C, Yusoff R, Teoh W.H 2016. Sequential ultrasound-microwave assisted acid extraction
(UMAE) of pectin from polemo peels. International Journal of Biological Macromolecules 93: 426-435.
Maran J.P, Priya B, Al-Dhabi N.A, Ponmurugan K, Moothy I, Sivarajasekar N 2016. Ultrasound assisted citric
acid mediated pectin extraction from industrial waste of musa balbisiana. Ultrasonics Sonochemistry 35:
204-209.
Minjares-Fuentes R, Femenia A, Garau M.C, Meza-Velazquez J.A 2014. Ultrasound-assisted extraction of
pectins from grape pomace using citric-acid: A response surface methodology approach. Carbohydrate
Polymers, 106: 179-189.
Moorthy I.G, Maran J.P, Ilakya S, Anitha S.L, Sabarima P, Priya B 2016. Ultrasound assisted extraction of
pectin from waste artocarpus heterophyllus fruit peel. Ultrasonics Sonochemistry 34: 525-530.
Swamy G.J, Muthukumarappan K 2017. Optimization of continuous and intermittent microwave extraction of
pectin from banana peels. Food Chemistry 220: 108-114.
Valdes A, Burgos N, Jimenez A, Garrigos M.C 2015. Natural pectin polysaccharides as edible coatings. Coating
5: 865-886.
Wang W, Ma X, Xu Y, Cao Y, Jiang Z, Ding T, Ye X, Liu D 2015. Ultrasound-assisted heating extraction of
pectin from grapefruit peel: Optimization and comparison with the conventional method. Food Chemistry,
178: 106-114.
ORAL PRESENTATION
172
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Yang Y, Wang Z, Hu D, Xiao K, Wu J 2017. Efficient extraction of pectin from sisal waste by combined
enzymatic and ultrasonic process. Food Hydrocolloids 79: 189-196.
Zhang D, Wan Y, Xu J, Wu G, Li L, Yao X 2016. Ultrasound extraction of polysaccharides from mulberry
leaves and their effect on enhancing antioxidant activity. Carbohydrate Polymers 137: 473-479.
ORAL PRESENTATION
173
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Synthesis and Characterization of New Nanocomoposite Chitosan/Clay for Food Aplications
A. Laaraibi*, I. Charhouf, S. Hamdouch, A. Bennamara, A. Abourriche, M. Berrada
University Hassan II of Casablanca,Faculty of Sciences Ben M'sik, ,Department of Chemistry, Laboratory of
Biomolecules and Organic Synthesis (BIOSYNTHO), Casablanca, Morocco
Corresponding author e-mail:Asmae90laaraibi@gmail.com
Abstract
Biopolymer chitosan/bentonitenanocomposites have been prepared by dissolving chitosan powder in
aqueous acetic acid solution. Plastic deformation of the chitosan is carried out using a thermomechanical
treatment in the presence of a solvent and a plasticizer. The main objective of the present research is
development and characterization of chitosan films and chitosan/clay nanocomposite based on the intercalation
of chitosan into clay to form miscible, biodegradable nanocomposite polymers to be used as packaging films for
food preservation. Strong interaction between chitosan and bentonite was revealed by FTIR. The structural
properties, thermal behaviour and mechanical properties of nanocomposites of chitosan with various clays have
been characterized using X ray diffraction (XRD), thermogravimetric analysis (TGA) and a tensile
test.Thenanocomposite films obtained with and without glycerol show the best mechanical properties due to the
reinforcement of chitosan intercalation in the silicate. These nanocomposite films made from naturally occurring
materials might play an important role in advanced research in food and environmental science.
1. INTRODUCTION
The present research is directed towards the development of biodegradable ecofriendly materials with
enhanced properties [1]. The increase in living standards, changing habitsconsumer, industrial development led
to a high consumption of biodegradable plastic materials[2]. Chitosan is a natural mucopolysaccharide of marine
origin consists of a linear (1-4) linked 2- amino-2-deoxy-D glucan, obtained from chitin, is a relatively
inexpensive material because chitin is the second most abundant polymer in nature, next to cellulose. The
positive charge and molecular arrangement confer to chitosan interesting properties [3]. Clays are also abundant
and low-cost natural materials. Chitin and chitosan are biopolymers having immense structural possibilities for
chemical and mechanical modifications to generate novel properties, functions and applications[4-5], as
biomedicine[6-7], pharmaceuticals [8-9-10], metal chelation[11-12], food additives [13], and in the fabrication
of sensors or biosensors [14].
Figure 1: Chemical structure of Chitosan.
Bentonite (named after Ford Benton, Wyoming) is rich in montmorillonite(usually more than 80%)[1518]. Its color varies from white to yellow, to olive green, to brown. The names bentonite and montmorillonite are
often used interchangeably. However, the terms represent materials with different degrees of purity. Bentonite is
the ore that comprises montmorillonite, inessentials minerals and others impurities. Beyond quartz, kaolinite,
and many other minerals often present in small proportions (feldspar, calcite, dolomite, muscovite, chlorite,
hematite, etc), organic matter is present in bentonites as intrinsic impurities composed predominantly of humid
substances [19]. Since competitive reactions can take place between the organic matter present in the bentonite
and the chitosan, the extent of intercalation and polymer/clay interactions can be affected. Purification capable of
ORAL PRESENTATION
174
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
removing of organic matter from bentonites before intercalation is fundamental. Nano-biocomposites, obtained
by adding nanofillers to biopolymers like chitosan, result in very promising materials since they show improved
properties with preservation of the material biodegradability without eco-toxicity[20]. Although chitosan/clay
nanocomposites are very interesting materials but they were not extensively investigated as potential films
packaging for food application. Thus, the aim of this work is to analyze the role of plasticizer specially glycerol
in the solution casting process for the achievement of chitosan/clay nanocomposite films. The interest in use of
the glycerol is acting as plasticizer and reduces the intermolecular forces by increasing the mobility of the
biopolymer chains[21]. The glycerol reduces the extent interactions between Na-MNT stacks making it possible
to achieve a better dispersion of nanosized filler[22], and can modify the ability of water to swell MNT in the
aqueous solution, due to the ability to reduce the surface energy of aqueous solution .In order to investigate the
combined effect of glycerol and unmodified clay on the properties of chitosan based nanocomposites, films
containing different amount of clay and glycerol were prepared and characterized with particular regard to
structural, thermal , mechanical properties Finally, New nano-composite active film was proposed for safe
packaging of edibles.
2. MATERIAL AND METHODS
2.1. Materials
Chitosan (CS) with DDA ~ 87% in powder form was prepared in our laboratory. Its chemical structure is
schematically shown in Scheme 1. The degree of deacetylation (DDA %) was determined by conductimetric
titration. Analytical grade bentonitewas purchased from Sigma-Aldrich. All the other chemicals used are of
analytical grade and used as received.
2.2.Preparation of chitosan film
Chitosan solution was prepared by dissolving 1g of chitosan powder in 100 ml ofaqueous acetic acid
solution(1%, v/v), under continuous stirring at room temperature for 2h followed by vacuum filtering to remove
the insoluble residue. This solution was cast into petri dishes and dried at 50°C for β0 h to evaporate the solvent
and form the films. The dried films were soaked with an aqueous solution of 0.05 M NaOH to remove residual
acetic acid, followed by rinsing with distilled water to neutralize, and then dried at room temperature.
2.3. Preparation of chitosan/bentonite films
Chitosan/clay films were prepared using the casting/solvent evaporation technique. Firstly, 1% chitosan
solutions were prepared by dissolving 1g of chitosan powder in 100 ml of aqueous acetic acid solution(1%, v/v),
under continuous stirring at room temperature for 2h followed by vacuum filtering to remove the insoluble
residue. Nanocomposite samples were obtained by dispersing selected amounts of bentonite in water and stirred
at 50°C until solubilisation. After, the dispersion was slowly added to the CS solution to reach a final clay
concentration of 1, β, γ and 5 wt% followed by stirring at room temperature for 5h and then for γ0min at β5 °C
in ultrasonic bath.The amounts of chitosan, clay and plasticizer used for each sample are listed in Table1. The
nanocompositesolutionswere then poured into petri dishes and dried at 50°C for β0h to evaporate the solvent and
form the films. Free chitosan and nanocomposite films plasticized with glycerol were obtained by adding
glycerol (30% (wt/wt) on solid CS) to the CS solution while stirring for 20 min at room temperature. Following
the same procedure used for chitosan films, the dried films were soaked with an aqueous solution of 0.05 M
NaOH to remove residual acetic acid, followed by rinsing with distilled water to neutralize, and then dried at
room temperature.
ORAL PRESENTATION
175
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table1:Amounts (g and wt%) of chitosan, glycerol, Bentonite (BNT), used for the preparation of
chitosan, chitosan/glycerol, chitosan/BNT, and chitosan/glycerol/BNT.
Sample code
CS
Chitosan(g)wt%
1-100%
BNT(g)wt%
-
Glycerol(g)-wt%
-
CSBNT1%
1-99%
1%
-
CSBNT2%
1-98%
2%
-
CSBNT3%
1-97%
3%
-
CSBNT5%
1-95%
5%
-
CSG
1-70%
-
30%
CSGBNT1%
1-69%
1%
30%
CSGBNT2%
1-68%
2%
30%
CSGBNT3%
1-67%
3%
30%
CSGBNT5%
1-65%
5%
30%
Abbreviations codes used:CS: Chitosan, BNT: bentonite, CSBNT1%: Film chitosan/bentonite 1%, CSBNT2%: Film chitosan/bentonite
2%,CSBNT3%: Film chitosan/bentonite 3%,CSBNT5%: Film chitosan/bentonite5%,CSG: Film Chitosan/Glycerol, CSGBNT1%: Film
Chitosan/Glycerol/bentonite 1%, CSGBNT2%: Film Chitosan/Glycerol/bentonite 2%, CSGBNT3%: Film Chitosan/Glycerol/bentonite3%,
CSGBNT5%: Film Chitosan/Glycerol/bentonite5%.
2.4. Characterization and measurements
2.4.1. Infrared spectroscopy (FTIR)
Fourier transforms infrared (FTIR) spectra of the chitosan films and the chitosan/clay films werecollected
using a Tensor 37 FT-IR Spectrophotometer (Spectrum 400 Perkin Elmer) operating in the range of 400-4000
cm−1 at a resolutionof 4 cm-1.
2.4.2. Mechanical properties: tensile measurement
Mechanical properties of chitosan/clay nanocomposite were measured with a Universal Testing Machine
Ludwig mpK, tensile strength (TS) and percentage elongation at break (EL) of the films at β5°C according to
ASTM D882 standard procedures. The films were cut to a dog bone shape with a rectangular midsection (100
mm long x15 mm wide) flaring to 25 mm x 35 mm sections on each end. The thickness of each sample was
measured with micrometer at three different locations and averaged. The films were conditioned at 50% RH for
72 h before each test. A 100 N load cell was used and the extension rate was set at 5 mm/min.The tensile
strength (σ) and percentage of elongation at break (E) were calculated using the following equationsμ
σ = F max/A
E = ∆l/L0 X 100%
Where F maxis the maximum load (N), A is the initialcross-sectional area (m2), ∆l is the extension of film
strips (m) and L0 is the initial length (m).
ORAL PRESENTATION
176
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2.4.3. Thermal stability analysis
The thermal properties of nanocomposites and pure chitosan were investigated by thermogravimetric
analysis (TGA). Samples were placed in the balance system and heated from β5°C to 600°C at a heating rate of
10°C/min under a nitrogen atmosphere. Three replicates were tested for each sample.
2.4.4. XRD analysis
The X-ray diffraction analysis of the obtained films was performed by diffractometer with Cu Kα
radiation (ζ=1.5418 A°) at room temperature. XRD scans were performed on sodium bentonite, chitosan films
and chitosan/bentonite films with a βθ range between 5°-γ0°, at a scanning rate of 1°/min and scanning step of
0.01°.
3. RESULTS AND DISCUSSION
3.1. Infrared spectroscopy (FTIR)
FTIR spectra of chitosan (CS), bentonite (BNT), and chitosan-bentonitenanocomposite (CSBNT) films are
displayed in Fig. 2.The spectrum of chitosan shows a broad peak at 3475.80 cm −1 corresponding to amine N–H
symmetrical vibration and H bonded O–H group, the peaks at 2924.44cm−1was assigned to the symmetric and
asymmetric –CH2 vibrations of carbohydrate ring. The absorption peak at 1618.79 cm−1 (C=O in amide group,
amide I vibration), 1545cm−1 (–NH2 bending of amide II) and 1390 cm−1 (N–H stretching or C–N bond
stretching vibrations, amide III vibration). The peak at 1116.93 cm −1 corresponds to the symmetric stretching of
C–O–C groups. The absorption peaks in the range 900–1200 cm−1 are due to the antisymetric C–O stretching of
saccharide structure of chitosan.
As can be seen in Fig. 2, the FTIR spectrum of BN shows a peak at 1010 cm −1that belongs to Si-O-Si
linkage. In addition, the characteristic absorption peaks are found at˷3670cm−1 (stretching vibration of Al-OH
and OH), at 3465 cm−1(stretching vibration of O-H and H-O-H groups), at 1638 cm−1 (H-O-H bending
vibration), at 933cm−1(Al-Al-OH bending frequency), and at 509 cm−1 (bending vibration of Si-O).
The FTIR was also used to study the polymer/clay interaction, since a shift in the NH 3+vibration may be
expected when –NH3+groups interact electrostatically with the negatively charged sites of the clay[23].
Nevertheless, this shift is higher for CSBNTnanocompositefilm with the lowest amounts of CS, while the
chitosan/clay films with the highest amounts of biopolymer show a frequency value that trends to that observed
in the films of pure chitosan (CS). This fact may be related to the – NH3+groups that do not interact
electrostatically with the clay substrate. Besides, the spectrum of CBNTnanocomposite film [Fig. 2] shows a
characteristic band at 3462.78cm−1that due to hydrogen bonding formation the functional groups of CS spectrum
(O-H and N-H groups) and BN (O-H groups)[24-25]. The intensity of the NH3+ band also increases for higher
amounts of intercalated chitosan. The secondary amide band at 1645 cm -1 of chitosan is overlapped with the
HOH bending vibration band at 1628 cm-1of the water molecules associated to the chitosan/clay films, which are
present as in the starting clay, as expected for a biopolymer with high water retention capability[26-27].
ORAL PRESENTATION
177
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 2: FTIRspectrum of: Chitosan film (FCSBNT0%), Chitosan/BNT films respectively (FCSBNT3%) and
(FCSBNT5%).
3.2. Tensile measurements of Chitosan, Chitosan/Bentonite and Chitosan/Glycerol/Bentonite films
The stress–strain curves of the tested specimens are being presented in Fig. 3, while the average values
along with thestandard deviation of the Young’s modulus, tensile strength and elongation at break of the films on
thestress–strain behavior of the chitosan and chitosan/glycerol films, respectively [28]. The higher strength
obtained in the caseof the CS films can be attributed to more efficient stress transferbetween the adjacent chains
due to the strong electrostatic interactions between the NH 2 and NH3+ groups. The CSG specimen presents
almost double strength (at yield and break) and elongation at break. Due to the lower acidity of the diluted films
a weaker hydrogen bond network was established between the amino groups andthe glycerol chains. On the
other hand the extensive deformationstrengthening in undiluted systems (CSG) suggests the creation of a longrange order and the formation of hydrogen bondingafter the addition of glycerol. The effect of BNT addition on
the tensile response of thechitosan and chitosan/glycerol films is being depicted. The stress–strain curves of BNT
composite films prepared from the 1w/v% chitosan solution is being presented. The addition of BNT results in a
pronounced enhancement of thestiffness and a dramaticdecrease in the elongation at break of all clayaddedsystems. Further addition of BNT leads in intercalated structures which limited thepolymer–clay
interactions and thus their reinforcing ability. In the fig.3,effect of BNT addition is being illustrated for the
diluted systems (CS nanocomposites). The ductile response of the CS films is maintained after the addition of
BNT withstrength and a relative lower decrease in the elongation at break. The systems with 3 wt% BNT
presented the lowest enhancement in all mechanical properties. The fig.3 and 4presents the combined effect of
glycerol and BNT onthe tensile response of the CS based nanocomposites. The firstobservation is that the
addition of BNT results in a direct reduction of the strength of the chitosan/glycerol. A completely different
stress-strain behavior is being obtained after the addition of BNT in diluted chitosan/glycerol systems (Fig. 3).
The CS/glycerol based nanocomposites behave like hyper elastic materials rather than like ductile polymers. Its
assumed that more water and glycerol is distributed in the chitosan network, inducing a very obvious
plasticization effect.Theextend of hydrated chitosan crystals was confirmed from the intensities of the XRD
patterns. It is very interesting to note that although the mechanical properties of the unreinforced chitosan are
comparable before and after the application of the reflux processing, reflux resulted in a fourfold increase of the
stiffness and strength of the nanocomposite films.
Figure 3: Mechanical properties of chitosan/BNT particles films.
ORAL PRESENTATION
178
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 4: Stress-strain curves of: Chitosan film (FCSBNT0%), Chitosan/BNT films respectively
(FCSBNT3%), (FCSBNT5%) and Chitosan/Glycerol film (FCSGBNT0%), Chitosan/Glycerol/BNT films
respectively (FCSGBNT3%), (FCSGBNT5%).
3.3. Thermal stability analysis
The thermal stability of the chitosan (CS) and its nanocomposites has been investigated by TGA under
nitrogen (Fig.5). There are two steps of degradation. The first range (50-β00°C) is associated with the loss of
water, whereas the second range at β70°C corresponds to the deacetylation and degradation of chitosan and the
third step, in the temperature range 450-550°C, can be associated with the oxidative degradation of the
carbonaceous residue formed during the second step.
The nano-dispersed clay in the chitosan matrix exhibits a significant delay in weight loss. The
nanocompositeforms char with a multilayered carbonaceous-silicate structure, which may keep its multilayered
structure in the polymer matrix. This high-performance carbonaceous-silicate char builds up on the surface
during burning, thus insulating the underlying material and slowing the escape of the volatile products generated
during decomposition. The decomposition temperature CS/BNT nanocomposites show higher thermal stability
compared to those of the pure CS.
For nanocomposites containing glycerol, a further degradation step at Tβ50°C is observed, related to the
loss of unbound glycerol, as indicated in Fig.6. Furthermore, it can also be observed that the presence of glycerol
plasticizer increases of about β0°C the degradation temperature for the third step, irrespective of the presence or
not of the nanoclay.
Figure 5: Thermal properties of: Chitosan (FCSBNT0%) and Chitosan/Bentonite films
(FCSBNT3%), (FCSBNT5%).
3.4. XRD analysis
The XRD patterns of chitosan and chitosan based nanocomposite films in the range of 5- γ0° (Fig 6). The
basal plane of BNTshows a reflection peak at about 2θ= 8.8°.After incorporating BNT within CS, with CS/BNT,
the basal plane of BNT at 2θ= 8.8° disappears, substituted by a new weakened broad peak at around 2θ= 1β.8° 1γ.0° (CSBNTγ%, CSBNT5%). It is suggested that the BNT form intercalated and flocculated structures.
ORAL PRESENTATION
179
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 6: Thermal properties of: Chitosan (FCS), Chitosan/Glycerol (FCSGBNT0%) and
Chitosan/Glycerol/Bentonite films (FCSGBNT3%), (FCSGBNT5%).
On the base of XRD patterns, it is suggested that the BNT forms intercalated and exfoliated structures at
higher CS content (CSBNT5%), while decreasing the CS content (CSBNT3%), clay layers (BNT) form
intercalated and flocculated structures. According to[23], the formation of flocculated structure in CS/clay
nanocomposites can be due to the hydroxylated edge-edge interactions of the clay layers. Since one chitosan unit
possesses one amino and two hydroxyl functional groups, these groups can form hydrogen bonds with the clay
hydroxyl edge groups. This strong interaction is believed to be the main driving force for theassembly of BNT in
the CS matrix to form flocculated structures.
Figure 7: XRD patterns of: Chitosan (CS), Bentonite (BNT) and Chitosan/Bentonite films
(FCSBNT3%) and (FCSBNT5%).
The XRD patterns of chitosan/glycerol films obtained from 30 w/v% solutions are shown. The addition of
glycerol results in a pronounced peak at 12.5°. Because of thehydrophilic and polycationic nature of chitosan in
acidic media, thisbiopolymer has good miscibility which is attributed to the interaction of glycerol molecules
with chitosan macromolecules. Glycerol favors the chains mobility andthus the chitosan crystallization process
in the early stage of thepost-processing aging the effect of glycerol addition. The XRD patterns of
chitosan/glycerol/BNT films obtained from chitosan solution are shown.The combined addition of glycerol and
clays resulted in greatenhancement of the chitosan crystallinity of the nanocomposite films prepared with 1
w/v% chitosan solution. This indicates thatthe presence of clay facilitates the distribution of glycerol withinthe
chitosan matrix and the interaction of glycerol molecules with chitosan macromolecules. The combined addition
of glycerol and clay had an opposite effect in films obtainedfrom low content chitosan solution leading to
decrease ofthe XRDpeaks intensities. In addition a new peak at 18.β° appeared in XRDpatterns of all obtained
films. This diffraction peak is characteristic forchitosan films prepared using acetic acid solution as solvent.The
additionof glycerol favors the opening of the clay galleries resulting inintercalatednanocomposites in comparison
tosamples without glycerol.
ORAL PRESENTATION
180
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 8: XRD patterns of: Chitosan (CS), Bentonite (BNT), Chitosan/Glycerol (FCSG) and
Chitosan/Glycerol/Bentonite films (FCSGBNT3%) and (FCSGBNT5%).
4.CONCLUSION
Natural biopolymer-based biodegradable packaging materials are a new generation of polymers emerging
on the packaging market. Biodegradable packaging materials have an expanding range of potential applications
and, driven by the growing use of plastics in packaging and the perception that biodegradable plastics are
‘environmentally- friendly’, their use is predicted to increase chitosan, a biobased material, has interesting
antimicrobial andfilm-forming activities. Its application in coatings, films and blendscan contribute to food
preservation and shelf-life extension.
In this study Chitosan/Bentonite films and Chitosan/Glycerol/Bentonite films were successfully prepared
by the solution casting technique and characterized with particular regard to structural, thermal and mechanical
properties. Since the nanocomposites prepared with purified bentonite (BNT) are less expensive and the
bentonite may be employed in the preparation of chitosan/clay nanocomposites.
The intercalation of the cationic biopolymer chitosan into layered silicate clay (bentonite) through a cation
exchange process results in nanocomposites with interesting structural and functional properties.
Chitosan/Na-MNT nanocomposites exhibit an intercalated or intercalated/orientated structure of clays. In
particular, the X-ray diffraction results show that in film without glycerol the MNT stacks lay with their platelet
surface parallel to the casting surface. The presence of glycerol, on the other hand, enhances the chitosan
intercalation in the silicate galleries and hinders the flocculation process, leaving the MNT stacks randomly
orientated in the space. The thermal stability of the nanocomposites increases systematically with increasing
clay.
The results on mechanical properties showed the increase in the TS and EM of such nanocomposite films
can be attributed to the high rigidity and aspect ratio of the nanoclay as well as the high affinity between the
biopolymer and the clay. On the other hand, the chitosan/clay nanocomposites have shown significant decrease
in elongation at break (EB). This reduction can be attributed to the restricted mobility of macromolecular chains.
The nanocomposite film prepared combines two inexpensive resources available and biocompatible
.
ORAL PRESENTATION
181
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
REFERENCES
1. W. Tan, Y. Zhang,Y. Szeto, L. Liao,Compos. Sci. Technol.68(2008) 2917–2921.
2. G. Martinho, N. Balaia, A. Pires, Waste.Manag. 61(2017) 3–12.
3. S. Bhuvaneshwari, D. Sruthi, V. Sivasubramanian, K. Niranjana, & J.Sugunabai,Int. J. Eng. Res. Appl.
1(2011) 292–299.
4. B. Christensen, I. Vold, K. M. Vårum,Carbohydr. Polym. 74(2008) 559–565.
5. V.K Mourya, N. N Inamdar, React. Funct. Polym.68 (2008) 1013–1051.
6. H. Luo, J. Li, X. Chen, Biomed. Pharmacother. 64 (2010) 521–526.
7. R. Drumright,D.J. Siegwart, K. Matyjaszewski, Prog. Polym. Sci. 33 (2008) 448–477.
8. P.Baldrick, Regul. Toxicol. 56(2010) 290–299.
9. R.A Muzzarelli, Carbohydr. Polym.77 (2009) 1–9.
10. V. Sinha, A. Singla, S. Wadhawan, R. Kaushik, R. Kumria, K. Bansal, S.Dhawan,Int. J. Pharm. 274
(2004) 1–33.
11. Y. Feng, L. Yang, F. Li, Anal. Methods. 2(2010).
12. K. Kofuji, C. Qian, M. Nishimura, I. Sugiyama, Y. Murata, S. Kawashima, Eur. Polym. J. 41(2005) 2784–
2791.
13. V. Ferraro, I. Cruz,R. F. Jorge, F. X. Malcata,M. E. Pintado, P. M. L. Castro,Food. Res. Int. 43(2010) 2221–
2233.
14. P. Jerónimo, A. N. Araújo, M. Montenegro, Sens. Actuators. B. Chem.103(2004) 169–177.
15. L. Holzer, B. Münch, M. Rizzi, R. Wep,P. Marschall, T. Graule, Appl. Clay. Sci.47(2010) 330–342.
16. Q. Li,Q. Y. Yue, H. Sun, Y. Su, Y. Gao, J. Environ.Manag. 91(2010) 1601–1611.
17. L. Utracki, Clay-containing polymeric nanocomposites. Shrewsbury: Rapra Technology Ltd.
18. J. Wei, R. Zhu, J. Zhu, J. Hazard. Mater. 166(2013) 195–199.
19. B. Bolto, D. Dixon, R. Eldridge, S. King,Water. Res.35(2002) 2669–2676.
20. S.K. Pillai, S. Ray,Natural Polymers: Nanocomposites.2(2012) (pp. 33–68).
21. P. Srinivasa,M.N. Ramesh, R.N. Tharanathan, J. Food. Hydrocoll. 21(2007) 1113–1122.
22. M. Darder, M. Colilla, E. Ruiz-Hitzky, J.Mater.Chem. 15(2003) 3774–3780.
23. L.Wang, A.Wang,J. Hazard. Mater. 147(2007) 979–985.
24. C. Paluszkiewicz,E. Stodolak,M. Hasik, M. Blazewicz.Spectrochim.Acta A. Mol. Biomol. Spectrosc.
79(2004) 784–788.
25. W. Tan, Y. Zhang,Y. Szeto, L. Liao, Compos. Sci. Technol. 68(2008) 2917–2921.
26. M. Darder, M. Colilla, E. Ruiz-Hitzky, Appl. Clay. Sci. 28(2005) 199–208.
27. Y. Han, S. H. Lee,K. H.Choi,I. Park, J. Phys. Chem. Solids. 71(2010) 464–467.
28. A. Laaraibi, I. Charhouf, A. Bennamara, A. Abourriche, M. Berrada, J. Mater. Environ. Sci. 6 (12) (2015)
3511-3516.
ORAL PRESENTATION
182
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Eş Çökelme Yöntemiyle Al3+ Katkılı β-BaB2O4 Sentezi
A. Abdullah Ceyhan1*, Binnaz Aydın2
*1
2
Selçuk Üniversitesi, Mühendislik Fak., Kimya Müh. B., Konya, Türkiye
Selçuk Üniversitesi, Mühendislik Fak., Kimya Müh. B., Konya, Türkiye
Sorumlu yazar e-mail: binnazzakdeniz@gmail.com
Özet
Bu çalışmada, yarı iletken özelliğe sahip ί-BaB2O4’ın yarı iletkenlik özelliğinin artırılması için Al3+
katkısı kullanılmıştır. Bu amaçla, eş-çökelme yöntemi ve ısıl işlem uygulanarak Al3+ katkılı ί-BaB2O4
sentezi gerçekleştirilmiştir. Elde edilen kristallerin sahip olduğu fonksiyonel gruplar FT-IR analizi,
Kristal yapısı XRD analizi, yüzey morfolojisi SEM analizi ve katkı maddesinin yapı içerisindeki varlığı
ESR analizi ile belirlenmiştir.
Anahtar Kelimeler: ί-BaB2O4, alüminyum, eş çökelme yöntemi, yarı iletken.
1. GİRİŞ
Baryum metaborat beyaz renkli ve kokusuz bir katı olup, mono hidratının öz kütlesi γ.β5-3.35 g/cm3, ergime
sıcaklığı λ00-1050°C ve β1°C’de sudaki çözünürlüğü % 0.γ’dür (Dibello ve ark., β007ν Trтger, 2012).
ί ve α olmak üzere sırasıyla düşük ve yüksek sıcaklıkta farklı kristal modifikasyonuna sahiptir ve α-BaB2O4 ve
ί-BaB2O4 polimorfları arasındaki faz dönüşüm sıcaklığı λβ5°C’dir. Baryum metaboratın, düşük ve yüksek
sıcaklık modifikasyonlarına ek olarak γ-BaB2O4 olarak tanımlanan kararsız bir düşük sıcaklık modifikasyonu da
bulunmaktadır (Akşener, β01γν Wu ve ark., β00β).
Uç ürünler olarak tanımlanan bor bileşikleri arasında yer alan baryum metaboratν lazerlerde, boyalarda biyolojik
sistemlerde plastik, tekstil ve ahşap malzemelerde yaygın biçimde kullanılmaktadır (Akşener, β01γν Wu ve ark.,
2002).
Yüksek hasar eşiği, düşük lineer absorpsiyon ve geniş transparan bant genişliği sebebiyle ί-BaB2O4 üzerine
yapılan çalışmalar bu özelliklerinin artırılması üzerine yoğunlaşmıştır. Literatürde ί-BaB2O4’ın fotolüminesans
özelliklerinin ve yarı iletkenliğinin artırılması için yapılmış çalışmalar bulunmaktadır. Bu amaçla Cu2+, Fe3+,
Cr3+, Pb2+, Co2+, Ni2+, Eu2+ ve Dy3+ katkıları kullanılmıştır (Reddy ve ark., 2012; Zhou ve ark., 2005).
Bu çalışmada, ί-BaB2O4’ ın yukarıda bahsedilen sahip olduğu özelliklerinin artırılması amacıyla, yüksek
iletkenlik özelliğine sahip olduğu bilinen alüminyum katkısı kullanılarak Al 3+ katkılı ί-BaB2O4 üretimi
gerçekleştirilmiştir. Elde edilen ürün ί-BaB2O4, FT-IR, SEM-EDX, XRD ve ESR analizleri yardımıyla
karakterize edilmiştir.
2. MATERYAL VE METOD
Deneysel çalışmada kullanılan reaktiflerν Ba(NO3)2.6H2O, Na2B4O710.H2O ve Al(NO3)3.9H2O analitik saflıkta
olup, Merck firmasından satın alınmıştır. De-iyonize su ise, S.Ü. İLTEK Araştırma Laboratuvarlarından temin
edilmiştir.
Çalışmanın başlangıcında, 0.0β mol Ba(NO3)2. 6H2O çözeltisi ile 0.01 mol Na2B4O7.10H2O çözeltisi ve 0.001
mol Al(NO3)3.9H2O katkı çözeltisi hazırlanmıştır. Baryum nitrat çözeltisi üzerine alüminyum katkı çözeltisi
eklenmiş ve manyetik karıştırıcıda (IKA RCT Classic) λ00 rpm karıştırma hızında, β0 dakika süre ile 50oC’de
karıştırma işlemi yapılmıştır. Ele geçen karışım, Na2B4O7 çözeltisi ile karıştırılmış ve γ0 dakika süre ile 50 oC’de
manyetik karıştırıcıda karıştırma işlemi gerçekleştirilmiştir. İzlenen prosedür literatür ile (Reddy ve ark., 2012;
Zhou ve ark., 2005) benzer olup, reaksiyon (1) denkleminde verildiği şekildedir.
ORAL PRESENTATION
183
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
�
. 6�
+ �
7.
�
+ �� � →
�
��
; �� � +
�
+
− � �
(1)
Karıştırma işleminin ardından, vakumlu filtrasyon işlemi (Sartorius Stedim ve KNF N-840.γ FT 18) ile katı-sıvı
faz ayrılmıştır. Katı faz, sıcak de-iyoize su ile yıkanmış ve sonrasında 85 oC’deki etüvde (Termal EPC 74β0) β4
saat süre ile kurutulmuştur. Elde edilen katıya, 10 oC/dk ısıtma hızı ile 800oC’deki boru tipi fırında (Magmatherm
MTTF) hava ortamında bir saat süre ile kalsinasyon işlemi uygulanmıştır.
Sentezlenen Al3+ katkılı ί-BaB2O4 kristallerinin karakterizasyon işlemiν FTIR analizi (Bruker Vertex 70), XRD
analizi (Bruker D8 Advance), SEM-EDX analizi (ZEISS Evo/LS 10) ve ESR analizi (Jeol Jes-FA300) ile
gerçekleştirilmiştir.
3. BULGULAR VE TARIŞMALAR
Sentezlenen Al3+ katkılı ί-BaB2O4 kristallerinin karakterizasyonu işlemine FT-IR analizleri yapılarak
başlanmıştır (Şekil 1). Şekil1’de, Al3+ katkısı varlığında ortaya çıkan, 1γβ5-1392 cm-1 dalga sayısı aralığındaki
pikler metaborat, ortoborat ve piroborat yapısında yer alan BO 3 grubuna ait gerilim titreşimine, 1β7γ-1280 cm-1
dalga sayısı aralığındaki pikler [B3O6]3- içerisindeki [BO3]3- yapısındaki B-O gerilim titreşimine, 1006 cm-1 dalga
sayısındaki pik tri, tetra ve pentaborat yapılarındaki BO 4 yapısına, 847-960 cm-1 dalga sayısı aralığındaki pikler
1006 cm-1 dalga sayısındaki tri, tetra ve pentaborat yapılarındaki BO 4 içerisindeki B-O’nun gerilim titreşimine,
650-784 cm-1 dalga sayısı aralığındaki pikler ise B-O-B bükülme titreşimine işaret etmektedir. Bu sonuçlar,
herhangi bir katkının yapılmadığı durumdaki ί-BaB2O4 kristallerine ait sonuçlar ile uyum içerisindedir.
Şekil 1. Al3+ katkılı ί-BaB2O4 kristallerinin FTIR analizi
İkinci aşamada, ele geçen kristallerin XRD analizleri yapılarak yapı içerisinde Al varlığı incelenmiştir. Elde
edilen sonuç, Şekil β’ de verildiği gibidir. Şekil β’den görüldüğü gibi üretim sonucu ele geçen katı baryum
alüminyum borat (BaAl2B4O10) yapısı ile uyum içerisindedir. Ayrıca reaksiyon sonrasında ortamda ί-BaB2O4
kaldığına da işaret etmektedir.
ORAL PRESENTATION
184
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 3. Al3+ katkılı ί-BaB2O4 kristallerinin XRD analizi
Çalışmanın üçüncü aşamasında, ί-BaB2O4 içerisine katılan Al3+ katkısının yapı içerisinde yer aldığının
gösterilmesi amacıyla, ESR analizi gerçekleştirilmiştir (Şekil γ). Şekil γ’ den görüldüğü gibi, 0-500 mT tarama
aralığında oda sıcaklığında elde edilen ESR spektrumu, spektroskopik yarılma çarpanı g değeri 1,λ68781
bölgesinde belirgin şiddetli bir sinyalden oluşmaktadır. Katkısız ortamda mevcut olmayan spektroskopik yarılma
çarpanı g = 1,λ68781 olan belirgin şiddetli sinyalin ί-BaB2O4 içerisindeki Al3+ katyonundan kaynaklandığı
düşünülmektedir.
Şekil 3. Al3+ katkılı ί-BaB2O4 kristallerine ait ESR analizi
Çalışmanın son aşamasında, elde edilen Al3+ katkılı ί-BaB2O4 kristallerinin SEM-EDX analizi
gerçekleştirilmiştir. Şekil 4’ den görüldüğü gibi, % β,6 oranında alüminyum varlığı söz konusudur. Al3+ katkısı
ORAL PRESENTATION
185
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
varlığında üretilen kristallerin SEM görüntülerinden kesilmiş kristaller şeklinde bulunduğu, yüzeylerde
gözeneklerin yer aldığı, aglomere olmadığı 1µm’nin altında partikül boyutunun oranının arttığı da
görülmektedir.
Element
wt.%
Oksijen
61.92
Baryum
31.22
Alüminyum β.60
Bor
16.96
Toplam:
100.00
Şekil 4. Al3+ katkılı ί-BaB2O4 kristallerine ait SEM- EDX analizi
4. SONUÇLAR
Bu çalışma kapsamında, eş çökelme yöntemi ile Al3+ katkılı ί-BaB2O4 kristal üretimi gerçekleştirilmiştir. FTIR
analizi ile katkı maddesi varlığında üretilen ί-BaB2O4’ın, katkısız ortamda üretilen ί-BaB2O4’a ait fonksiyonel
gruplarla benzerlik gösterdiği tespit edilmiştir. Al3+ katkılı ί-BaB2O4’ın partikül boyutunun 1µm’in altına
düştüğü belirlenmiştir. Ayrıca SEM-EDX analizi ile Al3+ iyonlarının nitel analizleri yapılmış olup söz konusu
katkının %β,60 oranında varlığı göstermiştir. XRD analizi katkının yapıya katıldığına işaret etmiştir. ίBaB2O4μAl yapılarına sahip kristallerin teyit edilmesi amacıyla ESR analizi gerçekleştirilmiştir. ESR analizi ile
Al3+ iyonlarının ί-BaB2O4 yapısına katıldığı tespit edilmiştir ve spektroskopik yarılma çarpanı g değeri
1,λ68781 olarak hesaplanmıştır.
TEŞEKKÜR
Bu çalışma Selçuk Üniversitesi Bilimsel Araştırma Projeleri Koordinatörlüğü tarafından desteklenmiştir. Proje
No : 15201029.
KAYNAKLAR
Akşener, A. E., (β01γ) “Farklı yöntemlerle baryum metaborat üretimi ve üretim sürecine etki eden
faktörlerin incelenmesi”, Doktora Tezi, Yıldız Teknik Üniversitesi, Fen Bilimleri Enstitüsü, İstanbul.
Dibello, P., Manganaro J. and Aguinaldo, E., (2007) Barium compounds. In: Kirk–Othmer encyclopedia of
chemical technology, vol.3, John Wiley & Sons, Inc., New Yok, A.B.D., 2007.
Fedorov P., Kokh A., Kononova N. and Bekker T., (β008) “Investigation of phase equilibria and growth of BBO
(ί-BaB2O4) crystals in BaO–B2O3–Na2O ternary system”, J Cryst Growth, vol.310 (7), pp.1943-1949.
Koçak, F. Z., (β01γ) “Baryum metaborat tetrahidrat'ın üretimi ve üretimi artlarının belirlenmesi”, Yüksek Lisans
Tezi, Selçuk Üniversitesi Fen Bilimleri Enstitüsü, Konya.
Reddy C. V., Krishna C. R., Thampy U. U., Reddy Y., Rao P. and Ravikumar R., (β011) “Spectral investigations
of Cu2+ doped beta-barium borate nanopowder by the co-precipitation method”, Phys. Scr., vol. 84 (2),
pp.025602.
Reddy C. V., Krishna C. R., Rao T. R., Sathish D., Rao P. and Ravikumar R., (β01β) “Synthesis and optical
properties of Co2+ and Ni2+ ions doped ί-BaB2O4 nanopowders”, J Lumin, vol.132 (9), pp.2325-2329.
Reddy C. V., Krishna C. R., Rao T. R., Thampy U. U., Reddy Y., Rao P. and Ravikumar R., (β01β) “Synthesis
and spectral characterizations of Fe3+ doped ί-BaB2O4 nano crystallite powder”, J. Mol. Struct., vol.1012,
pp.17-21.
ORAL PRESENTATION
186
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Reddy C. V., Kumar K. V., Vattikuti S. P. and Ravikumar R., (β01γ) “Structural and spectral features of Cr 3+
doped ί-BaB2O4 nanopowder by co-precipitation method”, Physica Bμ Condensed Matter, vol.429, pp.1823.
Trтger F., (2012) Springer handbook of lasers and optics, Springer Science & Business Media, New Yok,
A.B.D.
Zhou Y. F., Hong M. C., Xu Y. Q., Chen B. Q., Chen C. Z. and Wang Y. S., (β005) “Preparation and
characterization of ί-BaB2O4 nanoparticles via coprecipitation”, J Cryst Growth, vol.276, pp.478–484.
Zou W. G., Lü M., Gu F., Xiu Z., Wang S. and Zhou G., (β006) “Luminescence properties of Eu 3+ and Dy3+
doped ί-BaB2O4 nanocrystals”, Opt. Mater., vol.28 (8), pp.988-991.
Zou W. G., Lu M. K., Gub F., Wang S., Xiu Z. and Zhou G., (β006) “Photoluminescence characteristics of BaB2O4 nanoparticles co-doped with Cu2+ and Pb2+” Mater. Sci. Eng., B., vol.127, pp.134–137.
Wu S., Wang G., Xie J., Wu X., Zhang Y. and Lin X., (β00β) “Growth of large birefringent α-BBO crystal”, J
Cryst Growth, vol.245 (1), pp.84-86.
ORAL PRESENTATION
187
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Analytical Approach to the Waste Management of Nanomaterials in Developıng Countries
Mehtap Kara1*, Özlem Nazan Erdoğan2
1
İstanbul University, School of Pharmacy, Department of Pharmaceutical Toxicology, İstanbul,
Turkey
1
İstanbul University, School of Pharmacy, Department of Pharmacy Management, İstanbul,
Turkey
e-mail:matost@gmail.com
Abstract
Nanotechnology has been worldwide rapidly growing and developing scientific and industrial field since
1990s. Nanomaterials (NMs) and nanoparticles (NPs) refer the materials having thousand millionth of a meter
(10-9 meter) size. NMs production and consumption increase every passing day. Different variety of
consumption products as sunscreen, cosmetics, antibacterial textile, batteries, automotive industry, glass coating,
medical and pharmaceutical include NMs. Some consumer products including NMs such as cosmetics, drugs etc.
directly expose humans and the environment. Although nanotechnology field exhibit large scale economic and
research potential, there are limited information about biological and environmental risk of nanoproducts during
their “end of life” release to environment. It is very difficult to detect and prevent NMs release to the
environment at their end of life. NMs have strong interaction with biological structures, due to their size, shape
and chemical features. Many different types of NMs released to environment have bioaccumulation feature
which is very important for biological structures, human health and pollution. NMs are called as
“nanocontaminats” when they release to environment and offer hazardous effects. Also they can be classified as
“nanowaste” when show accumulation features and hazardous effects. Toxicological risks of nanocontaminats
and nanowastes are not fully understood. NMs behaviour in the environment is fully different from regular
materials and they may show more reactive and toxic effects compared to other bulk waste materials in the
environment. Unfortunately there are no sufficient scientific data about toxicological profile of nanocontaminats
and nanowastes after they released to environment. In developed countries legislative regulations were
constituted and been improved parallel to the development of the product range, however in developing
countries there is wide gap about determination of nanowastes and legislative regulations are still insufficient.
The goal of this article is to initiate discussion on handling of NMs containing wastes and nanowaste
management in developing countries.
INTRODUCTION
The Latin word “nano” that means dwarf, that refers one thousand millionth of a meter (10 -9 m).
Nanotechnology is that rapidly progressing and multidisciplinary scientific filed and has wide scope of
application area. (Bhatia S. 2016; Nanoodpadów N. 2016). Nanotechnlogic researches are highly attract
attentions of scientists and paper on nanotechnology is being published rapidly (Lewinski N. 2008).
Nanoparticles, nanoplates and nanofibers are the International Organization for Standardization (ISO)
classification of nanomaterials (Nanoodpadów N. 2016). Nanoparticles have three main classifications that
based on dimensions are; one dimension (1-100 nm thin film sized) ,two dimension (carbon nanotubes) and three
dimension (Dendrimers, Quantum Dots, Fullerenes). Nanoparticles can be characterized by advanced electron
microscopy techniques as atomic force microscopy (AFM), scanning electron microscopy (SEM) and
transmission electron microscopy (TEM). (OECD Testing Programm, 2008; Bhatia S. 2016;).
Materials that 1-100 nanometers (nm) or incluse nanoscale particles are termed as nanomaterials (figure
1). (Lewinski, N. 2008). It has been reported that nanomaterials production annual production amount will
increse 58,000 tons by 2020 (Maynard 2006). It has been reported that, global nanomaterial production is
regularly increase 25% per year and (Nanoodpadów N. 2016) Due to different research reports, global
nanomaterial market growing rate will be reach to 55.0 billion USD by 2022. Prominent regulatory coordinators
about nanomaterials are The United States Environmental Protection Agency (EPA), The European Chemicals
Agency (ECHA), Registration, Evaluation, Authorisation and Restriction of Chemicals (REACH) in the US and
the EU and also the Ministry of Industry and Information Technology (MIIT) in China. (Allied Market Research
ORAL PRESENTATION
188
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
September 2016; Allied Market Research, October 2016; Mordor Intelligence, 2017; Inshakova, E., and
Inshakov, O., 2017).
Concerning about NMs effects on human health and environment cause restrictions in global marketing.
Most of NMs are toxic or include toxic solvents, release hazardous intermediate compounds during production
phases. Thus governmets should organize critical legislative regularions and managements. (Inshakova E., and
Inshakov, O., 2017.)
Figure 1. Summarized definition of nanomaterials (IS0, 2008) (adapted from Faunce, T., & Kolodziejczyk, B.
(2017).
NANOCONTAMINATS AND NANOWASTE
Particles that sized at nanoscales regularly occurs in the environment. Also increasing number of
nanomaterials releasing to environment from market products that include cosmetics, textiles, lubricants,
batteries and solar cells products, drug delivery materials, medical imaging agents and medical implants etc.
regularly . Nanomaterials conducts different types of transformations dependent to their molecular spesifications
which sometimes resulted with hazardous residuals in the environment called as “nanocontaminats”. There are
contradictory evidences in the literature about effect of nanomaterials on human and environmental health in the
literature, however important issues for risk characterization of nanomaterials are size, shape, solubulity,
chemical parameters, biocompatibility features of the particles to qualify (spesify) them as “nanowaste”.
(Nanoodpadów N. 2016; Part F. Et al., 2015)
During regular production and usage phases of nanomaterial and nanpoarticles, their wastes disposed like
large scale sized products commonly (Nanoodpadów N. 2016). And also nanoproducts that reach its end of life
mix waste circulation too. (Caballero-Guzman et al., 2015; Gottschalk et al., 2013; Keller and Lazareva, 2013;
Mueller and Nowack, 2008). This case make monitoring and quantification of nanowastes in complex
environmental matrixes a current issue for ecosystem to do hazard identification. There are several different
analytical methods for the characterisation of nanomaterials in the environment as waste. These methods based
on nanomaterials particle number, elemental composition, particle size, particle distribution, aggregation state,
shape, structure, surface area, surface charge and surface spesifications. (Part F. Et al., 2015) Nanowastes
bahviour are not same as normal wastes in the environment and it is hard to detect these materials with
nowadays technology. Legal regulations and managements have critical role on identify and control of
nanowastes (Bystrzejewska-Piotrowska G, et al., 2009)
TOXICOLOGICAL RISKS OF NANOWASTES
There were limited data about distribution of nanomaterials into the environment and biological systems
due to their uncontrollably entrance to environment (Moore 2006). (Musee N. 2011). Environmental detection
and monitoring of nanowastes are important issues. Detection, quantification and analysis of nanowastes
aremore difficult compared large sized bulk wastes, because of their low concentrations, large chemical variety,
other nanomaterials interferance which ocuurs naturally in the environment as Al2O3, CuO, SiO2, TiO2, or ZnO
and insufficient analytical methods. Although there are different improved imaging techniques as Transmission
ORAL PRESENTATION
189
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
electron microscopy (TEM), scanning electron microscopy (SEM) and ICP-MS, it is still impossible
determinaton and quantşfşcation af nanoparticles ib complex solid phases (Part F. Et al., 2015).
Nanomaterials effects on environment and biological systems are not fully understood and unclear
because of their wide range physical, chemical and biological features (Colvin, 2003; Hoet et al., 2004). And
these features of nanomaterials could be enhance their spread in environment and may increase toxic effects on
the biological systems. Also nanomaterials may play role as a particle carrier in water and air due to their
physical and chemical characteristics (Kleiner and Hogan, 2003). While with nonotechnology it is possible to
work at nano scales, this new era intoduce a new waste definition as “nanowaste”. Nanowastes can be spread out
during production, storage and distribution and usage phases (Table 1). Nanowaste contamination routes were
shown in figure 2 According to British Standarts Guide (BSI) in the environment there are four form of
nanowastes as pure, material and surfaces include nanowaste, liquid phases include nanowastes and solid
matrixes include nanowastes. There were several studies about nanowastes health and toxicological effects in the
literature (Colvin, 2003; Moore, 2006; Nel et al., 2006; Holbrook et al., 2008), however limited studies on
nanowaste controlling and management. Nanomaterials uncontrolled releasing into the environment may
generate short and long term high risks of nanowaste contamination of soil, agriculturel products, underground
waters and air. (Musee N. 2011)
Figure 2. Nanowaste contamination routes. (Adopted from Marcoux MA. et al., 2013 )
Evaluating nanowaste is not same with larger particles in case of different physical and chemical
properties of nanomaterials and nanoparticles. Althoug toxicological properties of larger molecules well defined,
conditions are different in nanoscales and it is needed re-evaluating toxicological properties of these
nanomaterials. For instance, if molecule size get smaller, its surface area and also its biological activity increse.
(Lewinski, N. 2008). There are some examples at the below how nanoparticle contamination of goundwaer, soil,
air and water occurs. Nanoparticle directly releasing from technical compartments for instance using for water
treatment or groundwater remediation, effects groundwaters and air. Diffuse sources like fuels including CeO2
or Paints incuding TiO2 effects soil, water and air. (central.oak.go.kr )
There are unsufficient toxicological data from scientific studies about nanomaterials effects on
mammalian and aquatic model systems in the literature that make complicate risk assemment and hazard
identification of these materials. These limitations also negatively effect to arrengment of nanowaste
management. While physical and chemical features are an advantage for usage of nanomaterials, same features
are disadvantage for evaluate their toxicological profiles in biological systems and environment. In different
areas as air, soil, water, nanaowastes shows different toxcological characteristics (Musee N 2011). Due to their
different physical and chemical properties, nanoscales of bulk materials have higher toxicity and chemical
reactivity. For instance, as a nanoparticle character asbestos was highly used without sufficient toxicty and
hazardous data in the past caused several serious health impacts. Today asbestos is a banned product in many
countiries ( Faunce, T., & Kolodziejczyk, B. 2017).
There are limited and contradictory data in the literature about toxic effects of nanomaterials. These data
reported that some nanoparticles may pass the biological membrane barriers, transport via body fluids and may
ORAL PRESENTATION
190
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
accumulate in target organs. Respiratory, cardiovascular, reproductive, central nerveus system and urinary
system are the main targets of nanoparticles that effects cellular molecular mechanisms of these systems.
nanoparticles cause toxic effects primarily in respiratory system In case of their smaller size that enhance
enterance respiratory system. Nanoparticles toxic effects are related their particle size than their molacular mass.
Also nanoparticles surface encapsulation properites alter their toxicological effects in the biological system.
Nanocapsules, nanospheres and quantum dots are the another nanomaterials that commonly used as
biopharmacological vectors. A few toxicological data were in the literature about these types of nanomaterials.
These studies repored that nanodots may release cytotoxic ions and initiate oxidative stress in cellular systems,
however toxicologic data in workers of nanomaterial production were insufficient (Ostiguy C. 2006).
Titanium dioxide (TiO2) nanoparticle was classified as possible human (group 2B) carcinogen by the
International Agency for Research on Cancer (IARC). TiO2 distribution to environment as waste cause
disruptions and death of benefical soil microorganisms may result with imbalance of ecosystem. Althoug carbon
based nanomaterials have wide range production and application field in electronics, their hazardous toxic and
carcinogenic effects limited their applications in biological systems. Carbon nanotubes usage in buidings initiate
asbestos like toxic effects (Thomas Faunce T& Kolodziejczyk B. G20 Insigts-2017).
Table 1. significant nanotechnology appliaiton areas
Automotive Construction Electronics Fooddrink
Catalysts
Insulation
Displades
Packaging
Painting
Flame
Laser
additives
Sensors
retardants
diodes
Fiber
optics
transistos
Medicine
Textile
Cosmetics Military
Drug
Surface
Sunscreen
delivery
coating
Lipsticks
Coast
Coloring Creams
medium
Test
systems
Diagnositc
systems
(Table 1 is adopted from ; Danail Hristozov and Ineke Malsch. 2009)
Neutralizator
of chemical
weapons
Enenrgy
Lighting
Fuel
cells
Solar
cells
NANOMATERIALS USAGE IN MEDICINE AND PHARMACY
Nanotechnological improvements in medicine may lead to more effective and personalized therapy for
diseases with lower adverse effects of drugs. Nanomaterials can be used as imaging with high resolution,
targetting disease area, increasing bioavailability of drugs, increasing effects of the drugs and in tissue
engineering. Carbon nanotubes, several nanoparticle types as superparamagnetic iron oxide nanoparticles
(SPIONs), gold (AuNPs), magnetic, ferrofluidic, fleyroscent, silver and copper nanoparticles, quantum dots
(QD), nanogels, dendrimers and liposomes are commonly used nanomaterial types in medical applications. With
further studies, nanomaterial options for medicinal applications will be increased (Marchesan S and Prato M.
2013; Bystrzejewska-Piotrowska et al., 2009).
Several different type of barriers plays key roles on absorbtion, distrubition, metabolisation and exrection
of the drugs. Recent studies are focused on the bypass of biological barriers that decrease drugs effectiveness in
the body. Some examples that cross the biologic barriers are given in the below paragraphs. PEGylation (grafting
with polyethilene glycol) one of the process that increase the hemodynamics of the drugs in the body. Micelles
are the another nano-drug composing type that increase the effects of drugs with hydrophobic interaction. For
instance, anticancer drugs encapsulated into the micells and then these micells including drugs are decomposed
in the acidic environment of the tumor cells. And also nanoparticles design and use for induce immune system to
initiate immune response to influenza infections through respiratory administration. Several types nanocarriers
and nanocontainers are designed for DNA therapy, and stil investigating under in vitro studies. Thus, several
from basic to complex nanomaterials and nanoparticles designed and studied for several aspects for medicinal
applications. These materials enable to drugs; accessing target area by-passing the biologic barriers, decreasing
the drug tolerence, escape from drug clerance, increasing drug activity (Hubbell JA and Chilkoti A. 2012).
Nanoparticles and nanodevices usage in medicinal applications and drug delivery are growing rapidly
scientific area (Verma A. et al., 2008). Some examples about nanoparticle usage in medicinal area listed below;
ORAL PRESENTATION
191
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Magnetic nanoparticles for quatify several parameters in polirized cells, in molecular biology studies and
diagnostic purpose.
For cancer therapy, for the purpose of transporting chemical factors in drug targetting.
Drug biomanipulation
Labelling biomolecules to evaluate physiological features of the cell
Contrasting agent in imaging
Antibacterial, biocidal and antifungal properties
Biochemical tests and analysis (Verma A. et al., 2008; Gao et al., 2008; Liu, 2006; Kirchner et al.,
2005;
RISK ASSESSMENT OF NANOWASTES IN THE ENVIRONMENT
Automotive, cosmetic, medical, textile industries are the main nanowaste sources and different type of
nanomaterials, bare or functionalized nanoparticles are released into the air, soil and water rapidly in the
environment after production processes from these industries. After degradation in the environment these
nanowastes may accumulate and show ecotoxicological effects.
Degradated nanowastes which released to environment have short-term effects on biological systems,
however low soluble and degradable nanomaterials have tendency to accumulate in the environment and
biological systems. Despite to several scientific studies and technological improvement about nanotechnology, it
is stil difficult to descirbe toxicity and bioavailibility of nanomaterials in biological systems (BystrzejewskaPiotrowska G, et al., 2009 )
There are two risk categories defined in the literature as “known risks” and “potential risks”.
Nanoparticles risks are categrized under “potential risks”. Potentials risk factors have features asν it is not certain
that material or chemical have danger and when this material or chemical occur is it cause a significant damage.
There are several in-vitro and in vivo studies about nanoparticles toxic effects, however further studies should
done to explain detailed hazard effects of these materials. Different types of nanoparticles different toxic doses
and dose-response associations evaluated and revealed in different species, however it is needed compherensive
and extensive guidelines that include these studies and explain detailed toxicity and risk assessments. Due to
non-standartized testing protocols, it is difficult to clearly determine chemical properties of nano sized particles,
their characteristics in the environment and biological systems, and also their adverse effects (Hristozov D and
Malsch I. 2009).
MANAGEMENT
In Turkey, Medical Waste Control Regulation was first put in place in 1993 from Ministry of Environment
and Forestry legislators, then in 2005 this regulation revised to New Medical Waste Control Regulation
(MWCR) which in align with EU Environmental Directives was published. MWCR include issues on collection,
transportation, storage, disposal of medical wastes that classified into four group as municipal, medical waste
which are infectious, pathological and sharps, hazardous and radioactive wastes (Eker HH, et al., 2010)
In 1983, Ministry of Environment published Law 2872 which include regulations about improving
environmental contidions in Turkey and after 20 year duration only three regulative management update became
to main topic which in 1993, 2003 and 2005. This law regulation is not enough for today because of several type
of waste characteristics and different disposal methods for different types of wastes. Although strict regulaions
about municipal solid waste regulations, wrong disposal methods of municipal solid waste like open dumping
ongoing problem in developing countries.
According to The Turkish State Statistical Institute (TURKSTAT) 2014 report, municipal solid waste
generation was approximately 26 million ton and this number rising each passing year. In our country, different
departments and organisations work on waste managemnet which cause interaction problems and serious
implementation and administrative disruptions. In rural areas this problems increase incrementally due to
controlling disruptions (Sarptaş, H., & Erdin, E. 2015).
In Turkey there is no information or ragulation about nanowaste in “Hazardous Waste Management of
Turkey” and in “cosmetic management”. However in the world few developed countries refers nanowaste risk in
their managements or waste guidelines as shown in Table 2. (resmigazete.gov.tr-a,b).
ORAL PRESENTATION
192
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 2. Regulations for nanosafety in major countries
Country
USA
EU
JAPAN
Regulations TSCA
REACH
MOE-METI
FIFRA
CLP
including
FFDCA
RoHS
informations
CR
(Table 2 adopted from central.oak.go.kr )
THAILAND AUSTRALIA KOREA
NANOTEC NICNAS
Comprehensive
plans of nanosafety
(2011.10)
DISCUSSION
Nanotechnological scientific studies and industry improving each passing day, therefore in parallel with
this, wastes releaseing environment increase too. Further studies and observations needed to determination and
advanced risk assessment of nanowastes in the environment. There is big deficiency about management and
nanobiomonitoring of nanowastes in developing countries. It is needed to prepare regulative managements on
nanowastes releasing to environment before the nanoproduct come to marketting. With todays technology it is
limited and very expensive to detect nanowastes in the environment and also evalute their toxicological risk
assesment in the biological systems. Before publish highly effective nanowaste management, it is needed to
develop recent and cheaper technology strategies which faster and include easier protocols to identfy nanowastes
in the environment and also in biological systems. Possible remediation and deactivation techniques should be
developed thet incorporate with waste managements.
Within this review article we want to fill existing knowledge gaps on NMs “end of life process” in
Turkish Waste Management and provide data for scientist and regulatory authorities. For this purpose, some
directions and suggestions to manage safe and effective waste regulations about nanowastes were given in this
paper. Developing country governments should make a nanowaste detection, elimination, recycling and
prevention strategies and technologies in contact with researches works on nanotechnology before preparing
legislative managements. With recent scientific researches high throughput analytical methods should be
developed for detecting nanowastes during their contaminating phases and effecting biological structures. And
also improved detection technologies needed which discriminate new and old nanocontaminants in the
environmental and biological samples. After detection, identfying and classification of nanocontaminats,
improved technologies should be developed for removal of nanocontaminants from environment, especially
from waste water. Scientist should carefully work on artificial intelligence softwares to predict early nanowaste
release to environment from industries, medical and pharmaceutical sector.
Official and semi-official organisations should set up by related ministry and semi-official organisations
should organize regular survelliance to nanotechnology producing, using and nanotechnology research places
regularly about waste releasing with developed new technology strategies. Industry, universities and
governments in developing countries should handle nanowaste issue and recycling of nanocontaminants to
prevent pollution and adverse health effects of these materials on biological structures. During landfilling,
incineration and recycling processes of nanomaterials, several amounts of nanocontaminants release to the
environment. To minimize releasing during landfilling, nanocontaminants chemical properties should known
clearly and storage should convenient to this chemical properties. Governments in developing countries should
pay a special budget to scientific research activities on highly sensitive detection protocols and analytical
equipments which discriminate nanocontaminants from their natural counterparts.
Educative conference and workshops thet organized by official and semi-official organisations to
universities, industries, medical sector workers about nanowaste and their adverse effects on environment and
heath. To high quality and enhanced detection and prevention strategies, a formal nanocontaminant and
nanowaste analyzing laboratories shoul open in every region. To limiting occupational exposure of workers on
this area, health control centers and hospitals should updated for monitoring nanocontaminats exposure. And
another important issue is, organizing routinely ground water analysis from government.
CONCLUSION
Although nanotechnology research area and industrial activities and also medical applications grow
exponantial, controlling, recycling and disposal management of nanocotaminants and nanowaste grow more
slowly. Different international organisations as OECD, IUON and developed countries seriously handle
nanocontamination however develoing countries have big gap about managing and controlling on
ORAL PRESENTATION
193
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
nanocontamination. These countries should seriously attain importance to nanocontamination and nanowaste
management, because developed countries works is not provide worldwide efficient and effective protection
about this type contamination and adverse effects.
There were few study on nanowaste from Turkey and unfortunately there is no diverse regulatory
management. Immediately workshops, educations, research activities should organise in our country to prepare a
detailed management. In this paper we aimed to attarct attention on nanocontamination and nanowaste issue in
Turkey and step by step set a course for improving nanowaste researhes and organising official managements.
REFERENCES
Allied Market Research, October 2016; Europe Nanomaterials Market by Type of Material, by End User –
Opportunity Analysis and Industry Forecast, 2014–2022
Allied Market Research, September 2016; Nanomaterials Market – Global Opportunity Analysis and
Industry Forecast, 2014–2022
Bhatia S. 2016. Nanoparticles Types, Classification, Characterization, Fabrication Methods and Drug
Delivery Applications. Natural Polymer Drug Delivery Systems, DOI 10.1007/978-3-319-41129-3_2.
Blaser, S.A., Scheringer, M., MacLeod, M., Hungerbühler, K., β008. Estimation of cumulative aquatic
exposure and risk due to silver: contribution of nanofunctionalized plastics and textiles. Science of the Total
Environment 390, 396– 409.
Bystrzejewska-Piotrowska G, Golimowski J, Urban PL. 2009. Nanoparticles: their potential toxicity,
waste and environmental management. Waste Manag. Sep;29(9):2587-95.
Bystrzejewska-Piotrowska G, Golimowski J, Urban PL. 2009. Nanoparticles: their potential toxicity,
waste and environmental management. Waste Manag. Sep;29(9):2587-95.
Caballero-Guzman, A., Sun, T., Nowack, B., 2015. Flows of engineered nanomaterialsthrough the
recycling process in Switzerland. Waste Manage. 36, 33–43.
Colvin VL. 2003. The potential environmental impact of nanomaterials. Nat Biotechnol;21(10):1166–70.
Danail Hristozov and Ineke Malsch. 2009. Hazards and Risks of Engineered Nanoparticles for the
Environment and Human Health. Sustainability, 1, 1161-1194 )
Eker HH, Bilgili MS, Sekman E, Top S. 2010.vEvaluation of the regulation changes in medical waste
management in Turkey. Waste Manag Res. 28(11):1034-8.)
Faunce T and Kolodziejczyk B. 2017. Nanowaste: Need for Disposal and Recycling Standards.. G20
Insigts
Faunce, T., & Kolodziejczyk, B. 2017. Nanowaste: Need for Disposal and Recycling Standards.
https://sustainabledevelopment.un.org/content/documents/9539GSDR_Nano_brief%204.pdf )
Faunce, T., & Kolodziejczyk, B. 2017. Nanowaste: Need for Disposal and Recycling
Standards.https://sustainabledevelopment.un.org/content/documents/9539GSDR_Nano_brief%204.pdf
Gao, J., Zhang, W., Huang, P., Zhang, B., Zhang, X., Xu, B., 2008. Intracellular spatial control of
fluorescent magnetic nanoparticles. Journal of American Chemical Society 130, 3710–3711.
Gottschalk, F., Sun, T., Nowack, B., 2013. Environmental concentrations of engineered nanomaterials:
review of modeling and analytical studies. Environ. Pollut. 181, 287–300.
Hoet PHM, Brüske-Hohlfeld I, Salata OV. 2004. Nanoparticles—known and unknown health risks. J
Nanobiotechnol;2:12.
Holbrook RD, Murphy KE, Morrow JB, Ken D, Cole KD. 2008. Trophic transfer of nanoparticles in a
simplified invertebrate food web. Nat Nanotechnol;3:352–5.
Hristozov and Malsch. 2009. Hazards and Risks of Engineered Nanoparticles for the Environment and
Human Health. Sustainability, 1, 1161-1194.
http://central.oak.go.kr/journallist/journaldetail.do?article_seq=11682&tabname=abst&resource_seq=1&keywords=null
http://central.oak.go.kr/journallist/journaldetail.do?article_seq=11682&tabname=abst&resource_seq=1&keywords=null
http://www.resmigazete.gov.tr/eskiler/2005/03/20050314-1.htm
http://www.resmigazete.gov.tr/eskiler/2005/05/20050523-3.htm
Hubbell JA and Chilkoti A. 2012. Nanomaterials for Drug Delivery.. SCIENCE VOL 337,303-305
Inshakova, E., & Inshakov, O. 2017. World market for nanomaterials: structure and trends. In MATEC
Web of Conferences (Vol. 129, p. 02013). EDP Sciences.
ORAL PRESENTATION
194
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Kirchner, C., Liedl, T., Kudera, S., Pellegrino, T., Javier, A.M., Gaub, H.E., Stolzle, S., Fertig, N., Parak,
W.J., 2005. Cytotoxicity of colloidal CdSe and CdSe/ZnS nanoparticles. Nano Letters 5, 331–338.
Kleiner K, Hogan J. 2003. How safe is nanotech? New Sci Tech:14–5.
Lewinski, N. 2008. Nanotechnology for Waste Minimization and Pollution Prevention. Rice University:
Houston, TX.
List of Manufactured Nanomaterials and List of Endpoints for Phase One of the OECD Testing
Programme: June 2, 2008; Organization for Economic Cooperation and Development (OECD),.
Liu, W.T., 2006. Nanoparticles and their biological and environmental applications. Journal of Bioscience
and Bioengineering 102, 1–7.
Marchesan S and Prato M. 2013. Nanomaterials for (Nano)medicine.. dx.doi.org/10.1021/ml3003742
еACS Med. Chem. Lett., 4, 147−14λ
Marcoux MA, Matias M, Olivier F, Keck G. 2013. Review and prospect of emerging contaminants in
waste--key issues and challenges linked to their presence in waste treatment schemes: general aspects and focus
on nanoparticles. Waste Manag. Nov;33(11):2147-56.
Maynard AD. 2006. Nanoparticles and Occupational Health. ISBN-13-978-1-4020-5858-5, Springer
Moore MN. 2006. Do nanoparticles present toxicological risks for the health of the aquatic environment?
Environ Int;32:967–76.
Mordor Intelligence, Hyderabad, Telangana, March 2017; Nanomaterials Market – Global Trends,
Investment Analysis and Future Scope to 2022
Mueller, N.C., Nowack, B., 2008. Exposure modeling of engineered nanoparticles in the environment.
Environ. Sci. Technol. 42, 4447–4453.
Musee N. 2011. Nanowastes and the environment: Potential new waste management paradigm. Environ
Int. Jan;37(1):112-28.
Nel A, Xia T, Mтdler L, Li N. β006. Toxic potential ofmaterials at the nanolevel. Scienceνγ11μ6ββ–7.
Niebezpieczeństwo nanoodpadów. β016. Risk of nanowastes. Inżynieria i Ochrona Środowiska, 1λ(4),
469-478.
Ostiguy C. β006. Health Effects of nanoparticles. Dépôt légal Bibliothèque et Archives nationales ISBN
13 : 978-2-89631-060-9
Part F, Zecha G, Causon T, Sinner EK, Huber-Humer M. 2015. Current limitations and challenges in
nanowaste detection, characterisation and monitoring. Waste Manag. Sep;43:407-20.
Sarptaş, H., & Erdin, E. 2015. Municipal Solid Waste Management in Turkey: Status, Challenges and
Future Strategies Waste-to-Resources.
Verma, A., Uzun, O., Hu, Y., Hu, Y., Han, H.S., Watson, N., Chen, S., Irvine, D.J., Stellacci, F., 2008.
Surface-structure-regulated cell-membrane penetration by monolayer-protected nanoparticles. Nature Materials
7, 588–595.
Weir, E., Lawlor, A., Whelan, A., Regan, F., 2008. The use of nanoparticles in antimicrobial materials and
their characterization. Analyst 133, 835–845.
ORAL PRESENTATION
195
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
HEC/Chitosan Blend Pervaporation Membranes for the Separation of Dimethyl
Carbonate/Methanol Mixtures
Derya Ünlü, Aynur Hacıoğlu, Nilüfer Hilmoğlu*
Kocaeli Unversity, Engineering Faculty, Chemical Engineering Department, Kocaeli, Turkey
Corresponding author e-mail:niluferh@kocaeli.edu.tr
Abstract
In this study, chitosan and hydroxyethyl cellulose blend membranes were developed for the
pervaporation of methanol from a Dimethyl Carbonate (DMC) solution. Chitosan and hydroxyethyl
cellulose were chosen as membrane material due to the biodegradable and nontoxic properties.
Separation experiments were carried out in a pervaporation system. Pervaporation is an alternative
process for the separation of dimethyl carbonate (DMC)/methanol mixture. The effects of HEC/chitosan
ratio, feed MeOH ratio and operation temperature on pervaporation (PV) performance were investigated
and interpreted. In addition, the membrane characterization and membrane swelling effects were
investigated. The blend membrane with a HEC/chitosan ratio of 7/3 exhibited a separation factor of
28.25 and a total flux of 0.00054 kg/m 2 h in the pervaporation of 10 wt% methanol ratio at γ0 °C. The
results of the HEC/chitosan blend membrane exhibited higher separation performance and more
mechanic and chemical stable performance in separating methanol from the DMC solution. The
HEC/chitosan blend membrane can be a suitable pervaporation membrane to separate methanol from a
DMC solution.
Keywords: Chitosan,
Pervaporation.
Dimethyl
carbonate,
Hydroxyethyl
Cellulose,
Membrane,
Methanol,
1. INTRODUCTION
Dimethyl carbonate has wide application in chemical and petrochemical industry. Because of its hypotoxicity,
degradability, high oxygen content; it is called as a green chemical. Dimethyl carbonate, which has carbonyl and
methyl functional groups in its structure, is an important intermediate chemical for the carbonylation and
methylation reactions. In these reactions, DMC is used in place of carcinogenic and environmentally harmful
chemical substances such as dimethyl sulfate and methyl chloroformate. It is also a safe candidate for the
phosgene which is used in the synthesis of polycarbonate resins (Zhou et al., 2014).
DMC has also 53% oxygen content, so it can be used as fuel additive alternative to MTBE. The usage of MTBE
in gasoline is restricted due to the environmental concerns. Therefore, DMC is a good oxygenate alternative for
the gasoline (Won et al., 2002).
DMC has been synthesized by oxidative carbonylation of methanol, transesterification of ethylene carbonate
with methanol. DMC is obtained as a mixture with methanol at the end of the synthesis reaction. This mixture
has a separation problem because methanol forms an azeotrope with DMC. Various separation methods such as
distillation, extraction, adsorption are used to separation of DMC, but these methods need high energy and high
capital investment (Zhu et al., 2013). Pervaporation (PV) is a developing alternative technology for the
conventional separation process due to the eco-friendly and energy saving properties.
The separation processing by pervaporation is explained by the solution-diffusion model. The permeability of
the membrane is determined by solubility and diffusivity. Processing takes place in three steps. In the first step;
one of the components which is selective for the membrane is sorbed on the membrane surface. In the second
step; the selective component is diffused through the membrane. In the last step; the component is desorbed in
the vapor phase from the membrane (Wang et al., 2011).
ORAL PRESENTATION
196
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
In pervaporation process, the chosen of membrane material is an important factor for the diffusion and
permeability. Polymers, which have high thermal and chemical stability, high permeability, good sorption
properties, are preferred for the membrane preparation (Smitha et al., 2004). In this study, chitosan and
hydroxyethyl cellulose were used for the preparation of pervaporation membrane. Both of polymers are natural,
non-toxic, and, biodegradable (Liu et al., 2005; Chanachai et al., 2000). The structures of chitosan and HEC
contain hydroxyl groups which take an important role in diffusion and sorption of methanol. Methanol and water
have close polarity values and therefore, transport of methanol facilitates due to the presence of hydroxyl groups.
In this study, separation of methanol from DMC is carried out by using biodegradable HEC/chitosan blend
membrane with pervaporation process. The effects of HEC/chitosan ratio, feed MeOH ratio and operation
temperature on flux and selectivity values were determined and the optimum ratios were 7/3, 10 wt. % and 30oC
for HEC/chitosan ratio, feed MeOH ratio and operation temperature, respectively.
2. MATERIALS AND METHODS
2.1 Materials
The polymers used for membrane synthesis, chitosan and HEC were received from Sigma Aldrich. Methanol,
DMC, and acetic acid were also purchased from Merck Chemicals. All chemicals were used without further
purification.
2.2 Membrane preparation
HEC/chitosan blend membrane was prepared by solution casting method. The 1.5 wt.% solution of chitosan and
the 5 wt.% solution of HEC were mixed separately. The different ratios of HEC/chitosan blend membranes were
prepared by physically mixing both solutions. The blend membrane solution was stirred for 24 hours. The
prepared polymeric membrane solution was cast on a poly(methyl methacrylate) surface and dried at ambient
conditions. Chemical bond structure of HEC/chitosan blend membrane was characterized by FTIR. Furthermore,
the thermal stability of the HEC/chitosan blend membrane was investigated by thermogravimetric analysis
(TGA) by using a Mettler Toledo thermal analyzer. Blend membrane samples were heated from 25 oC to 600 oC
at a heating rate of 50 oC/min.
2.3 Pervaporation experiments
The scheme of pervaporation process is shown in Fig. 1.
Figure 1. Pervaporation scheme of PVCMR systemμ (1) agitator, (β) oven, (γ) membrane cell, (4) Dewar flasks,
(5) vacuum pump
ORAL PRESENTATION
197
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The volume of the membrane cell is 100mL and the effective membrane area is 9.62 cm2. DMC/methanol
solution was fed to the feed side of membrane cell and was mixed with an agitator. The temperature control was
provided by using an oven. The vacuum pump was used to reduce the pressure down to 20 mbar in permeate
side. The feed side pressure of the membrane is atmospheric pressure. This pressure differences facilitated the
diffusion of components through the membrane. The permeated stream samples were collected in liquid nitrogen
flask. Compositions of permeate were analyzed by an Agilent GC-7820A installed with FID and DB-1 column.
The separation performance of pervaporation process was determined by flux and separation factor of
components. Flux and separation factor formulas are given as below in Equation 1 and Equation 2, respectively:
J=
m
A.t
(1)
α=
Ya / Yb
Xa / Xb
(2)
In Equation 1; J indicates the flux, m is the mass of the permeate, A is the membrane area and t is the time. α P
represent the separation factor of the membrane. X and Y show the mass fractions of components in the feed and
permeate and, a and b signify the methanol component and DMC component in the sample.
3. RESULTS
3.1 Membrane characterization
Structure of HEC/chitosan blend membrane was determined by Fourier transform infrared spectroscopy (FTIR).
Figure 2 shows the FTIR spectra of the blend HEC/chitosan membrane.
Figure 2. FTIR spectra of HEC/chitosan blend membrane (7:3 ratio of HEC/chitosan blend)
The 1580.8 cm-1 band of the HEC/chitosan blend membrane can be assigned to the stretching vibration of −C=O
in–NH3+−OOCCH3 of chitosan acetate salt. The band of the 1038 cm -1 band is attributed to the stretching
vibrations of C–O bonds (Chanachai et al., 2000). The peaks in the 1650.9 cm -1 and 1364.9 9 cm-1 are assigned to
the NH3+ deformation in chitosan and –OH deformation in HEC occurring on blending the chitosan and HEC
polymers (Sridhar et al., 2005).
The TGA confirms the thermal stability of the HEC/chitosan blend membrane. Figure γ shows the TGA profile
of the membrane.
ORAL PRESENTATION
198
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 3. TGA curves for the HEC/chitosan blend membrane
The TGA of HEC/chitosan blend membrane shows the mass loss due to the water molecules within a
temperature range of 100–200oC. The weight loss in the temperature range of 200-300oC is related to the
evaporation of small molecules such as acetic acid. The last mass loss was seen between 300-600oC is due to the
decomposition of the chitosan and HEC. TGA results show that the HEC/chitosan blend membrane has the
stability to operation temperatures for the separation of methanol/DMC (Ghasemzadeh et al., 2016).
3.2 Pervaporation experiment
3.2.1 Effect of HEC ratio in the HEC/Chitosan blend membrane
Polymer blending is an efficient technique for modification of the pristine membrane. In this study, HEC was
introduced to modify the chitosan membranes. Figure 4 shows the effect of HEC ratio in blend membranes on
separation performance for DMC/MeOH azeotropic mixture at 50◦C.
Figure 4. Effect of HEC ratio in the HEC–chitosan blend membrane on PV performances for 70 wt. % methanol
at 50◦C (a) total flux (b) methanol selectivity.
The obtained results show that the total flux increases with an increase in HEC ratio. The separation factor
decreases with HEC ratio. Methanol affects the swelling properties of the membrane due to the close solubility
parameter of the HEC polymer. Hydrophilicity of membrane increases with an increase in HEC ratio. Methanol
has close polarity value with water. Therefore, an increase in the HEC ratio leads to higher affinity and resulting
in increased permeation. High HEC ratio results in more flexible polymer networkν chain mobility increases and
diffusion facilitates by large free volume (Zhou et al., 2014, Chanachai et al., 2000).
When the blend membrane contains 70 wt. % HEC and 30 wt.% chitosan, the membrane shows the highest total
flux of 0.014β kg/m2.h. It is also seen from Figure 4 that the flux value tends to unchangeable above 70 wt.%
HEC.
ORAL PRESENTATION
199
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3.2.2 Effect of methanol ratio in feed mixture
The variation of pervaporation performance over different methanol ratio in feed mixture at 50oC was
investigated using the blend membrane of 70 wt.% HEC. Figure 5 shows the effect of methanol ratio on
pervaporation separation performance.
Figure 5. Effect of methanol ratio in feed mixture on PV performances for 70 wt. % HEC at 50◦C (a) total flux
(b) methanol selectivity.
The total flux increased and the separation factor decreased with methanol ratio increasing in the feed mixture.
These could be explained by that the free volume and swelling degree of membrane increased significantly with
methanol ratio in the feed. The swollen membrane becomes more flexible and methanol can be diffuse easily
through the membrane. Diffusion of DMC is difficult into the membrane because of its molecule size, but it
easily penetrates with methanol through the swollen membrane. Therefore, the increased swelling has an
unfavorable effect on the selectivity value. The total flux increases while the methanol selectivity decreases
(Chen et al., 2008, Jiraratananon er al., 2002, Sridhar er al., 2005, Zhu et al., 2013). Furthermore, the increasing
feed methanol ratio also enhanced the partial pressure difference between the upstream side and the downstream
side. This differences creates the driving force for the permeation, and flux increased (Zhu et al., 2013).
3.2.3 Effect of operation temperature
Temperature has an important effect on permeation flux and separation factor, because all steps of pervaporation
process are influenced the temperature. The effect of operation temperature on the flux and selectivity is shown
in Figure 6.
Figure 6. Effect of operation temperature in the HEC–chitosan blend membrane on PV performances for 70 wt.
% HEC, 10 wt. % methanol in feed (a) total flux (b) methanol selectivity.
It can be seen from Figure 6 that total flux increased and selectivity decreased by temperature. The driving force
and the free volume increased with an increase in operation temperature. Higher temperature encourages the
motion of the polymer chains, the free volume of membrane increases and diffusion of molecules facilitates
ORAL PRESENTATION
200
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
through the membrane (Zhou et al., 2014). Furthermore, the saturated vapor pressure of feed mixture increases
with increasing the operation temperature, and the vapor pressure at the permeate side remains constant. The
driving force increases for mass transfer. As a result, the diffusion of methanol and DMC increased, and this led
to higher flux but lower methanol selectivity (Chen et al., 2008, Zhu et al., 2013).
5. CONCLUSION
A HEC-chitosan blend membrane was successfully fabricated to separate methanol from a DMC solution. HECchitosan blend membranes were prepared by solution casting and solvent evaporation methods. The effects of
membrane composition (HEC ratio), feed composition (methanol ratio) and operating temperature on the
membrane performance were investigated. Higher temperature, higher HEC ratio, and higher feed methanol ratio
resulted in higher membrane swelling. Swollen membrane greatly improves the flux and decreases the
selectivity. The highest flux was found to be 0.0142 kg/ m 2h at 90 wt % HEC ratio in the membrane for 70 wt %
of methanol ratio in the feed at 50oC. Maximum methanol selectivity was also observed as 28.25 at 70 wt %
HEC ratio in the membrane for 10 wt % of methanol ratio in the feed at 30oC. The obtained results indicated that
the HEC-chitosan blend membrane should be used to separate DMC-methanol mixtures. Therefore, the
developed HEC-chitosan blend membrane is a promising candidate for purification of DMC from methanol.
ACKNOWLEDGEMENTS
This study was supported financially by the Kocaeli University Scientific Research Projects Unit.
REFERENCES
Chanachai A, Jiraratananon R, Uttapap D, Moon GY, Anderson WA, Huang RYM 2000. Pervaporation with
chitosan/hydroxyethylcellulose (CS/HEC) blended membranes. J Journal of Membrane Science, 166:
271–280.
Chen JH, Liu QL, Zhu AM, Zhang QC, Fang J 2008. Pervaporation separation of MeOH/DMC mixtures using
STA/CS hybrid membranes. Journal of Membrane Science, 315: 74-81.
Ghasemzadeh H, Mahboubi A, Karimi K, Hassani S 2016. Full polysaccharide chitosan-CMC membrane and
silver nanocomposite: synthesis, characterization, and antibacterial behaviors. Polymers for Advanced
Technologies, 27: 1204–1210.
Jiraratananon R, Chanachai A, Huang RYM, Uttapap D 2002. Pervaporation dehydration of ethanol–water
mixtures with chitosan/hydroxyethylcellulose (CS/HEC) composite membranes I. Effect of operating
conditions. Journal of Membrane Science, 195: 143–151.
Liu YL, Su YH, Lee KR and Lai JY 2005. Crosslinked organic–inorganic hybrid chitosan membranes for
pervaporation dehydration of isopropanol–water mixtures with a long-term stability. Journal of Membrane
Science, 251: 233–238.
Smitha B, Suhanya D, Sridhar S, Ramakrishna M 2004. Separation of organic–organic mixtures by
pervaporation a review. Journal of Membrane Science, 241: 1-21.
Sridhar S, Ganga D, Smitha B, Ramakrishna M 2005. Dehydration of 2-Butanol by Pervaporation Through
Blend Membranes of Chitosan and Hydroxy Ethyl Cellulose. Separation Science and Technology, 40:
2889–2908.
Wang L, Han X, Li J, Zhan X, Chen J 2011. Separation of Azeotropic Dimethylcarbonate/Methanol Mixtures by
Pervaporation: Sorption and Diffusion Behaviors in the Pure and Nano Silica Filled PDMS Membranes.
Separation Science and Technology, 46: 1396–1405.
Won W, Feng X, Lawless D 2002. Pervaporation with chitosan membranes: separation of dimethyl
carbonate/methanol/water mixtures. Journal of Membrane Science, 209: 493–508.
Zhou H, Lv L, Liu G, Jin W, Xing W 2014. PDMS/PVDF composite pervaporation membrane for the separation
of dimethyl carbonate from a methanol solution. Journal of Membrane Science, 471: 47-55.
Zhu T, Li Z, Luo Y, Yu P 2013. Pervaporation separation of dimethyl carbonate/methanol azeotrope through
cross-linked PVA–poly(vinylpyrrolidone)/PAN composite membranes. Desalination and Water
Treatment, 51: 5485-5493.
ORAL PRESENTATION
201
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Gaziantep İl Merkezi ve Çevre Florasının Hemerobik Açıdan İncelenmesi
Mustafa Pehlivan1*, Necattin Türkmen2
1
Gaziantep Ünüversitesi, Nurdağı MYO, Bitkisel ve Hayvansal Üretim Bölümü, Gaziantep/TÜRKİYE
2
Çukurova Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, Adana/TÜRKİYE
Corresponding author e-mail: mpehlivan27@hotmail.com
Özet
Bu çalışma, nüfus ve sanayi bakımından ülkemizin en büyük kentlerden biri olan Gaziantep’in, il merkezi
ve çevresindeki köylerinin florası incelenerek, hemerobi (doğallık derecesi) açısından değerlendirilmesi
amacıyla yapılmıştır. Çalışma kapsamında β00λ-β011 yılları arasında il merkezi ve çevre köylerini kapsayan β15
örnek parsel belirlenmiş ve bu alanlarda bulunan floristik yapı ortaya konulmuştur. Çalışma sonucunda, alanda
toplam 87 familya ve β58 cinse ait tür ve tür altı seviyede γλ5 takson tespit edilmiştir. Bu taksonlardan 18’i
endemik olup toplam tür sayısı içerisinde egzotik ve dikili-doğal türlerin sayısı 11λ’dur. IUCN Tehlike
kategorilerine göre endemik taksonların β’si CR, 4’ü VU, 1β’si ise LR kategorisindedir. Örnek parsellerde tespit
edilen floristik yapı, TWINSPAN Multivariate istatistik programında, taksonların parsellerde
bulunma/bulunmama durumuna göre analize edilmiş ve bunun sonucunda 7 farklı bitki grubu elde edilmiştir.
Ayrıca, alandaki floristik içeriğe bağlı olarak 17 farklı biyotop tipi tespit edilmiştir. Tespit edilen taksonların, ait
olduğu alanların floristik yapılarının hemerobi skalasındaki yerleri belirlenmiştir Yapılan çalışma sonucunda
alandaki floristik kompozisyonun yüksek oranda sinantropik özellik gösterdiği tespit edilmiştir.
Anahtar Kelimeler: Gaziantep, flora, biyotop, hemerobi.
1.GİRİŞ
Bir ekosistem, sadece bir coğrafi birim (veya ekobölge) değil, aynı zamanda belirli girdileri ve çıktıları
bulunan, sınırları doğal ya da isteğe bağlı olarak belirlenebilen, işlevsel bir sistem birimidir (Odum ve Barrett,
2008).
Uygulamalı Ekolojinin bir alt dalı olarak ortaya çıkan kentsel ekolojinin (urban ekoloji) başlıca amacı,
kentlerin ve kentleşmenin doğal çevre üzerindeki doğrudan veya dolaylı etkilerini incelemektir (Kocataş, 1λλ4).
Kentler, küresel ölçekte dünyanın %γ’lük bir alanını kaplamasına rağmen (MAE, β005), kentsel gelişim,
mevcut peyzaj düzeyinde büyük dönüşümü teşvik eder ve biyoçeşitlilik için büyük bir tehlike olarak kabul edilir.
Çünkü kentsel gelişim biyoçeşitliliğin korunması için büyük zorlukları barındırır (Antrop, β004ν Hansen ve ark.,
β005). İnsanların ekosistem üzerinde meydana getirdiği değişikliklerin en bariz olarak ortaya çıktığı alanlar kent
merkezleri ve civar alanlarıdır (Alberti ve ark., β00γ). Bu etkilerden biri olan kentsel alanlarda yoğun toprak
kullanımı, flora, fauna, biyosenöz ve habitatların nicel ve nitel koşullarının önemli ölçüde kaybına neden
olmaktadır (Tüxen, 1λ61ν Sukopp, 1λ76).
Kent ekolojisi kapsamında yapılan çalışmalarda insan faktörünün etki alanının ve derecesinin ortaya
konması ve gerekli önlemlerin alınabilmesi için, özellikle 1λ50’li yıllardan sonra, “Hemerobi” adı verilen bir
kavram adı altında çalışmalar yoğunlaşmaya başlamıştır. Bu konu ile ilgili yapılan çalışmalarν insanoğlunun
kentleşme faaliyetleri sonucu, doğal çevre üzerinde oluşturduğu tahribatın derecesini ortaya koymayı
amaçlamaktadır.
Doğal çevre üzerindeki değişimleri derecesi, söz konusu bölgenin “hemerobi” sinin bir kriteri olarak
görülebilir. “Hemerobi” terimi ile “insanların ekosistemler üzerine isteyerek veya istemeyerek olan tesirlerinin
tamamı” anlaşılır. Biyotopların hemerobi cetvelindeki düzeni içinν tek yıllık türlerin oranları, geçmiş zamanlarda
göç etmiş bitki türlerinin (neofit) miktarları ve doğal flora türlerinin kaybı gibi parametreler önemlidir ve bunlar
göz önüne alınır (Kowarik,1λλ8).
ORAL PRESENTATION
202
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Çevre üzerindeki insan kaynaklı değişimler, özellikle kent ortamlarında kısaca gradient olarak adlandırılan
ve çevre üzerine etkisi bulunan her bir değişkenin miktarını veya şiddetini etkilemektedir. Bu değişkenler
özellikle kent ortamlarında çok daha hızlı ve etkili sonuç vermektedir. Kentlerde, toprağın, havanın, nemin ve
canlı çevre üzerine etkisi olan diğer tüm parametrelerin değişiminin temel belirleyicisi çoğu zaman insan ve
insan kaynaklı etkilerdir.
Kentlerde gelişen tohumlu bitkiler, kent vejetasyonun aslî üyeleridir. Öyle ki, tohumlu bitkiler
dışında, kent vejetasyonunda yer alan başka bitkiler pek seyrektir. Kent ortamlarında, civardaki doğal
çevreye ve bilhassa da ormanlara göre kilometrekarede daha fazla tür bulunmaktadır. Bunun
nedenleri, her şeyden önce özellikle bu tohumlu bitkilerin gelişmiş su kullanım kabiliyetleri ve baskılara
(antropojenik vs.) karşı olan adaptasyon kabiliyetleridir. Bununla birlikte, bütün tohumlu bitki türlerinin,
şehir şartlarına aynı şekilde adapte olabildiklerini söylemek de mümkün değildir. Çünkü şehir florasının
geliştiği ve varlığını idame ettirdiği ortam, şehir civarındaki doğal ortamlardan oldukça farklıdır
(Hodgson, 1986; Altay, 2009).
Hemerobi kavramının belirli ölçekler üzerinden açıklanmasının daha doğru olacağı düşüncesi ile
antropojenik etkilerin derecesini belirten 0-1 aralığında 11 farklı skalalı bir hemerobi cetvel ortaya
konmuştur (Jalas, 1955).
Bu araştırmada, Gaziantep kentsel ve kırsal alanlarındaki insan etkisinin biyotop çeşitliliğine ve floristik
yapıya ne şekilde etki etttiği ve bu etkinin bitki örtüsünün yapısını belirlemede rol oynayıp oynamadığı tespit
edilmeye çalışılmıştır.
2.MATERYAL VE METOD
Materyal
Araştırma alanı olan Gaziantep ili, Akdeniz Bölgesiyle Güneydoğu Anadolu Bölgesi'nin birleşme
noktasında yer almakta olup γ6° β8' ve γ8° 01' doğu boylamları ile γ6° γ8' ve γ7° γβ' kuzey enlemleri arasında
bulunmaktadır. Gaziantep ili 6.βββ km²'lik alanıyla Türkiye topraklarının yaklaşık olarak % 1'lik bölümünü
kapsamaktadır. Kentin merkez nüfusu 1λ. Yüzyıl sonlarına doğru yaklaşık 15.000 iken (Şıvgın, β000), β000
yılında toplam nüfus 1.β85.β4λ’e ulaşmıştır.
Çalışma alanının denizden ortalama yükseltisi 850 metre olup Maraş, Halep, Urfa’dan Akdeniz’e kadar
uzanan önemli yolların kesişme noktası üzerinde önemli bir yerleşim yeri, kültür ve ticaret merkezidir. Dünyanın
en eski yerleşim yerleri (M.Ö. 5600 ) arasındadır (Anonim, β010).
Gaziantep Meteoroloji İstasyonu iklimsel verilerine göre uzun yıllara ait ortalama sıcaklık değeri 15.0β
oC’dir. En sıcak ayın maksimum sıcaklık ortalaması β7.λ °C ve en soğuk ayın minimum sıcaklık ortalaması -0.3
°C’dir. Yıllık ortalama yağış toplamı 56β.6 mm’dir. Kurak devre Mayıs-Ekim aylarını kapsamaktadır (Şekil γ).
Metod
Gaziantep il merkezi ve çevre köylerinin floristik yapısının hemerobi kavramı ışığında irdelenmesi
amacıyla β00λ-β011 yılları arasında arazi çalışmaları yapılmıştır. Kent merkezinde 370.0γ” kuzey ve γ70.ββ”
doğu enlemlerinden Güney yönüne doğru γ6 0.55” kuzey ve γ70.β1” enlemlerine kadar 15 km boyunda bir
transekt seçilmiştir. Kent merkezinden γ70.0γ” kuzey ve γ70.ββ” doğu enlemlerinden Doğu yönünde γ7 0.04”
kuzey ve 370.γ7” doğu enlemlerine kadar β1.8 km’lik bir transekt belirlenmiştir. Kent merkezinden γ7 0.04”
kuzey ve 370.ββ” doğu enlemlerinden Kuzey yönünde γ7 0.1β” kuzey ve γ70.βγ” enlemlerine kadar 16.γ km’lik
bir transekt ve son olarak kent merkezinde 37 0.0γ” kuzey ve γ70.ββ” doğu enlemlerinden Batı yönüne doğru
370.04” kuzey ve γ70.11” doğu enlemlerine kadar 16.γ km’lik bir transekt seçilmiştir (Şekil β.).
ORAL PRESENTATION
203
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 1. Araştırma alanına ait ombro-termik iklim diyagramı
Şekil 2. Çalışma alanında belirlenen transektler ve bilinçli seçilen biyotoplar
Çalışma alanının floristik karakterinin hemerobi dereceleri Tablo 1’de verilen 11 skalalı ölçeğe göre
değerlendirilmiştir (Jalas, 1λ55ν Sukopp, 1λ76ν Kowarik, 1λ88ν Kowarik 1λλ0). Çalışmalarda toplana bitki
örnekleri Türkiye Florası ile ilgili temel kaynaklara göre teşhis edilmiştir (Davis, 1λ65-1λ88ν Güner ve ark.,
2000).
3.BULGULAR
Araştırma alanının tümünde (doğal-kentsel alanlarda) doğal yayılış gösteren 60 familyaya ve 1λ1 cinse ait
β86 tür ve tür altı takson belirlenmiştir. Kentsel alanda ise, dikili taksonlar veya egzotik flora olarak tabir edilen
50 familya, 86 cins ve 11λ tür ve tür altı takson yer almaktadır. Bu iki alana ait flora üyelerinden β1 familya 17
cins ve 8 takson hem doğal florada hem de kent içi açık-yeşil alanlarda ortak olarak temsil edilmektedir. Toplam
olarak alanda 8λ familya ve β60 cinse ait γλ7 takson tespit edilmiştir.
Araştırma alanındaki doğal olarak yayılış gösteren türlerin en çok takson içeren familya ve cinsleri
şöyledirμ Asteraceae % 15 (4β), Lamiaceae %9 (25), Fabaceae %7 (21), Poaceae %6 (17), Rosaceae %5 (15),
Brassicaceae %5 (1γ), Boraginaceae %5 (1γ) ve diğer 5γ familyanın toplamı ise %4λ (140)’luk bir orana
sahiptir. En çok türe sahip olan cinsler ise şu şekildedirν Salvia (6), Astragalus (5), Euphorbia (5), Trifolium (5)
ve Verbascum (5) tür ile temsil edilmektedir.
ORAL PRESENTATION
204
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tablo 1. Hemerobi dereceleri ve muhtemel biyotop tipleri (Jalas, 1955; Sukopp, 1976; Kowarik, 1988; Kowarik
1990)
Hemerobi Basamağı
H0 ahemerob
%0 NDP=0.0
H1 oligohemerob
%10 NDP=0.1
H2oligomesohemerob
%20 NDP=0.2
H3 mesohemerob
%30 NDP=0.3
H4 mesoίeuhemerob
%40 NDP=0.4
H5 ί-euhemerob
%50 NDP=0.5
H6
ί-eu-a-euhemerob
NDP=0.6
H7 a- euhemerob
%70 NDP=0.7
H8 a-eu-polyhemerob
%80 NDP=0.8
H9 polyhemerob
%90 NDP=0.9
%60
Metahemerob %100 NDP=1.0
Bulunduğu Yerler/Vejetasyon
Antropojenik aktivitelerden etkilenmemiş veya insan aktivitelerine maruz
kalmamış bir ekosistem
Tesir görmemiş sık ormanlar, Bataklıklar, kayalık deniz kenarı
vejetasyonu
Geniş kapsamlı, sulardan arındırılmış nemli bölgeler. Odunsu türleri az
olan alanlar, bazı nemli çayırlıklar
Sık kullanılan ormanlar, bozulmamış ikincil ormanlar, antropojen
bölgelerdeki otlaklar, geleneksel olarak kullanılan çayırlar
Tek ağaç türünden oluşan ve müdahale edilmiş kültür korulukları (örnν
hatıra ormanı), ikincil ormanlar, örtü vejetasyonu ruderalize edilmiş kuru
çayırlar
Genç ormanlar, sık çayırlar ve otlaklar, ruderal yüksek çalı vejetasyonu,
antropojen alanlardaki kuvvetli ruderalize edilmiş kuru çayırlar
Tek ağaç türünden oluşan ve müdahale edilmiş geleneksel segetal
vejetasyon, üstüne basılan çimler, ruderal çayırlar,
Yoğun tarım faaliyetleri olan alanlar ve bahçeler
Kuvvetli ilaçlanmış tarla vejetasyonu, ruderal öncül vejetasyon, üzerine
basılan tek yıllık otsu türler.
Tren yolu kenarlarındaki öncül vejetasyon, çöp dökülen yerler, tuz
dökülmüş karayolları, moloz atıklarının olduğu yerler,
Vejetasyonda vasküler bitkiler yoktur.
Taksonların fitocoğrafik bölgelere göre dağılımındaν İran – Turan 69 takson (%24.1), Akdeniz 46 takson
(%16.1), Avrupa-Sibirya 10 takson (%γ.5), kozmopolitler ve bilinmeyenler 5 takson (%56.γ) ‘dir. Çalışma
alanının İran-Turan ve Akdeniz fitocoğrafik bölgelerinin kesiştiği bir alanda bulunması nedeniyle her iki bölgeye
ait taksonların %40’lık bir oranda olması doğaldır.
Araştırma alanındaki bitkilerin hayat formları dağılışında Hemikriptofitler %45, Terofitler %γ1,
Fanerofitler %1β, Kriptofitler %λ ve Kamefitler %γ ile temsil edilmektedir. Toplam floranın 18’i (%5)
endenmik taksonlardır. Bu endemik taksonlardan Satureja aintebensis ve Centaurea haussknechtii Türkiye
Bitkileri Kırmızı kitabına (Ekim ve ark., β000) göre “CR” (Çok Tehlikede) kategorisinde olduğundan özellikle
korunması gereken taksonlardır.
Çalışma alanında tespit edilen toplam takson sayıları içerisinde, doğal olarak yayılış gösteren taksonlar
β86 (%71), dikili taksonlar olarak bulunan ancak aynı zamanda ülkemiz florasında da doğal yayılış gösteren
taksonlar 59 (%14) ve egzotik taksonlar 60 (%15) olarak tespit edilmiştir. Özatlı, (β00λ) yaptığı çalışmada
Balıkesir kent merkezinin florasını araştırmış ve bu alandaki egzotik türlerin toplam türlere oranını %1β olarak
tespit etmiştir. Göktürk (1λλ4), Antalya’nın florasını çalışmış ve alandaki egzotik taksonların toplam taksonlara
oranının %16 olduğunu belirtmiştir.
Yapılan çalışmada, doğal yayılış gösteren β86 taksonun en çok takson içeren familya ve cinsleri şu
şekildedirμ Asteraceae % 15 (4β), Lamiaceae %λ (β5), Fabaceae %7 (β1), Poaceae %6 (17), Rosaceae %5 (15),
Brassicaceae %5 (1γ), Boraginaceae %5 (1γ) ve diğer 5γ familyanın toplamı ise %4λ (140)’luk bir orana
sahiptir. En çok türe sahip olan cinsler ise şu şekildedirν Salvia (6), Astragalus (5), Euphorbia (5), Trifolium (5)
ve Verbascum (5) tür ile temsil edilmektedir.
Doğal flora elamanlarının fitocoğrafik bölge dağılımı şu şekildedirν İran-Turan elementlerinin 69 takson
(%β4) hâkimiyeti görülmektedir. Akdeniz elementleri (Doğu Akdeniz dâhil) 46 takson (%16) ile ikinci, AvrupaSibirya elementleri 10 takson (%γ) kozmopolit taksonlar 5 takson (%β) ve son olarak bölgesi bilinmeyen
taksonlar veya çok bölgeli 156 (%55) taksondur. Çalışma alanının İran-Turan ve Akdeniz fitocoğrafik
ORAL PRESENTATION
205
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
bölgelerinin kesiştiği bir alanda bulunması nedeniyle her iki bölgeye ait taksonların %40’lık bir oranda olması
doğaldır.
Çalışma alanında dikili ve egzotik türler haricinde doğal olarak yayılış gösteren taksonların hayat
formlarının yüzde dağılışları ise şu şekildedirν Hemikriptofitler (%45), Terofitler (%γ1), Fanerofitler (%12),
Kriptofitler (%λ) ve Kamefitler (%γ) ile temsil edilmektedir. Kent içerisinde özellikle fanerofitlerin doğal olarak
yayılış göstermesine engel olan birçok antropojenik faaliyet (yapılaşma ve ulaşım), aynı zamanda zamanda
toprağın hem mekanik hem de fiziksel yapı bakımından yoğun baskı altında olması nedeniyle kriptofitlerinde bu
tip alanlarda düzenli olarak yayılışına müsaade etmemektedir. Alanda tespit edilen floristik kompozisyondaki
taksonların hayat formları bazında karşılaştırma yapıldığında ise, açık bir şekilde hemikriptofitlerin ve
terofitlerin hayli yüksek oranlarda temsil edildiği görülmektedir. Yalnızca Quercus coccifera L. bitki
topluluğunda Fanerofit hayat formuna ait taksonlarında belli bir ağırlığı (%β5) sözkonusudur. Alanın maki
formasyonu olması nedeniyle de bu sonuç doğaldır.
Çalışma alanı gerek coğrafi olarak gerekse iklim yapısı olarak İran-Turan Fitocoğrafik Bölgesi ile
Akdeniz fitocoğrafik bölgesinin kesiştiği bir konumdadır. Alan, bir yönüyle (Güney ve Batı) Akdeniz bölgesinin
özelliklerini göstermekle beraber diğer taraftan ilin kuzey ve doğu kısımları Yarı Karasal iklim tipinin tesiri
altındadır. Ancak son yıllarda özellikle Fırat nehri ve üzerinde kurulu barajların bölgenin ikliminde tesiri olduğu
söylenebilir. Nitekim uzun yıllara dayalı meteorolojik kayıtlarda, ilin β0-γ0 yıl öncesine kadar daha fazla kar
yağışı aldığı ve sıcaklığın 0 oC’nin altına düştüğü günlerin daha fazla olduğu bilinmektedir.
Fitocoğrafik bölge dağılımlarında bölgesi bilinmeyen taksonlar kent ortamında yaklaşık %50 civarında
olmaktadır. Bu durumun nedeninin yukarıda bahsedildiği üzere kent ortamlarının habitat koşullarının sadece
belli bazı türlere (Urbanofil veya Urbanonötr) müsaade etmesi olduğunu düşünmekteyiz. İran-Turan ve Akdeniz
Fitocoğrafik bölge elementlerinin oransal olarak birbirine yakın bir şekilde karışım oluşturduğu alanlar, çalışma
alanının doğala yakın alanlarıdır.
Çalışmamızda tespit edilen toplam γλ7 taksonun 18’i endenmik taksonlardır. Bu endemik taksonlardan
Satureja aintebensis ve Centaurea haussknechtii Türkiye Bitkileri Kırmızı kitabına (Ekim ve ark., β000) göre
“CR” (Çok Tehlikede) kategorisinde olup özellikle korunması gereken taksonlardır. Bu nedenle alan ayrı bir
öneme sahiptir. Bu taksonlardan Satureja aintebensis türüne diğer bazı araştırmacılar tarafından Gaziantep ili
Sakçagözü ilçesinde rastlanmış ve çalışmamız kapsamında Aktoprak beldesi ve Organize Sanayi Bölgesi ile
tarihi Dülük Köyü arkasındaki tepeliklerde tespit edilmiştir.
Alanda tespit edilen Arum balansanum, Euphorbia anacampheros var. tmolea, Symphymtum aintabicum
ve Verbascum diversifolium taksonları “VU” (Zarar Görebilir) kategorisinde olup yine korunma konusunda
dikkatli olunması gereken türlerdir. Bu kategorideki tüm taksonlar alanın doğala yakın kesimlerinden olan Sof
dağı ve çevresinde bulunmaktadır.
Alanda tespit edilen endemik taksonlardan “LR” (Az Tehdit Altında) kategorilerisinde olanlarν Acanthus
hirsutus, Centaurea tomentella, Tanacetum argenteum subsp. argenteum, Astragalus aintabicus, Astragalus
leporinus var. hirsutus, Lathyrus elongatus, Crocus biflorus subsp. pseudonubigena, Phlomis armeniaca, Salvia
pisidica, Stachys cretica var. mersinae, Helleborus vesicarius ve Sideritis condensata’dır.
Bitki Toplulukları
Günümüzde, flora ve vejetasyon çalışmalarında klasik metodların yanı sıra bu alanlarla ilgili verilerin
istatistiksel olarak değerlendirilmesine olanak sağlayan bilgisayar programlarının kullanımı giderek artmaktadır.
Bu nedenle çalışmamızda da bu istatistik programlarından TWINSPAN (Two-way indicator species analysis)
programı kullanılarak türlerin örnek parsellerde bulunma veya bulunmama durumlarına göre bu örneklik alanlar
gruplandırılmaya çalışılmıştır. 4’lü dallanma temeline dayanan analiz sonucunda ortaya 7 farklı grup çıkmıştır
(Şekil γ). Toplam β15 örnek parsele ait flora verileri analiz edilmiş ancak β08 örnek parsel bu gruplarda
kümelenmiştir. 7 örnek parselin ise ortaya çıkan bu 7 grupta yer edinecek özellikte olmadığı anlaşılmıştır.
ORAL PRESENTATION
206
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 3. Araştırma alanındaki örneklik alanların floristik yapısının Twinspan yöntemi ile bulunma sınıfına göre
dağılımı gösteren dendrogram
TWINSPAN Grup A
Topluluk, alandan toplam 17 örneklik alan seçilerek bu örneklik alandan Nisan-Temmuz ayları arasında
yapılan arazi çalışmaları sonucunda toplanan ve kaydedilen bitki örneklerinin teşhisi sonucunda tanımlanmıştır.
Bölgede Sof Dağı olarak adlandırılan ve çalışma alanındaki topografyanın (1486 m.) zirve yaptığı bu alan
bölgenin floristik içerik bakımından en zengin bölgesidir. Alanın hakim vejetasyon yapısı Quercus cocciferaPistacia terebinthusbitki toplulukları olmasına rağmen, bölge, Styrax officinalis, Rhamnus aleternus, Rhamnus
oleoides, Crateagus monogyna, Crateagus orientalis, Phyllarea latifolia ve Lonicera etrusca gibi taksonlarında
geniş yayılış gösterebildiği bir alandır. Çalışma alanında Sof dağı kadar olmasada hala maki formasyonunun
özelliklerini gösteren bir diğer alan olan ilin kuzeyindeki, Karacaören ve Göksuncuk köylerinin tepelikleri,
giderek bölgede hızla genişleyen Organize sanayi bölgesinin baskısı altına girmektedir. Bu alanda da yer yer
maki formasyonuna ait taksonlar (Quercus coccifera, Pistacia terebinthus, Rhamnus oleoides, Crateagus
monogyna) kendilerini muhafaza edebilmişlerdir.
Topluluğun alanı floristik içerik ve antropojenik etki açısından alanların hemerobik skala içerisindeki yeri
H5 ß-euhemerob derecesindedir. Topluluktaki taksonlardan örnek parsellerde bulunma sıklığı en fazla olanlarν
Quercus coccifera L. 17 (%90), Pistacia terebinthus L. subsp. palaestina, 15 (%79), Crataegus monogyna
subsp. monogyna, 9 (%47), Paliurus spina –christi 9 (47), Rhamnus oleoides subsp. graecus 8 (%42), Styrax
officinalis 8 (%42), Phillyrea latifolia 7 (%37), Lonicera etrusca var. etrusca 7 (37) ve Rubus sanctus 7 (%37)
örnek parselde tespit edilmiştir.
TWINSPAN Grup B
Çalışma alanında Grup B’nin kapsadığı örneklik alanlar kentsel alanlardaki yapılar arası boşluklar ile
anropojenik aktivitenin yoğun olduğu (bağ evleri, tarım arazileri, yol kenarları) kırsal alanlardır. Bu tip alanlara
urbanofob taksonların dahil olması mümkün olamadığı gibi kentin sınırlarındaki alanlarda bulunan urbanofob
taksonlar gün geçtikçe insan kaynaklı baskılara maruz kalmaktadır. Her ne kadar il merkezinde farklı fonksiyon
alanları bulunsa da tüm bu alanlardaki floristik yapı, ekolojik istekleri bakımından benzer özellik gösteren
urbanofil taksonların varlığıyla karakteristiktir. Yapılan istatistiksel analizde 154 örnek parsel Grup B’de
kümelenme göstermiştir. Büyük bir kısmı kentsel alanlara ait olan 154 örnek parselde doğal yayılış gösteren
toplam 161 tür ve tür altı takson bulunmaktadır. Kent merkezinde doğal yayılış gösteren 4β familyaya ait bu
taksonların hemen hemen üçte biri 5β (%γβ) Asteraceae, Poaceae ve Brassicaceae familyalarına aittir.
ORAL PRESENTATION
207
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Taksonların örnek parsellerde bulunma durumları, yapılan istatiksel analizde ortaya çıkan grupları
açıklamada önemlidir. Bu nedenle, yapılan analizde Grup B’de kümeleşme gösteren örnek parsellerin floristik
yapısı aynı zamanda bu alanlarla ilgili bir kısım ekolojik özellikler konusunda bazı bilgileride bize verebilmesi
açısından önemlidir. Bu nedenle 154 örnek parselin kümeleşme gösterdiği alanlarda bulunma sıklığı β0
parselden fazla olan taksonlar ele alınmıştır. Toplam β0 parsel ve üzerinde bulunma sıklığına sahip olan takson
sayısı γβ’dir. Bu taksonlar içerisinde de bulunma sıklığı en fazla olan taksonlar, Chenopodium album L. subsp.
album 59 (%38), Cynodon dactylon (L.)Pers. var. dactylon 50 (%32), Cardaria draba (L.) Desv. subsp. draba
43 (%28), Hordeum murinum L. subsp. murinum 43 (%28), Cichorium intybus L. 41 (%27), Echium italicum L.
40 (%26) ve Sisymbrum officinale (L.) Scop. 40 (%β6) şeklindedir.
Kentsel habitatlara ait bu örnek parsellerin floristik içerikleri, alanın hemerobi skalasındaki yerini Hλ
polyhemerob, H8 a-eu-polyhemerob H7, a- euhemerob olarak değerlendirmemize sebep olmuştur. Çünkü alanda
tespit edilen taksonların örnek parsellerde bulunma sıklığına göre yapılan istatistiksel analizde 154 örnek
parselin Grup B’de toplanmış olması bu 154 alanın bazı kesimlerini farklı hemerobik skalada değerlendirmemize
sebep olmuştur. Şöyle ki, kent ortamlarında bir çok farklıkullanım alanları mevcuttur ve bu alanların her taksonu
bulundurma durumu veya bulundursada geniş yayılış alanlarına yayılmasına izin vermesi aynı olamamaktadır.
Bu durum, aslında kullanım alanının nüfus yoğunluğu, fonksiyon alanı, kullanım sıklığı gibi nedenlerden
kaynaklanmaktadır.
TWINSPAN Grup C
Grup C’de toplam 1γ örnek parsel tanımlanmıştır. Alan, kent içerisinden geçen ve Şehitkamil ve Şahinbey
ilçelerinin sınırının büyük kısmınıda oluşturan Allaben deresi ve çevresidir. Derenin kent merkezinden geçen
büyük bir kesimi sağlısollu park alanlarıdır. Cumhuriyetin ilk yıllarında derenin merkezden geçen kesimi
tamamen doğal akışında olup, dere kenarları bölge halkı tarafından mesire alanıolarak kullanılmaktaydı. Dere
içerisinden geçen suyun zamanla kirlenmesinden ve civarına kötü koku yaydığı gerekçesiyle içerisi tamamen
betonlaştırılmış ve neredeyse doğal türlerin yayılışı sonlandırılmıştır. Ancak kentin dış kesimlerine doğru dere
kenarında bazı doğal taksonlar yayılış gösterse de bu taksonlar da yine çoğunlukla urbanofil taksonlardır.
Özellikle son yıllarda Alleben deresinin kent dışındaki güzergahında, çevre yolunun yapılmasıve aktif olarak
kullanılmasıyla birlikte dere yatağının betonlaştırılması hız kazanmıştır. Üstelik çevre yolunun kenarları için
açık yeşil alan uygulaması ile birlikte özellikle yoğun olarak Nerium oleander L. dikimi yapılmıştır. Ayrıca
derenin çevre yolu kenarından geçen kolu moloz atıklarıyla beslenmiş ve taşıma topraklar ve beton atıkları
alanın toprağınının doğal yapısını bozmuştur. Ancak yine de Rhus coriaria, Capparis spinosa, Tamarix
smyrnensis gibi bazı taksonlar dere kıyısında varlığını koruyabilmiştir.
Alanda doğal, dikili doğal ve egzotik olmak üzere toplam 78 takson bulunmaktadır. Bu taksonlardan 7’si
egzotik, γ’ü dikili 68’i ise doğal yayılış gösteren taksonlardır. Doğal yayılış gösteren taksonlardan Echium
italicum 4 (%31), Silybum marianum, Cichorium intybus ve Malva sylvestris γ’er (%β1) örnek parselle alanda
en sık rastlanan türlerdir.
Bu alanın, il içerisindeki kalan kesimi, Hλ polyhemerob olarak değerlendirilsede, alanın il sınırlarına
yakın alanlarındaki kesimleri H7 a-euhemerob olarak değerlenrilebilir.
TWINSPAN Grup D
Çalışma alanında tespit edilen taksonların örnek parsellerde bulunma sıklığına göre yapılan Twinspan
analizinde gruplaşma yapan taksonlar alanda, mezarlıklar ve çevresinde bulunmaktadır. Çalışma alanında iki
büyük mezarlık bulunmaktadır. Bunlardan ilki ve en eski olanı Asri Mezarlık’tır. Diğeri ise Yeşilkent
Mezarlığı’dır.
Bu habitatı diğer habitatlardan ayıran temel faktör hem odunsu hem otsu egzotik türlerin yoğun olarak
kullanılmasının yanı sıra mezarlıkların kendi dinsel dokunulmazlıklarının getirdiği statik yapı bu alanlarda doğal
flora üyelerinin de kendine yer bulabilmesidir. Öyle ki, bu mezarlıklarda, özellikle de uzun bir geçmişe sahip
ORAL PRESENTATION
208
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Asri mezarlıkta, kent içerisinde kalmış olmasına rağmen şehrin yoğun antropojenik baskısı içerisinde doğal flora
elemanlarının sığınabildiği ender alanlardan birisidir. Üstelik bu mezarlık alanlarında ilgili resmi birimlerin
yaptığıpeyzaj düzenlemesinin yanı sıra her mezarlıkta, mezarlığa gelen ziyaretçilerin kendi yakınlarına ait
mezarlıklarda mini bir açık yeşil alan düzenlemesi yapması bu biyotopların biyoçeşitliliğini arttırmaktadır. Bu
bakımdan her ziyaretçi kendi zevkine göre getirdiği bitkileri veya tohumları alana dahil etmesiyle alanın tür
sayısı suni olsa da artmaktadır. Grubun karakterize ettiği örnek parsel sayısı 8’dir. Mezarlık alanlarındaki odunsu
taksonların tamamı dikili doğal veya egzotik taksonlardır. Örneklik alanlarda tespit edilen ve en sık karşılaşılan
taksonlar; Pauwlonia tomentosa, Platanus orientalis, Pinus brutia, Pinus pinea, Cupressus sempervirens var.
horizontalis, Cupressus sempervirens var. pyramidata, Cupressus arizonica, Thuja orientalis, Nerium oleander,
Robinia pseudoacacia, Mirabilis jalapa, Yucca elephantipes, Syringa vulgaris, Viburnum opulus, Albizia
julibrisin, jasminium mesnyi, Vitis vinifera, Morus alba ve Lonicera japonica’dır. Ancak, çalışma alanında,
mezarlıkların yoğun müdahale edilmiş yapısında bazı spontan türler kendilerini bu alanlarda koruyabilmiştir. Bu
taksonlar; Carduus nutans, Anemone coronaria, Trigonella coelasyriaca, Urtica dioica, Polygonum arenastrum,
Hordeum murinum, Centaurea solstitialis, Carthamus persicus, Ixilorion tataricum, Malva neglecta, Alcea
setosa, Alcea digitata, Galium verum, Muscari neglectum, Salvia multicaulis, Teucrium polium, Verbascum
lasianthum ve Verbascum alepense’dir.
Grup D’nin barındırdığı alanlar, büyük bir kısmı plantasyon da olsa ağaç ve çalı türlerinin çok oluşu, bu
taksonların yanında bazı spontan türlerinde bu alanlşara dahil olmuş olması ve hatta bu alanların kent
merkezinde çok sık rastlanmayan bazıkriptofit taksonlara yer vermesinden dolayı H5 ί-euhemerob olarak
değerlendirilmesini sağlamıştır.
TWINSPAN Grup E
Yapılan istatistiksel analize göre bu Grup’ta karakterize olan örnek parsel sayısı λ’dur. Bu örnek
parsellerin tamamı alandaki parklara aittir. Bu parklar, alan büyüklüğü bakımından kentin belli başlı parklarıdır.
Kent ortamında bulunan bu parkların tamamı tek veya birkaç bitki türü ile karakterize olmayıp çoğunlukla
birçok dikili veya egzotik bitki türü ile çeşitlendirilmiştir. Alandaki bu parklar, kent ortamının yoğun günlük
aktivitelerinden bunalan halkın kendini dinlenme amacıyla bu alanlara sevk etmesi nedeniyle ayrı bir önem
kazanmaktadır. Bu tip alanlarda genellikle çimlendirme çalışmaları nedeniyle doğal türlerin yayılışına çok fazla
izin verilmemekte ve çimlendirme alanları dışındaki yerlerde ya eğlence alanları ya da yürüyüş parkurları
yapılarak toprak yüzeyi örtülmektedir. Ayrıca parkların yeşil örtüsünün bakımı düzenli olarak yapıldığı için
bizler için doğal, yerel yöneticiler için “yabani ot” olarak kabul edilen türler alandan temizlenmektedir. Bu
parklarda doğal türler sadece parkların çimlendirme alanlarının sınır kesimlerinde kendilerine yer bulabilen bir
kısım terofit karakterde taksonlardır.
Çalışma alanındaki parklarda sık rastlanan doğal-dikili veya egzotik bitki türleriν Robinia pseudoacacia,
Salix babylonica, Morus alba, Vitis vinifera, Hedera helix, Paulownia tomentosa, Viburnum opulus, Cupressus
arizonica, Cupressus sempervirens var. horizontalis, Thuja orientalis, Rosmarinus officinalis, Rosa foetida,
Cupressus macrocarpa, Juniperus sabina, Hibiscus syriacus, Hibiscus rosa-sinensis, Ailanthus aitissima, Tilia
argentea, Acer negundo, Fraxinus angustifolia subsp. oxycarpa, Yucca elephantipes, Pyracantha coccinea,
Cedrus libani, Abies cilicica subsp. cilicica, Picea pungens, Coteneaster horizontalis, Aesculus hippocastanum,
Lonicera japonica, Laurus nobilis, Lagerstroemia indica, Magnolia grandiflora, Nerium oleander,
Washingtonia filifera’dır.
Grup E’ye ait örnek parsellerde sıklıkla rastlanılan doğal flora elemanlarıμ Senecio vulgaris, Vicia cracca,
Trifolium pratense, Polygonum aviculare, Hordeum murinum, Poa annua, Taraxacum officinale, Plantago
lanceolata, Tragopogon longirostris, Malva neglecta, Capsella bursa-pastoris’dir.
Bu alanın genellikle dikili doğal veya egzotik taksonlarla ağaçlandırılmışpark alanlarının olması ve
spontan türlerin sadece bu park alanlarının sınır kesimlerinde bulunması nedeniyle alan H7 a-euhemerob
skalasında değerlendirilmiştir. Çünkü ildeki parklar zaten günlük olarak yoğun insan baskısıaltında ve alanda
ORAL PRESENTATION
209
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
spontan türlere rutin olarak yetkililer tarafından yapılan bakım çalışmasıyla nedeniyle yaşam şansı
tanınmamaktadır.
TWINSPAN Grup F ve G
Bu iki grubu aynı başlık altında toplamamızın sebebi her iki grubunda kent içerisindeki yapay ormanlık
alanlara ait örnek parsellerden oluşmasıdır. Toplam 1β örnek parsel bu alanlara aittir. Çalışma kapsamındaki
alanda irili ufaklı birçok yapay olmasına rağmen bunlardan en önde gelenleri Dülük Baba, Burç ve Gerciğin
ormanlıklarıdır. Bu yapay ormanların tamamı tek türün dominantlığı üzerine kurulmuşken yer yer ikincil türlerin
mevcudiyeti tespit edilmiştir. Bu alanlarda Pinus brutia dominant tür iken yer yer Pinus halepensis’e de
rastlanmaktadır. Burç ormanlığı, diğer iki yapay ormanlık alanı olan Gerciğin ve Dülük Baba ormanlık alanından
genel örtü olarak olmasa da orman altı örtüsü bakımından ayrılmaktadır. Aynı zamanda bu ormanlık bir yandan
çevre yolu ile diğer yandan Gaziantep Üniversitesi kampüs alanı ile sınırlanmaktadır. Bu nedenle hem kentin
neredeyse merkesinde kalması hem de içerisindeki yoğun antropojenik etkiler nedeni ile orman altı örtüsüne çok
fazla izin vermemektedir. Hem hayvanat bahçesinin il içerisinden ve il dışından yoğun ziyaretçi alması hem de
kampüs alanının giderek büyüme ihtiyacı bu alanı giderek darltmaktadır. Hayvanat bahçesi içerisinde
ziyaretçilere görsel bir mekan sunma ihtiyacından dolayı doğal yapı bozularak yeşil alan uygulamasına
gidilmektedir. Ayrıca ormanlığın içerisinde hala şahıslara ait bağevlerinin bulunması bir diğer sorundur. Üstelik
bu alanlarda zaman içerisinde ortaya çıkan tahribatlar sonucunda (yangın, kesim v.s) boş kalan kesimlerde yeşil
alan tasarımına gidilerek ormana bazı farklı türler de dâhil olmuştur (Cupressus sempervirens var pyramidata,
Cupressus sempervirens var. horizantalis, Robinia pseudoacacia). Bu tip ormanlarda bölgenin toprak ve iklim
şartlarına uyum sağlayabilen ve sistematik bir şekilde bakıma ihtiyaç duymayan türlerin tercih edilmesi bu
taksonların büyüme ve gelişmesi için pozitif parametreler olmuşlardır. Halkın daha çok “sahre” adını verdiği ve
hafta sonları ailesi ve aile dostlarıyla birlikte veya esnaf birliklerinin düzenlediği pikniklerin mekanı olan bu
alanlar sınır kesimleri ve içerisinden geçen yol kenarları ve ormanın tahrip edildiği alanlar hariç hemen hemen
otsu türlerden yoksundur.
Dülük ve Gerciğin ormanlıklarının bugün hala orman altı örtüsünde, Quercus coccifera, Paliurus spinachristi, Pistacia terebinthus, Crateagus monogyna subsp. monogyna, Crateagus orientalis, Pyrus syriaca,
Rhamnus aleternus, Rhamnus oleoides, Prunus spinosa ve Rosa canina, gibi maki formasyonun üyelerini
barındırmaktadır.
Grup F ve G’nin barındırdığı alanların, büyük bir kısmı yapay ormanlık alanlardır. Ancak yukarıda
belirttiğimiz nedenlerden dolayı, Grup F’yi oluşturan alanlar çok fazla antropojenik baskı altındadır. Bu nedenle
alanda doğal flora elemanlarının önemli bir yayılış gerçekleştirebilği söylenemez. Bu durumun sonucunda Grup
F ve oluşturan alanlar H5 ί-euhemerob olarak değerlendirilmiştir. Ancak Grup G’yi ortaya çıkaran Dülük ve
Gerciğin ormanlık alanlarının tamamı Burç ormanlığı kadar yoğun baskı altında değildir. Bu nedenle her iki
yapay ormanlık alan, aynı zamanda alanın doğal potansiyel bitki örtüsü olarak değerlendirilebilecek taksonların
yayılış göstermesini ve hatta bir anlamda bu yayılışıkoruma altına alınmasını sağlamıştır. Eğer alandaki maki
formasyonuna ait bu taksonlar kentin bu kadar yakınındaki bir alanda yapay ormanlık alan yerine tarım arazileri
yakınında olmuş olsaydı muhtemelen günümüzde bu taksonları kente yakın bu alanlarda göremeyecektik. Bu
nedenler Grup G’yi ortaya çıkaran bu yapay ormanlık alanların hemerobi skalasındaki yerleri H4
mesoίeuhemerob olarak değerlendirilmiştir.
4. TARTIŞMA
Kentsel ortamdaki antropojenik kaynaklı her türlü yapay girdiler urbanofil familyalara ait üyelerin yayılış
alanlarını etkilememekte aksine değişen ortam şartlarına hızlı adapte olamayan diğer bazı türlerin ortamdan yok
olmasına neden olduğu için bu familyaların alandaki yayılışına ivme kazandırmaktadır.
Çalışma alanımızda, kentsel ve kırsal habitatlarda elde edilen floristik veriler mevcut flora elemanlarının
başlı başına sintaksonomik bir grup olarak değerlendirilmesini mümkün kılmamaktadır. Her ne kadar alanda bazı
taksonların (Carduus nutans subsp. nutans, Cardaria draba, Sinapis arvensis, Rhus coriaria, Chenopodium
ORAL PRESENTATION
210
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
album, Conyza canadensis, Silybum marianum, Verbascum alepense, Salsola ruthenica, Urtica dioica,
Cichorium intybus, Amaranthus blitoides, Sisymbrium officinale, Hordeum murinum subsp. murinum, Rumex
crispus) gerek bulunma sıklığı gerekse örtüş bakımından diğer taksonlara nazaran belli bir hakimiyeti söz
konusu olsa da elimizdeki veriler ışığında yapılan istatistiksel analizler bu taksonları sintaksonomik olarak
değerlendirmemize olanak sağlamamıştır. Bu durum, kentsel açık alanların hem süreklilik arzetmeyen arazi
parçaları şeklinde bulunması hem de bu arazi parçalarının hemen hergün yoğun baskı altında oluşundan dolayı
kararlı bir hale geçememesinden kaynaklanmış olabilir. Çünkü, kentsel alanlarda flora elemanlarının bulunuşuna
ve yoğunluğuna etki eden faktörler (nüfus, ulaşım, yapılaşma, sanayileşme, zirai faaliyetler,) flora üyelerinin
değişimine bazen çok yönlü etki edebilmektedir. Özellikle Gaziantep gibi büyük metropollerde belli bir açık
alanın yapısal değişimi bazen 1-β yıl gibi kısa bir sürede gerçekleşmektedir. Kentin doğala yakın alanları için
durum farklıdır. Bu alanlarda bulunan maki formasyonunun karakteristik türü olan Quercus coccifera L. geniş
yayılış alanına sahiptir. Alandaki tek doğal topluluk olarak adlandırılabilen topluluğunun bulunduğu alan olan
Sof Dağı ve ilin kuzeyindeki dağlardır.
Ancak, maki formasyonu, farklı bilim adamları tarafından değişik açılardan yorumlanmaktadır. Kimi
bilim adamları bu formasyonu sekonder vejetasyon olarak nitelendirirken (Polunin ve Huxley, 1λ68ν Akman ve
ark., 1λλ5ν Altay, β00λ), bazıları ise bu görüşe katılmayıp, Akdeniz Bölgesi’nin klimaks vejetasyonu olduğunu
görüşündediler (Rikli, 1λ48). İkinci görüşe katılan bir araştırıcı olan Walter (1λ6β), makinin sekonder
vejetasyon olduğunu savunan bilim adamlarının aksine, sert yapraklı ağaçların Akdeniz Bölgesi’nin alt
kademelerinde klimaksı oluşturduğunu söylemektedir. Ancak, çalışmamızda gerek arazi gözlemleri sırasında
gerekse çalışma alanı hakkında elde edilen bilgiler, alanın önceki dönemlerde özellikle Pinus brutia Ten. gibi
orman vejetasyonu ile anılan bazı taksonların alanda var olduğu yönündedir. Bu nedenle çalışmamızda makilik
alan olarak tespit edilen bu alanlarda aslında önceleri orman vejetasyonunun hâkim olduğu ve mevcut vejetasyon
yapısının sekonder vejetasyon özelliği taşıdığı kanaatini oluşturmuştur.
Araştırmamızda Quercus coccifera L. topluluklarının yayılış alanları alanı İlin Batı kısmında yer alan ve
Batı-Doğu yönünde uzanan Sof Dağı ve çevresidir. Aynı zamanda ilin kuzeyinde Yavuzeli ilçesi yolu üzerinde
bulunan Göksuncuk köyü ve çevresindeki makilik alanlar da çalışmamız kapsamında bilinçli seçilen biyotoplar
içerisinde yer almıştır ve bu alan ilk kez tarafımızdan incelenmiştir. Sof Dağı’nda ise daha önce Özuslu, (β005)
floristik anlamda bir çalışma yapmış ve tür listesi vermiştir. Sof dağının genel bitki örtüsü maki vejetasyonu
olmakla birlikte alanın hakim türleri Quercus coccifera ve Pistacia terebinthus subsp. palaestina’ dır. Ayrıca,
alanda yoğun olarak Rhus coriaria, Paliurus spina-christi, Styrax officinalis, Rosa canina, Rhamnus alaternus,
Createagus orientalis ve Crataegus monogyna subsp. monogyna taksonlarıda bu taksonlara eşlik etmektedir. Bu
taksonlardan Rhus coriaria her ne kadar ruderalize olmuş bir takson olsa da çalışma alanında doğal yayılış
gösterebildiği bir alandır. Bu takson kentin hemen hemen her yönünde fakat özellikle de üzerinde hiçbir
antropojenik faaliyet gerçekleşmeyen boş arazilerde yoğun olarak bulunmaktadır. Bu durum, belli bir alanda
geçmişte var olan ve günümüzde doğal potansiyel bitki örtüsü olarak birkaç örnekle temsil edilen maki
formasyonun yerini bu taksonun aldığı kanaatini oluşturmuştur.
Biyotoplar ve Hemerobi Dereceleri
Kentsel alanlarda, antropojenik etkiler öncelikle alandaki biyotoplar üzerinde etkisini göstermektedir. Bu
etki, doğal veya doğala yakın alanları kentlerde azalttığı gibi aynı zamanda insan kaynaklı bilinçli-bilinçsiz
olarak ortaya çıkan etkiler bu tip alanlarda çok farklı biyotop tiplerini ortaya çıkarmaktadır. Bu nedenle örneğin
kentlerde sıcaklığın kent dışı alanlara nazaran birkaç derece yüksek olması, toprağın daha sık, pH’nın alkali
özellikte olması gibi nedenler, farklı biyotop tiplerinin oluşmasında etkendir. Kentsel alanlarda, özellikle de
büyük kentlerde, konut alanları, parklar, bahçeler birer farklı biyotop tipini oluşturdukları gibi, demiryolları,
tarım alanları, endüstriyel alanlar da farklı birer biyotop tipi olarak karakterize olurlar.
Kentsel alanlara ait biyotoplar konusunda yapılan çalışmalarda, bazı araştırmacılar (Atik ve Yılmaz, 1λλ7ν
Sayar, 1λλ8ν Kunick, 1λλβν Beyhan, β007) biyotopları hemerobi skalasına göre değerlendirmişken, bazı
araştırmacılar da (Kim ve ark., β00βν Godefroid ve ark., β007ν Altay, β00λ) biyotoplardan ziyade kentsel
alanlardaki bu biyotopların floristik veya sintaksonomik yapılarına göre bir hemerobi skalası belirleme yoluna
ORAL PRESENTATION
211
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
gitmişlerdir. Çalışmamızın ana konusu kentsel ve kırsal alan flora yapısı ve bu flora yapısını barındıran farklı
biyotoplar olması nedeni ile çalışmamızda da birinci grup araştırmacılar gibi biyotop tipi esas alınarak hemerobi
skalası tespiti yoluna gidilmiştir.
Kentsel alana ait biyotoplar konusunda yapılan benzer çalışmalarda, Yılmaz (1λ86) yaptığı çalışmasında
İzmir ili Buca ilçesine ait ekoloji yönünden önemli biyotopları tespit etmiştir. Bu biyotopları, Yapı alanları, Yeşil
Alanlar ve Yapı Alanları Çevresi olmak üzere γ ana başlık altında toplamıştır. Bu γ ana başlık altında ise 1γ
farklı biyotop tipi olduğunu bildirmiştir. Atik ve Yılmaz (1λλ7), yaptığı çalışmada Adana kentindeki
biyotopların sınıflandırılması konusunda yaptığı çalışmada, alandaki biyotopları 6 ana başlık altında toplamış ve
bu başlıklar altında toplam γγ biyotop tipi tespit etmiştir. Aynı zamanda araştırmacı alandaki biyotopların
hemerobi derecelerini, 6’lı hemerobi skalasına (Seiberth, 1λ81) göre ortaya koymuştur.
Özatlı (β00λ) yaptığı çalışmada Balıkesir ilinin kentsel alanlardaki biyotop tiperini belirlemiş ve 1γ farklı
biyotop tipi tespit ettiğini bildirmiştir. Beyhan (β007), ise yaptığı çalışmada İzmit ilinin kentsel ekolojik
verilerini incelemiş ve bu kapsamda çalışma alanında 15 farklı biyotop tipi tespit etmiştir. Ersoy (β008), yaptığı
çalışmada, İzmir Aliağa’da uydu görüntülerini kullanarak önemli biyotopları sınıflandırmış ve 14 farklı biyotop
tipi tespit edildiğini bildirmiştir. Biyotop haritalama konusunda yapılan bir diğer çalışmada Nayim (β010),
Amasra-İnkum (Bartın) arasında yer alan önemli biyotopların haritalanması konusunda araştırma yapmış ve
alanda 11 farklı ana biyotop tipi tespit etmiş ve bu biyotop tipleri altında γ0 farklı biyotop tipi sınıflandırıldığını
bildirmiştir.
Çalışmamız sonucu tespit edilen biyotop tiplerinden kentsel alanlar bazı alt biyotop tiplerini barındırsa da
hemen hemen birçok kentte insan kaynaklı etkilerin yoğun olduğu alan floralarının, bulunduğu habitata göre
giderek urbanofil, ruderal ya da segetal flora olmaya doğru evrildiği bir gerçektir. Bu tip alanlarda urbanofil,
ruderal veya segetal flora elemanları sayıca az olsa bile kentlerde bulunma sıklığı olarak çok yoğun ve
örtüşleride bir o kadar fazladır (Kunick, 1λ8γνWittig, 1λλ1ν Celesti-Grapow ve ark., 1λλ6ν Doğan, β007νAltay,
β00λν Özatlı, β00λ). Kunick (1λ8γ)’in Almanya’nın Stutgart eyaletinde kentlerde spontan olarak yayılabilen
urbanofil olarak değerlendirdiği taksonlardan Poa annua, Taraxacum officinale, Plantago major, Lolium
perenne, Hedera helix, Trifolium repens, Dactylis glomerata, Solidago canadensis, Circium arvense, Conyza
canadensis, Urtica dioica ve Convolvulus arvensis’in aynı zamanda çalışmamızda da kentsel ortamlarda yoğun
olarak bulunduğu tespit edilmiştir. Wittig (1λλ1), Orta Avrupa’da yaptığı çalışmada urbanofil olarak tespit ettiği
Hordeum murinum ve Salsola ruthenica türleri çalışma alanımızdaki kentsel alanlarda da tespit edilmiştir.
Ancak, daha çok iki katlı müstakil yapılarda, konut sahipleri şahsi çabaları ile konut bahçelerinin
ağaçlandırılmasında öncelikle meyve ağaçlarını tercih etmekte ve bu sayede toprağın yapısı çok fazla
değiştirilmemektedir. Bu tip alanlarda da en azından konut duvarlarının kenarlarında bazı hemikriptofit ve terofit
karakterde taksonlar müdahale edilmedikçe kendilerine yer bulabilmektedir. Hatta çok fazla işlenmeyen kimi
konut bahçelerinde genelde kent ortamlarının geofit taksonlar için uygun ortamlar olmadığı bildirilmiş olmasına
rağmen (Gutte 1λ78, 1λ8λν Rapoport ve ark. 1λ8γ) Muscari neglectum, Hyacinthella nervosa gibi geofit
taksonlar kendilerine yer bulabilmektedir.
Çalışma örnek parsellerin bulunduğu demiryolları ve karayollarında kent merkezinde daha çok yeşil alan
düzenlemesi yapılarak dikili doğal -egzotik türlerle bezenmiş, kenarları kaldırımlarla döşenmiş ve toprağın çok
fazla yüzeye çıkmadığı alanlar olarak yer almaktadır. Ancak kentin sınırlarına ve kırsal alanlara doğru yeşil alan
düzenlemelerinin yapılmadığı ve kaldırımların olmadığı alanlarda toprağın kent merkezine nazaran daha çok
yüzeyi gördüğü alanlarda ve tarım alanlarına doğru açılan tali yollarda birçok ruderal karakterdeki taksona
rastlamak mümkündür. Bu alanlardaki ruderal floranın yanında yer yer bazı doğal flora üyeleri de bu alanlara
sokulabilmişlerdir. Genelde kurak olan kesimlerde Asteraceae (Cichorium intybus, Lactuca serriola, Carduus
nutans, Echinops ritro, Scolymus hispanicus ve Onopordum carduchorum) ve Poaceae (Hordeum murinum,
Festuca rubra) nemli alanlarda ise Fabaceae (Trifolium repens, Vicia cracca, Lotus corniculatus ve Medicago
orbicularis), Brassicaceae (Sinapis arvensis, Sisymbrium officinale), ve Polygonaceae (Rumex pulcher)
familyalarına ait taksonlar haha sık göze çarpmaktadır. Benzer bir çalışmada, Doğan ve ark. (β004), Batı
Anadolu’da yol kenarı bitkilerini araştırmış ve β.700 km boyunda bir alan üzerinde 17 farklı karayolunu
ORAL PRESENTATION
212
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
incelemişlerdir. Çalışma sonucunda toplam 51 familyaya ait β71 takson tespit etmişlerdir. Yapılan çalışmada en
çok tür sayısına sahip olan taksonları Asteraceae, Fabaceae ve Poaceae familyaları olarak sıralamışlardır.
Yapılan çalışma, bu yönüyle çalışmamızda tespit edilen ve tür yoğunluğu fazla olan familyalar ile paralellik arz
etmektedir.
Demiryolu kenarlarında ise kent merkezinde ruderal karakterde bazı hemikriptofitler ve terofitler ön plana
çıkarken kentten uzaklaştıkça bu taksonlara Rhus coriaria, Amygdalus orientalis, Crataegus monogyna subsp.
monogyna. ve Rosa canina gibi bazı fanerofitler de eşlik etmektedir
İl merkezine yakın ve bağ evi olarak kullanılan alanlar, sahipleri tarafından hem seyrek ziyaret, hemde
ticari kaygı olmamasından dolayı egzotik türler, çim ve çit bitkilerinin mekânsal zararı dışında çok yoğun
mekanik ve kimyasal etki yönüyle zarar görmemektedir. Ancak kentten uzak ve daha çok kırsal kesimde yaşayan
insanların geçim kaynağı olan bağ alanları daha sık müdahaleye maruz kalmaktadır. Bu müdahale şekli, dikim
öncesi ve sonrası toprak yüzeyini tamamen traşlama, dikim sonrası toprak sürüm faaliyetleri ve zararlılar için
pestisit kullanımı şeklinde olmaktadır.
Çalışmamız sonucu, alandaki floristik yapının hemerobi durumu göz önüne alındığında, çalışma alanında
H0-H3 (Ahemerob-Mezohemerob) derecelerine ait alanlar tespit edilememiştir. Bu durumun nedeni, hemerobi
cetvelinde belirtilen antropojenik baskılardan etkilenmemiş alanların ve doğal ormanların bulunmayışıdır.
Bununla birlikte kent ortamlarında veya yoğun antropojenik faaliyetlerin olduğu kırsal ortamlarda, birliklerin
hemerobi skalasındaki yerleri (H7), (H8) ve (Hλ) skalasında olmasına rağmen kırsal alanlar ve yapay ormanlık
alanlarda bu skala (H4) veya (H5) seviyesindedir.
Atik ve Yılmaz (1λλ7), yaptıkları çalışmada Adana kentinde biyotopların haritalanması amacıyla
yaptıkları çalışmalarında, eski kent merkezlerinde tespit ettikleri Parieteria judaica, Vitis vinifera, Ficus carica,
Morus nigra türleri aynı zamanda çalışma alanımızdaki benzer biyotop tipinde de tespit edilmiştir.
Ülkemizde bu konuda yapılan bir çalışmada, Balıkesir il merkezinin farklı biyotopları araştırılmış ve 1γ
farklı biyotop tipi tespit edilmiştir (Özatlı, β00λ). Araştırmacının tespit ettiği biyotop tiplerinden eski yerleşim
alanlarındaki taksonlardan Ficus carica ve Parieteria judaica türleri aynı zamanda çalışma alanımızın benzer
biyotop tipinde de tespit edilmiştir. Altay (β00λ), İstanbul ilinin Anadolu yakasının kentsel vejetasyonunu
araştırma amacıyla yaptığı çalışmada ise kent merkezindeki alanlarda Parieteria judaica’nın bitki topluluğu
oluşturduğunu tespit etmiştir. Araştırmacının alanda tespit ettiği Parieteria judaica, Sonhus asper, Stellaria
media taksonları aynı zamanda araştırma alanımızda da tespit edilmiştir.
Alanda tespit edilen γλ7 taksondan 11λ’unun dikili doğal veya egzotik olması başlı başına alana insan
etkisinin bir göstergesidir. Bu anlamda dikili doğal veya egzotik bitki türlerinin alanda tespit edilen toplam
taksonlara oranı %γ0’dur. Benzer bir çalışma sonucunda Godefroid ve ark. (β007) Brüksel’de, kentsel
ortamlarda toprak ve mikroklimatik çeşitliliğin kentsel flora üzerine etkisini araştırdığı çalışmada, ββ farklı
kentsel açık alanda toprak ve flora yapısını incelemiş ve alandaki floristik kompozisyonun toprağın pH, organik
madde içeriği ve nem şartlarından etkilendiğini belirtmiştir. Ayrıca alanda 74 takson tespit edilmiş ve
yoğunluklu olarak bu türlerin Buddleja davidii, Cirsium arvense, Hordeum murinum, Plantago major,
Elymus repens, Rumex obtusifolius ve Conyza canadensis türleri olduğunu belirtmiştir. Ayrıca, tespit edilen
floranın %β8’inin egzotik türlerden oluştuğunu bildirmiştir.
Kentsel alanların doğal tür kayıplarına ilişkin bir araştırmada ise DeCandido (β004), yaptığı araştırmada
New York eyaletinin Pelham bölgesinde kentsel alanlardaki yerel tür oranının %71,1’den %5λ,6’ya düştüğünü
belirtmiş ve alanda öncelikli olarak otsu türlerin yok olduğunu bildirmiştir.
Kim ve ark. (β00β) Güney Kore, kırsal alanda Hemikriptofitler ve Kamefitler açısından hemerobi skalası
arasında herhangi bir korelasyon olmadığını, Fanerofit ve Geofit türler açısından hemerobi dereceleri ile bu
hayat formlarına ait türler arasında negatif bir korelasyon olduğunu vurgulamıştır. Nitekim çalışmamızda da
doğala yakın alanlar ile kentsel alanlar arasında Hemikriptofitler ve Kamefitler açısından herhangi bir
ORAL PRESENTATION
213
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
korelasyon bulunmazken özellikle H5 ve H6 ölçeğindeki hemerobi derecelerine sahip olan doğala yakın
alanlarda Fanerofitler ve Geofitlerin artış gösterdiği tespit edilmiştir. Bu durumun başlıca sebebi kentsel
ortamlarda özellikle toprak yapısında meydana gelen bozunmalar ve toprağın işlenmesi sonucu diğer bazı
mekanik etkiler öncelikle geofit türlere zarar vermekte ve diğer yandan kentsel alanlarda araziler tarımsal veya
konut yapımı amacıyla işlenirken ağaç ve çalı türlerinin öncelikle yok edilmesi yoluna gidilmesi olarak
açıklanabilir. Ancak Hemikriptofitler veya terofitlere aynı derecede engel olunamamasından dolayı aynı etki bu
hayat formlarının üyeleri için geçerli olamamaktadır. Ayrıca terofitler ve hemikriptofitlerin üreme potansiyeli
açısından fanerofitler ve geofitlere oranla bir üstünlüğü olmasınında kentsel alanlarda bu hayat formlarına sahip
taksonlara daha sık rastlanılmasının bir sebebi olarak değerlendirilebilir.
KAYNAKLAR
Akman, Y., Düzenli, A., Güney, K., β005. Biyocoğrafya. Palme Yayınlarıμ γ44, 44λ sayfa.
Albertı, M., Marzluff, J.M., Shulenberger, E., Bradley, G., Ryan, C., Zumbrunnen, C., 2003. Integrating humans
intoecology: opportunities and challenges for studying urban ecosystems. BioScience 53: 1169–1179.
Altay, V., β00λ. İstanbul’un Anadolu Yakası’nın Kentsel Vejetasyonu. Marmara Üniversitesi, Fen-Edebiyat
Fakültesi - Doktora tezi 436 sayfa.
Anonim, β010. İl Çevre Durum Raporu. Gaziantep Çevre ve Orman İl Müdürlüğü,
Antrop, M., 2004. Landscape change and the urbanization process in Europe. Landscape and Urban Planning,
67: 9-26.
Aslan, O., β010. Arslanbey (İzmit) Çevresi ile İzmit Şehir Florasının Tespiti. Sakarya Üniversitesi, Fen-Edebiyat
Fakültesi - Yüksek Lisans Tezi 1β8 sayfa.
Atik, M., Yilmaz, K.T., 1λλ7. Adana Kentinde Biyotopların Haritalanması. Ç.Ü. Fen ve Mühendislik Bilimleri
Dergisi, Vol. 7, Sayı 1μ β4γ-257.
Beyhan, D.E., β007. İzmit’in Kent Planlamasında Ekolojik Verilerin Değerlendirilmesi. Marmara Üniversitesi,
Fen-Edebiyat Fakültesi – Doktora tezi 255 sayfa.
Braun-Blanquet, J. 1λ64. Pflanzensoziologie. Grundzüge der Vegetationskunde. Springer-Verlag, Wien and New
York.
Buzas, I., 1988. Talaj- és agrokémiai vizsgalati módszerkönyv β. A talajok fizikaikémiai és kémiai vizsgalati
módszerei. (Methods of soil and agricultural chmistry analysis β. Physical-chemical and chemical
methods of soil analysis.) Mezőgazdasagi Kiadó, Budapest, Hungary.
Celesti G.L., Ricciardi, M., Blasi, C., 1996. Confronta tra la flora di alcune citta mediterranee in Italia. S. It. E.
Atti, 17: 257-259.
Ceylan, E., 1λλλ. Gaziantep Tarihi. Gaziantep Ticaret Odası, Kültür Yayınları, λλ/β.
Davis, P.H., 1965. Flora of Turkey and the East Aegean Islands. Vol.1, Edinburgh Univ. Press., Edinburgh.
Davis, P.H., 1965-1985. Flora of Turkey and the East Aegean Islands. Vol.1-9, Edinburgh Univ. Press.,
Edinburgh.
Decandido, R., 2004. Recent changes in plant species diversity in urban Pelham Bay Park, 1947–1998.
Biological Conservation 120:129–136.
Dogan, Y., Baslar, S., Celik, A., Mert, H.H., Ozturk, M., 2004. A Study Of The Roadside Plants Of West
Anatolia, Turkey. Nat. Croat., Vol 3, No 1: 63-80.
Ekim, T., Koyuncu, M., Vural, M., Duman, H., Aytaç, Z., Adıgüzel, N., β000. Türkiye Bitkileri Kırmızı Kitabı
(Red Data Book of Turkish Plants). Türkiye Tabiatını Koruma Derneği ve Van 100. Yıl Üniversitesi, β46
sayfa.
Ersoy, E., β008. Uydu görüntüsü kullanımıyla Aliağa (İzmir) kıyı bölgesinde ekolojik açıdan önemli
biyotopların haritalanması. Ege Üniversitesi, Ziraat Fakültesi, Peyzaj Mimarlığı – Yüklek Lisans Tezi,
102 sayfa.
Godefroid, S.,Monbaliu, D., Koedam, N., 2007. The role of soil and microclimatic variables in the distribution
patterns of urban wasteland flora in Brussels. Landscape and Urban Planning 80:45–55.
Göktürk, S. R., 1λλ4. Antalya Şehir Florası Üzerine Bir Araştırma. Akdeniz Üniversitesi, Fen-Edebiyat Fakültesi
- Yüksek Lisans Tezi ββ5 sayfa.
Gutte, P., 1978. Ruderalpflanzengesellschaften von Lima und Huanuco. Beitrag zur Kenntnis
zentralperuanischer Pflanzengesellschaften I. Feddes Repertorium, 89: 75-97.
ORAL PRESENTATION
214
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Gutte, P., 1989. Ein Beitrag zur Kenntnis von Flora und Vegetation der stadt Santa Clara in Cuba. Wiss. Ztschr.
Friedrich-Schiller-Univ. Jena, Naturwiss. R., 38: 297-314.
Hansen, A.J., Knight, R.L., Marzluff, J.M., Powell, S., Brown, K., Gude, P.H., Jones, K., 2005. Effects of
exurban development on biodiversity: patterns, mechanisms, and research needs. Ecological Applications
15: 1893-1905.
Jalas, J., 1955. Hemerobe und hemerochoer Pflanzenarten. Ein terminologoscher Reformversuch – Acta Soc.
Fauna Flora Fenn. 72, 11: 1–15.
Kim, Y., Zerbe, S., Kowarik, I., 2002. Human impact on flora and habitats in Korean rural settlements. Preslia,
Praha, 74: 409–419.
Kocataş, A., 1λλλ, Ekoloji, Çevre Biyolojisi. Ege Üniversitesi Su Ürünleri Fakültesi Yayınları, Noμ51, Ders
Kitabı Dizini Noμ β0, Bornova/İzmir.
Kowarik, I., 1992. Zur Rolle nichteinheimischer Waldarten bei der Waldbildung auf innerstтdtischen Standorten
in Berlin. Verhandl. Ges. Ökol., β1μβ07- 213.
Kowarik, I., 1998. Zum menschlichen EinfluB auf flora und Vegetation. Landschaftsentwicklung und
Umweltforschung TU, Berlin, 56.
Kunick, W., 1λ8γ. “Köln, Landschaftsökologische Grundlagen – Teil γ”, Biotopkartierung, Grünflтchenamt,
Köln.
Kunick, W., 1λλβ. Möglichkeiten der naturnтheren Anlage und Pflege öffentlicher Grünflтchen. Das Gartenamt,
10:685-690.
Nayim, S.Y., 2010. Amasra-İnkum (Bartın) arasında yer alan önemli biyotopların haritalanması. İstanbul
Üniversitesi, Mühendislik Fak., Peyzaj Mimarlığı – Yüksek Lisans Tezi, γ11 sayfa.
Odum, E.P., Barret, G.W., β008. Ekoloji’nin Temel İlkeleri. Palme Yayıncılık, (5. Baskıdan Çeviri, Editör, Kani
Işık), 6β4 sayfa.
Özatli, D., β00λ. Balıkesir İlinin Kentsel Ekolojik Özellikleri. Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Doktora tezi 226 sayfa.
Özuslu, E., İskender, E., Özaslan, M., Zeynalov, Y., β005. The Investigation of the Flora of Sof Mountain
(Gaziantep, Turkey). Flora Mediterranea, Italia, 15:179-209.
Polunin, O., Huxley, A., 1968. Flowers of the Mediterranean. London, 272 pages.
Rapoport, E. H., Dıaz Betancourt, M. E., Lopez Moreno, I. R., 1λ8γ. Aspectos de la ecologia urbana en la ciudad
de Mexico. Flora de las calles baldios, Editorial Limusa, 197 pages.
Rikli, M., 1948. Dans Pflanzenkleid der Mittelmeerlander. Bern: Huber. Vol. 3, 148 pages.
Sayar, A., 1λλ8. Kent Planlamasında Ekolojik Verilerin Değerlendirilmesi Muğla Örneği”, Ege Üniversitesi,
Ziraat Fakültesi, Doktora tezi, İzmir
Seiberth, H., 1λ8γ. Stadtökologie – Naturschutz Und Landschaftspflege In Grossstadt. Grün Un Der Stadt,
Veröffentlicht Im Rowohlt Tascherbuch Verlag GmbH, Reinbek Bei Hamburg,
Sukopp, H., 1λ76. Verтnderungen der Flora und Fauna in der Bundesrepublik Deutschland (W. Trautmann.
edts.). Schr.-R. Vegetationkde. 10:1–409.
Şıvgın, H. β000. Ankara Üniversitesi Osmanlı Tarihi Araştırma ve Uygulama Merkezi Dergisi, Sayı 11, sayfa.
503-553.
Walter, H., 1λ6β. Anadolu’nun Vejetasyon Yapısı. (Çeviri Editörü.μ S.Uslu) İst. Üniv. Orm. Fak. Yay. Noμ 80.
Wittig, R., 1λλ1. Ökologie der GroBstadtflora. G. Fischer, Stuttgart.
Yilmaz, K.T., 1λ86. Buca Yerleşme Merkezinde Ekoloji Yönünden Önemli Biyotoplar Üzerine Arştırmalar. Ege
Üniversitesi, Ziraat Fakültesi, Y. Lisans Tezi 44 sayfa.
Yilmaz, T.K., 1λλγ. Amanos Dağları Dörtyol Kesiminde Yayla Yerleşimlerinin Doğala Yakın Vejetasyonlar
Üzerine Etkilerinin Araştırılması. Ç.Ü. Ziraat Fakültesi-Doktora Tezi, 171 sayfa.
ORAL PRESENTATION
215
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Wound Healing Properties of Capparis ovata desf. var. paleastina zoh. Methanol Extract
Mehmet Evren Okur1*, Şule Ayla2, Derya Çiçek Polat3, Mehmet Y. Günal4
*1
2
Universtiy of Istanbul Medipol, School of Medicine, Department of Histology and Embryology, Istanbul,
Turkey
3
4
University of Anadolu, Faculty of Pharmacy, Department of Pharmacology, Eskişehir, Turkey
University of Ankara, Faculty of Pharmacy, Department of Pharmaceutical Botany, Ankara, Turkey
University of Alanya Alaaddin Keykubat, Faculty of Medicine, Department of Physiology, Antalya, Turkey
Corresponding author e-mail: evrenokurecz@gmail.com
Abstract
Wound healing is a natural process that enables tissue repair after an injury. In most cases, wounds can
occur resulting from an accident, an infection, a surgery, or a hidden etiological ailment. The aim of the
present study was to evaluate in vivo the wound healing property and in vitro antioxidant activities of C.
ovata Desf. var. palaestina zoh. methanol fruit extract. HPLC, phenolic and flavonoid compounds
analysis were performed. The wound healing effect was tested by excisional wound model. Wound
closure was measured for 14 days and at 14 th day, wound healing was assessed by levels of TGF-ί,
VEGF, COL1A1 and angiogenesis, granulation tissue thickness, epidermal and dermal regeneration. The
antioxidant activity was calculated by DPPH and ABTS free radical scavenging assays. The extract
indicated significant antioxidant activity while it also exhibited antimicrobial activity. HPLC study
revealed that rutin was found the extract. Moreover, the extract was found to have rich phenolic and
flavonoid contents. The total phenolic value, which was obtained from the fruit-methanol extract, found
to be 1017.4β±44.18 mgGAE/100g. Histological evaluation showed that extract group induced
significant (p<0.001) wound healing activity compared to control group. Furthermore, extract group
increased wound healing rates by promoting granulation tissue, epidermal regeneration, angiogenesis,
collagen, TGF-ί, and VEGF. The results showed that the extract indicated antioxidant activities and thus
could provide a valuable contribution to the wound healing.
Keywords: Wound healing, Capparis ovata var. palaestina, Antioxidant, Extract
1. INTRODUCTION
Wound is an inevitable part of the human life. The body is provided with a complicated self-healing mechanism
(Joshi et al., 2016). In scientific meaning, wound healing is achieved through four exactly and highly
programmed stages: hemostasis, inflammation, proliferation, and remodeling (Han and Ceilley, 2017). For a
wound to be healed successfully, all of these stages must occur in the appropriate sequence and time frame.
Nonetheless, many factors can affect one or more stages of the process that cause deficient or impaired wound
healing (Guo and Dipietro, 2017). It should be noted that a complex signaling system, including various growth
factors, chemokines, and cytokines, coordinate the wound healing process (Joshi et al., 2016). Many wounds and
ulcers types including diabetic foot ulcers, venous ulcers as well as pressure wounds present delayed healing and
sustained inflammation and impaired extracellular matrix function. Subsequently, such wounds are associated
with chronic healing process whereas are mainly colonized by bacteria, filamentous fungi and yeasts prolonging
more the healing process (Han and Ceilley, 2017). The Caper (Capparis) which is known kapari, keper, kebere,
and gevil in different regions of Turkey, is a perennial shrub and it grows as spontaneously throughout
Mediterranean basin (Ozcan M, 2005). In this study a newer approach to evaluate Capparis ovata desf. var.
palaestina and its wound healing, antioxidant activities are proposed.
ORAL PRESENTATION
216
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS AND METHODS
2.1 Plant material and extraction
C. ovata var. palaestina fruits were collected from Batman, Turkey. Voucher samples were deposited in
Herbarium of Ankara University Faculty of Pharmacy (No:AEF 26797, AEF 26798). For methanolic extract, the
fruits of C. ovata var. palaestina was extracted with methanol for 24 h.
2.2 Total phenolic and flavonoid contents of the extract
The amount of phenolic content was measured according to Folin-Ciocalteu technique. The absorbance of the
sample was determined at 765 nm (Spanos and Wrolstad, 1990).The amount of flavonoid content was
determined by the aluminum chloride colorimetric assay. The absorbance of each sample was determined at 510
nm (Chia-Chi Chang et al., 2002).
2.3 High-performance liquid chromatography (HPLC) analyses
Chromatographic separation of the compound was achieved using a Discovery HS C18 column maintaining at
β5°C. Elution was achieved at a flow rate of 0.4 mL/min in a gradient. The mobile phase consisted of 0.1%
formic acid solution and acetonitrile. Chromatograms were acquired at 280 nm.
2.4 In vitro antioxidant activity
The DPPH (2,2-diphenyl-1-picrylhydrazyl) free radical scavenging activity of the extract was detected by its
capacity of bleaching the stable radical DPPH (Blois M,1958). Absorbance was measured at 517 nm, and the
free radical scavenging activity was detected as the percentage of the radical reduction. The antioxidant activity
of the extract was also determined by ABTS [β,β’-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid)] radical
cation decolorization test (Re R et al., 1999). The results were expressed as IC 50.
2.5 Animals, Excisional wound model and experimental groups
Balb-c mice (25-28 g) were procured from Medipol University, MEDITAM, Istanbul, Turkey. The mice were
hosted in regular cages with food and water ad libitum, at room temperature (β0±β°C) with artificial light from
7.00 am to 7.00 pm. Before performing in vivo experiments, ethical clearance approval was obtained from the
Institutional Animals Ethical Committee (Approval No:38828770-604.01.01-E.20553).
A total of thirty-two mice were assigned randomly into four groups of eight animals each as follows;
Group 1: Untreated (UG) as the control group (with sterile saline).
Group 2: Blank gel (no drug content) (BG) as the vehicle group.
Group 3: C. ovata extract gel (EG) group.
Group 4μ Madecassol® (Bayer Consumer Care AG, Switzerland) (MG) as the topical standard group.
The animals were anesthetized by intraperitoneal injection of 80-100 mg/kg xylazine and 10 mg/kg ketamine,
after that the hair on the back of mice were shaved and the skin was washed with povidone-iodine solution. Two
full excisional skin wounds were formed 1 cm from the midline and 1 cm apart using a punch biopsy tool
(diameter; 5 mm). Wounds were treated according to the designated treatment group. All treatments were
topically administered to coat the surface of the wounds once daily for 14 days. Photographs were taken using a
Canon digital 160 camera with an internal scale of each wound at days 0, 2, 4, 6, 8, 10, 12 and 14 to measure
wound contraction. The pictures of the wounds were taken at a λ0° angle to the plane of the wound. Wound
surface areas were calculated using an image analyzer to assess changes in size during healing.
2.7 Histology and immunohistochemistry
On the 14th day post-wounding, the animals were sacrificed by decapitation and the skin of the back including
the wound area was removed. Full-thickness biopsy samples extended from the outside margin to the center of
the treated area. The tissue samples were fixed in neutral formalin at room temperature for 24 h. Thereafter, the
fixed tissue samples were dehydrated in ethanol, cleared in xylene and embedded in paraffin. 5 ηm thick sections
were mounted on glass slides, dewaxed, rehydrated with distilled water and stained with vascular endothelial
ORAL PRESENTATION
217
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
growth factor (VEGF) (Santa Cruz sc-7269), collagen type1 alpha1 (COL1A1) (Santa Cruz sc-293182),
transforming growth factor beta1 (TGF-ί1) (Santa Cruz sc-65378) and hematoxylin-eosin (HE) in accordance
with procedures for light microscopy. Wound healing for each group was evaluated using the scoring system
described by Galeano et al., 2006. Immunoreactivity of immunohistochemical stain was evaluated by the
semiquantitative method. The evaluation was carried out on 5 randomly selected areas for each experiment and
the averages were taken. Score 0: No painting, 1: Little painting, 2: Medium painting, 3: Heavy painting.
2.8 Statistical analysis
Statistical significance between groups was analyzed by one-way ANOVA followed by Dunnett’s post hoc test.
Values for p<0.05 were considered statistically significant. Wherever significance has been confirmed, it is
showed by p < 0.05, p < 0.01 and p < 0.001.
3. RESULTS AND DISCUSSION
The total phenolic (TP) value, which was obtained from the fruit-methanol extract, found to be 1017.4β±44.18
mgGAE/100g. In our results, total flavonoid (TF) content of the C. ovata var. palaestina extract was also
screened, exhibiting a TF value of β785±β1.β1 mgQE/100g from fruit extract. In general, the phenolic
compounds are recognized to have the capacity to decrease oxidative damage. This activity is thought to be by
way of their redox properties, which play a key role in decomposing peroxides, absorbing and neutralizing free
radicals, or quenching singlet and triplet oxygen (Sakat et al, 2010). Antioxidant activities of C. spinosa are
connected to the high level of phenolic compounds (Tlili et al, 2011). Further, phenolic compounds possess the
capability to ease wound healing at different phases of the healing either by stimulating proliferation,
angiogenesis and collagen synthesis (Joshi et al, 2016). It has been already stated, flavonoids are one of the most
common groups of plant phenolics which could be graded such as flavones, flavonols, flavanones, flavonols,
anthocyanins, and isoflavonoids (Eddouks et al, 2005).
Rutin is a phenolic compound which has antioxidant and anti-inflammatory activities (Sharma et al, 2010). It’s
previously reported that rutin was found in different parts of C. moonii and C. spinosa (Gull et al, 2015).
According to results of the quantitative analysis of rutin, fruit ethanol extract include 0.027% rutin amount. As a
result, its determined that Capparis ovata var. palaestina’s fruits are source of rutin.
Oxidative stress is characterized by the impaired balance between higher cellular levels of reactive oxygen
species and cellular antioxidant mechanisms (Nazıroğlu et al, β011) and the free radicals can induce chronic
illnesses, such as inflammation and neurodegenerative disorders (Gull et al, 2015). In previous studies, it was
demonstrated that wound healing activity was related to the antioxidant activity (Fikru et al, 2012). DPPH free
radical scavenging test value of the extract was 0.γ4γ±0.0γγ mg/ml (IC50) and has shown free radical scavenging
activity as compared to the reference (BHTν 0.018±0.001 mg/ml) (IC 50) (p<0.05). On the other side, ABTS free
radical scavenging test value of the extract was 0.106±0.001mg/ml (IC 50) and also has shown free radical
scavenging activity as compared to the reference (Troloxν 0.015±0.001 mg/ml) (p<0.05). Both tests were
indicated the strong resemblance that the extract shown antioxidant activity.
As it is shown in Figure 1, the surface area of the wound of each group was screened on the day 0, 2, 4, 6, 8, 10,
12, and 14. It was observed that MG and EG displayed wound scabs on early stages as compared to the UG and
BG. After dropping of the crust, a residual lesion remained on the wound. Furthermore, EG and MG were almost
fully healed on the day 14.
ORAL PRESENTATION
218
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 1. Macroscopic examples of wound healing with sterile saline, blank gel, extract gel and madecassol
after excision at 0, 2, 4, 6, 8, 10, 12 and 14 days.
The measurement of the wound closure rate is useful for evaluate the progress of wound healing (Zeng and Zhu,
2014). The wound closure rates in mice were shown in Figure 2. UG and BG indicated least rate of wound
healing and the wound area of EG and MG rapidly decreased. Further, compared to the UG treated mice, EG
(p<0.001 at 2, 4, 6, 8 days; p<0.01 at 10, 12, 14), MG (p<0.001 at 2, 4, 6, 8 days; p<0.05 at 10, 12 days; p<0.01
at 14 days) treated mice indicated significant reduction in the wound surface at all time points (Table 1). The
goal of the wound treatment is to either shorten the time required for healing or to reduce the undesired
consequences, hence scarring (Maver et al, 2015).
Figure 2: Healing percentage of scar tissue surface area in each group.
Table 1: Wound surface areas calculated using an image analyzer (%)
Day 14
βγ,γ4±1,
41,5β±γ,78 β6,81±1,7γ
08
βγ,71±1,
4β,47±γ,0γ γ0,8λ±β,1γ
Blank gel 10λ,5±γ,ββ
***
3
81,γ1±5,β6
5β,71±6,45 ββ,17±1,55 11,61±0,84
6,08±0,5
Extract
***
***
***
***
**
**
3**
gel
**
5γ,78±γ,7β β0,78±1,βγ 14,λ6±1,16 λ,λ4±0,75 5,7λ±0,γ
Madecass λβ,07±4,4β λγ,1±γ,75
***
*
***
***
*
*
9**
ol
Values are percentage of open wound surface. Statistically significant as compared to control; P<0.05 (*),
P<0.01 (**), P<0.001 (***).Values are presented as the mean±SEM.
Untreate
d
Day 2
11β,7β±4,6
5
Day 4
1γ6,γ7±6,γ
3
116,54±β,λ
8***
8β,14±6,08
Day 6
116,λλ±5,γ
9
86,0γ±6,01
Day 8
Day 10
Day 12
β4,1γ±1,8
5
β6,4λ±1,8
6
7,λ1±0,87
The proliferative phase starts after nearly 3 days from the early lesion. Proliferation is formed over different
stages including angiogenesis, epithelialization, granulation tissue formation, in order to repair barrier function,
protection against fluid loss and bacterial intrusion (Joshi et al, 2016). In this study, granulation tissue thickness,
ORAL PRESENTATION
219
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
angiogenesis, and epidermal-dermal regeneration were evaluated separately. Granulation tissue progress during
wound healing is one of the indicators to determine of wound treatment (Ayla et al, 2017). As seen in Fig. 3,
according to the results obtained from the tissue samples, it was determined that MG (p<0.001) and EG
(p<0.001) had a significant effect compared to control group and BG. In addition, it was observed that thicker
granulation tissue was formed in extract group as compared to MG after treatment (Fig. 5). Angiogenesis plays
an essential role in physiological and pathological processes such as wound healing, embryonic development,
tumor growth, and chronic inflammation (Park et al, 2017). Actually, angiogenesis has a dual function, which
provides the oxygen and essential nutrients to the lesion site and accelerating granulation tissue formation (Zeng
and Zhu, 2014). In this work, according to the results of histological evaluation, more blood vessel formation
was determined on EG (p<0.001) and MG (p<0.001) as compared to control group and BG. Also, extract group
provides new blood vessel formation as nearly as MG (Fig. 3-5). Epidermal regeneration is characterized by
well-structured epithelial layers with no evidence of crusting or intraepithelial inflammatory cells (Galeano et al,
2006). Our study also revealed that there were significantly higher percentages of dermal and epidermal
regeneration with the EG (p<0.001) and MG (p<0.001) compared to control group; otherwise, a difference was
also seen between the BG (p<0.05) and control group (Fig. 3-5). It was suggested that extract group accelerates
the regeneration of the epidermal layer in part by enhancing keratinocyte migration (Shen et al, 2016).
Figure 3: Microscopic examination of granulation tissue thickness, anjiogenesis and epidermal-dermal
regeneration on sterile saline (control-untreated), blank gel, extract gel and madecassol groups by histological
wound healing scores among. Statistically significant as compared to control; P<0.05 (*), P<0.01 (**), P<0.001
(***).
A chronic wound tends to show decreased levels of platelet-derived growth factor (PDGF), transforming growth
factor-ί (TGF-ί), fibroblast growth factor (FGF), epidermal growth factor (EGF), VEGF and while expressing
lower levels of tumor necrosis factor-a (TNF-a) and interleukins (IL) 1 and 6 (Han and Ceilley, 2017). Targeting
of TGF-ί has been shown to accelerate wound healing and reduce scarring (Sinno and Prakash, 2013).
Immunohistochemical staining for TGF-ί revealed that there was a significantly increased of the expression of
TGF-ί in EG (p<0.001) and MG (p<0.001) as compared to control group and BG (Fig. 4-5). Also, both two
effective groups showed nearly 3 fold increase in TGF-ί compared with the control group and BG. The strength
of the repaired wound tissue is a result of the remodeling of collagen and the formation of stable intra and intermolecular cross-linking to form fiber (Fikru et al, 2012). A statistically significant difference was seen in
collagen formation, in EG (p<0.001) and MG (p<0.001) compared to the control group and BG (Fig. 4-5). As
seen in Fig. 4, it was also monitored that EG and MG showed nearly two-fold collagen formation than the
control group and BG.
VEGF is one of the most important cytokines for stimulating angiogenesis, which is necessary for the formation
of granulation tissue. Up-regulation of VEGF expression can increase the number of newly formed capillaries
and accelerate the formation of granulation tissue, thereby enhancing angiogenesis and wound healing (Shen et
al, 2016). Immunohistochemistry demonstrated that EG (p<0.001) and MG (p<0.001) showed the significant
increase of VEGF as compared to the control group and BG in wound tissue. Otherwise, it was also detected that
both two treatment groups showed nearly two-fold increase of VEGF than the control group and BG (Fig. 4-5).
ORAL PRESENTATION
220
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 4: Comparison of immunohistochemistry wound healing scores among groups. Statistically
significant as compared to control; P<0.05 (*), P<0.01 (**), P<0.001 (***).
Figure 5. Histopathological view of injured tissues of the untreated (control), blank gel, extract gel and
madecassol groups on 14th day after wound incision (Hemotoxylen and eosin (H&E) (original
magnificationX10) and immunohistochemistry (TGF-ί (original magnificationX10), VGF (original
magnificationX20) and Collagen (COL1A1) (original magnificationX10))
4. CONCLUSION
The data obtained from this work revealed that methanol extract exhibited antioxidant activity. In addition,
methanol extract was involving high levels of phenolic substances and flavonoids as well as rutin compound.
Due to in vivo macroscopic wound healing assessment and evaluation of histological strain, extract group
demonstrated increased rates of granulation tissue, epidermal-dermal regeneration, and angiogenesis. It was also
found that the extract group showed a significant increase TGF-ί, VEGF and collagen formation, which are
important criteria for wound healing, compared to the control group. The results of our study depicted that
methanol extract of C. ovata var. palaestina fruit is a valuable candidate for further research as an alternative
therapy for the treatment of wounds.
REFERENCES
Ayla Ş et al. 2017. Effects of Prunus spinosa L . fruits on experimental wound healing. Medeni Med J,
32(3):152-158.
ORAL PRESENTATION
221
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Blois M 1958. Antioxidant Determinations by the Use of a Stable Free Radical. Nature, 181:1199-1200.
Chia-Chi Chang et al. 2002. Estimation of Total Flavonoid Content in Propolis by Two Complementary
Colorimetric Methods. J Food Drug Anal, 10(3):178-182.
Eddouks M et al. 2005. Hypolipidemic activity of aqueous extract of Capparis spinosa L. in normal and diabetic
rats. J Ethnopharmacol, 98(3):345-350.
Galeano M et al. 2006. Recombinant human erythropoietin improves angiogenesis and wound healing in
experimental burn wounds. Crit Care Med, 34(4):1139-1146.
Fikru A et al. 2012. Evaluation of in vivo wound healing activity of methanol extract of Achyranthes aspera L. J
Ethnopharmacol, 143(2):469-474.
Gull T et al. 2015. Capparis species: A potential source of bioactives and high-value components: A review. Ind
Crops Prod, 67:81-96.
Guo S, Dipietro LA 2010. Factors Affecting Wound Healing. J Dent Res, 89(3):219-229.
Han G, Ceilley R β017. Chronic Wound Healing μ A Review of Current Management and Treatments. Adv Ther,
34(3):599-610.
Joshi A et al. 2016. Systematic investigation of ethanolic extract from Leea macrophylla: Implications in wound
healing. J Ethnopharmacol, 191:95-106.
Maver T et al. 2015. A review of herbal medicines in wound healing. Int J Dermatol, 1-12.
Nazıroğlu M et al. 2011. Capparis ovata modulates ovariectomize induced-oxidative toxicity in brain, kidney
and liver of aged mice. Cell Membr Free Radic Res, 3(1):186-193.
Ozcan M 2005. Mineral Composition of Different Parts of Capparis ovata Desf. var. canescens (Coss.)
Heywood Growing Wild in Turkey. J. Med. Food, 8:405-407.
Park JY et al. 2017. Abietic acid isolated from pine resin (Resina Pini) enhances angiogenesis in HUVECs and
accelerates cutaneous wound healing in mice. J Ethnopharmacol, 203:279-287.
Re R et al. 1999. Antioxidant Activity Applying an Improved Abts Radical Cation Decolorization Assay. Free
Radic Biol Med, 26(9):1231-1237.
Sakat SS et al. 2010. In-vitro antioxidant and anti-inflammatory activity of methanol extract of Oxalis
corniculata linn. Int J Pharm Pharm Sci, 2(1):146-155.
Sharma B et al. 2010. Anti-diabetic potential of alkaloid rich fraction from Capparis decidua on diabetic mice. J
Ethnopharmacol, 127(2):457-462.
Shen HM et al. 2017. The N-butyl alcohol extract from Hibiscus rosa-sinensis L. flowers enhances healing
potential on rat excisional wounds. J Ethnopharmacol, 198:291-301.
Spanos GA, Wrolstad RE 1990. Influence of processing and storage on the phenolic composition of Thompson
Seedless grape juice. J Agric Food Chem, 38(7):1565-1571.
Tlili N et al. 2011. The caper (Capparis L.): Ethnopharmacology, phytochemical and pharmacological properties.
Fitoterapia, 82(2):93-101.
Zeng Z, Zhu B-H 2014. Arnebin-1 promotes the angiogenesis of human umbilical vein endothelial cells and
accelerates the wound healing process in diabetic rats. J Ethnopharmacol, 154(3): 653-662.
ORAL PRESENTATION
222
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Üçlü Nd-Fe-B Tipi Mıknatısların Çeşitli Yöntemlerde Üretim Aşamalarına
Oksidasyonun Etkisi
Sefa DURMUŞ1, Kübra ZENKİN2*, Mecit AKSU1, Aslıhan DALMAZ3
Düzce Üniversitesi, Fen-Edebiyat Fakültesi, Kimya Bölümü, Düzce, Türkiye.
Düzce Üniversitesi, Fen Bilimleri Enstitüsü, Kimya Anabilim Dalı, Düzce, Türkiye.
3
Düzce Üniversitesi, Fen Bilimleri Enstitüsü, Kompozit Materyal Teknolojileri Anabilim Dalı,
Düzce, Türkiye.
1
*2
Sorumlu yazar e-mail: kubrazenkin@gmail.com
Özet
Manyetik malzemeler alanında yapılan araştırmalar, sentez, karakterizasyon, teorik kavramlar ve mühendislik
uygulamalarının zengin bir kombinasyonudur. Özellikle Nd 2Fe14B sert manyetik malzemelerin üstün manyetik
özellikleri bulunduğundan, araştırmalar yeni sentez teknikleri ve optimum mikro yapı geliştirme konularına
odaklanmıştır. Nd-Fe-B kalıcı manyetik malzemeler, yüksek zorlayıcı ve enerji ürünlerinin ((BH) max)
mükemmel kombinasyonu sayesinde muazzam bir teknolojik uygulama yelpazesine sahiptir. 1980'lerin
başından beri rüzgar türbinleri, hibrit ve elektrikli araçlarda (HEV'ler ve EV'ler), elektrikli ev aletleri,
endüstriyel ve robotik motorlar, sabit disk sürücüleri ve birçok küçük tüketici elektronik cihazlarında yaygın
olarak kullanılmaktadır. Toz metalurjisi veya hızlı söndürme gibi Nd 2Fe14B mıknatıslarının üretimi için farklı
geleneksel yöntemler vardır. Bununla birlikte, bu yöntemler, başlangıç malzemeleri olarak yüksek saflıkta
metallerin kullanılması ihtiyacından dolayı pahalıdır. Püskürterek kurutma ve sol-jel usulü olarak bir
redüksiyon-difüzyon işlemini içeren bir başka yöntem, demir, neodmiyum ve borik asit tuz karışımlarının
kullanılmasıdır. Bu yöntem, toz metalurjisi veya hızlı söndürme işlemlerine kıyasla daha ucuzdur. Aynı
zamanda, Nd-Fe-B manyetik malzeme, parçacık boyutu, manyetik anizotropi ve faz saflığı gibi çeşitli
faktörlerden yüksek oranda etkilenir. Örneğinν Neodim ve amorf borun aşırı eklenmesi Nd-Fe-B
mıknatıslarının manyetik özelliklerini iyileştirir. Bu çalışmada, NdFeB tipi kalıcı mıknatıslar üretmek için
farklı yöntemler denenmiştir. Oksitlenmenin mıknatıs üretim süreci üzerindeki etkisi araştırılmış ve
reaksiyonun birkaç aşamada gerçekleştiği görülmüştür. Son olarak, atmosferik koşulların etkisi altında orta
kademeli olarak oluşan NdFeO3, hematit ve manyetit ürünleri XRD analizleri ve çeşitli spektral yöntemler ile
araştırılmıştır.
Anahtar Kelimeler: Neodmiyum, Manyetizma, Nd-Fe-B, Oksidasyon, Kalıcı mıknatıs
1. GİRİŞ
Mıknatıslar manyetik alan üreten materyallerdir. Mıknatısν demir, kobalt, nikel gibi ferromanyetik materyalleri
çekmektedir. Mıknatısların genel özellikleri ise kısaca şöyledirν mıknatıslar ferromanyetik objeleri çeker,
mıknatıs kutuplarındaki manyetik alan orta kısmındaki manyetik alandan daha büyüktür, mıknatıs kutupları
birbirlerini iterken zıt kutuplar birbirlerini çeker, mıknatıs serbestçe askıya alındığında güney kutbu ve kuzey
kutbu, sırasıyla dünyanın kuzey ve güney kutbuna doğru hareket etme özelliğine sahiptirler. Modern endüstri ve
bilgi teknolojilerindeki gelişmiş mıknatıslar için yüksek enerji gereksinimlerini karşılamak için sürekli
mıknatıslar geliştirmek için sürekli bir çaba olmuştur (Yu ve ark., 2013). Kalıcı manyetizmanın tarihi yüzyıllar
öncesine dayanmaktadır. Manyetizmanın ilk araştırmaları M.Ö. 6. yüzyıldaki Yunan filozof Thales’e kadar
uzanır. Buna rağmen manyetizmanın modern anlayışı 1600’lü yıllarda başlamıştır. Kalıcı manyetik maddelerin
gelişimi adım adım olmuştur ve her madde yenisi ile yer değiştirmeden önce geliştirilmiş ve yenilenmiştir. β0.
yüzyıl boyunca kalıcı manyetik maddelerin gelişimi Şekil 1’de görülmektedir. Bu şekilde, yatay eksen yılları
verirken düşey eksenler mıknatısların ürettiği maksimum enerjiyi göstermektedir (Başoğlu, β01γ).
ORAL PRESENTATION
223
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 1. β0.yüzyılda kalıcı mıknatısların gelişimi.
İlk olarak mıknatıs taşının demiri çektiğini Yunanlı bilim insanları tarafından keşfedilmiştir. Bunlar ayrıca
ihtiyaca göre farklı boyut ve şekillerde yapay yöntemlerle oluşturulabilmektedirler. Sık kullanılan mıknatıs,
çubuk mıknatıs olup demir nesneleri çeken uzun biçimli dikdörtgen çubuktur. Benzer şekilde pusula iğnesi bir
mili kuzey yönünde diğer mili de güney yönünde yatay olarak serbestçe hareket edebilen mıknatıstır. Mıknatıs
çevresindeki alan manyetik alanı algılar. Mıknatıs etkisi etrafındaki manyetik kuvvetten kaynaklanmaktadır. Bu
nedenle, bir alanda bir çubuk mıknatıs koyduğumuzda manyetik kuvvetler meydana gelir ve bu manyetik
kuvvetler mevcut manyetik alandan uzaklaştırıldıktan sonra da etkisini sürdürür. Akımın akışı tarafından
manyetik alan üretilir. Manyetik özelliklerine ve manyetizma gösterme etkilerine göre mıknatısların farklı
çeşitleri vardır. Mıknatıslarν etki sürelerine göre, genellikle geçici mıknatıslar ve kalıcı mıknatıslar olarak ikiye
ayrılır. Geçici mıknatıs uzun süre mıknatıslanmaya devam etmeyen mıknatıs türüdür. Manyetik alanın veya
manyetik gücün etkisinde olduklarında mıknatıs özelliklerini gösterirler. Geçici mıknatıslara örnek
elektromıknatıstır. Akım çekirdekten geçtiğinde mıknatıslanır, aksi takdirde mıknatıs olarak davranmazlar.
Kalıcı mıknatıslarν Mıknatıslandığında bir miktar manyetizmayı koruyan mıknatıs türleridir. Bu da isminin
neden kalıcı mıknatıs olduğunu açıklamaktadır. Bazı doğal kalıcı mıknatıslar, mıknatıs taşı ya da magnetit içeren
mıknatıslardır. Mıknatısların iki kutbu vardır, bunlar kuzey ve güney kutbudur. 100 cm uzunluğunda iki kutba
sahip bir mıknatıs 50 cm’lik iki yarıma bölündüğünde, her biri kuzey ve güney kutba sahip iki mıknatıs elde
edilecektir. 100 cm’lik mıknatıs dört parçaya bölünmüş olsa da iki kutba sahip olacaktır. Bunun anlamı, bir
mıknatıs doğada asla tek kutuplu var olmamaktadır. Kalıcı mıknatısların sınıflandırılması şu şekildedirμ
Alniko Mıknatıslar ( Al, Co ve Ni tabanlı alaşımlar )μ 1λγ0’larda keşfedilen Alniko ilk modern kalıcı mıknatıstır.
Bu mıknatısların özellikleri şekil anizotropisine dayanır. İki fazlı nano yapıya sahip olan bu mıknatısta manyetik
olmayan Al-Ni matrisi içine dağılmış manyetik Fe-Co iğneli yapı vardır. Yüksek Curie sıcaklığından dolayı
(з850 °C), bugün hala bazı uygulamalarda kullanılmaktadır (Permanent Magnet Catalog, β007).
Ferrit, mıknatıslar manyetiti (Fe3O4) ve asemitat (Fe2O3) gibi kimyasal bileşiklerden oluşan mıknatıslardır. Ferrit
mıknatıslar dünyadaki en doğal manyetik mineraldir. Ferrit mıknatıslar kimyasal bileşimde seramiktir ve
mıknatıstır. Ferrit mıknatısı ferromanyetik malzemeleri çeker ve diğer mıknatısları iter veya çeker (Özdinçer ve
ark., 2017).
Samaryum Kobalt (SmCo), kobalt, demir, nadir toprak elementlerinin alaşımı olan bu mıknatıs 1λ60’larda
keşfedilmiştir. Samaryum-kobalt, yüksek ortam sıcaklığında yüksek itme ve çekme kuvveti ile çalışmanın
gerekli olduğu uygulamalar için en uygun malzemedir. Manyetik malzemeden olan Samaryum-kobalt, özellikle
300 ℃ ve üzerindeki çalışma sıcaklığında mükemmel ısıl performansı gösterir. Fakat Samaryum ve Kobalt’ın
yüksek maliyetleri bu mıknatısı kullanılan en pahalı mıknatıs yapar (Permanent Magnet Catalog, β007).
ORAL PRESENTATION
224
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Neodmiyum Demir Bor (NdFeB ya da NIB)ν en yaygın kullanılan nadir toprak mıknatıs türü, Nd 2Fe14B
tetragonal kristal yapısını oluşturmak için neodmiyum, demir ve borun alaşımından yapılmış kalıcı bir
mıknatıstır (Fraden, β010). Neodmiyum mıknatısların gücü çeşitli faktörlerden kaynaklanmaktadır. Tetragonal
Nd2Fe14B kristal yapısı son derece yüksek tek eksenli manyetokristalin anizotropisine sahiptir (Boysen ve Muir,
2011). Bu, maddenin bir kristali belirli bir kristal ekseni boyunca tercihen mıknatıslanır, ancak diğer yönde
mıknatıslanması çok zor olduğu anlamına gelir. Neodmiyum atomu aynı zamanda büyük bir manyetik dipol
momentine sahip olabilir, çünkü demirdeki üç elektronunun aksine yapısında yedi eşleşmemiş elektrona sahiptir
(Chu, 2011).
2. MATERYAL VE METOD
2.1. Materyal
Neodmiyum(III) nitrat hekzahidrat (Nd(NO3)3.9H2O), demir(III) nitrat hekzahidrat (Fe(NO3)3.9H2O), borik asit
(H3BO3), sitrik asit (C6H8O7), mono etilen glikol (MEG), sodyum bor hidrür (NaBH4), demir(II) klorür
tetrahidrat (FeCl2.4H2O), sodyum hidroksit (NaOH), neodmiyum(III) klorür hekzahidrat (NdCl3.6H2O) ve Mg
tozu Merck'ten ticari olarak satın alındı ve tekrar saflaştırma işlemi uygulanmadan kullanıldı. İlave bir çözücü
olarak deiyonize su ve aseton (Merck) kullanıldı.
Elde edilen nihai ürünler, kristal faz kompozisyonunu belirlemek için X-ışını kırınım çalışmalarına [bir
Panalytical diffraktometre ve bir Cu Ka radyasyon kaynağı kullanılarak] tabi tutuldu. Bileşiklerin kızılötesi
spektrumları ise Perkin Elmer ATR spektrometresi kullanılarak kaydedildi.
2.2. Metod
2.2.1. Nd2Fe14B Sentezi
Yöntem A
Bu yöntemdeν Nd15Fe77.5B7,5 stokiyometrik oranı baz alınarak neodmiyum(III) nitrat hekzahidrat, demir nitrat
hekzahidrat ve borik asit deiyonize suda çözülerek sulu çözeltileri ayrı ayrı hazırlandı ve karıştırıldı. Daha sonra,
sitrik asit çözeltisi ve etilen glikol metal tuzlarına oranı βμβμ1 olacak şekilde hazırlandı. Bunu takiben termal
olarak kararlı solüsyon oluşturmak için hazırlanmış olan Nd-Fe-B sulu çözeltisine ilave edildi. Ardından
çözeltinin viskoz jel olması için λ0 ˚C ısıya maruz bırakıldı. Viskoz jel daha sonra β00 ˚C’de kurutuldu.
Kurutulan jel 400 ˚C de β saat kalsine edildi. Sonrasında ise 800 ˚C de tavlanması için yine β saat işlem gördü.
Oluşan ürün istenen Nd2Fe14B fazını elde etmek amacıyla redüksiyon-difüzyon işlemine tabi tutuldu. 800 ˚C’de
işlem görecek olan ürüne redüksiyon-difüzyon işlemi için 1μβ molar oranında elementel Mg tozu ilave edildi.
(Şekil β)
Şekil 2. Yöntem A’ya göre Nd2Fe14B sentezinin akış şeması.
ORAL PRESENTATION
225
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Yöntem B
İlk olarak Fe-B partiküllerini sentezlemek amacıyla, üç boyunlu β50 mL yuvarlak dipli balonun bir girişinden
yüksek saflıkta Ar gazı geçirildi. Diğer bir girişinden ise, meydana gelecek olan hidrojen gazının çıkışı sağlandı.
Ar atmosferi altında yaklaşık 0.0β mol NaBH 4, 150 mL saf suda çözüldü. Daha sonra hazırlanmış olan NaBH4
çözeltisinin üzerine, FeCl2.4H2O ( 50 mL saf suda 0.014 mol) çözeltisi ilave edildi. Ardından 30 dakika boyunca
manyetik karıştırıcıda karıştırıldı. Daha sonra aynı molar oranda ayrıca hazırlanan phμ10’a ayarlanmış NaBH 4
çözeltisi, 1 M NaOH çözeltisi ile muamele edildi. Ve bu çözelti karışımının üzerine 0.00β mol NdCl 3.6H2O ilave
edildi. Daha sonra başta hazırlanmış olan Fe-B çözeltisine ilave edilerek yarım saat manyetik karıştırıcıda
karıştırıldı. Oluşan ürün birçok kez saf su ve aseton ile yıkandıktan sonra santrifüjlendi, inert atmosferde
kurutuldu. (Şekil γ)
Şekil 3. Yöntem B’ye göre Nd2Fe14B sentezinin akış şeması.
3. SONUÇ
Çalışmadaν Neodmiyum(III) nitrat hekzahidrat, demir(III) nitrat hekzahidrat ve borik asit, Nd-Fe-B jeli
sentezlenmek amacıyla kullanıldı. Kalsine edilmiş numunenin fazları ve kristallenmesi, X-ışını toz kırınımı ile
tanımlandı. Şekil 4 ve 5’te gösterildiği gibi, sentezlenmiş olan magnetit, neodmiyum demir oksit, hematit,
neodmiyum oksitin X-ışını deseni tasvir edildi. XRD deseninde, magnetit, neodmiyum demir oksit, hematit,
neodmiyum oksit haricinde başka hiçbir karakteristik pik tespit edilmedi. Yöntem A sonucunda elde edilen
ürünün XRD analiz sonucu incelendiğindeν % 78 magnetit, % 15 neodmiyum demir oksit, % 6,β hematit
oluştuğu görüldü. Tek fazlı bir kristal yapı meydana gelmediği görüldü. Yöntem B sonucunda elde edilen ürünün
XRD analiz sonucu incelendiğinde iseν % λ1 magnetit, % λ neodmiyum oksit oluştuğu görüldü. Bu yöntemde de
aynı şekilde tek fazlı bir yapı meydana gelmediği görüldü. Demir oksitin iyonlaşma enerjisi düşük olduğundan
dolayı, reaksiyon sonucunda elde edilen ürün daha kararlı yapı olan magnetite dönüşmüştür. FT-IR spektrum
sonuçları incelendiğinde, yöntem A sonucunda elde edilen ürünün titreşim spektrumunda 450-500 cm-1
aralığında metal oksitlere ait titreşim piklerinin görülmesi, 160λ cm -1’de neodmiyum demir oksite ait titreşim
piklerinin görülmesi, yine Yöntem B sonucunda elde edilen ürünün titreşim spektrumunda aynı şekilde 450-500
cm-1 aralığında metal oksit titreşim piklerinin görülmesi, 1γγ0 cm -1’de neodmiyum oksite ait titreşim piklerinin
görülmesi de XRD analiz sonucuyla birbirini desteklemektedir. (Şekil 6 ve 7)
ORAL PRESENTATION
226
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 4. Yöntem A’ya göre elde edilen ürünün XRD deseni.
Şekil 5. Yöntem B’ye göre elde edilen ürünün XRD deseni.
ORAL PRESENTATION
227
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 6. Yöntem A’ya göre elde edilen ürünün FT-IR Spektrumu.
Şekil 7. Yöntem B’ye göre elde edilen ürünün FT-IR Spektrumu.
TEŞEKKÜR
Bu çalışma Düzce Üniversitesi Bilimsel Araştırma Fonu (BAP) tarafından desteklendi (Proje Noμ
2017.05.03.643).
KAYNAKLAR
Başoğlu M β01γ. Ni Ve Cu Katkılı Nd-Fe-B Mıknatıslarının Üretimi Ve Manyetik Özelliklerinin
İncelenmesi, Doktora Tezi, Karadeniz Teknik Üniversitesi.
Boysen E, Muir Nancy, C 2011. Nanotechnology For Dummies, 2nd Ed.
Chu S 2011. Critical Materials Strategy. United States Department of Energy.
Fraden J 2010. Handbook of Modern Sensors: Physics, Designs and Applications, USA.
Özdinçer M, Durmuş S, Dalmaz A 2017. Magnetic Spinel-Type CoFe2O4 Nanoparticles: Synthesis and
Investigation of Structural, Morphological Properties. Süleyman Demirel Üniversitesi Fen Bilimleri Enstitüsü
Dergisi, 21: 311-315.
Permanent Magnet of Materials 2007. Permanent Magnet Catalog, Dexter Magnetic Technologies.
Yu LQ, Zhang YP, Yang Z, He JD, Donga KT, Hou Y 2013. Chemical Synthesis of Nd2Fe14B/Fe3B
Nanocomposites. Journal Name, 00: 1-3.
ORAL PRESENTATION
228
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Determining the Optimum Insulation Material through Life Cycle Assessment
Figen Balo 1,1, Lutfu Sagbansua2
Firat University, 1 Industrial Engineering Department, Elazig, Turkey
2
Assoc. Prof. of Industrial Engineering, Elazig, Turkey
Corresponding author e-mail: figenbalo@gmail.com
Abstract
Utilization of proper insulation materials in construction industry contributes significantly in providing the
required environmental protection and reducing the annual energy demand. Various alternatives for insulation
materials exist in order to obtain high energy efficiency and low environmental effects through the design of
building insulation. This study aims to determine the best insulation material alternative for buildings
considering a set of factors listed throughout the literature and industry standards. These factors mainly indicate
the environmental effects and thermal conductivity characteristics of the materials evaluated. A selection method
that can take these factors into account during the selection process is required. A hierarchical decision-making
method is utilized in this research to determine the optimum insulation material with low thermal conductivity
and along with desired environmental characteristics like air pollution, waste water, and solid waste. A life cycle
assessment of insulation materials from an environmental point of view based on the multi-criteria decision
making method has been presented in this paper. The implementation of this method has allowed an objective
assessment of the building sustainability behavior and the required environmental protection while using four
groups of criteria. The applied method has shown more accurate estimates of the presented criteria groups with
experienced specialists, therefore the result is more objective in comparison to other currently used multi-criteria
methods.
Keywords: Hierarchical decision-making, Green insulation, Life cycle, Air pollution
1.
INTRODUCTION
The big part of main energy consumption and CO 2 emissions in architectonics industry originate from insulation
materials production and building design. Globally, one-third of bad emissions and over 40% of main energy
consumption are related with the architectonics industry and 60% of the mineral sources in the world are used
for the building sector [1, 2]. For this reason, the use of proper thermal insulation in buildings contributes in
providing the required environmental protect and reducing the annual energy cost [3]. Thus, building envelope
could play a significant role in accomplishing high energy efficiency in a building design project. The life cycle
evaluation of the building insulation materials is also necessary for the environmentally conscious design. In
terms of the environmental effect, implementation of this type of design must generally provide in-depth analysis
of the related environmental problems. The life cycle evaluation of the building insulation materials is necessary
for the green building assessment. Lately, the multi-criteria decision making methods have been quantitatively
used to successfully assess such controversial and complex phenomena. The AHP is a decision assistance tool
developed by Saaty [4]. It is one of the most powerful and popular methods for efficient decision making used in
advisable project design. With this multi-criteria decision making method, the criteria weights are generally
detected according to expert opinion.
1
Corresponding author. E-mail: figenbalo@gmail.com
Tel: +90 0424 2370000/5646; Fax: +90 424 2370000
ORAL PRESENTATION
229
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
In the related literature, it can be seen that there are many papers concerning environmental effects of the
building insulation materials. Huang et al. provided materials choice to achieve environment friendly design by
uncertainty analysis and multi-criteria decision making [5]. Čulákov et al. drafted nearly zero-energy building
with optimized materials. With this aim, he studied the multi-criteria decision making analysis of building
material choice to decrease environmental effects at all construction options of building external wall [6].
Sabapathy and Maithel evaluated the wall materials that use non-fired products as masonry units. The
environmental performance of these wall materials are compared with the multi-criteria decision making method
[7]. Tudora analyzed the environmental criteria of building materials from ecological point of view [8]. Parganaa
et al. compared the environmental life cycle evaluation of insulation materials in buildings [9]. Vilcekovaa et al.
compared the environmental and energy performance of materials used at the exterior walls of the building
design [10]. Carreras et al. identified the solutions that improves significantly the environment efficiency for the
optimum design with lower environmental effect in building projects. With this aim, environmental and
economic solutions are analyzed for the five sites thinking diverse insulation thicknesses in roof and walls [11].
Rosa et al. investigated the environmental effects and building insulation efficiency of novel insulation material
solutions for building design projects with low environmental impacts and low thermal conductivity [3]. Tingley
et al. researched by comparing the environmental effects of the diverse insulation selection of external walls
from the perspective of minimizing effect [12]. Milani et al. evaluated the life cycle for material choice of
composites by multi criteria decision making method [13]. In terms of energy savings, Ma et al. compared the
three different building insulation materials (rigid foam polyurethane board polystyrene board and rock wool
board) on life cycle evaluation. According to the manufacturing of insulation materials in unit mass, the life
cycles environmental effects of these insulation materials were investigated [14]. To assess the environmental
effects, Perez et al. determined the best environmental option among the building insulation materials for diverse
climatic conditions [15]. Tettey et al. determined building designs that fix importantly the environmental effect
at the increase in total cost. In addition, they investigated the effects on emissions and energy savings of the
diverse insulation materials [16]. Giudice et al. described a novel analysis of the materials choice in the life cycle
design procedure by environmental performance and integrating mechanical criteria. Their method utilized a
multi-objective analysis technique to show the application of the approach for material selection of a car brake
disk [17]. Biswas et al. evaluated the building insulation materials with regard to the environmental effects and
life-time energy. According to the author, the environmental effect criteria were evaluated by global warming
problem in terms of CO2 emissions and energy consumption [18]. The hazardous environmental effects of
insulation materials in fire were determined in terms of performance criteria by Hidalgo et al. [19]. Lolli and
Hestnes researched the effect of diverse emissions conversion elements at the selection of insulation materials
[20]. Giama analyzed environmental effect assessment along the material’s choice of thermal insulation [21].
Ginevicius et al. evaluated the most energy efficient building insulation material option by different multicriteria assessment methods (VS, GV, COPRAS, VIKOR, TOPSIS and SAW) [22].
In the present research, the life cycle evaluation is described quantitatively the depletion of diverse energies and
resources besides the bad emission in the life cycle of manufacturing and the environmental effect of the
manufacturing process is evaluated in a systematical nature. This study has applied the life cycle evaluation of
four most extensively available building insulation materials (polyurethane, EPS, glass wool and rock wool) by
AHP. The study aims to exemplify the fundamental information on the life cycle environmental responsibility of
building insulation materials in construction sector, considering the properties of the usage of such insulation
materials in diverse sites. Data on life cycle evaluation are obtained from institutions where these insulation
materials are manufactured. To build up a sequence of criteria defining the process of environment friendly
building insulation material, which can be used in selecting the most proper alternative, a questionnaire applied
to the experts from the insulation material products and services, as well as researchers and specialists from
reconstruction and construction enterprises is conducted.
ORAL PRESENTATION
230
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. ENVIRONMENTAL EFFECTS OF INSULATION MATERIAL: MULTI-CRITERIA
MAKING
DECISION
2.1. Main and Sub Criteria
Environment Friendly Insulation Material
Air Pollution
M
Waste Water
Solid Waste
acro
Global
Warm.
Water
Cons.
Energy
Cons.
Acidific
ation
Eutrop
hicatio
n
Photo
chemi
cal
CO2
NOx
CO
SOx
CxHy
AKM
BOD
Na+
Cl-
KOI
Industrial
Resi.
Mineral
Che.
Dust
4
4
Fig. 1. The Hierarchy of Criteria
The reason for using an AHP-based decision analysis approach in this study is that it allows decision makers to
analyze complex decision-making problems using a systematic approach that breaks down the main problem into
simpler and affordable sub-problems. In an AHP hierarchy for choosing an insulation material, the goal would
be to choose the best material in terms of the selected criteria. This study aims to contribute to the existing
literature by helping decision makers in selecting the best material based on various groups of criteria. A set of
macro criteria, air pollution, waste water, and solid waste related factors are the four groups of criteria that are
evaluated to be the factors reflecting the effects of materials on environment. These criteria can be subdivided
into several sub-criteria. In this study, the macro criterion is investigated under six sub-criteria. The air pollution
criterion is subdivided into six sub-criteria as well. The waste water criterion comprises of five factors. Finally,
the solid waste criterion is measured using four factors. Four alternative materials are compared using AHP
technique. The structure of the problem composed of these criteria is constructed as shown in Fig. 1.
As it is the case in all multi-criteria decision making methods, the relative weights of criteria need to be
determined initially. In AHP, this is accomplished by pairwise comparison of the elements, starting with the
main criteria. Fig.2 shows the resulting priorities of four main criteria. These are the resulting weights for the
criteria based on pairwise comparisons.
ORAL PRESENTATION
231
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
MAIN CRITERIA PRİORİTIES
8,9%
17,8%
43,0%
30,3%
Macro
Air pollution
Waste water
Solid Waste
Fig. 2. Main Criteria priorities
At this point, the comparison of macro criteria set has been made and the AHP method has derived the local
priorities for this group which includes global warming, water consumption, energy consumption, acidification,
eutrophication, and photochemical effects. These priorities reflect on how much a sub-criterion contributes to the
priority of its parent, thus we need to calculate the global priority of each sub-criterion. That will show us the
priority of each sub-criterion with respect to the overall goal. The global priorities throughout the hierarchy
should add up to one. The global priorities of each sub-criterion in this category are calculated by multiplying
their local priorities with the priority of parent criterion. The sub-criteria priorities are given in Fig. 3. Factors
related to the air pollution includes CO2, CO, CxHy, NOx, SOx, and dust. In waste water subgroup, there are
five sub-criteria (AKM, BOD, KOI, Na+, Cl-) available. These elements are compared as to how significant they
are with respect to the waste water. Solid waste factors considered are industrial, residential, mineral, and
chemical waste. Comparison of these elements with respect to solid waste leads to the associated weights.
2.2. Pairwise Comparison of the Alternatives with Respect to the Criteria
After determining the priorities of each criterion with respect to the overall goal of determining the most
environment friendly material and priorities of sub-criteria with respect to their associated main criteria, the
alternatives need to be compared two by two with respect to each sub-criterion. The properties of the selected
thermal insulation materials for 1m2K/W are presented in Table 1 [23-40]. Table 2 shows life cycle inventory
and environmental impacts across the life cycle, for 0.1 m 3 XPS [23-40].
ORAL PRESENTATION
232
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
MACRO
AIR POLLUTION
PRIORITIES
PRIORITIES
40%
Lo al…
Glo al…
30%
30%
20%
20%
10%
10%
0%
0%
1
40%
Local
Priority
40%
2
3
4
5
6
1
3
4
5
6
SOLID WASTE PRIORITIES
WASTE WATER
PRIORITIES
Lo al…
Glo al…
30%
2
80%
Lo al…
Glo al…
60%
20%
40%
10%
20%
0%
0%
1
1
2
3
4
2
3
4
5
Fig. 3. Sub-criteria priorities
Aır pollutıo su - rıterıa
Macro sub- rıterıa
M1
M2
M3
M4
M1
120,0%
100,0%
80,0%
60,0%
40,0%
20,0%
0,0%
M2
M3
M4
CO2
Waste water sub- rıterıa
M1
M2
M3
CO
CxHy
SOx
Local
Global
Local
NOx
Global
Local
Global
Global
Local
Local
Global
Local
Global
120,0%
100,0%
80,0%
60,0%
40,0%
20,0%
0,0%
Dust
Solıd waste su - rıterıa
M4
M1
120,0%
100,0%
80,0%
60,0%
40,0%
20,0%
0,0%
M2
M3
M4
AKM
BOD
Na+
Cl-
Industrial
Residential
Mineral
Global
Local
Global
Local
Global
Local
Global
Local
Global
Local
Global
Local
Local
KOI
Global
Global
Local
Global
Local
120,0%
100,0%
80,0%
60,0%
40,0%
20,0%
0,0%
Chemical
Fig. 4. Priorities of the alternatives for sub-criteria
The next step in applying the AHP technique is pairwise comparisons of the alternatives with respect to each
sub-criterion. Remainder of this section presents the priorities obtained under each sub-category using this
ORAL PRESENTATION
233
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
technique. Fig. 4 shows the resulting weights of the material alternatives for the groups of criteria based on
pairwise comparisons. The resulting weights by the principal eigenvector of the decision matrix are given in
Table 3.
Table 1. Life cycle of insulating material providing thermal insulation for 1m2K/W [23-40]
Poliüretan
EPS
Glass Wool
Global Warming
g CO2 Equivalent
Water Consumption
kg
Energy Consumption
MJ
Acidification
g SO2 Equivalent
3.200
4.380
2.200
Rock
Wool
1.449
297.7
-
47.3
16.6
93.6
71.9
27
3.9
27.9
24
8.4
12.3
Eutrophication
g PO4 Equivalent
2.94
2
1.3
1.2
Photochemical Ozone Formation
g C2H4 Equivalent
1.4
3
2.5
4.6
CO2
3.4
2.298
1.814
1.421
CO
5
6.2
7.62
105.35
CxHy
6.1
13.18
21
0.02
NOx
8.2
11.97
8.22
2.47
SOx
11
13.38
1.09
6.08
Toz(PM10)
4.3
2.31
0.29
1.19
AKM
23
-
0.583
0.02
BOD
4.7
0.146
-
-
KOİ
0.82
0.84
0.429
0.05
Na+ Compounds
280
-
-
0.01
Cl-
520
2.53
-
-
Industrial
Waste
Municipal Solid
Waste
Mineral
Waste
Chemical Waste
13
2.25
6.70
-
-13
5.92
-
53
79
30.91
-
-
-
6.42
62.2
1
Air Emissions
Waste Water
Solid Waste
Table 2. For 0.1 m3 XPS, Life Cycle Inventory and Environmental Impacts Across the Life Cycle [23-40]
Life Cycle Phases For XPS
Production
Build
Disposal
Recycle
Global Warming
g CO2 Equivalent
Water Consumption
kg
Energy Consumption
MJ
Acidification
g SO2 Equivalent
Eutrophication
g PO4 Equivalent
14.150
527
6.183
-3.591
39
0.00005
10
-2
323.7 -
7.4
5.2
61.9
46
3
0.002
-9
3
0.0005
0.0004
-0.0008
Photochemical Ozone Formation
g C2H4 Equivalent
Solid Waste
Dangerous
38
0.0003
0.0002
-0.0007
11
-
5
-
NonDangerous
7.149
18.7
1.769
-2.803
Radioactive
4
-
-
-2
ORAL PRESENTATION
234
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 3. The resulting weights are based on the principal eigenvector of the decision matrix
Consistency
Ratio (CR)
Macro
Criteria
Air
Pollution
Criteria
Waste
Water
Criteria
Solid
Waste
Criteria
Global
Warming
Water
Consumption
Energy
Consumption
Acidification
Eutrophication
Photochemical
CO2
CO
CxHy
NOx
6.6%
Principal
Eigen
Value
4.180
Eigenvector
Solution
(Iteration)
5
Elta
0.0%
4.000
1
0.0E+0
6.0%
4.164
5
5.9E-8
3.0%
4.9%
5.8%
4.6%
0.0%
6.6%
4.5%
4.081
4.133
4.158
4.126
4.000
4.180
4.123
4
5
5
5
1
5
4
2.3E-8
1.3E-8
4.7E-8
1.9E-8
0.0E+0
9.0E-8
7.7E-8
SOx
Dust
AKM
BOD
KOI
Na+
Cl-
5.6%
6.3%
0.0%
5.7%
4.9%
0.0%
0.0%
4.152
4.171
4.000
4.154
4.133
4.000
4.000
4
5
1
5
5
1
1
6.3E-8
8.3E-8
0.0E+0
2.0E-8
1.4E-8
0.0E+0
5.8E-34
Industrial
4.5%
4.123
4
8.4E-8
Residential
6.0%
4.165
5
8.1E-8
Mineral
Chemical
6.9%
0.0%
4.187
4.000
4
1
1.3E-8
3.9E-34
9.0E-8
3. CONCLUSIONS
Based on the calculations above, the relative priorities corresponding to the attractiveness of each material about
all factors of macro, air pollution, waste water and solid waste are presented in Fig 5. Fig. 5 indicates that M4 is
the material that contributes most to the overall goal in terms of macro properties, air pollution, and waste water
categories with total global priorities of 0.1984, 0.1292, and 0.0821, respectively.
GLOBAL PRIRITIES
MATERIAL 1
0,45
0,4
0,35
0,3
0,25
0,2
0,15
0,1
0,05
0
MATERIAL 2
MATERIAL 3
MATERIAL 4
Macro
Air Pollution
Waste water
Solid waste
Total
MATERIAL 1
0,0386
0,0603
0,0143
0,007
0,1198
MATERIAL 2
0,0293
0,0396
0,0364
0,052
0,1572
MATERIAL 3
0,1641
0,0738
0,0453
0,016
0,299
MATERIAL 4
0,1984
0,1292
0,0821
0,014
0,4242
Fig. 5. Global Priorities
Fig 5 indicates that M2 has the highest global priority in terms of solid waste considerations. M1 has the lowest
score in all categories but air pollution where it is ranked the third.
ORAL PRESENTATION
235
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
In overall, adding the global priorities in all categories, the obtained results indicate that the material M4 is the
alternative that contributes the most to the goal of choosing the best material that satisfies all the criteria
selected.
For insulation materials, the evaluation of environmental potential is needed for the environmentally conscious
design of sustainable buildings. The purpose of environment friendly insulation materials is to obtain harmless
growth in terms of environmental effects, social advances, utilize environment friendly resources financially,
guarantee favorable living conditions, and maintain ecological balance for the future and present posterity. The
aim of the present work is to choose the most proper environmental insulation material to reduce building
energy consumption and its associated negative effect on the environment.
A life cycle assessment of insulation materials from an environmental point of view based on the multi-criteria
decision making method has been presented in this paper. AHP method used here has utilized a hierarchy of
related factors for specialists who have evaluated them using four groups of criteria. For the specialists’
assessment, the outputs obtained from the manufacturers are used. The implementation of this method has
allowed an objective assessment of the building sustainability behavior and the required environmental
protection while using four groups of criteria. AHP method has shown more accurate estimates of the presented
criteria groups with experienced specialists, therefore the result is more objective in comparison to other
currently used multi-criteria methods.
REFERENCES
[1] United Nations Environment Programme, Buildings and Climate Change Status, Summary for DecisionMakers, United Nations Environment Programme, 2009, ISBN: 987-92-807-3064-7.
[2] I. Z. Bribian, A.V. Capilla, A.A. Uson, Life cycle assessment of building materials: Comparative analysis of
energy and environmental impacts and evaluation of the eco-efficiency improvement potential, Building and
environment, 2011, 46(5), 1133-1140.
[3] A.D. La Rosa, A. Recca, A. Gagliano, J. Summerscales, A. Latteri, G. Cozzo, G. Cicala, Environmental
impacts and thermal insulation performance of innovative composite solutions for building applications,
Construction and Building Materials, 2014, 55, 406-414.
[4] T.L. Saaty, Decision making with the analytic hierarchy process, International journal services sciences,
2008, 1(1), 83-98.
[5] H. Huang, L. Zhang, Z. Liu, J.W. Sutherland, Multi-criteria decision making and uncertainty analysis for
materials selection in environmentally conscious design, Int J Adv Manuf Technol, 2011, 52, 421-432.
[6] M. Čulákov, S. Vilčekov, J. Katunsk, E.K. Burdov, Multi-Criteria Analysis of Material Selection in order to
Reduce Environmental Impacts, Chemical Engineering Transactions, 2013, 35.
[7] A. Sabapathy, S. Maithel, A Multi-Criteria Decision Analysis based assessment of walling materials in India,
Building and Environment, 2013, 64, 107-117.
[8] A.C. Tudora, Assessments criteria of building materials from ecological point of view, Buletinul institutului
politehnic din iaşi, Publicat de Universitatea Tehnică, Gheorghe Asachi” din Iaşi Tomul LIV (LVIII), Fasc,
2011, 57(4), 129.
[9]N. Parganaa, M.D. Pinheiro, J.D. Silvestre, J. de Brito, Comparative environmental life cycle assessment of
thermal insulation materials of buildings, Energy and Buildings, 2014, 82, 466-481.
[10] S. Vilcekovaa, A. Sedlakovab, E.K. Burdovaa, J. Vojtus, Comparison of Environmental and Energy
Performance of Exterior Walls, Energy Procedia, 2015, 78, 231-236.
[11] J. Carreras, D. Boer, L.F. Cabeza, L. Jiménez, G. Guillén-Gosálbez, Eco-costs evaluation for the optimal
design of buildings with lower environmental impact, Energy and Buildings, 2016, 119, 189-199.
[12] D.D. Tingley, A. Hathway, B. Davison, An environmental impact compariso n of external wall insulation
types, Building and Environment, 2015, 85, 182-89.
[13] A.S. Milani, C. Eskicioglu, K. Robles, K. Bujun, H. Hosseini-Nasab, Multiple criteria decision making with
life cycle assessment for material selection of composites, EXPRESS Polymer Letters, 2011, 5(12), 1062-1074.
ORAL PRESENTATION
236
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
[14] L.P. Ma, Q. Jiang, P. Zhao, C.Z. Zhao, Comparative Study on Life Cycle Assessment for Typical Building
Thermal Insulation Materials in China, Materials Science Forum, 2014, 787, 176-183.
[15] J. Sierra-Perez, J. Boschmonart-Rives, X. Gabarrell, Environmental assessment of façade-building systems
and thermal insulation materials for different climatic conditions, Journal of Cleaner Production, 2016, 113, 102113.
[16] U.Y.A. Tettey, A. Dodoo, L. Gustavsson, Effects of different insulation materials on primary energy and
CO2 emission of a multi-storey residential building, Energy and Buildings, 2014, 82, 369–377.
[17] F. Giudice, G. La Rosa, A. Risitano, Materials selection in the life-cycle design process: A method to
integrate mechanical and environmental performances in optimal choice, Materials and Design, 2005, 26, 9-20.
[18] K. Biswasa, S.S. Shresthaa, M.S. Bhandarib, A.O. Desjarlais , Insulation materials for commercial buildings
in North America: An assessment of lifetime energy and environmental impacts, Energy and Buildings, 2016,
112, 256–269.
[19] J. P. Hidalgo, S. Welch, J.L. Torero, Performance criteria for the fire safe use of thermal insulation in
buildings, Construction and Building Materials, 2015, 100, 285-297.
[20] N. Lolli, A.G. Hestnes, The influence of different electricity-to-emissions conversion factors on the choice
of insulation materials, Energy and Buildings, 2014, 85, 362-373.
[21] E. Giama, A. M. Papadopoulos, Environmental performance evaluation of thermal insulation materials and
its impact on the building, Mechanical Engineer, MSc, 2000.
[22] R. Ginevicius, V. Podvezko, S. Raslanas, Evaluatıng the alternatıve solutıons of wall ınsulatıon by multı
crıterıa methods, Journal of cıvıl engıneerıng and management, 2008, 14(4), 217-226.
[23] M. Pfundstein, R. Gellert, M. Spitzner, A. Rudolphi, Insulating Materials: Principles, Materials,
Applications, 2008.
[24] Thermal insulation handbook, Incorporating the architectural glass industry, the thermal insulation
association of southern Africa, 2001.
[β5] E. Alkaya, M. Böğürcü, F. Ulutaş,Yaşam döngüsü analizi ve bina isi yalitim malzemeleri için uygulamalar,
Çevre Bilim & Teknoloji, β01β, 3(4), 261-274.
[26] European Extruded Polystyrene Insulation Board Association – EXIBA “Extruded Polystyrene (XPS) Foam
Insulation Environmental Product Declaration According to ISO 140β5” Environmental Construction Products
Organisation (ECO), 2010.
[27] A. C Schmidt, A comparative life cycle assessment of building insulation products made of stone wool,
paper wool and fl ax: Comparative assessment, The International Journal of Life Cycle Assessment 2004, 9(2),
122–129.
[β8] IVPU e.V. “Extruded Factory-made Polyurethane Insulation Products Environmental Product Declaration
According to ISO 140β5” Environmental Construction Products Organisation (ECO). Institut Bauen und
Umwelt e.V., 2010.
[29] http://www.eceinsaat.com/Upload/Files/tasyunu.pdf
[30] http://energy.gov/energysaver/types-insulation
[31] http://www.izobedel.com/isi_yalitimi_satandart_mevduat.html
[32] http://www.mmo.org.tr/resimler/dosya_ekler/cf3e258fbdf3eb7_ek.pdf
[33] http://www.fao.org/docrep/006/y5013e/y5013e08.htm
[34] http://www.homeadvisor.com/cost/insulation/
[35] https://en.wikipedia.org/wiki/Building_insulation_materials
[36] http://www.thermaxxjackets.com/5-most-common-thermal-insulation-materials/
[37] http://www.ode.com.tr/insulation-glossary/
[38] (http://www.aaamsa.co.za/images/technical%20publications/tiasa/handbook%20chapter1.pdf)
[39] http://www.designingbuildings.co.uk/wiki/Thermal_insulation_for_buildings
[40] https://www.gnyapi.com.tr/isi-yalitim-malzemeleri
ORAL PRESENTATION
237
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Sakarya Nehri Boyunca Sülfametaksazol, Trimetoprim ve Diklorafenak Mikrokirleticilerin
İncelenmesi ve Farklı Ultrafiltrayon Membranlar ile Arıtımı
Fatma Büşra Yaman Büyükbüberoğlu*, Mehmet Çakmakçı
Yıldız Teknik Üniversitesi, İnşaat Fakültesi, Çevre Mühendisliği Bölümü, İstanbul, Türkiye
*
Sorumlu yazar e-mail:fbyaman@gmail.com
Özet
Bu çalışmada Türkiye için önemli su kaynaklarından biri olan Sakarya Nehri boyunca 5 farklı noktadan
numune alınarak sülfametaksazol, trimetoprim ve diklorafenak mikrokirleticileri ve çözünmüş organik
karbon (ÇOK), ultraviolet absrobance at β54 nm dalga boyu (UVβ54), sertlik, iletkenlik gibi su kalite
parametreleri incelenmiş, mikrokirleticilerin giderilmesi ve su kalitesinin iyileştirilmesi amacıyla
mikrofiltrasyon (MF) ve ultrafiltrasyon (UF) membranları ile arıtım çalışmaları yapılmıştır. En iyi arıtma
verimi UP005 UF membran ile elde edilmiştir. Küçük por çaplı ultrafiltrasyon membranlar ileν TMP,
SMX ve DFN gibi sularda çok sıklıkla ve yüksek miktarlarda bulunabilen farmakolojik kirleticilerin
%66 ’ya kadar çıkabilen bir verimle arıtılabildiği görülmüştür.
Anahtar Kelimeler: sülfametaksazol, trimetoprim ve diklorafenak, ultrafiltrasyon membran
1. GİRİŞ
Son zamanlarda yapılan çalışmalarda tıbbi kaynaklı ilaçlar, pestisit gibi tarımsal alanda kullanılan ilaçlar ve
kişisel bakım ürünleri gibi genel olarak mikrokirletici adı verilen kimysalların içme suyu kaynağı olarak
kullanılan sucul ortamlarda sıklıkla görülmeye başlanmıştır.(Alexander ve ark.,β01β) Bu tip kirleticiler
“öncelikli kirleticiler” olarak adlandırılmakta ve ng/L-µg/L gibi düşük konsantrasyonları bile sucul ortamdaki
canlılar ve insan sağlığı açısından endişe verici olumsuz sonuçlara yol açmaktadır (Broséus ve ark.,β00λν Shen
ve Andrews, β011).Tıp ve veterinerlik kullanımı sonucu 5000‘den fazla ilaç doğaya karışmaktadır (Van
Doorslaer ve ark.,β014). Avrupa Birliği (AB)’nde şu an kullanımda olan, farklı terapötik sınıflara ait çok farklı
kimyasal özelliklerde, insani kullanım amaçlı yaklaşık 5000 farklı farmasötik madde bulunmaktadır (Wen ve
ark.,β014). Son yıllarda yapılan araştırmalar sonucunda farmasötik maddelerin yüzey ve yeraltı sularında geniş
bir dağılım gösterdiği görülmüştür Derco ve ark., β015ν Azzouz ve Ballesteros, 2013). Yüzeysel sularda, yeraltı
sularında ve içme sularında 150’den fazla farmasötik madde tespit edilmiştir (Cristale ve ark., β01γ).
Bu maddeler günlük kullanımdaki yüzlerce ilaç, deterjan, kişisel bakım, zirâi vb. ürünlerden kaynaklanmakta ve
genel olarak bunlar literatürde PPCPs ( pharmaceuticals and personal care products) olarak geçmektedir (Shen
ve Andrews, β011). Bu atıklar evsel,endüstriyel deşarjlar ile rögar, hastane, mezbaha, tarımsal alanlardan gelen
yağmur akışları ve yetersiz arıtma yapan atıksu arıtma tesislerinin deşarjları sonucu su kütlelerine
karışabilmektedirler. Şekil 1 (a) ’da kirleticlerin doğaya karışım döngüsü verilmiştir.
Su ortamında en büyük endişe ilaç grubunda bulunan antibiyotiklerden kaynaklanmaktadır (Johnson ve
ark.,β015). Antibiyotikler çok düşük konsantrasyonlarda bile alg çeşitliliğini azaltmakta ve bakteri direncini
artırarak sucul yaşamı olumsuz etkilemektedir (Zhang ve ark.,β016). Antibiyotikler yüksek dayanım güçleri
sebebiyle bozunmadan uzun süre alıcı ortamda kalabilmektedirler (Van Doorslaer ve ark.,β014)
Sülfametaksazol (SMX) ve Trimetoprim (TMP) ilaçları bronşit ve idrar yolu enfeksiyonlarının tedavisinde
genellikle beraber olarak kullanılmaktadır (Daneshvar ve ark.,β01β). Beraber kullanıldıklarında birbirinin
etkisini artırmaktadır. Bu ilaçlar veterinerlik alanında da kullanılmaktadır (Yang ve ark.,β014ν Peng ve
ark.,2016).
ORAL PRESENTATION
238
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
(a)
(b)
Şekil 1. Kirleticilerin doğaya karışım şekilleri
SMX tetrahydrafolik asit sentezleyen enzimleri inhibe eder, TMP ise tetrahydrafolik asiti yok etmek için farklı
bir enzim salgılar. Bu sebeple bu iki ilaç 1λ60‘dan beri beraber kullanılmaktadır (Dias ve ark.,β014ν Johnson ve
ark.,β015ν Peng ve ark.,β016). TMP ve SMP konvansiyonel atıksu arıtma tesislerinde tamamen arıtılamamakta,
yüzeysel sulara kadar ulaşmaktadır (Yang ve ark.,β015ν Zheng ve ark.,β015) Su ortamında SMX’lerin sucul
ortamlarda yaygın olarak görülmesi potansiyel ekotoksik etkisi ve bakterilere karşı yüksek dirence sahip
olmalarından dolayı büyük endişe oluşturmaktadır (Dias ve ark.,β014). Barnes ve ark.(β008) yaptığı çalışmada
yüzeysel sularda SMX’in 1,11 mg/L’ye kadar çıktığını belirtmişlerdir. Loos ve ark.(β00λ) alıcı ortamda SMX’in
maksimum 4 mg/L olduğunu görmüşlerdir TMP’nin atıksu arıtma tesisi çıkışında 0,00γ to 4,γ0 µg/L
konsantrasyon aralığında olduğu ve bu konsantrasyonun yüzeysel sulara deşarj edildiği belirtilmiştir.
Diklorafenak (DCF) reçete olmadan satılan en yaygın nonsteroid antiinflamatuvar ilaçlardan biridir, Avrupa‘da
yılda yaklaşık 100 ton satılmaktadır(Esteban ve ark., β016ν Lu ve ark.,β016). DCF suda yaşayan canlılar ve
bitkiler üzerinde toksik etkiye sahiptir aynı zamanda insanlarda da hemodinamik değişiklikler ve tiroid
tümörlerine neden olduğu belirtilmiştir. DCF’nin tüketildikten sonra %15‘i değişmeden doğaya karışmaktadır.
DCF biyolojik olarak birikme eğilimi göstermektedir ve başka ilaçlar ile birleşerek toksik etkisi önemli derecede
artmaktadır (Bhadra ve ark.,β016). Atıksu arıtma tesislerinde konvansiyonel arıtımla DCF tam olarak
arıtılamadığı için alıcı su ortamlarında da en sık saptanan kirleticilerden biridir (Perisic ve ark.,β016). Félix–
Cañedo ve ark. (β01γ) yaptıkları çalışmada yüzeysel sularda DCF konsantrayonunun β8-γβ ng/L olduğunu
belirtmişlerdir. Bazı çalışmalarda da yüzeysel sularda 1-γ10 ng/L gibi geniş bir konsantrasyon aralığında
bulunduğu belirtilmiştir .( Chong, ve ark.,β017ν Félix–Cañedo ve ark.,β01γ)
Mikrokirleticilerin yüzeysel ve yeraltı sularından arıtımı her geçen gün daha çok önem kazanmaktadır.
Amerika’da ve Avrupa ülkelerinde yapılan çeşitli araştırmalarda yüzeysel ve yeraltı sularında ve hatta arıtma
tesisi çıkış sularında, γ00’ün üzerinde mikrokirleticiye rastlandığı bildirilmiştir. Özellikle tıbbi ilaçlar insan
metabolizmasından dışkı ve idrarla ilaç kalıntıları olarak veya ana madde olarak atılmakta ve sucul sistemlere
çeşitli yollarla ulaşmaktadırlar (Şekil 1(b)). Bütün bu sebeplerden dolayı her geçen gün mikrokirletici arıtımı
önem kazanmaktadır. Son zamanlarda yapılan çalışmalarν koagülasyon/flokülasyon, filltrasyon, klorlama gibi
sistemleri içeren klasik (konvansiyonel) içme suyu arıtma tesislerinin mikrokirletici gideriminde etkisiz olduğu
belirtilmiş ve ileri arıtım yöntemlerinin uygulanması gerektiği vurgulamıştır (Broséus ve ark.,β00λνFélix–
Cañedo ve ark.,β01γ).
2. MATERYAL VE METOD
2.1 Numune Alma Noktaları
Çalışmada Sakarya Nehri boyunca 5 farklı noktadan numune alınmıştır. Ilk nokta Sakarya nehrinin doğduğu
nokta olan Çiftelerdir. İkinci ve üçüncü noktalar sırasıyla Gökçekaya ve Yenice barajlarıdır. Dördüncü nokta
ORAL PRESENTATION
239
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
olarak yerleşmenin ve sanayinin yoğun olduğu bir bölge olan Geyve seçilmiştir. Son numune alma noktası ise
Sakarya Nehrinin Karadeniz’e döküldüğü nokta olan Karasu bölgesidir. Böylelikle nehir boyunca doğduğu
noktadan denize döküldüğü noktaya kadar hem yüksek kirlilik içermesi (Geyve gibi) hem de yüksek kalitede
olması beklenen noktalardan (Gökçekaya ve Yenice barajları gibi) numune alınarak su kalitesi izlenmiş
olacaktır. Numune alma noktaları Şekil β’de görülmektedir.
Şekil 2 Numune alma noktalarının haritadaki konumu
2.2 Deneysel Yöntem
Ham su analizi Tablo 1 ‘de ve yöntemleri ile verilmiştir.
Tablo 1.Karakterizasyon için ölçülen parametreler
2.3 Membran Deney Düzeneği
Ham suların süzülmesi amacıyla Şekil γ‘de gösterilen Amicon 8400 membran düzeneği kullanılmıştır.
Karıştırmalı süzme düzeneğinde bulunan membran hücresinin hacmi 400 ml ve çapı ise 76 mm’dir. Sistem
işletilirken magnet manyetik karıştırıcı ile döndürülmekte ve membran yüzeyinde dik filtrasyon sebebiyle
ORAL PRESENTATION
240
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
oluşabilecek birikim engellenmektedir. Böylece sistem çapraz akışlı düzeneğe benzer şekilde işletilmiştir.
Membran hücresinde istenilen basınç değeri azot gazı ile oluşturulmaktadır.
Şekil 3 Membran deney düzeneği
3. SONUÇ
Sakarya Nehrinden numune ilkbahar mevsiminde (Mart β015’de) alınmıştır. Tablo γ’de su karakterizasyonu
verilmiştir. Numunelerin ortalama pH, sıcaklık ve iletkenlik değerleri sırasıyla 7,76, λ,04 0C, λ01 µS/cm olarak
ölçülmüştür. pH ve sıcaklık parametreleri açısından sular 5 noktada da Yüzeysel Su Kalitesi Yönetimi
Yönetmeliği (YSKYY)’ne 1. Sınıf su özelliği gösterirken, İçme suyu Elde Edilen veya Elde Edilmesi Planlanan
e Yüzeysel Suların Kalitesine Dair Yönetmelik](İSEEPSHY)’e göre de A1 sınıfına girmektedir. İletkenlik
değerlerine göre Geyve γ. Sınıf Çifteler, Gökçekaya, Yenice ve Karasu ise β. sınıf su özelliği taşımaktadır.
Tablo 3. Sakarya Nehrine ait su karakterizasyonu
Deney Adı
pH
Sıcaklık (0C)
İletkenlik (ηS/cm)
Çözünmüş oksijen
(mg O2/L)
Çifteler Gökçekaya Yenice Geyve Karasu TS266 EPA
7,83
7,86
7,88
7,98
7,28 9,5-6.5 6.6-8.5
14,4
15,2
12,28 16,3
14,5
795
858
845
1012
988
2500
7,2
6,9
7,54
7,93
7,2
AKM (mg/L)
Bulanıklık(NTU)
20
10,22
26
11,63
28
15
32
20,12
24
18,00
Nitrat (mg NO3/L)
0,32
0,86
0,81
0,99
0,78
Florür (mg F/L)
Bromür (mg /L)
Demir (mg Fe/L)
Mangan (mg Mn/L)
Bakır (mg Cu/L)
Çinko (mg Zn/L)
Nikel (mg Ni/L)
0,61
0,08
< 0,25
< 0,2
< 0,25
0,129
<0,5
0,62
0,17
< 0,25
< 0,2
< 0,25
<0,1
<0,5
<0,1
<2
<1
<0,1
<2
<1
Kadmiyum (mg Cd/L)
Toplam krom (mg Cr/L)
Kurşun (mg Pb/L)
ORAL PRESENTATION
0,19
0,11
0,17
0,18
< 0,25 < 0,25
< 0,2 < 0,2
< 0,25 < 0,25
<0,1
<0,1
<0,5
<0,5
<0,1
<2
<1
<0,1
<2
<1
-
-
0,5
45
1,50
0,17
0,07
< 0,25
< 0,2
< 0,25
<0,1
<0,5
0,002
2
1
0,2
0,05
2
5
0,002
<0,1
<2
<1
0,005
0,005
0,01
0,005
0,05
0,015
0,2
0,05
-
241
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Deney Adı
Çifteler Gökçekaya Yenice Geyve Karasu TS266 EPA
Sülfat (mg SO4/L)
187
189
Klorür (mg CI/L)
21,99
UV254 (cm -1)
0,026
TOK (mg/L)
140
97
128
250
250
87,47
84,9
0,104
0,198
57,48
40
250
250
0,185
0,137
-
-
9,72
10,12
11,6
13,62
12,4
-
-
SUVA254
0,27
0,87
1,71
1,27
1,1
-
-
Alkalinite(mg CaCO3/L)
Sertlik (mg CaCO3/L)
Sülfametaksazol (ng/L)
Trimetoprim (ng/L)
Diklorafenak (ng/L)
330
464
0
0
13,26
260
400
17,6
2,1
0,4
255
386
31,2
1,5
1,2
250
348
15,2
0
0,2
265
328
13,2
0
0,4
-
-
Organik madde giderimi için numunelerin UV254 ve ÇOK giderim verimleri kıyaslanmıştır. Şekil 4.’de UV 254,
ÇOK, giderim verimleri verilmiştir. En yüksek UV 254 giderimi UP005 membranı ile %46 ile Geyve’de elde
edilirken en düşük UV254 giderimi ise %1γ ile Çifteler ve Gökçekaya’da MV0β0 membranı ile elde edilmiştir.
ÇOK giderim verimleri ise en düşük MV0β0 membran ile %10 Çifteler’de, en yüksek giderim verim ise UP005
membran ile %61 Geyve’de görülmüştür. UP0β0 membranında görülen en düşük ve en yüksek ÇOK giderim
verimi ise sırasıyla %15 Çifteler ve %βλ Gökçekaya’da görülmüştür. Sutherland ve ark.(β015) tarafından
yapılan çalışmalarda <10 kDa UF membranlar ile γ7-87% arasında ÇOK giderimi sağlanmıştır. Bu çalışmada da
membranların gözenek boyutu veya moleküler ağırlığı azaldıkça organik madde giderme verimi artmıştır.
Şekil 5 ‘de Mikrokirleticilerin membran ile giderim verimi verilmiştir. MV0β0 membran ile her üç kirletici için
giderim veriminin %1 ile β arasında olduğu ve mikrofiltrasyon membran ile mikrokirleticilerin gideriminin yok
denecek kadar az olduğu görülmüştür. En yüksek giderim %66 ile Karasu ve Çifteler ‘de UP005 membran ile
SMX ‘de görülürken onu %6γ ve %61 ile Geyve ve Gökçekaya takip etmiştir. UP005 membran ile TMP ‘nin
arıtım verimi %5λ ile %46 DFN ‘nin ise %55 ile %44 arasında bulunmuştur. UP0β0 membran ile ise giderim
%β1 ve %1β arasında değişim göstermiştir. Küçük por çaplı ultrafiltrasyon membranlar ile TMP, SMX ve DFN
gibi sularda çok sıklıkla ve yüksek miktarlarda bulunabilen farmakolojik kirleticilerin %66 ’ya kadar çıkabilen
bir verimle arıtılabildiği görülmüştür.
Şekil 4. Organik maddelerin membran ile giderim verimi
ORAL PRESENTATION
242
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 5. Mikrokirleticilerin membran ile giderim verimi
3. TARTIŞMA
Türkiye‘nin dördüncü büyük su kaynağı olan Sakarya Nehri boyunca nehrin doğduğu ve denize döküldüğü
noktaya kadar 5 farklı noktadan dört farklı mevsimde numune alınarak karakterizasyon ve SMX, TMP, ve DFN
giderimi çalışılmıştır. Su Kalitesi Kontrol yönetmeliği su kalitesi sınıflarına göre Sakarya Nehri pH açısından 1.
Sınıf iletkenlik açısından Geyve’de γ. Sınıf diğer noktalarda ise β. su özelliği göstermektedir. Su
karakterizasyonlarına göre Sakarya Nehiri’nin en temiz noktası nehrin doğduğu nokta olan Çifteler ve en kirli
nokta ise sanayilerin ve yerleşimin yoğun olarak bulunduğu Geyve’dir. Bu çalışmada ilk defa Sakarya Nehri’nde
mikrokirleticiler nehir boyunca incelenmiştir. Hem en yüksek organik madde hem de en yüksek mikrokirletici
giderimin UP005 membran ile olduğu görülmüştür.
Sakarya Nehri içme suyu kaynağı olarak kullanılması durumunda ilk tercih edilecek noktanın Çifteler olması
gerekmektedir. Diğer noktalar veya yakın civarlarından su alınacak ise ızgaralar, biriktirme yapısı,
konvansiyonel arıtma ve sonrasında ise membran ile arıtım tercih edilmelidir. Geyve ve Karasu noktasında
nehrin kirlendiği göz önüne alınırsa bu noktalardaki yerleşim yerlerinin ve kontrolsüz deşarj yapabilecek
noktaların denetlenmesi ve gerekli önemlerin alınması gerekmektedir.
TEŞEKKÜR
Bu Çalışma YTÜ Bilimsel Araştırma Projeleri Koordinatörlüğü (BAPK) tarafından desteklenmiş olup (β015-0502-DOP0γ), koordinatörlük çalışanlarına da proje faaliyetleriyle ilgili yardımlarından dolayı teşekkür ederim.
Deneysel çalışmalar aşamasında desteklerini esirgemeyen Ebubekir YÜKSEL’e teşekkürlerimi sunarım.
KAYNAKLAR
Alexander JT. Hai F I, Al-Aboud TM 2012. Chemical coagulation-based processes for trace organic
contaminant removal: current state and future potential, J Environ Manage, 111: 195-207.
ORAL PRESENTATION
243
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
An Y, Wang Z, Wu Z, Yang D, Zhou Q 2009. Characterization of membrane foulants in an anaerobic nonwoven fabric membrane bioreactor for municipal wastewater treatment, Chemical Engineering Journal,
155: 709-715.
Azzouz A ve Ballesteros E 2013. Influence of seasonal climate differences on the pharmaceutical, hormone and
personal care product removal efficiency of a drinking water treatment plant, Chemosphere, 93: 20462054.
Barnes KK, Kolpin, DW, Furlong ET, Zaugg SD, Meyer MT, Barber LB 2008. A national reconnaissance of
pharmaceuticals and other organic wastewater contaminants in the United States--I) groundwater", Sci
Total Environ, 402: 192-200.
Bhadra BN, Seo PW, Jhung SH, 2016 Adsorption of diclofenac sodium from water using oxidized activated
carbon, Chemical Engineering Journal, 301: 27-34.
Broséus R. Vincent S, Aboulfadl K, Daneshvar A, Sauvé S, Barbeau B, Prévost M β00λ. Ozone oxidation of
pharmaceuticals, endocrine disruptors and pesticides during drinking water treatment, Water Res, 43:
4707-4717.
Chong S, Zhang G, Wei Z, Zhang N, Huang T, Liu Y 2017. Sonocatalytic degradation of diclofenac with
FeCeOx particles in water", Ultrasonics Sonochemistry, 34: 418-425.
Cristale J, Katsoyiannis A, Sweetman AJ, Jones KC, Lacorte S 2013. Occurrence and risk assessment of
organophosphorus and brominated flame retardants in the River Aire (UK), Environ Pollut, 179: 194200.
Daneshvar A, Aboulfadl K, Viglino L, Broseus R, Sauve S, Madoux-Humery AS., Weyhenmeyer GA, Prevost
M. 2012 Evaluating pharmaceuticals and caffeine as indicators of fecal contamination in drinking water
sources of the Greater Montreal region, Chemosphere, 88: 131-139.
Derco J, Dudáš J, Valičková M, Šimovičová K, Kecskés J β015. Removal of micropollutants by ozone based
processes, Chemical Engineering and Processing: Process Intensification, 94: 78-84.
Dias, IN, Souza BS, Pereira JHOS, Moreira FC, Dezotti M, Boaventura RAR, Vilar VJP 2014. Enhancement of
the photo-Fenton reaction at near neutral pH through the use of ferrioxalate complexes: A case study on
trimethoprim and sulfamethoxazole antibiotics removal from aqueous solutions, Chemical Engineering
Journal, 247: 302-313.
Drinking Water Contaminants – Standards and Regulations: EPA 2003
Esteban S, Moreno-Merino L, Matellanes R, Catalá M, Gorga M, Petrovic M, López de Alda M, Barceló D Silva
A, Durán J, López-Martínez J, Valcárcel Y, β016 Presence of endocrine disruptors in freshwater in the
northern Antarctic Peninsula region, Environ Res, 147: 179-192.
Félix–Cañedo TE, Durán–Álvarez JC, Jiménez–Cisneros B 2013 The occurrence and distribution of a group of
organic micropollutants in Mexico City's water sources, Science of The Total Environment, 454-455:
109-118.
Fu G,Peng J, Wang Y, Zhao S, Fang W, Hu K, Shen J, Yao J 2016. Pharmacokinetics and pharmacodynamics
of sulfamethoxazole and trimethoprim in swimming crabs (Portunus trituberculatus) and in vitro
antibacterial activity against Vibrio: PK/PD of SMZ-TMP in crabs and antibacterial activity against
Vibrio, Environmental Toxicology and Pharmacology, 46: 45-54.
İçmesuyu Elde Edilen veya Elde Edilmesi Planlanan Yüzeysel Suların Kalitesine Dair Yönetmelik Orman ve
Su İşleri Bakanlığı, (βλ Haziran β01β).
Johnson AC, Keller V, Dumont E, Sumpter JP. 2015. Assessing the concentrations and risks of toxicity from the
antibiotics ciprofloxacin, sulfamethoxazole, trimethoprim and erythromycin in European rivers Sci Total
Environ, 511: 747-755.
Kim HC ve Yu MJ, 2007. "Characterization of aquatic humic substances to DBPs formation in advanced
treatment processes for conventionally treated water, J Hazard Mater, 143: 486-493.
Loos R, Gawlik BM, Locoro G, Rimaviciute E, Contini S, Bidoglio G 2009 EU-wide survey of polar organic
persistent pollutants in European river waters, Environ Pollut, 157: 561-568
ORAL PRESENTATION
244
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Lu X, Shao Y, Gao N, Chen J, Zhang Y, Wang Q,mLu Y 2016 Adsorption and removal of clofibric acid and
diclofenac from water with MIEX resin", Chemosphere, 161: 400-411.
Perisic DJ. Gilja V, Stankov MN. Katancic Z, Kusic H, Stangar UL, Dionysiou DD, Bozic AL 2016 Removal of
diclofenac from water by zeolite-assisted advanced oxidation processes, Journal of Photochemistry and
Photobiology A: Chemistry, 321: 238-247.
Petrie B., Barden R, Kasprzyk-Hordern B 2015 A review on emerging contaminants in wastewaters and the
environment: Current knowledge, understudied areas and recommendations for future monitoring, Water
Res, 72: 3-27.
Rivera-Utrilla J, Daiem MM, Sanchez-Polo M, Ocampo-Perez R, Lopez-Penalver, JJ, Velo-Gala I, Mota AJ
2016 Removal of compounds used as plasticizers and herbicides from water by means of gamma
irradiation, Sci Total Environ, 569-570: 518-526.
Shen R ve Andrews SA 2011. Demonstration of 20 pharmaceuticals and personal care products (PPCPs) as
nitrosamine precursors during chloramine disinfection, Water Res, 45: 944-952.
Su T, Deng H, Benskin JP, Radke M, 2016 Biodegradation of sulfamethoxazole photo-transformation products
in a water/sediment test, Chemosphere, 148: 518-525.
Sutherland S, Parsons SA, Daneshkhah A, Jarvis P, Judd SJ 2015 THM precursor rejection by UF membranes
treating Scottish surface waters. Separation and Purification Technology, 149: 381-388.
TSβ66 Standartları - İnsanь Tüketim Amaçlı Sular. β005
Van Doorslaer X, Dewulf J, Van Langenhove H, Demeestere K 2014. Fluoroquinolone antibiotics: An
emerging class of environmental micropollutants, Science of The Total Environment, 500-501: 250-269.
Van Doorslaer X. Dewulf J, Van Langenhove H, Demeestere K, 2014 Fluoroquinolone antibiotics: An emerging
class of environmental micropollutants, Science of The Total Environment, 500-501: 250-269.
Wang Z, Wu Z, Yin X, Tian L, 2008. Membrane fouling in a submerged membrane bioreactor (MBR) under
sub-critical flux operation: Membrane foulant and gel layer characterization, Journal of Membrane
Science, 325: 238-244.
Wang Z. Chen Z, Chang J, Shen J. Kang J, Chen Q 2015 Fabrication of a low-cost cementitious catalytic
membrane for p-chloronitro benzene degradation using a hybrid ozonation-membrane filtration system",
Chemical Engineering Journal, 262: 904-912
Wen ZH, Chen L. Meng XZ, Duan YP, Zhang ZS, Zeng EY, 2014 Occurrence and human health risk of
wastewater-derived pharmaceuticals in a drinking water source for Shanghai, East China, Sci Total
Environ, 490: 987-993.
Yang GC, Yen CH, Wang CL, 2014. Monitoring and removal of residual phthalate esters and pharmaceuticals in
the drinking water of Kaohsiung City, Taiwan, J Hazard Mater, 277: 53-61.
Yang L, Kim D, Uzun H. Karanfil T, Hur J.2015 Assessing trihalomethanes (THMs) and Nnitrosodimethylamine (NDMA) formation potentials in drinking water treatment plants using
fluorescence spectroscopy and parallel factor analysis, Chemosphere, 121: 84-91.
Yüzeysel Su Kalitesi Yönetimi Yönetmeliği, Ankaraμ Orman ve Su İşleri Bakanlığı, (γ0 Kasım β01β).
Zhang Y, Wang A, Tian X, Wen Z, Li D, Li J. 2016 Efficient mineralization of the antibiotic trimethoprim by
solar assisted photoelectro-Fenton process driven by a photovoltaic cell, J Hazard Mater, 318: 319-328.
Zheng D, Andrews RC, Andrews SA, Taylor-Edmonds L, 2015 Effects of coagulation on the removal of natural
organic matter, genotoxicity, and precursors to halogenated furanones, Water Res, 70: 118-129.
ORAL PRESENTATION
245
POSTER PRESENTATIONS
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Polypropylene/synthetic hydroxyapatite polymer composites: physical friction and wear
behaviors
Elif ULUTAS1
Munir TASDEMIR2
1
2
Marmara University, Ins. for Graduate Studies in Pure and Appl. Sci., Istanbul 34722, Turkey
Marmara University, Technology Faculty, Metallurgy and Materials Eng. Dep., Istanbul 34722, Turkey
elifulutas24@gmail.com
Abstract
In this investigation, composites of polypropylene, synthetic hydroxyapatite and maleic anhydride powder
were prepared. The effects of synthetic hydroxyapatite and maleic anhydride powder ratio on the physical,
friction and wear properties of the polymer composites are presented. Synthetic hydroxyapatite powder (30
wt %) was added to PP to produce composites. Maleic anhydride powder, in four different concentrations (1,
5, 10 and 15 wt %), were added to PP to produce composites as well. The physical properties, including the
vicat softening point, heat deflection temperature, melt flow index and water absorption of the composites
were investigated. On the other hand, the friction properties, including the static friction, and the wear
properties of the composites were investigated as well. The structure of the composites were investigated by
scanning electron microscopy and compared to friction and wear properties as a function of maleic anhydride
powder content.
Keywords: Mechanical properties, synthetic hydroxyapatite, polypropylene, bio composites
1. INTRODUCTION
Hydroxyapatite (HA) reinforced polymer bio composites were first conceived by W. Bonfield and colleagues
[1–6] as a bone analog biomaterial enabling mechanical properties to be tailored to mimic those of bone
tissue. Polyolefin cannot interact by themselves effectively with living tissues. Hence, hydroxyapatite (HA),
a material highly compatible with those of bones and bioactive, has been incorporated into polyethylene and
polypropylene to obtain bone implants or substitutes. In fact, hydroxyapatite is one of the major components
of human bones [7]. These composites comprise a polymeric ductile matrix and a stiffer ceramic dispersed
phase. However, some incompatibility problems arise when hydroxyapatite is mixed with non-polar
polymers. Thus, to obtain an effective compatibility between the hydroxyapatite and the polyolefin, a third
component has to be incorporated into the composite. This compatibilizer must contribute to promote the
interaction among the phases. Albano et al. have incorporated coupling agents [8,9], functionalized
polyolefin [10] and copolymers of ethylene-acrylic acid [11] into composites of high-density polyethylene
and HA. Recent progress in nanotechnology has allowed the synthesis of nanomaterials with excellent
physical and mechanical properties [12] as well as biocompatibility [13,14]. For example, synthetic
nanoscale HA strongly promotes the adhesion and proliferation of osteoblasts [15–17]. Liao et all [18]
prepared polypropylene (PP) composites with 5–20 wt% HA nanorods (HANRs). The results showed that
the addition of 20 wt% HANRs (6.67 vol%) to PP improves its mechanical performance and
biocompatibility. PP exhibits excellent chemical resistance, durability, dimensional stability, and flexibility.
PP exhibits higher fatigue resistance than HDPE, and thus can replace ductile HDPE for biomedical implants
experiencing frequent cyclic stress. The wear resistance of polymer composites is significantly decreased and
increased depending upon the type of particles, particles size and size distribution, interfacial actions
between polymer matrix and fillers, as well as wear test conditions, i.e., wear mode, sliding distance, applied
load, test temperature, and humidity [19]. In recent years, thermoplastic resin/mineral filler composites have
been widely used in molded products due to effective cost reduction. Much effort has been devoted to
improving the properties of polymers by the addition of inorganic fillers, such as Talc, SiO 2, ZnO, CaCO3,
and carbon fibers [20-25]. In this investigation, composites of polypropylene, synthetic hydroxyapatite and
maleic anhydride powder were prepared. The effects of synthetic hydroxyapatite and maleic anhydride
powder ratio on the physical, friction and wear properties of the polymer composites are presented.
Synthetic hydroxyapatite powder (30 wt %) was added to PP to produce composites. Maleic anhydride
powder, in four different concentrations (1, 5, 10 and 15 wt %), were added to PP to produce composites as
well.
POSTER PRESENTATION
247
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS and METHODS
2.1 Compositions and Materials
Six different polymer composites were prepared. Compositions of polypropylene/hydroxyapatite/maleic
anhydride grafted polypropylene (PP/HA/MA) polymer composites that were formed are given in Table 1.
PP (Moplen EP 3307) supplied by Lyondell Basell. Its density is 0.900 g/cm 3, MFI value is 15 g/10 min (230
o
C, 2,16 Kg) and its head deflection temperature (0.45 MPa, unannealed) is 95.0 oC. Synthetic hydroxyapatite
(acros 371260010) supplied by Acros Organics.
Table 1. Composition of the PP/HA/MA polymer composites formulations
Groups
Polypropylene (wt %)
Hydroxyapatite (wt %)
1
2
3
4
5
6
100
70
70
70
70
70
30
30
30
30
30
Maleic anhydride (wt
%)
1
5
10
15
2.2 Sample Preparation
Polypropylene, synthetic hydroxyapatite and maleic anhydride were dried overnight at 105 oC for 24 h in a
vacuum oven prior to melt blending. Mechanical premixing of solid compositions was done using a LB-5601
liquid-solids blender (The Patterson-Kelley Co., Inc.USA) brand batch blender for 15 min. Samples with
various proportions of PP/HA/MA polymer composites were produced between 180-220 oC at 15 bar
pressure, and a rotation rate of 25 rpm, with a Microsan extruder (Microsan Instrument Inc. Turkey).
Polymer composites were also dried in vacuum oven at 105 oC for 24 hours after extrusion. Subsequently,
test samples were manufactured by injection molding. Injection temperature was 180-220 oC, pressure was
90-110 bar and screw speed was 25 rpm.
2.3 Test Procedure
Flow behavior testing of all the mixtures was done according to ISO 1133 standard with Zwick 4100 MFI
equipment. Heat deflection temperature (HDT) and Vicat softening point tests were done according to ISO
75 and ISO 307 standard with determined by CEAST 6521 (Ceast SpA, Italy) HDT-Vicat test equipment.
Water absorption (WA) test was carried out according to ISO 62. Three specimens for each type of
composite were used in the WA test. The conditioned specimens were entirely immersed for 1 day in a
container of water at βγ± β oC. At the end of immersion time, the specimens were taken out from the water
and all surface water was removed with a clean dry cloth. The specimens were immediately weighed to the
nearest 0.01 g. The wear tests were done according to the DIN 53 516 method with Devotrans DA5
(Devotrans quality control test equipment Istanbul-Turkey) abrasion test equipment. The thickness of the test
specimens was 7.0 mm and diameter was 15.5 mm. Cylinder rotational speed was selected as 40 rpm and
normal load (FN) of 10N was used. Total sliding distance (L) was 40 m. The mass loss of the samples (Δm)
was measured after the wear process, and the specific wear rates (Ws) were calculated using the following
equation:
Ws=(Δm) / ρ.FN.L (mm3/Nm)
(1)
Where Δm is the specimen’s mass loss, ρ is the density of specimen, F N is the normal load applied, and L is
the total sliding distance.
Static coefficient of friction: The force increases linearly to a maximum which represents the static frictional
force FS. Measurements made at a high friction drag permit the dynamic coefficient of friction to be
calculated, but not the static coefficient of friction. The static coefficient of friction µs is given by the
equation,
POSTER PRESENTATION
248
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
µs=FS/FP
(2)
Where FS is the static frictional force, expressed in Newton, FP is the normal force exerted by the mass of the
sled, expressed in Newton (=1.96 N) [26]. The friction coefficients and wear rates reported in the present
study were the averages of at three measurements.
The fractured surfaces of the PP/HA/MA polymer composites were coated to thickness of β0 Å of a gold
(Au) to prevent electrical charging by Polaron SC7640 (high resolution sputter coater) (United Kingdom).
The surfaces of the prepared samples were observed by the FEI Sirion XL30 FEG (Nederland) scanning
electron microscopy (SEM) at an acceleration voltage of 10 and 20 kV.
3. RESULT and DISCUSSION
3.1 Physical properties of the PP/HA/MA polymer composites
The effects of hydroxyapatite and maleic anhydride content on the physical properties of the PP/HA/MA
polymer composites are given in Figure 1. The relationship between the heat deflection temperature and the
percentage of the maleic anhydride of PP composites is shown in the Figure 1-A. With inclusion of maleic
anhydride particles in the polymer matrix the heat deflection temperature of the composite is found to be
decreasing. For example, the heat deflection temperatures of the five different samples (with 0, 1, 5, 10 and
15 wt% of maleic anhydride) are measured as 68.33, 65.07, 63.0, 62.3 and 61.33 oC respectively. The heat
deflection temperature of pure PP is 65.47 oC. In comparison with the heat deflection temperature of virgin
PP, the heat deflection temperature decreased by 6% for the composites with a 15 wt % maleic anhydride
concentration. The relationship between the Vicat softening point and the percentage of the maleic
anhydride of PP composites is shown in the Figure 1-B. With inclusion of maleic anhydride particles in the
polymer matrix the Vicat softening point of the composite is found to be decreasing. For example, the Vicat
softening point of the five different samples (with 0, 1, 5, 10 and 15 wt% of maleic anhydride) are measured
as 145.95, 140.15, 139.2, 138.1 and 136.05 oC respectively. The vicat softening point of pure PP is 144.85
o
C. In comparison with the vicat softening point of virgin PP, the vicat softening point decreased by 6% for
the composites with a 15 wt % maleic anhydride concentration.
Group 1 PP (100)
Group 2 PP/HA (70/30)
Group 3 PP/HA/MA (70/30/1)
Group 4 PP/HA/MA (70/30/5)
Group 5 PP/HA/MA (70/30/10)
74
68,33
69
65,47
64
63
62,3
155
150
61,33
65,07
Group 1 PP (100)
Group 2 PP/HA (70/30)
Group 3 PP/HA/MA (70/30/1)
Group 4 PP/HA/MA (70/30/5)
Group 5 PP/HA/MA (70/30/10)
160
Vicat Softening Point (oC)
(1Kg)
HDT (°C) (1.8 MPa)
79
145,95
144,85
145
140,15
140
59
138,10
136,05
135
54
130
0
5
10
Maleic Anhydride (wt%)
15
0
5
10
Maleic Anhydride (wt%)
A
0,160
15,68
0,120
Water Absorption (%)
15
12,70
12,34
9,51
4,60
Group 1 PP (100)
Group 2 PP/HA (70/30)
Group 3 PP/HA/MA (70/30/1)
Group 4 PP/HA/MA (70/30/5)
Group 5 PP/HA/MA (70/30/10)
0,0766
0,0757
0,0603
0,0364
0,040
5,51
3
0,1001
0,080
11
7
15
B
Group 1 PP (100)
Group 2 PP/HA (70/30)
Group 3 PP/HA/MA (70/30/1)
Group 4 PP/HA/MA (70/30/5)
Group 5 PP/HA/MA (70/30/10)
19
MFI (g/10 min) (280°C/10 kg)
139,20
0,0319
0,000
0
5
10
Maleic Anhydride (wt%)
C
15
0
5
10
Maleic Anhydride (wt%)
15
D
Figure 1. Physical properties of PP/HA/MA polymer composites
POSTER PRESENTATION
249
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The relationship between the melt flow index and the percentage of the maleic anhydride of PP composites is
shown in the Figure 1-C. With inclusion of maleic anhydride particles in the polymer matrix the melt flow
index of the composite is found to be increasing. For example, the melt flow index of the five different
samples (with 0, 1, 5, 10 and 15 wt% of maleic anhydride) is measured as 4.6, 5.51, 9.51, 12.7 and 15.68
g/10min respectively. The the melt flow index of pure PP is 12.34 g/10min. The melt flow index increased
by 240% for the composites with 15 wt % maleic anhydride when comparison with PP/HA (70/30)
concentration. The relationship between the water absorption and the percentage of the maleic anhydride of
PP composites is shown in the Figure 1-D. With inclusion of maleic anhydride particles in the polymer
matrix the water absorption of the composite is found to be decreasing. For example, the water absorption of
the five different samples (with 0, 1, 5, 10 and 15 wt% of maleic anhydride) is measured as 0.1001, 0.0766,
0.0757, 0.0603 and 0.0364 % respectively. The the water absorption of pure PP is 0.0319 %. The water
absorption decreased by 64% for the composites with 15 wt % maleic anhydride when comparison with
PP/HA (70/30) concentration.
3.2 Wear and friction properties of the PP/HA/MA polymer composites
Obviously, the tribological processes involved in this investigation are complex. The effects of maleic
anhydride content on the tribological behaviors of PP composites were examined. The wear loss for various
specimens sliding distance against the sand paper (#60) under 10N load and 0,32 m/s abrasion speed. The
values of wear rate is shown in Figure 2-A. The wear rate of PP/HA/MA composites decreases as the maleic
anhydride concentration increases from 0 to 15 wt %, which could be attributed to the adhesion between the
fillers and polymer matrix. Static friction performance is shown in Figure 2-B when speed was 100mm/min;
load separately was 1.96, 2.94, 3.92, 4.90 and 6.86 N respectively. It is seen that the load had a great effect
on the static friction coefficient of the composite. As the load increases, the static friction coefficient of all
kinds of composites increases. Figure 2-B shows that static coefficient of friction of PP/HA/MA (70/30/15,
load: 1.96 N) is much lower than that of pure PP. Same situation was seen PP/HA/MA (70/30/15, load: 6.86
N) composites at 100mm/min.
0,08
0,0661
0,0602
0,0624
0,06
0,0545
0,0532
Static Friction
Wear Rate (cm3/Nm 10-3)
1,2
Group 1 PP (100)
Group 2 PP/HA (70/30)
Group 3 PP/HA/MA (70/30/1)
Group 4 PP/HA/MA (70/30/5)
Group 5 PP/HA/MA (70/30/10)
Group 6 PP/HA/MA (70/30/15)
0,10
0,8
Group 1 PP (100)
Group 2 PP/HA (70/30)
Group 3 PP/HA/MA (70/30/1)
Group 4 PP/HA/MA (70/30/5)
Group 5 PP/HA/MA (70/30/10)
Group 6 PP/HA/MA (70/30/15)
0,4
0,04
0,0319
0
0,02
0
5
10
Maleic Anhydride (wt%)
15
1,96
2,94
3,92
4,9
Applied Load (N)
A
6,86
B
Figure 2. Wear and friction properties of the PP/HA/MA polymer composites
3.3 Morphological properties of the PP/HA/MA polymer composites
The SEM study was carried out to study the dispersion of hydroxyapatite in the PP matrix. The boundaries
and the contrast can be obviously seen between the hydroxyapatite and PP matrix on the fractured surfaces of
polymer matrix (Figure 3). The micrographs indicate that the all particulates are homogeneously dispersed
on the fractured surfaces of polymer matrix.
POSTER PRESENTATION
250
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Pure PP
PP/HA (70/30)
PP/HA/MA (70/30/5)
PP/HA/MA (70/30/10)
PP/HA/MA (70/30/1)
PP/HA/MA (70/30/15)
Figure 3. SEM photograph of PP/HA/MA polymer composites
4. CONCLUSIONS
The effects of hydroxyapatite and maleic anhydride on the some properties, vicat softening point, heat
deflection temperature, melt flow index, water absorption, static friction, wear properties and morphological
of PP/HA/MA composites were investigated. It has marginal effects on some properties of the composites.
The following results were obtained:
1. Heat deflection temperature, vicat softening point and water absorption values of PP/HA/MA
composites decreased as the maleic anhydride concentration increases. On the other hand, MFI
values increased as the maleic anhydride concentration increases.
2. The wear rate of PP/HA/MA composites decreases as the maleic anhydride concentration increases
from 0 to 15 wt %.
3. The addition of maleic anhydride to the PP changed significantly the friction coefficient of the
composites. Applied load had a great effect on the friction coefficient of composites
4. The micrographs indicate that the HA particulates are homogeneously dispersed on the fractured
surfaces of PP matrix.
ACKNOWLEDGEMENT
This work has been supported by the Scientific Research Project Program of Marmara University
REFERENCES
[1] W. Bonfield et al., 1981. “Hydroxyapatite Reinforced Polyethylene-A Mechanically Compatible Implant
Material for Bone Replacement,” Biomaterials, β, pp. 185–186.
[2] W. Bonfield, 1988. “Composites for Bone Replacement,” J. Biomed. Eng., 10 (6), pp. 522–526.
[3] M. Wang, D. Porter, and W. Bonfield, 1994. “Processing, Characterisation, and Evaluation of
Hydroxyapatite Reinforced Polyethylene Composites,” Brit. Ceram. Trans., λγ (γ), pp. 91–95.
[4] M. Wang, R. Joseph, and W. Bonfield, 1998. “Hydroxyapatite Polyethylene Composites for Bone
Substitution: Effects of Ceramic Particle Size and Morphology,” Biomaterials, 1λ (β4), pp. 2357–2366.
[5] P.T.T. That, K.E. Tanner, and W. Bonfield, 2000. “Fatigue Characterization of a HydroxyapatiteReinforced Polyethylene Composite. I. Uniaxial Fatigue,” J. Biomed. Mater. Res., 51 (3), pp. 453–460.
[6] L.D. Silvio, M.J. Dalby, and W. Bonfield, 2002. “Osteoblast Behaviour on HAP/PE Composite Surfaces
with Different HA Volumes,” Biomaterials, βγ, pp. 101–107.
POSTER PRESENTATION
251
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
[7] R. Perera, C. Albano, R. Casella, L. Cataño, A. Karam, G. González, 1λλλ. SPE/ANTEC Proceedings.
[8] C. Albano, R. Perera, G. González, A. Karam, N. Domínguez, Y. Sánchez, J. Puerta, 2006. Mol. Cryst.
Liq. Cryst., 448, 251.
[λ] C. Albano, R. Perera, A. Karam, G. González, N. Domínguez, Y. Sánchez, J. Brito, 2007. Macrom.
Symp., 247, 190.
[10] C. Albano, R. Perera, L. Cataño, S. Alvarez, A. Karam, G. González, Y. Sánchez, β008. Proc. of 4th
International Symposium on Nanostructured and Functional Polymer-Based Materials and Nanocomposites
(NANOFUN POLY), Rome, Italy.
[11] C. Albano, L. Cataño, L. Figuera, R. Perera, A. Karam, G. González, K. Noris, 2009. Polym. Bull., 62,
45.
[12] Tjong SC, Chen H., 2004. Nanocrystalline materials and coatings. Mater Sci Eng R Rep., 45(1–2):1–88.
[13] Yang L, Zhang LJ, Webster TJ, 2011. Nanobiomaterials: state of the art and future trends. Adv Eng
Mater, 13(6):B197–B217.
[14] Zhang LJ, Webster TJ., 2009. Nanotechnology and nanomaterials: promises for improved tissue
regeneration. Nano Today, 4(1):66–80
[15] Ergun C, Liu HN, Halloran JW, Webster TJ. 2007. Increased osteoblast adhesion on nanograined
hydroxyapatite and tricalcium phosphate containing calcium titanate. J Biomed Mater Res A., 80(4): 990–
997.
[16] Li K, Tjong SC, 2011 Hydrothermal synthesis and bio-mineralization of hydroxyapatite nanorods. J
Nanosci Nanotechnol,11: 10444–10448.
[17] Zhou H, Lee J., 2011. Nanoscale hydroxyapatite particles for bone tissue engineering. Acta Biomater.
7(7):2769–2781.
[18] Liao CZ, Li K, Wong HM, Tong WY, Yeung KW, Tjong SC, 2013 Novel polypropylene biocomposites
reinforced with carbon nanotubes and hydroxyapatite nanorods for bone replacements. Mater Sci Eng C
Mater Biol Appl., 33(3):1380–1388
[19] P. Podsiadlo, A. K. Kaushik, E. M.Arruda,A.M.Waas,B.S.Shim, J. Xu, H. Nandivada, B. G. Pumplin, J.
Lahann, A. Ramamoorthy, and N. A. Kotov, 2007. Science, 80, 318.
[20] Srivastava, S.; Tiwari, R. K., 2012. Int. J. Pol. Mater., 61, 999.
[21] Sun SS, Li CZ, Zhang L, Du HL, Burnell-Gray JS, 2006. Eur Polym J, 42, 1643.
[22] Lin HB, Cao MS, Zhao QL, Shi XL, Wang DW, Wang FC, 2008. Scripta Mater, 59, 780.
[23] Zheng J, Ozisika R, Siegel RW, 2005. Polymer, 46, 10873.
[24] Zuiderduin W.C, Westzaan JC, Huetink J, Gaymans RJ, 2003. Polymer, 44, 261.
[β5] Taşdemir, M., Yerleşen, U., 2015. Study on the friciton and wear behaviors of modified HDPE/glass
spheres composites, Romanian journal of materials. 1, 45, 59-66.
[26]ISO 8295:1995(E) test standard: Plastics-Film and sheeting-Determination of the coefficients of friction
POSTER PRESENTATION
252
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Flor Toksikasyonu Oluşturan Broylerlerde Rasyona Epigallokateşin-3-Gallat İlavesinin Bazı Kan
parametreleri ve Karaciğer Histopatolojisi Üzerine Etkisi
İlkay Aydoğan1*, Ebru Yıldırım2*, Miyase Çınar3*, Tugçe Sümer4*
*1
Kırıkkale Üniversitesi, Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları, Kırıkkale, Türkiye
*2
Kırıkkale Üniversitesi, Veteriner Fakültesi, Farmakoloji ve Toksikoloji, Kırıkkale, Türkiye
*3
Kırıkkale Üniversitesi, Veteriner Fakültesi, Biyokimya, Kırıkkale, Türkiye
*4
Kırıkkale Üniversitesi, Veteriner Fakültesi, Patoloji, Kırıkkale, Türkiye
Sorumlu yazar e-mail:ilkayaydogan@kku.edu.tr
Özet
Bu çalışmaν Flor toksikasyonu oluşturulmuş broylerlerde epigallokateşin-3-gallat (EPG) kullanımının
kan parametreleri ve karaciğer histopatolojisi üzerine etkilerini incelemek amacıyla yapılmıştır.
Araştırma, I. grup kontrol grubu, II. grup Flor (800 mg/kg) (F)ν III. grup EPG 400 mg/kg (E)ν IV. grup
EPG (400mg/kg)+Flor (E+F) olacak şekilde gruplara ayrılarak yapılmıştır. Deneme 4β gün sürmüştür.
Flor verilen grupta serum ALP, ALT, ve TOS seviyeleri yükselmiştir. Histopatolojik değerlendirmede,
F+E grubunda hafif portal bölge değişikliklerine (portal enflamasyon ve ödem) rastlanırken, bunların
dışında karaciğerin normal yapısını koruduğu ve flor katılan grupla karşılaştırıldığında ise iyileşme
görüldüğü dikkati çekmiştir.
Anahtar Kelimeler: Antioksidan, broyler, epigallakateşin, flor toksikasyonu, kan parametreleri,
karaciğer patolojisi.
1. GİRİŞ
Yeşil çayın türüne göre değişmek üzere polifenollerden (+) kateşin, epikateşin, epigallokateşin ve
epigallokateşingallat gibi kateşinleri içermektedir (Önenç ve ark, β006). Bu bileşikler yeşil çayda miktarca
epigallokateşingallat (toplam kateşin miktarının % 60’ı)>epigallokateşin>epikateşin≥ epikateşingallat
şeklinde sıralanmaktadır (Şahin ve Özdemir, β006). Yeşil çay yaprakları (Camellia sinensis) antioksidatif
kateşinleri kapsar (Miura ve ark., β001). Çay kateşinlerininν antioksidatif (Fujiki, β005), hipolipidemik, kan
(Sarıca ve ark, β008ν Arina ve ark, β011) ile kan kolesterolü düşürücü etki (Biswas ve ark, β000) gibi sağlık
üzerine olumlu etkileri vardır.
Flor doğada bulunan en elektronegatif element olup, pek çok elementle iyonize floridler halinde bulunan
(Chlubek β00γ), hem doğal hemde endrüstriyel kaynaklar yoluyla çevre kirliliğine sebep olan önemli
kirleticilerdendir (Whitford, 1λ8γ). Aşırı Flor birikimi iskelet, dişler ve yumuşak dokularda hasara neden
olabilmektedir.
Floride toksisitesinin patogenezinde üretimi artan serbest oksijen türleri, artmış
lipidperoksidasyonu ve bozulmuş antioksidan savunma sistemi rol oynar (Vani ve Reddy, β000). Özellikle
miktarı artmış serbest radikaller membran fosfolipidlerine saldırır ve bu da lipidperoksidasyonu,
mitokondriyal membran depolarizasyonu ve apoptozis yoluyla membran hasarına neden olur (Barbier ve
ark., β010). Bunun yanı sıra florid hücre membranını geçerek (Carlson ve ark., 1λ60), kan (Karadeniz ve
Altıntaş, β008) ve karaciğer (Mittal ve Flora β006) gibi yumuşak dokularda çeşitli değişiklikler
oluşturmaktadır. Karaciğer oldukça aktif bir metabolizmaya sahip olduğu için florid toksisitesine karşı
oldukça hassastır (Guo ve ark., β007).
Bu çalışmaν Flor toksikasyonu oluşturulmuş broylerlerde epigallokateşin-3-gallat (EPG) kullanımının kan
parametreleri ve karaciğer histopatalojisi üzerine etkilerini incelemek amacıyla yapılmıştır.
2. MATERYAL VE METOD
2.1. Hayvan Materyali
Günlük 160 adet Ross PMγ erkek etlik civciv kullanılacaktır. Her bir grup 40 hayvandan oluşacak şekilde 4
gruba ayrılacak ve her bir grubun 4 alt grubu olacak şekilde düzenlenmiştir. Deneme, 40 × 65 × λ8 cm,
ölçülerinde kafes siteminde yapılmıştır. Çalışma, Kırıkkale Üniversitesi Hayvan Deneyleri Yerel Etik
Kurulu’nun β014/41 sayılı kararı ile onaylanmıştır.
2.2. Yem Materyali
POSTER PRESENTATION
253
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Her bir gruba civciv döneminde (0-β hafta) etlik civciv başlangıç yemi (% βγ,γ0 HP ve γ060 kcal/kg ME),
14. günden 4β. güne kadar (γ-6 hafta) (% β1,70 HP ve γ174 kcal/kg ME) büyütme yemi, verilmiştir (Tablo
2). Araştırma rasyonlarının temelini mısır, soya küspesi ve tam yağlı soya oluşturmuştur. Denemede yeşil
çay yapraklarından elde edilen TeavigoTM (λ4% EPG) kullanılmıştır (DSM, İstanbul, Türkiye). Sodyum
florür (NaF) ise Merck ten satın alınmıştır (Darmstadt, Germany).
Araştırma grupları I. grup kontrol grubu, II. Grup Flor (800 mg/kg); III. Grup EPG 400 mg/kg; IV. Grup
EPG(400mg/kg)+Florν olacak şekilde düzenlenmiştir. Deneme 4β gün sürmüştür.
2.3. Kan Parametrelerininin Analizi: Serum test tüplerine alınan kan örnekleri 1600 x g'de, 4 ° C'de 10
dakika santrifüj edildi ve -80 ° C'de saklandı. Toplam kolesterol, yüksek yoğunluklu lipoprotein (HDLkolesterol) yanı sıra, serum alkalin fosfataz (ALP) (EC γ.1.γ.1) ve alanin aminotransferaz (ALT) (EC
β.6.1.β) aktiviteleri, glukoz konsantrasyonları otoanalizör ile belirlendi (Gesan Chem 400, İtalya). Düşük
yoğunluklu lipoprotein (LDL kolesterol) Friedewald'ın ampirik formülü kullanılarak primer ölçümlerden
hesaplandı[16]. TAS seviyeleri, ticari bir kit (Rel Assay Diagnostics, Gaziantep, Türkiye) aracılığıyla
serumda belirlenmiştir [17]. TAS seviyeleri otoanalizör (Gesan Chem 400, İtalya) ile ölçüldü. Sonuçlar,
ηmol Trolox Denklem / L'olarak ifade edildi. TOS değerleri serumda ticari kit (Rel Assay Diagnostics,
Gaziantep, Türkiye) ile tespit edildi [18]. Sonuçlar litre başına mikromolar hidrojen peroksit eşdeğeri olarak
ifade edildi (ηmol HβOβ Eşit / L).
2.4. Histopatalojik değerlendirme
Histopatolojik değerlendirme içinν ötenazi sonrasında 48 adet tavuktan alınan karaciğer örnekleri %10’luk
tamponlu formalin içinde 48-72 saat fikse edildi. Fikse olan dokular; 2-γ mm kalınlığında trimlenerekν rutin
doku takip, parafin emdirme ve bloklama işlemlerine tabi tutuldu. Hematoksilen ve eozin (HE) boyaması
için, parafin bloklardan adezivli lamlara 4-5µm kalınlığında kesitler alındı. Kesitler sırasıylaν ksilol ve
dereceli alkol (%100, %96, %80, %70 ve %50) serilerinden geçirilerek deparafinize ve dehidre edildi ve
sonrasında hematoksilen ve eozin boyandı. Boyamanın ardından entellanla kapatılan lamlar, ışık
mikroskobunda (Olympus BX51,Tokyo, Japonya) histopatolojik olarak değerlendirilmiştir.
Tablo 1. Etlik Civciv ve Piliç Rasyonlarının Bileşimi (%)
Etlik Civciv
Etlik Piliç
(0-14. Gün)
(15-42. Gün)
Mısır
46.60
53.60
Soya küspesi
30.00
22.00
Tam yağlı soya
15.00
15.00
Bitkisel yağ
4.00
5.50
Kireç taşı
0.90
0.90
DCP
2.35
2.20
DL-Metiyonin
0.35
0.25
L-Lizin
0.15
0.00
L-Treonin
0.10
0.00
Tuz
0.35
0.35
Vitamin+Mineralpremix*
0.20
0.20
23.40
19.90
3065
3200
0.89
0.88
0.60
0.58
Yemler
Hesapla bulunan
HP, %
ME, kcal/kg
Ca, %
P, %
*Vit. A 12.000.000 IU/kg, Vit D3 2.500.000 IU/kg, Vit. E 40.000 mg/kg, Vit K3 5.000 mg/kg, Vit B1 2.500 mg/kg, Vit
B2 6.000 mg/kg, Vit B6 5.000 mg/kg, Vit B12 20 mg/kg, Pantotenik Asit 15.000 mg,kg, Niasin 25.000 mg/kg, Folik
Asit 1.000 mg/kg, Biotin 50 mg/kg. Bakır 5.000 IU/kg, İyot 1.000 IU/kg, Kobalt β00 mg/kg, Selenyum 150 mg/kg,
Demir 60.000 mg/kg, Çinko 60.000 mg/kg, Mangan 80.000 mg/kg.
POSTER PRESENTATION
254
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2.5. İstatistik Analizler
Gruplara ait istatistik hesaplamalar ve grupların ortalama değerleri arasındaki farklılıkların önemliliği
variyans analiz metodu, gruplar arası farkın önemlilik kontrolü için Duncan testi uygulanmıştır. İstatistik
analizler SPSS 16.0 paket programına göre yapılmıştır.
3. BULGULAR
Flor verilen grupta kontrol grubu ile karşılaştırınca ALP, GPT, ve TOS seviyesi yükselmiştir. Flor verilen
grupta istatistiksel bir fark olmasa da kontrole göre kolesterol seviyesinde sayısal bir artış görülmüştür. EPG
florla birlikte verildiğinde ALT, total kolesterol ve TOS seviyesi, kontrol grubuna göre düşmüştür (Tablo β).
Table 2. Rasyonlara ilave edilen Flor ve EPG’ın Kan Parametreleri Üzerine Etkisi
Parametre
K
F
E
F+E
ALP (IU/L)
β77λ,08±
145,69b
6,58±0,4γb
108,75±4,84ab
4γλ0,64±
295,60a
11,β1±β,14a
1βγ,50±γ,8λa
β645,40±
171,34b
6,50±0,60b
11β,00±4,74ab
γ845,γγ±
249,27a
6,11±0,λβb
101,00±8,86b
P
0,000
ALT (IU/L)
0,033
Total kolesterol
0,034
(mg/dL)
HDL (mg/dL)
47,75±1,87
5γ,λβ±1,71
5γ,44±1,λ4
5γ,50±β,50
0,073
Glukoz (mg/dL) 1λ7,80±7,17
β04,58±6,56
β04,71±6,15
18β,67±6,λγ
0,114
TAS (ηmol
1,55±0,10a
1,λ6±0,β5a
0,85±0,05b
0,66±0,0γb
0,000
Trolox Eq/L)
TOS (ηmol
γ,84±0,66b
7,β1±1,60a
γ,67±0,61b
β,λλ±1,04b
0,046
Trolox Eq/L)
a, bν Aynı satırda farklı harf taşıyan ortalama değerler arasındaki farklılıklar istatistiksel olarak önemlidir
(P<0.01).
Karaciğerin histopatolojisindeν Kontrol ve epigallokateşin ilave edilen grupta hafif portal enflamasyon
dışında hiçbir patolojik değişikliğe rastlanmamıştır. Bununla birlikteν Grup F de ise şiddetli portal ve
sinüzoidal enflamasyona, orta derecede portal bölge değişiklikleri (portal ödem, portal venkonjesyonu) ile
birlikte safra kanalı epitelyum hiperplazisinin de eşlik ettiği gözlendi. Bunların yanısıra Flor katılan gruptaν
hepatositlerde hafif intrastoplazmik vakuolleşme ve hepatosit dejenerasyonu gibi parankimal değişikliklere
de rastlandı. F+E grubunda hafif portal bölge değişikliklerine (portal enflamasyon ve ödem) rastlanırken,
bunların dışında karaciğerin normal yapısını koruduğu ve flor katılan grupla karşılaştırıldığında ise iyileşme
görüldüğü dikkati çekmiştir. Bulgular Şekil 1, Şekil β’de verilmiştir.
Şekil 1: Grup III (flor)’ ün karaciğer dokusunun histopatolojik kesitleri. (A) Portal bölge, ok portal enflamasyonu gösteriyor. (a)
hepatik arter (v) portal ven, portal vendekikonjesyon. (d) safra kanalı, asteriks safra kanalı epitelhiperplazisini gösteriyor. HE, 200X
büyütme. (B) Sinüzoidal konjesyon ve enflamasyon. HE, 100X büyütme. (C) Hepatositlerdedejenerasyon, sinüzoidal konjesyon ve
enflamasyon, ok hepatositlerdekiintrastoplazmikvakuolizasyonu gösteriyor. HE, 1000X büyütme.
POSTER PRESENTATION
255
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 2: Tüm çalışma gruplarında karaciğer dokularının histolojik kesitleri. (A) Grup I (kontrol)’de hafif portal enflamasyon, normal
karaciğer yapısı. HE, 100X büyütme. (B) Grup II (epigallokateşin)’ de normal karaciğer yapısı. HE, β00X büyütme. (C) Grup III
(flor)’de şiddetli portal enflamasyon, orta derecede venözkonjesyon ve portal ödem. HE, β00X büyütme. (D) Grup IV (flor +
epigallokateşin)’de hafif portal enflamasyon, normal karaciğer yapısı. HE, β00X büyütme
4. TARTIŞMA
Broylerlerde flor zehirlenmesinin etkisini araştırmak amacıyla birçok çalışma yürütülmüştür.
Kanbur ve ark (2009), flor verilen farelerde, GOT ve glıkoz seviyesinde kontrole göre bir yükselme, GPT,
kolesterol ve trigliserid düzeyinde seviyesinde bir düşüş saptamışlardır, ALP düzeyinde bir değişiklik
bulamamışlardır. Eraslan ve ark (β007), flor verilen sıçanlarda ALT sayısal ve ALP de istatistiksel bir
azalma, AST’de istatistiksel bir artış bulmuşlardır. Deng ve ark (β014), broiler ırkı tavuklara 400, 800 ve
1β00 mg/kg yüksek doz flor vermiştir ve ALT, ALP ve AST seviyesinde artma, ALT düzeyinde ise kontrole
göre azalma bulmuşlardır. Bizim çalışmamızın sonuçları Deng ve ark (β014) sonuçlarından ALT, ALP
parametreleri ile uyumludur. Bu durum karaciğerde oluşan hasarı işaret etmektedir.
Deng ve ark (β014) floridin MDA seviyesini artırdığını saptamışlardır. Bu çalışmada da TOS seviyesi 800
mg/kg florid verilen grupta artmıştır.
Florid maruziyeti, anyon süperoksit üretiminin artmasına, Oβ-konsantrasyonunun artmasına ve hidrojen
peroksit, peroksinitrit, hidroksil radikallerinin artmasına neden olmaktadır. Ayrıca florid nitrik oksit
oluşumunu da artırır. Süperoksitlerle birleşerek peroksinitrit ve proteinlerde thiollerle birleşerek
nitrosiladduktlar oluşturur. Disülfid bağların oluşmasına sebep olarak endoplazmikretikulumda yanlış
yapılandırılmış proteinlerin birikmesine ve sonuçta ER stres ve ROS üretimine neden olur. Oksidatif stress
flor zehirlenmesinin ana etki mekanizması olarak nitelenmektedir (Barbier ve ark, β010). Epigallokateşinin
antioksidan etkisi Zhen ve ark (β007), Tipoe ve ark (β010), Atmaca ve ark (β014) tarafından gösterilmiştir.
Muhtemelen bizim çalışmamızda da karaciğer hasarındaki histopatolojik azalma epigallokateşinin flor
toksikasyonunda meydana getirdiği oksidatif hasarın düzeltilmesi ile ilgilidir. Çalışmamızdaki birçok
karaciğer biyokimya verileri ve TOS’ da meydana gelen değişiklikler epigallokateşin ile düzeltilmiştir. Bu
bulgular patoloji bulgularını destekler niteliktedir.
Zhen ve ark (β007), benzer şekilde karaciğerde fibrozis oluşturulan sıçanlarda AST ve ALT seviyesini
yükseltmiş epigallokateşin uygulaması bu verileri düşürmüştür. Tuzcu ve ark (β008) bıldırcın rasyonlarına
EPG ilavesinde, serum kolesterol seviyesinin düştüğünü saptamışlardır. Bizim çalışmamızda da EPG florla
birlikte verildiğinde GPT, kolesterol ve TOS seviyesi, kontrol seviyesine düşmüştür. Sıçanlarda yapılan
birçok çalışmada flor intoksikasyonunun karaciğerde gerek biyokimyasal gerek morfolojik değişikliklere
neden olduğunu göstermiştir (Iano ve ark β014, Zhou ve ark β015, Wang ve ark β000, Atmaca ve ark β014,
POSTER PRESENTATION
256
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Nabavi ve ark 2012). Iano ve ark (β014), Zhou ve (β015) flor verilmesinin sıçanlarda karaciğerde
antioksidan sistemi değiştirdiğini bildirmişlerdir. Zhou ve ark, sıçanlarda oluşturulan flor zehirlenmesinin,
hepatositler karışık bir biçimde dizilim göstermiş ve bir kısmı eriyerek küçük parçalar haline gelmiştir.
Karaciğerde hücre sınırları belirgin değildir ve çekirdekte bile çok hafif boyanma bulunmaktadır. Ersan ve
ark farelerde yaptığı çalışmada 10, β0 ve 40 ppm düzeyinde suya katılan florun λ0 günün sonunda
karaciğerde lokal nekroz, vakuoler dejenerasyon ve merkezi toplar damar çevresindeki hepatositlerde
şişmeler tespit etmişlerdir. Abdelsalam ve Dorra (1λλβ), broiler yemine toksik dozda flor ilavesinin genel
bakı ve postmortem bulgulara bakılarak karaciğerde bozukluk yaptığını bildirmişlerdir. Bizim çalışmamız da
yukarıdaki çalışmalara benzer olarak karaciğerde şiddetli portal ve sinüzoidal enflamasyona, orta derecede
portal bölge değişiklikleri (portal ödem, portal venkonjesyonu) ile birlikte safra kanalı epitelhiperplaziye
neden olmuştur.
Yeşil çay ekstresinin karaciğer üzerinde olumlu etkileri oldukça fazladır. Kurşun (Mehana ve ark, β01β),
konkanavalin (Liu ve ark, β014), karbontetraklorür (Tipoe ve ark, β010, Zhen ve ark, β007) ile oluşturulan
karaciğer hasarının, epigallokateşin ile düzeldiği saptanmıştır. Bu çalışmanın bulguları da benzer şekilde
florun karaciğerde oluşturduğu patolojik hasarı düzeltmiştir. Bu sonuçlar epigallokateşinin karaciğer hasarını
önlediğini kanıtlar niteliktedir.
Bu çalışmada epigallokateşin ilavesi florun karaciğer üzerinde oluşturduğu zararlı etkiyi ortadan kaldırdığı
görülmektedir. Bunun yanı sıra kan analiz sonuçları da yeşil çay ekstresinin antioksidan etkisini destekler
niteliktedir.
KAYNAKLAR
Abdelhamid AM, Dorra TM 1992. Effect of feedborne fluorine intoxication on broiler chicks' performance,
biochemistry, physiology and pathology. Arch Anim Nutr, 42:133-45.
Arina M, Samie A, Edriss MA, Jahanian R, 2011. Effects of powder and extract form of green tea and
marigold, and alfa-tocopheryl acetate on performance, egg quality and egg yolk cholesterol levels of laying
hens in late phase of production. J Med Plant Res, 5(13): 2710-2716.
Atmaca N, Atmaca HT, Kanici A, Anteplioglu T 2014. Protective effect of resveratrol on sodium fluorideinduced oxidative stress, hepatotoxicity and neurotoxicity in rats. Food Chem Toxicol, 70:191-197.
Barbier O, Arreola-Mendoza L, Del Razo LM 2010. Molecular mechanisms of fluoride toxicity. Chem-Biol
Interact, 188:319-333.
Barbier O, Mendoza LA, Del Razo LM 2010. Molecular mechanisms of fluoride toxicity. Chemico-Biol
Interact, 188(2):319-333.
Biswas AH, Miyazaki Y, Nomura K, Wakita M 2000. Influences of long-term feding of japanese green tea
powder on laying performance and egg quality in hens. Asian-Aust J Anim Sci, 13(7): 980-985.
Carlson CH, Armstrong WD, Singer L 1960. Distribution and excretion of radio fluoride in the human. Proc
Soc Exp Biol Med, 104:235-239.
Chlubek D 2003. Fluoride and oxidative stress. Fluoride, 36, 217-228.
Deng Y, Cui H, Peng X, Fang J, Zuo Z, Deng J, Luo Q 2014. Effects of high dietary fluoride on serum
biochemistry and oxidative stress parameters in broiler chickens. Health, 6:1840-1848.
Eraslan G, Kanbur M, Silici S 2007. Evaluation of propolis effects on some biochemical parameters in rats
treated with sodium fluoride. Pestic Biochem Physiol, 88:273-283.
Erel O 2004. A novel automated direct measurement method for total antioxidant capacity using a new
generation, more stable ABTS radical cation. Clin Biochem, 37:277–285.
Erel O 2005. A new automated colorimetric method for measuring total oxidant status. Clin Biochem,
38:1103–1111.
Ersan Y, Koç E, Ari I, Karademir B β010. Histopathological effects of chronic fluorosis on the liver of mice
(Swiss albino). Turk J Med Sci, 40 (4):619-622.
Friedewald WT, Levy RI, Fredrickson DS 1972. Estimation of the concentration of low-density lipoprotein
cholesterol in plasma, without use of the preparative ultracentrifuge. Clinical Biochem, 18(6): 499–502.
Fujiki H, 2005. Green tea: health benefits as cancer preventive for humans. Chem. Rec, 5: 119-132.
Iano FG, Cecília M, Giovana F, Mileni BQ, Fernandes S, Cardoso R, Valdecir O, Marília FX, Buzalaf AR
2014. Effects of chronic fluoride intake on the antioxidant systems of the liver and kidney in rats. J Fluorine
Chem, 168:212-217.
Kanbur M, Eraslan G, Silici S, Karabacak M 2009. Effects of sodium fluoride exposure on some
biochemical parameters in mice: Evaluation of the ameliorative effect of royal jelly applications on these
parameters. Food Chem Toxicol, 47:1184-1189.
POSTER PRESENTATION
257
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Karadeniz A, Altıntaş L β008. Effects of Panax Ginseng on fluoride-induced haematological pattern changes
in mice. Fluoride, 41:67-71.
Killham K 1994. Soil ecology. Cambridge: Cambridge University Press, 242 pp.
Mehana EE, Meki AR, Fazili KM 2012. Ameliorated effects of green tea extract on lead induced liver
toxicity in rats. Exp Toxicol Pathol, 64μβλ1-βλ5.
Mittal M, Flora SJ 2006. Effects of individual and combined exposure to sodium arsenite and sodium
fluoride on tissue oxidative stress, arsenic and fluoride levels in male mice. Chem Biol Interact, 162(2):12839.
Miura Y, Chiba T, Tomita I, Koizumi H, Miura S, Umegaki K, Hara Y, Ikeda M, Tomita T 2001. Tea
catechins prevent the development of atherosclerosis in apoprotein E-deficient mice. J Nutr, 131: 27-32.
Nabavi SM, Nabavi SF, Eslami S, Moghaddam AH 2012. In vivo protective effects of quercetin against
sodium fluoride-induced oxidative stress in the hepatic tissue. Food Chem, 132:931-935.
Önenç SS, Açıkgöz Z, Akkan S β006. Yeşil çayın (Camellia Sinensis) hayvan beslemede kullanım
olanakları. Türkiye λ. Gıda Kongresi, β4-β6 Mayıs, Bolu.
Şahin H, Özdemir F β006. Yeşil çayın sağlık üzerine etkisi. Türkiye λ. Gıda Kongresi, β4-β6 Mayıs, Bolu.
Tipoe GL, Leunga TM, Lionga EC, Yue T, Lauc H, Fung ML, Nanji AA 2010. Epigallocatechin-3-gallate
(EGCG) reduces liver inflammation, oxidative stress and fibrosis in carbon tetrachloride (CCl4)-induced
liver injury in mice. Toxicology, 273:45-52
Tuzcu M, Sahin N, Karatepe M, Cikim G, Kilinc U, Sahin K 2008. Epigallocatechin-γ-gallate
supplementation can improve antioxidant status in stressed quail. Br Poult Sci, 49 (5):643-648.
Vani ML, Reddy KP 2000. Effects of fluoride accumulation on some enzymes of brain and gastrocnemius
muscle of mice. Fluoride, 33:17-26.
Wang YN, Xiao KQ, Liu JL, Dallner G, Guan ZZ 2000. Effect of long term fluoride exposure on lipid
composition in rat liver. Toxicology, 146:161-169.
Whitford GM 1983. Fluorides: metabolism, mechanisms action and safety. Dent Hyg (Chic), 57:16-8.
Zhen MC, Wang Q, Huang XH, Cao LQ, Chen XL, Sun K, Liu YL, Li W, Zhang LJ 2007. Green tea
polyphenol epigallocatechin-3-gallate inhibits oxidative damage and preventive effects on carbon
tetrachloride–induced hepatic fibrosis. J Nutr Biochem, 18:795-805.
Zhou BH, Zhao J, Liu J, Zhang JL, Wang HW 2015. Fluoride-induced oxidative stress is involved in the
morphological damage and dysfunction of liver in female mice. Chemosphere, 139:504-511.
POSTER PRESENTATION
258
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Fluorimetric determination of cefotaxime sodium in pharmaceuticals preparation via the
quenching of the continuous fluorescence of calcein using a homemade ISNAG-continuous
flow injection analyser
Hayder Q. Munshid1*, Nagam S. Turkie 2
*1
2
Department of Pharmacy, Al-esraa University College, Baghdad, Iraq,
Department of Chemistry, College of Science, University of Baghdad, Baghdad, Iraq.
Corresponding author e-mail: Haider.qais1989@gmail.com
Abstract
A newly developed analytical method for the determination of Cefotaxime sodium (CTX) in pure and
pharmaceuticals preparation via fluorescence measurements at ± λ0◦ via β×4 solar cell of a new
homemade ISNAG fluorimeter. The method was based on the quenching of the continuous fluorescence
of calcein. The calibration graph was linear in the range of 10-50 mmol/L, with correlation coefficient r
= 0.9820 and the limit of detection 501.γ14 µg/sample from the step wise dilution for the minimum
concentration in the linear dynamic ranged of the calibration graph. The method was successfully applied
to the determination of cefotaxime sodium in two pharmaceutical drugs. A comparison was made
between the newly developed method analysis and the classical method using the standard addition
method via the use of t-test. It was noticed that there was no significant difference between two methods
at 95 % confidence level.
Keywords: Fluorescence – Cefotaxime sodium – Calcein – Flow injection.
1. INTRODUCTION
Cefotaxime sodium (CTX) is a potent third-generation cephalosporin with a 2-amino-4-thiazolyl side chain
and a syn α-methoxyimino group at position 7. Also known as sodium [6(R)-[6α,7ί(Z)]]-3-[(acetyloxy)methyl]-7-[[(2-amino-4-thiazolyl) (methoxyimino)acetyl]-8-oxo-5-thia-1-azabicyclo[4.2.0] oct-2-ene-2carboxylate] (Figure 1) and is a kind of white or light-yellow crystalline powder that is soluble in water. This
antibiotic, which was developed by Hoechst, is highly effective against a broad antibacterial spectrum of
microorganisms, specially Gram-negative aerobes, it is clinically available for the treatment of various
infections (Sun, Cui et al. 2017). the empirical formula for CTX is C 16H17N5NaO7S2 and the molecular
weight is 477.468 g/mol. CTX contains approximately 50.5 mg (2.2 mEq) of Na per g of CTX. (Arafat, Kon
et al. 2015). Many analytical methods have been reported for the determination of CTX in pure form and
pharmaceutical preparations, these methods includes spectrophotometry (Bushra, Akter et al. 2014, Ali
Ahmed, Elbashir et al. 2015, Adegoke and Quadri 2016), fluorometry (Omar, Abdelmageed et al. 2009,
Elbashir, Ahmed et al. 2012, Stirbet, Vasilescu et al. 2014), chemiluminescence (Du and Li 2010, Chen,
Wang et al. 2011), HPLC (Arafat, Kon et al. 2015, Legrand, Vodovar et al. 2016), capillary electrophoresis
(Gáspár, Andrási et al. β00β, Andrási, Gáspár et al. β007), and electrochemical (Xu, Wu et al. 2016,
Dehdashtian, Behbahani et al. 2017) methods.
The aim of this work was to develop a new fluorometric flow injection method for the determination of
cefotaxime sodium using ISNAG fluorimeter. The method is based on the quenching of the continuous
fluorescence of calcein. Calcein (CAL), fluorescein-complexone, is a fluorescence dye, which has proven as
a rapid, accurate, and dependable for the determination of calcium (Hill 1965). Calcein give a continuous
fluorescence using homemade ISNAG fluorimeter at pH5, the emitted fluorescence was measured at ± λ0◦
via β×4 solar cell to detect any of the reflected emission.
Figure 1. Chemical structure of Cefotaxime sodium (CTX)
POSTER PRESENTATION
259
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS AND METHODS
2.1 Apparatus and Reagents
A homemade ISNAG fluorimeter was used with 4-channels peristaltic pump (Ismatec, Switzerland) and Sixport medium pressure injection valve (I D E X corporation, USA) with sample loop (1 mm i.d. Teflon,
variable length). Potentiometric recorder to estimate the output signals (Siemens, Germany (1- 5 V)).
Spectrophotometer (UV-1800, shimadzu, Japan) was also used for classical spectrofluorometric methods.
All chemicals were used of analytical-reagent and distilled water was use to prepare all the solutions. A
standard solutions of 1 mmol/L and 50 mmol/L of CAL and CTX, molecular weight 622.539 and 477.442
g/mole respectively, were prepared by dissolving 0.3113 g of CAL in 500 mL and 2.3872 g of CTX in 100
mL of distilled water. A pH range of 2.2–8.0 buffers were prepared according to citric acid–phosphate buffer
systems (McIlvaine 1921). A series of sodium hydroxide solutions were prepared from the dilution of
standardized stock solution (0.1 mol/L) with distilled water.
2.2 Methodology
Single line manifold design (Figure 2) for the flow injection system of CAL used to determine the CTX
using ISNAG fluorimeter with experimental parameters of β.75 mL/min flowrate and β50 µL volume of
CTX injected via the flow system. These parameters will be investigated to enhance the quenching of
fluorescence of CAL, the study of effect of CAL concentration on the sensitivity of quenching was carried
out using different concentration of CAL (0.01-0.1 mmol/L) as a carrier stream with flow rate of 2.75
mL/min and 250 µL of 30 mmol/L of CTX injected in an open valve mode. The physical parameters were
studied by investigate the effect of the flow rate of CAL as a carrier stream by changing their flow rate from
0.575 to 4.γ mL/min, using β50 µL of CTX (30 mmol/L) as the injected sample volume using open valve
mode. Using these parameters variable sample loop (50-β50 µL) were used in an open valve mode for the
optimization of sample volume, and the purged time were studied at (2-25 sec).
Figure 2. Manifold system design of quenching system of CAL fluorescence via CTX.
A series of CTX concentration having the range of (1-50) mmol/L were papered using all achieved
parameters in previous sections for the study of calibration graph. The method achieved in this work was
compared by classical method (Spectrophotometric methods) via the measurement of absorbance spectrum at
ζmax = 240 nm. The developed method was used for the determination of CTX in two different
pharmaceutical preparations from two different well known manufacturers (Bilim Turkey, 1g and LDP
Spain, 1g), using the total quenching of fluorescence of CAL-CTX system. The standard addition method
was applied by preparing a series of solutions from each pharmaceutical drug via transferring 5 mL (50
mmol/L) to five volumetric flasks (10 mL), followed by the addition of (0, 1, 2, 3 and 4 mL) from 50
mmol/L standard solution of CTX. For the classical spectrophotometric method comparison, a series of
solutions from each pharmaceutical drug via transferring 5 mL (0.02 mmol/L) to five volumetric flasks (10
mL), followed by the addition of (0, 1, 2, 3 and 4 mL) from 0.04 mmol/L standard solution of CTX.
3. RESULTS AND DISCUSSION
The study of this quenching system with expected mechanism for quenching was illustrated in scheme 1.
The obtained results for concentration study were tabulated in table 1. The results show an increased in the
total quenching of fluorescence. While the blank response increased with the increased of CAL
POSTER PRESENTATION
260
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
concentration, therefore, the variation of quenching of CTX effected and the remained fluorescence
increased. The optimum concentration of CAL that gave maximum quenching and minimum blank response
is 1 mmol/L, higher concentration of CAL di not included in this study due to the self-quenching of CAL.
Scheme 1. Schematic of quenching of CAL via CTX.
Concentration
of CAL
mmol/L
0.01
0.03
0.05
0.07
0.1
Table 1. Variation of CAL concentration using β50 µL of γ0 mmol/L of CTX.
Total
Total
Confidence
Quenching
continuous
quenching of
interval
of the
of CAL
fluorescence
CAL
RSD
average
response
fluorescence
of CAL
fluorescence
%
(at 95%
ȳiQ (mV)
ȳi (mV)
ȳiQ (mV)
confidence level)
Expressed as an average peak heights (n=3)
ȳiQ±t0.05/2, n-1 σn-1/√
98
221
298
375
405
84
134
160
263
263
42
36
37
67
101
0.57
0.67
1.86
1.24
0.95
4β ± 0.5λ6β
γ6 ± 0.5λ6β
γ7 ± 1.714β
67 ± β.06β0
101 ± β.γ850
Remained of
fluorescence
ȳiR (mV)
14
87
138
112
142
The response profile obtained for the flow rate effect study shown in Figure 3,A. and the results tabulated in
table β. It was noticed that there was an increased in peak base width (Δtb) at low flow rate which might
cause by dilution and dispersion, while at higher flow rate (>1.7 mL/min), a regular and sharp response was
obtained as shown in Figure 3,B. The optimum chosen flow rate was 2.2 mL/min, as a clear peak profile
response, narrow Δtb and easy measurable peak. Using optimum concentration of CAL 0.1 mmol/L (intensity
of the continuous fluorescence 412 mV) at flow rate 2.2 mL/min for the optimization of sample volume. The
data obtained were plotted as shown in Figure 4, A&B. which reveals that the optimum sample volume is
150 µL that gave a regular and highest clear response with minimum response of distilled water. More than
150 µL there were an increase in the response of distilled water (negative response), therefore 150 µL was
found to the best sample volume that gave a sharp regular response. The purge time was studied, the
optimum mode with the highest response is the open valve mode. The obtained results were tabulated in
table 2. which shows the average of total quenching of three successive measurement expressed in mV,
relative standard deviation, the confidence interval of average response at 95% confidence level, quenching
of the fluorescence and remained of the fluorescence.
Figure 3. Variation of flow rate A: Response profile-time, B: Effect of quenching of fluorescence, remained
of fluorescence and peak base width.
POSTER PRESENTATION
261
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 4. Variation of sample volume A: Response profile-time, B: Effect of quenching of fluorescence,
remained of fluorescence and peak base width.
Table 2. Purge time effect using 0.1 mmol/L of CAL and 150 µL of γ0 mmol/L of CTX.
Total quenching Quenching
Confidence interval
of CAL
of CAL
of the average
Remained of
fluorescence fluorescence ȳiQ RSD
Purge time
response (at 95%
fluorescence
ȳiQ (mV)
(mV)
(sec)
%
confidence level)
ȳiR (mV)
Expressed as an average peak
ȳiQ±t0.05/2, n-1 σn-1/√
heights (n=3)
2
5
10
15
20
Open valve (25)
171
209
206
208
210
213
66
104
101
103
105
108
0.77
0.51
0.61
0.82
0.89
0.85
66 ± 1.β670
104 ± 1.γ167
101 ± 1.540γ
10γ ± β.0868
105 ± β.γ104
108 ± β.β856
235
197
200
198
196
193
Response of continuous fluorescence: 406 mV.
The responses profile for calibration graph was obtained as shown in Figure 5. Total quenching of
fluorescence, quenching of fluorescence and remained of fluorescence (mV) was plotted against the
concentration CTX, the straight line equation for these types of measurements shows a linear calibration
graph range for the variation with CTX concentration, which was ranging from (10-50) mmol/L with
correlation coefficient r: 0.9820 and the calculated t-value at 95% confidence level of 16.431 which is larger
than the tabulated t-value indicating clearly that the linearity against non-linearity is accepted. The method
achieved in this work was compared by classical method (Spectrophotometric methods) via the measurement
of absorbance spectrum at ζmax = 240 nm Figure 6, calibration graph was obtained for classical
spectrophotometric method and Table 3 sum up all the results obtained using linear regression analysis for
both methods. The limit of detection was calculated for the developed method and the reality and
repeatability was studied for eight repeated injections for (15 and 40 mmol/L) of CTX.
Figure
5. Responses profile for calibration graph of CTX.
POSTER PRESENTATION
262
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 6. Absorbance spectrum of CTX .
Table 2. Summary of calibration graph results for CTX at 95% confidence level.
Classical
Developed
Range of
calibration
Type of method
curve
(mmol/L), (n)
Equation of calibration curve
̂� =
�
±
�+
±
�[�
]
/�
at confidence level 95%, n-2
Total
quenching
of
fluorescence
10-50
(12)
̂� mV =
�
Quenching
of
fluorescence
10-50
(12)
Remained
of
fluorescence
10-50
(12)
̂� mV = − . 6 ± . + .
�
[CTX]
� /�
̂� mV =
�
ζmax = 240 0.0001-0.04
nm
(11)
Practical based on the gradual
dilution for the minimum
concentration (7 mmol/L)
3.342 g/L
501.314 µg/sample
̂� = .
�
. ±
[CTX]
. 6±
[CTX]
± .
[CTX]
.
+ .
� /�
± .
± .
. − .
� /�
+ .
� /�
± .
± .
Limit of detection
Theoretical based on the value
of slope
X=3SB/slope
0.263 g/L
γλ.4ββ µg/sample
Repeatability
[CTX]
mmol/L
Fluorescence Intensity
expressed as an average
peak heights (n=8) ȳi (mV)
RSD%
15
40
148
239
0.55
0.47
r
r2
R2 %
0.9820
0.9643
96.43
0.9820
0.9643
96.43
0.9820
0.9643
96.43
0.9890
0.9781
ttab =
t0.025 ,n-2
tcal =
|�|√ −
√ −�
2.228<<16.431
2.228<<16.431
2.228<<16.431
2.262<<20.057
97.81
Theoretical (linear equation)
based on the value of
̂=
+
3.802 g/L
570.γ0β µg/sample
Confidence interval of the
average response (at 95%
confidence level)
ȳi±t0.05/2, n-1 σn-1/√
148 ± 0.677γ
βγλ ± 0.λγ65
n: No. of measurements in calibration curve, �̂� : in mV for developed method, r: correlation coefficient, r 2: coefficient
of determination, R2%(Percentage capital R-squared): explained variation as a percentage total variation. X: value of
L.O.D based on slope, SB: Standard deviation of blank repeated for 13 times, Yb: average response for blank = intercept,
Sb: standard deviation equal to Sy/x (residual), t 0.025,7 = 2.365.
The analysis of pharmaceutical preparation was applied using the standard addition method for two different
pharmaceutical preparations from two different well known manufacturers (Bilim Turkey, 1g and LDP
Spain, 1g). The results were mathematically treated and tabulated in Table 3 at confidence level of 95%.
Two paths of t-test were applied for the assessments of the newly developed method; the first path is the
individual t-test for each sample of CTX using both methods (classical and developed methodology), and the
second path is the paired t-test in order to compare between the two methods. Since all values obtained Table
POSTER PRESENTATION
263
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4. (tcal) less than (ttab) for the both two paths; these means that there is no significant difference between the
measurements of the mean of the samples using two methods and there is no significant difference between
the two methods.
Cefotaxime
Sefagen
Commercial name
Table 3. Standard addition results for the determination of CTX in two different pharmaceuticals preparation using two
methods.
Developed method using ISNAG fluorimeter (mV)
UV- spectrophotometric classical method absorbance measurement at ζmax = 276 nm
Confidence
interval for the
average Weight
of tablet
̅̅̅� ± .
� − ⁄√
Theoretical
Weight of sample
content for
the active equivalent to 2.3872 g
(50 mmol/L)
ingredient
of active ingredient
at 95% (g)
1.0β7λ ± 0.01β5
1 ± 0.0122
1.05γ4 ± 0.0β08
̂�
�
2.4538
=
̂� = .
�
1 ± 0.01λ7
̂�
�
2.5147
=
̂� = .
�
24.732
49.464
Practical weight of CTX
(g) ̅̅̅� � ±
.
� − ⁄√
0.00987
49.383
24.804
0.00969
Practical concentration
(mmol/L) in 10 mL *
Cefotaxime Sefagen
Equation of standard addition at 95% for n̂� = ± � + ± �
2�
[� ]
/�
Practical
concentration
(mmol/L) in 100 mL
β.γ616 ± 0.ββ11
. ±
[� ]
.
. ±
[� ]
.
± .
+
[� ]
+ .
/�
± .
+ .
/�
± .
.
±
/�
± .
+
[� ]
.
.
±
/�
Weight of CTX in vial
̅̅̅� � ±
.
�
−
⁄√
.
r
r2
R2 %
0.9820
0.9643
96.43%
0.9805
0.9614
96.14%
0.9881
0.9764
97.64%
0.9720
0.9448
94.48%
Efficiency of
determination
Recovery %
0.λ8λγ ± 0.0926
98.93 %
β.γ577 ± 0.β45λ
0.λ877 ± 0.1030
98.77 %
49.608
β.γ685 ± 0.β06β
0.λλββ ± 0.0864
99.22 %
48.476
β.γ144 ± 0.β4γ5
0.λ6λ5 ± 0.10β0
96.95 %
�̂� : in mV for developed method and absorbance for classical method, r: correlation coefficient, r2: coefficient of determination, R2%: explained
variation as a percentage total variation, t0.025,∞ = . 6 �� % , W̅i :Mean of weight for n=4. µμ quoted value (g). * Practical concentration
(mmol/L) in 10 mL: In classical method the concentration diluted to 0.02 mmol/L before the addition.
Table 4. Statistical treatments of newly developed method.
Developed method using ISNAG fluorimeter (mV)
UV- spectrophotometric classical method
Commercial
name,
Company
Sefagen,
Bilim
Cefotaxime,
LDP
Weight of CTX in vial
̅̅̅� � ± .
� − ⁄√
0.λ8λγ ± 0.0926
0.λ877 ± 0.1030
0.λλββ ± 0.0864
0.λ6λ5 ± 0.10β0
4. CONCLUSION
Individual t-test for
compared between quoted
value & practical value
̅̅̅� − � √ ⁄� −
|− .
|− .
|≪ .
|≪ .
Paired t –test compared between two
methods
� =
̅ √ ⁄�
−
��
at 95% confidence
level (n-1)
X̅dμ 0.01β15
σn-1: 0.01492
.
≪ . 6
The suggested methods are simple, sensitivities and rapid. The comparison between finally arrived ISNAG
procedure with classical spectrophotometric method was shown that with no doubt that newly developed
method is a good as the classical method. An alternative analytical method is found through this research
work, which based on simple parameter conditions.
POSTER PRESENTATION
264
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
REFERENCES
Adegoke, O. A. and M. O. Quadri (2016). "Novel spectrophotometric determinations of some cephalosporins
following azo dye formation with p-dimethylaminobenzaldehyde." Arabian Journal of Chemistry 9:
S1272-S1282.
Ali Ahmed, S. M., A. A. Elbashir and H. Y. Aboul-Enein (2015). "New spectrophotometric method for
determination of cephalosporins in pharmaceutical formulations." Arabian Journal of Chemistry 8(2):
233-239.
Andrási, M., A. Gáspár and A. Klekner (β007). "Analysis of cephalosporins in bronchial secretions by
capillary electrophoresis after simple pretreatment." Journal of chromatography. B, Analytical
technologies in the biomedical and life sciences 846(1-2): 355-358.
Arafat, M., S. Kon and M. Mikov (2015). "The measurement of cefotaxime sodium in rat plasma after oral
administration: a sensitive HPLC-UV method." Int J Pharm Pharm Sci 7(4): 343-346.
Bushra, M. U., N. Akter, M. R. Hassan, A. Islam and M. R. Hossain (2014). "Development and validation of
a simple UV spectrophotometric method for the determination of cefotaxime sodium in bulk and
pharmaceutical formulation." IOSR Journal of Pharmacy 4(1): 74-77.
Chen, D., H. Wang, Z. Zhang, L. Ci and X. Zhang (2011). "Chemiluminescence determination of cefotaxime
sodium with flow-injection analysis of cerium (IV)–rhodamine 6G system and its application to the
binding study of cefotaxime sodium to protein with on-line microdialysis sampling." Spectrochimica Acta
Part A: Molecular and Biomolecular Spectroscopy 78(1): 553-557.
Dehdashtian, S., M. Behbahani and A. Noghrehabadi (2017). "Fabrication of a novel, sensitive and selective
electrochemical sensor for antibiotic cefotaxime based on sodium montmorillonite
nonoclay/electroreduced graphene oxide composite modified carbon paste electrode." Journal of
Electroanalytical Chemistry 801: 450-458.
Du, J. and H. Li (2010). "Sensitive Chemiluminescence Determination of Thirteen Cephalosporin Antibiotics
with Luminol—Copper(II) Reaction." Applied Spectroscopy 64(10): 1154-1159.
Elbashir, A. A., S. M. A. Ahmed and H. Y. Aboul-Enein (2012). "New spectrofluorimetric method for
determination of cephalosporins in pharmaceutical formulations." Journal of fluorescence 22(3): 857-864.
Gáspár, A., M. Andrási and S. Kardos (β00β). "Application of capillary zone electrophoresis to the analysis
and to a stability study of cephalosporins." Journal of chromatography. B, Analytical technologies in the
biomedical and life sciences 775(2): 239-246.
Hill, J. B. (1965). "Automated fluorometric method for determination of serum calcium." Clinical chemistry
11(2): 122-130.
Legrand, T., D. Vodovar, N. Tournier, N. Khoudour and A. Hulin (2016). "Simultaneous Determination of
Eight ί-Lactam Antibiotics, Amoxicillin, Cefazolin, Cefepime, Cefotaxime, Ceftazidime, Cloxacillin,
Oxacillin, and Piperacillin, in Human Plasma by Using Ultra-High-Performance Liquid Chromatography
with Ultraviolet Detection." Antimicrobial agents and chemotherapy 60(8): 4734-4742.
McIlvaine, T. (1921). "A buffer solution for colorimetric comparison." J Biol Chem 49: 183–186.
Omar, M. A., O. H. Abdelmageed and T. Z. Attia (2009). "Kinetic spectrofluorimetric determination of
certain cephalosporins in human plasma." Talanta 77(4): 1394-1404.
Stirbet, D., I. Vasilescu and G.-L. Radu (2014). "SPECTROFLUORIMETRIC ANALYSIS OF
CEFOTAXIME
SODIUM
BY
USING
4-FLUORO-7-NITROBENZOFURAZAN
AS
DERIVATIZATION AGENT."
Sun, H., X. Cui, B. Liu and J. Zhang (2017). "Relationship between the color stability and impurity profile of
cefotaxime sodium." J Chromatogr B Analyt Technol Biomed Life Sci 1063: 235-244.
Xu, F., F. Wu, L. Chen, Z. Cai and X. Wei (2016). "Electrochemical Determination of Cefotaxime Using
Nafion-Graphene Oxide Modified Electrode." Asian Journal of Chemistry 28(1): 111.
POSTER PRESENTATION
265
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
LiCH3COO Modifiye Sepiyolit Nanokompozit Yapının Sentezi, Karakterizasyonu ve
Heterojen Katalizör Olarak Biyodizel Üretiminde Kullanabilirliğinin Araştırılması
Sema Aslan1*, Necdet Aka1, M. Hamdi Karaoğlu1
*1
Muğla Sıtkı Koçman Üniversitesi, Fen Fakültesi, Kimya Bölümü, Muğla, Türkiye
Sorumlu yazar e-posta: semaaslan@mu.edu.tr
Özet
Biyodizel üretiminde değişik metotlar kullanılmaktadır. Destekli katalizörler ile biyodizel üretimi
çalışmaları son yıllarda daha da önemli hale gelmiştir. Bu katalizörlerin tekrar kullanabilirliği, prosesi
daha da ekonomik yapmakta ve ürün kalitesini artırmaktadır. Yapılan çalışmada, öncelikle gözenekli
sepiyolit kil mineraline optimum şartlarda LiCH3COO yüklenmiştir. Elde edilen destekli nanokompozit
katalizörün yapısal karakterizasyonları FT-IR, XRD, SEM ve TEM ölçümleri ile gerçekleştirilmiştir.
Daha sonra bu LiCH3COO/sep. nanokompozit heterojen katalizörü kullanılarak, kanola yağından
biyodizel üretiminde reaksiyon sıcaklığı, değişik yağ/alkol oranı, karıştırma hızı, katalizör miktarının
etkisi ve reaksiyon süresi parametre olarak incelenmiştir. Bu kapsamda sentezlenen bu heterojen
katalizörün yenilenebilir bir yakıt olan biyodizel üretimi için çevreye duyarlı bir çalışma olduğu
düşünülmektedir.
Anahtar Kelimeler:
Transesterifikasyon.
Yenilenebilir
Enerji,
Biyodizel,
Heterojen
Katalizör,
Sepiyolit,
1. GİRİŞ
Biyodizel yenilenebilir ve çevre dostu bir yakıt olduğu için en potansiyel bir alternatif enerji kaynağıdır
(Suryaputra vd., β01γ). Biyodizel bir katalizör varlığında, trigliseritlerin kısa zincirli alkoller ile
transesterifikasyon reaksiyonu sonucunda üretilir (Sun vd., β010).
Katalizörlü transesterifikasyon reaksiyonları daha çok alkali, asidik ve enzimatik katalizör kullanılarak
gerçekleşmektedir. Son zamanlarda yapılan çalışmalarda mikroporoz zirkonyum, sülfatlı zirkonyum ve
titanyum temelli zeolit gibi heterojen katalizörlerde kullanılmaya başlanmıştır (Prakash, β006).
Transesterifikasyon reaksiyonu katalizörsüz ortamda β50 0C ve üstünde gerçekleşirken asidik, alkali veya
heterojen katalizör kullanımı sayesinde daha düşük sıcaklıklarda gerçekleşmektedir (Demirci ve Alpaslan,
1993; Richarda ve Vogel,1999 ).
Son yıllarda biyodizel üretiminde kullanmak üzere heterojen katalizör geliştirme çabaları hız kazanmıştır.
Proses sonrası ayırma, saflaştırma işlemlerinin olmaması, serbest yağ asitlerinin nötralizasyon adımını
elimine etmesi, trigliseritlerin sabunlaşmasının görülmemesi, metil ester ve gliserinde katalitik artık
bırakmaması ve üretimi daha ekonomik hale getiriyor olması, bu artışın en önemli sebepleridir. Aynı
zamanda heterojen katalizörlerde yüksek ürün dönüşümü elde edilebilir ve çevre dostu bu katalizörler
rejenere edilebilir özelliklere sahip katalizörlerdir (Marchetti vd., β007 ).
Bu çalışmada bir tür kil olan sepiyolit ile LiCH3COO birleştirilerek LiCH3COO/sep. nanokompozit heterojen
katalizörü sentezlenmiş ve yapısal karakterizasyonları gerçekleştirilmiştir. Sentezlenen katalizör kanola
yağından transesterifikasyon yöntemi ile biyodizel üretiminde kullanılmıştır. Bu amaçla biyodizel üretiminde
önemli parametreler olan metanol/yağ oranı, sıcaklık ve katalizörün dozajı etkileri incelenmiştir.
2. MATERYAL VE METOD
2.1. Katalizörün Hazırlanması
İki boyunlu balon içerisinde 5,87λ g CH 3COOLi 500 mL deiyonize saf suda çözüldükten sonra, çözelti
içerisine β0 g termal aktif sepiyolit ilave edilip, 60 °C de sabit tutularak β4 saat karıştırılmıştır. Karışım
süzülerek etüvde 110 °C sıcaklıkta β4 saat kurutulmuştur. Kurutma işleminden sonra, karışım 500 °C
sıcaklıkta 5 saat kalsine edilmiştir. Üretilen nanokompozit katalizör biyodizel deneylerinde kullanılmak
üzere desikatörde saklanmıştır.
POSTER PRESENTATION
266
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2.2. LiCH3COO/sep. Katalizörünün Yüzey ve Yapı Karakterizasyonu
Sentezlenen katalizörün yüzeysel ve yapısal özelliklerinin belirlenmesinde FT-IR, SEM, TEM ve XRD
cihazları kullanılmıştır FT-IR analizleri Perkin Elmer, SEM görüntüsü JEOL marka JSM-7600F model SEM
(Scanning Electron Microscope), TEM görüntüsü JEOL marka JEM 2100F HRTEM model TEM
(Transmission Electron Microscope) ve XRD analizi Rigaku marka Smart Lab model XRD (X-Ray
Diffractometer) cihazı ile karakterize edilmiştir.
2.3. Biyodizel Üretimi, Optimizasyonu ve Karakterizasyonuna Ait Deneylerin Yapılışı
Biyodizel üretimi, Şekil β.1’de gösterilen geri soğutucu, termometre ve manyetik karıştırıcı ile donatılmış
yuvarlak dipli (500 mL) üç boyunlu bir balon düzeneğinde gerçekleştirilmiştir. Üretime dair önemli
parametreler olan, katalizör miktarı, reaksiyon sıcaklığı, yağ/alkol oranı optimize edilmiştir. %3 ila %9
aralığında değişen miktarlarda belirlenen katalizörler, CH3OH ile birlikte reaktöre eklenerek 60 oC’de 1 saat
ısıtılmıştır. Daha sonra farklı yağ/alkol oranları kullanılarak değişen miktarlarda kanola yağı da karışıma
eklenerek γ saat karıştırılmıştır. Reaksiyon tamamlandıktan sonra, ele geçen ürün santrifüj edilerek üstte
kalan biyodizel fazı iki kez saf su ile yıkanmıştır. Ortamda reaksiyona girmeden kalan CH3OH, karışımın
105 oC’de ısıtılması yoluyla uzaklaştırılmıştır ve su içeriği de karışıma Na2SO4 ilave edilerek kurutulmuştur.
Tüm deneysel çalışmalar en az iki tekrarlı yapılmıştır. Sunulan veriler bu sonuçların ortalaması alınarak
oluşturulmuştur.
Şekil 2.1. Biyodizel üretiminde kullanılan reaktör
Üretilen biyodizelin bileşimi GC-MASS analizi sonrasında belirlenmiştir, analiz sonucunda elde edilen %
pik alanlarından faydalanılarak % verim hesabı yapılmıştır. Taşıyıcı gaz olarak helyum, iç standart olarak
metil heptadekanoat kullanılmıştır. Aşağıdaki formül kullanılarak % verim hesaplanmıştır.
% Verim = [(GC-MASS’den okunan % pik alanı x Biyodizel ağırlığı)/Yağ ağırlığı]x100
3. BULGULAR VE İRDELEME
3.1 LiCH3COO/sep. Katalizörün Karakterizasyon Çalışmaları
3.1.1. FT-IR ölçümleri
Ham sepiyolit ve LiCH3COO/sep. materyallerine ait 4000- 490 cm-1 aralığında elde edilen FT-IR
spektrumları Şekil γ.1.a ve Şekil γ.1.b’de gösterilmektedir. Ham sepiyolite ait spektrumda (Şekil 3.1.a)
bulunan 3451,62 cm-1 bandındaki geniş pik, sepiyolitin yapısındaki OH- grubuna aittir. 1644.83 cm−1 piki
sepiyolitin yapısında bulunan zeolitik suyun titreşimine işaret etmektedir. Ayrıca, 14β6,17 ve 1000 cm-1 deki
geniş pikler sırasıyla yapıya bağlı OH- gerilmelerini ve Si-O titreşimini göstermektedir (Alkan vd., β005).
Ham sepiyolitin yüzeyi Li2O ile kaplandığında yukarıda bahsi geçen karakteristik piklerde kaymalar
gözlenmiştir. Bu durum bağlanmanın sağlıklı bir şekilde gerçekleştiğinin göstergesidir.
POSTER PRESENTATION
267
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 3.1. a) Ham Sepiyolitin FT-IR spektrumu, b) LiCH3COO/sep. katalizörüne ait FT-IR spektrumları
3.1.2. XRD ölçümleri
Ham sepiyolit ve LiCH3COO/sep. katalizörlerine ait XRD spektrumları Şekil γ.2.a ve Şekil γ.2.b’de
sunulmuştur. XRD sonuçlarına göre LiCH3COO/sep. katalizörünün kalsinasyon işleminden sonra ham
sepiyolit üzerine LiCH3COO adsorpsiyonu başarıyla gerçekleşmiştir. Şekil γ.β.a ve b’de görülen XRD
piklerinden ham sepiyolit yapısının değişmediği (βθ=7.16) fakat kalsinasyon sonrasında elde edilen Şekil
γ.β.b’deki XRD spektrumundaki pik şiddetlerinde önemli azalmaların veya bazı piklerde kaybolmaların
olduğu görülmüştür.
3.1.3. SEM ve TEM analizleri
LiCH3COO/sep. katalizörlerine ait SEM ve TEM görüntüleri Şekil γ.3.a ve Şekil γ.γ.b’de sunulmuştur. Şekil
3.3.a incelendiğinde, kalsinasyondan sonra sepiyolit örneklerinde lifsi ve pürüzlü yapının belirgin bir şekilde
korunduğu, fakat üzerindeki heterojen olarak dağınık olan beyaz yapıların metal oksitlerden kaynaklandığı
tahmin edilmektedir. Şekil 3.3.b’de LiCH3COO/sep. katalizörüne ait TEM görüntüsü sunulmuştur. TEM
görüntüsü incelendiğinde, daha düzlemsel olan sepiyolit tabakaları yüzeyinde metal oksit tabakalarının
oluştuğu ve üç boyutlu lifli yapı katmanlarının daha da belirginleştiği görülmektedir.
POSTER PRESENTATION
268
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 3.2. a) Ham sepiyolite ait XRD pikleri, b) LiCH3COO/sep. katalizörüne ait XRD pikleri
POSTER PRESENTATION
269
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 3.3. LiCH3COO/sep. katalizörüne ait a) SEM ve b) TEM görüntüleri.
3.2. Deneysel Çalışmalardan Elde Edilen Bulgular
Transestirifikasyon deneysel çalışmalarında parametre olarak seçilen reaksiyon sıcaklığı, alkol/yağ oranı ve
katalizör miktarına ait % biyodizel verimleri hesaplanmış ve ilgili grafikler oluşturulmuştur. Heterojen
katalizör ile kanola yağı arasında gerçekleşen transesterifikasyon reaksiyonu Şekil γ.4.’de gösterilmiştir.
Şekil 3.4. Heterojen katalizör ile kanola yağı arasında gerçekleşen transesterifikasyon reaksiyonu
3.2.1. LiCH3COO/sep. katalizörünün aktivite testleri
Kanola yağının transesterifikasyon reaksiyonlarında LiCH 3COO/sep. katalizörünün aktivitesini araştırmak
için bir seri deney yapılmıştır.
3.2.1.1. Katalizör yükleme etkisi
Biyodizel üretimi üzerinde katalizör dozajı etkisi Şekil γ.5.a’da verilen grafikte gösterilmiştir. Metanol/yağ
oranı λ/1, sıcaklık 60 oC ve 180 dakika reaksiyon süresinde deneyler gerçekleştirilmiştir. LiCH3COO/sep.
katalizörünün miktarı %1.5’den %γ.0’a artırıldığında biyodizel üretim veriminin %45.11’den % 45.46’ya
yükseldiği, katalizör miktarı % 6.0’ya yükseldiğinde ise biyodizel veriminde %45.0γ değerine düşüş
görülmektedir. Bu durum LiCH3COO/sep. temelli biyodizel üretiminde uygulanabilecek en iyi katalizör
miktarının %γ.0 olduğunu göstermektedir.
3.2.1.2. Metanol/yağ oranı Etkisi
Biyodizel deneylerinde metanol/yağ oranı etkisi 3:1, 6:1, 9:1 ve 12:1 molar oranlarında çalışılarak
belirlenmiştir. LiCH3COO/sep. katalizöründe metanol oranı γμ1’den λμ1 molar oranına artırıldığında
biyodizel verimi %γ6.18’den %45.46’ya arttığı Şekil 3.5.b’de görülmektedir. Biyodizel üretiminde, kütle
transferi ve reaktantın katalizör yüzeyindeki adsorpsiyonu önemli rol oynamaktadır (Dehkordi ve Ghasemi,
β01β). Düşük metanol oranında, reaksiyon çözeltisi düşük süspansiyon oluşturur ve yağda iyi karışmamış
veya çözünmemiş metanol düşük biyodizel verimine neden olur. Metanol oranı düşük tutulduğunda, bu
durum kütle transferini sınırlar ve bu nedenle transesterifikasyon reaksiyonunu sürükleme gücü yeterli
POSTER PRESENTATION
270
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
gelmez. Yüksek metanol oranında ise (λμ1) metanolün yağda çözünmesi kolaylaştırılmış olur ve katı
katalizör süspansiyonunun kütle transfer problemini ortadan kaldırır (Olutoye ve Hammeed, 2013).
3.2.1.3. Biyodizel Verimi Üzerine Sıcaklığın Etkisi
Reaksiyon sıcaklığı heterojen katalizli transesterifikasyon prosesinde önemli bir etkiye sahiptir. Farklı fazlar
arasında difüzyon direnci var olduğundan, reaksiyon sisteminde yer alan yağ-metanol-heterojen katalizör üç
fazını içeren heterojen katalizör reaksiyonu yavaş olabilmektedir (Mohammed Takase, β014).
LiCH3COO/sep. katalizörü üzerinde sıcaklığın etkisi 50, 60 ve 70 oC değerleri için incelenmiş ve reaksiyon
veriminin sıcaklık artışıyla orantılı olarak arttığı görülmüştür (Şekil 3.5.c).
Şekil 3.5. LiCH3COO/sep. katalizörü kullanılarak üretilen biyodizellerin verimleri üzerinde a)
LiCH3COO/sep. katalizör miktarının etkisi, b) Metanol/yağ oranının etkisi, c) Reaksiyon sıcaklığının etkisi.
4.YORUM
LiCH3COO/sep. katalizörü sentezlenerek yüzey karekterizasyonu ve kimyasal yapısı FT-IR, XRD, SEM ve
TEM cihazları kullanılarak başarılı bir şekilde aydınlatılmıştır. Üretilen nanokompozit yapılı katalizörün
transesterifikasyon yöntemi ile biyodizel üretiminde alternatif olarak kullanılabilme potansiyelinin oldukça
yüksek olduğu deneysel çalışmalar neticesinde görülmektedir. Mevcut katalizörün yenilenebilirlik ve tekrar
kullanılabilirlik özelliği üzerinde çalışılarak, çözelti fazından ayrılması ve tekrar tekrar kullanımının
sağlanmasının ekonomik açıdan biyodizel üretim maliyeti üzerine oldukça büyük katkı sağlayacağı
düşüncesindeyiz.
TEŞEKKÜR
Bu çalışmayı 1γ/1β5 numaralı Bireysel Araştırma Projesiyle desteklediği için Muğla Sıtkı Koçman
Üniversitesi Bilimsel Araştırma Projeleri Koordinasyon Birimine teşekkür ederiz.
KAYNAKLAR
Alkan M, Tekin G, Namli H 2005. FT-IR and zeta potential measurements of sepiolite treated with some
organosilanes. Microporous and Mesoporous Materials, 84: 75–83.
Dehkordi AM, Ghasemi M 2012. Transesterification of waste cooking oil to biodiesel using Ca and Zr mixed
oxides as heterogeneous base catalysts. Fuel Processing Technology, 97: 45–51.
Demirci M, Alparslan M 1993. Bitkisel Yağ Teknolojisi, Trakya Üniversitesi Ziraat Fakültesi Basımevi, s 125.
Karmakar A, Karmakar S, Mukherjee S 2010. Properties of various plants and feedstocks for biodiesel
production. Biosource Technology, 101: 7201-7210.
POSTER PRESENTATION
271
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Madhuvilakku R, Piraman S 2013. Biodiesel synthesis by TiO2–ZnO mixed oxide nanocatalyst catalyzed
palm oil transesterification process. Bioresource Technology, 150: 55–59.
Marchetti JM, Miguel VU, Errazu AF 2007. Possible methods for biodiesel production. Renewable and
Sustainable Energy Reviews, 11: 1300-1311.
Olutoye MA, Hameed BH 2013. A highly active clay-based catalyst for the synthesis of fatty acid methyl
ester from waste cooking palm oil. Applied Catalysis A: General, 450: 57– 62.
Prakash N, Arul Jose A, Devanesan MGT 2006. Optimization of Karanja oil transesterification. 13: 505-509.
Richarda JY, Vogel TM 1999. Characterization of a soil bacterial consortium capable of degrading diesel
fuel. International Biodeterioration & Biodegradation, 44: 93-100.
Sun H, Ding Y, Duan J, Zhang Q, Wang Z, Lou H, Zheng X 2010. Transesterification of sunflower oil to
bodiesel on ZrO2 supported La2O3 catalyst. Bioresource Technology, 101: 953–958.
Suryaputra W, Winata I, Indraswati N, Ismadji S 2013. Waste capiz (Amusium cristatum) shell as a new
heterogeneous catalyst for biodiesel production. Renewable Energy, 50: 795-799.
Takase M, Chen Y, Liu H, Zhao T, Yang L, Wu X 2014. Biodiesel production from non-edible Silybum
marianum oil using heterogeneous solid base catalyst under ultrasonication. Ultrasonics Sonochemistry,
21: 1752–1762.
POSTER PRESENTATION
272
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Rational Formation of Peptides Hybrid Nanoflower With Its Enzyme-Mimic and
Antimicrobial Activities
Didar Tasdemir1, Cagla Celik1, Sadi Yusufbeyoglu1, Nilay Ildiz2, Ilker Avan3, Vedat Yilmaz1,* and
Ismail Ocsoy1,*
1
Department of Analytical Chemistry, Faculty of Pharmacy, Erciyes University, 38039, Kayseri, Turkey
2
Department of Pharmaceutical Microbiology, Faculty of Pharmacy, Erciyes University, 38039 Kayseri,
Turkey
3
Department of Chemistry, Faculty of Science, Anadolu University, 26470, Eskisehir, Turkey
Corresponding author e-mail:ismailocsoy@erciyes.edu.tr
Corresponding author e-mail: vyilmaz@erciyes.edu.tr
Abstract
In this study, we develop, for the first time, the synthesis of novel peptide-inorganic hybrid
nanoflowers (HNFs) formed of tripeptide as an organic component and copper (II) ion as an
inorganic component in phosphate buffer saline (PBS) solution and to cast light on their
peroxidase mimic and antimicrobial activities. The peptide used in the HNF was synthesized
from three nonpolar and hydrophobic amino acids (glycine, leucine and phenylalanine). The
presence of abundantly nonpolar R groups, Cu2+ ions and pores in the HNFs are relatively
responsible in performing their peroxidase mimic activity by oxidation of guaiacol to colored
3,3-dimethoxy-4,4-diphenoquinone in the presence of hydrogen peroxide (H2O2) based on
mechanism of Fenton-like reaction. The number of hydrophobic sites in the the HNFs and
aforementioned factors above may play roles in denaturing bacterial cell membrane and lead to
eventual cell death.
Keywords: Amino acids, Peptide, Nanoflower, Peroxidase like Activity and Antimicrobial
Activity
1. INTRODUCTION
In recent years, researchers have put much effort into developing the strategies for synthesis of functional
bio-materials for benefiting from their enhanced properties [Yao et al., 2011, Ye et al., 2016]. For instance,
in 2012, Zare and co-workers discovered an encouraging breakthrough in fabrication of immobilized
enzymes with greatly enhanced activity and stability. They reported the synthesis of flower shaped organicinorganic hybrid nanostructures consisting of protein and salt nanocrystals (copper phosphate) by selfassembly strategy [Gu et al., 2012]. Due to this inspirational work, several researchers have used various
biomolecules (protein, enzyme and amino acids) and metal-phosphate nanocomplexes for underlying
principles of organic-inorganic hybrid nanostructures formation and enhancement in catalytic activity and
stability [Altinkaynak et al., 2016, Lin et al., 2014, Yu et al., 2015, Somturk et al., 2015, Ocsoy et al., 2015,
Somturk et al., 2016, Altinkaynak et al., 2016, Zhu et al., 2013, Ildiz et al., 2017 and Baldemir et al., 2017].
In this study, we develop, for the first time, the synthesis of novel peptide-inorganic hybrid nanoflowers
(HNFs) formed of tripeptide as an organic component and copper (II) ion as an inorganic component in
phosphate buffer saline (PBS) solution and to cast light on their peroxidase mimic and antimicrobial
activities with Fenton like reaction. The peptide used in the HNF was synthesized from three nonpolar and
hydrophobic amino acids (glycine, leucine, and phenylalanine). Although amino acids (AAs), peptides and
proteins act as biocides against various pathogens including bacteria, fungi and viruses, however, their poor
bio-stability due to rapid degradation by proteases, tedious synthesis procedures and difficulty to react with
cell membranes strictly limits their use in biomedical applications [Wu et al., 2016, Avan et al., 2016, Avan
et al., 2014].
POSTER PRESENTATION
273
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS AND METHODS
2.1.Chemicals and Instrumentation
Glycine, leucine, phenylalanine, bovine serum albumin (BSA), copper sulfate pentahydrate, phosphate
buffered saline, guaiacol, hydrogen peroxide and Coomassie brilliant blue G-250 were purchased from
Sigma-Aldrich. Deionized water (18.βMΩν MilliporeCo., USA) was used in all experiments. UV–vis
spectrophotometry, scanning electron microscopy (SEM) and Energy-dispersive X-rays pectroscopy (EDX)
were used to characterize the HNFs.
2.2. Preparation of Tripeptides HNFs
Tripeptide and tripeptide HNFs were synthesized using reported methods. 0.02 mg mL −1 tripeptide powder
was dissolved in 10 mM phosphate buffered saline (PBS) solution (pH 7.4) and certain volume of CuSO 4
solution was added to the mixture (final concentration of CuSO 4 solution was fixed to 0.8 mM. After
addition of CuSO4 solution, the final mixture was vigorously and was then left undisturbed for incubation
room temperature (RT = β5°C) for γ days. In general, a blue-colored precipitate at the bottom of reaction
tube can be considered as indication of HNF formation). After 3 days, the mixture was centrifuged at 12 000
rpm for 20 min in order to collect the HNF powder and discarded unreacted components. The HNF
precipitates were dried under vacuum at room temperature and stored for futher characterization and use.
The glycine, leucine, phenylalanine HNFs were synthesized following the same procedure.
2.3. Peroxidase-Like and Antimicrobial Activites
The tripeptide HNF powder was dissolved in 1 mL of PBS and then 1 mL of 22.5 mM hydrogen peroxide
(H2O2) and 1 mL of 45 mM guaiacol were added to the mixture. The oxidation of guaiacol to colored 3,3dimethoxy-4,4-diphenoquinone was spectrophotometrically observed with the changes in the absorbance at
470 nm.
Antimicrobial activities of free tripeptide and HNFs were tested using in vitro microdilution method based
Clinical and Laboratory Standards Institute. The 1×10 8 CFU/ml concentration of bacterial and 1x10 6 CFU/ml
concentration of fungal cells (adjusted in 1 mL of NB and YEPDB) were separately mixed with free
tripeptide and HNF solutions. The each mixture was incubated for 24 hours for activation at 0.5 McFarland
standard turbidity. The Minimum inhibitory concentrations (MIC) with a µg/mL were spectrometrically for
each bacterial and fungal strain. All experiments were set up in two parallels and repeated four times.
2.4 Figures
Figure 1. Time dependent HNF formation with various incubation times. A) in one day, B) in two days and C) in three
days. D) High magnification SEM image of HNF.
POSTER PRESENTATION
274
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
A
B
C
D
Figure 2. The SEM images of A) glycine, B) leucine, C) phenylalanine and D) peptide HNFs
Figure 3. A) No peptide based HNFs formed at pH A) 10 and B) 4.
Figure 4. A) XRD patterns of the HNF (black line). The peak position of the Cu3(PO4)2·γHβO (red line,
JCPDS card (00-022-0548) located for comparison. B) EDX analysis of the HNF.
POSTER PRESENTATION
275
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 5. Addition of A) formaldehyde and B) EDTA.
Fig. 6. A) The absorbance changes of product with AAs and peptide HNFs. B) The antimicrobial activities
of AAs and peptide HNFs.
POSTER PRESENTATION
276
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3. RESULTS
In typical synthesis strategy based on the coordination chemistry, Cu 2+ ions react with amine and carboxyl
groups of the peptide to form hybrid nanoflowers in 10 mM PBS solution at pH 7.4. The HNFs are
hierarchically and kinetically formed in incubation of three days in 10 mM PBS solution at pH 7.4. The
small size petals on primary nanocrystals appear in Figure 1A with 1 day incubation. The incorporation of
the petals for procreation of the HNFs is observed in Figure 1B at the second incubation days. The whole
HNF formation was completed, as seen in Figure 1C. The high magnification image shows the petals
assembly and porous structure of a HNF in Fig. 1D.
The AAs HNFs were also produced to compare their morphologies with the peptide HNFs, as shown in
Figure 2. While the each AA-incorporated HNF is sphere and has almost the same size (∼14 ηm) (Figure
2A, 2B and 2C), the peptide based HNF resulted in more blooming structures with diameters ∼λ.5 ηm in size
(Figure 2D). We claim that using peptides somehow restrict the growth of HNF and lead the more compact
morphology due to tight binding between peptides molecules and copper phosphate nanocrystals. Synthesis
of the HNFs were achieved at PBS pH values pH 5 thru 10. Although all AAs HNFs were not formed at pH
9 and above and pH 5 and below, peptide HNFs were obtained at both pH 5 and 9 (data not shown). In
addition to that, while the precipitates even were not observed at pH 10 and pH 4 when AAs used, the
peptides give blue colored precipitates at those pH values but the peptide HNFs were not formed due to
incompletion the growth process (Figure 3A and 3B). The structure of primary crystal in the all HNFs was
analyzed by XRD. The most of the diffraction peaks of primary crystal pertaining to the Cu 3(PO4)2, which
was quite consistent with that of JCPDS card (00-022-0548) (Figure 4A). The presence of Cu in the HNF
powder was indicated with EDX analysis (Figure 4B). We further examined the effect of formaldehyde on
morphology of the HNFs (Figure 5A). It is known that ethylenediaminetetraacetic acid (EDTA) strongly
attack to most of the metal ions for formation of EDTA-metal ions complexes. Addition of EDTA to the
nanoflower solution caused the loss of the flower structure due to removal of the Cu 2+ ions, which are
indispensable component for nanoflower formation (Figure 5B). We demonstrated that the formaldehyde
was not able to completely remove the Cu2+ ions but may weaken bond strength between amines groups and
Cu2+ ions or partially break bond presented between Cu2+ ions and amine groups, both of which distort the
morphology of the HNFs (Figure 5).
In our work, plenty of nonpolar R groups, Cu2+ ions and pores, much highly enhance catalytic performance
of the peptide HNFs compared to the AAs HNFs. The peptide HNFs consisting of abundant nonpolar
aliphatic and aromatic R groups lead to produce Cu1+ ions in the HNFs, which may oxidize the guaiacol. The
peroxidase-like activities of AAs and peptide HNFs are given on Table 1. Several metal compounds
including copper show intrinsic peroxidase-like activity in the presence of H2O2 based on Fenton-like
reaction mechanism. The enzyme mimic activity of AAs and peptide HNFs was systematically studied
towards guaiacol in the presence of H 2O2 and the absorbance changes of the product were measured at 470
nm as shown in Figure 6A. Qu and co-workers commentate that protein-incorporated nanoflowers exhibited
peroxidase-like activity depending on the reaction mechanism of Fenton-like reaction. In addition to that Dr.
Li and co-workers speculate that the electronegativity of R groups of amino acids play a role in comparison
of peroxidase-like activity performance of amino acid NFs [Vlieghe et al., 2010 and Tsai et al., 2015]. We
also tested the antimicrobial activities of the HNFs. Although, free amino acids and tripeptides showed no
antimicrobial activity, the HNFs exhibited mid antimicrobial activity against Enterococcus faecium (E.
faecium) and Enterococcus faecalis (E. faecalis) as Gram-positive bacteria. The AAs HNFs caused ∼20% of
E. faecium and E. faecalis cell inactivations however over ∼50% of cell death for both E. faecium and E.
faecalis bacteria was observed when peptide HNF was used (Figure 6B). We assume that HNFs may
electrostatically and hydroponically interact the bacterial membrane consisting of plenty of negatively
charged and hydrophobic phospholipids and kill the bacterial cells by denaturing the membrane structure.
We also consider that the bacteria can be entrapped into the pores the peptide HNFs, thus almost the entire
cell surface is influenced by the HNFs. It is worthy to mention that in Fenton chemistry, metal and metal ions
act Fenton’s reagent to produce various radicals, which result in the cell inactivation [Lloyd et al., 1997 and
Sutton et al., 1989].
4. DISCUSSION
Flower shaped morphology was obtained in three successive steps. In first step, Cu2+ ions react with
phospate ions (PO4)3-) to form Cu3(PO4)2 primary nanocrystals as seed. In secend step, the amine and
POSTER PRESENTATION
277
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
carboxyl groups of AA and peptide bind to nanocrystals to initiate the formation of petal. In the final step,
AA and peptide act as a glue to combine petal together to generate flower like structures. ,
It is worthy to mention that copper compounds exhibit peroxidase type activity in the presence of hydrogen
peroxide (H2O2). The mechanism for this reaction called “fenton-like reaction” as shown in Figure 7. The
HNFs were considered as Fenton agent by reacting of Cu2+ ions in i HNFs with H2O2 to form Cu1+ ions. The
reaction of Cu1+ with H2O2 results in a highly reactive hydroxyl radical. This free hydroxyl radical initiates
the oxidation of the substrate and formation of product proceeds through this mechanism. Peroxidase-like
activities of the HNFs are significantly increased by increasing H2O2 and catalyst concentration.
Figure 7. mechanism of Fenton-like reaction.
5. CONCLUSION
In conclusion, the HNFs composed of amino acids and tripeptides and Cu 2+ in PBS were synthesized and
their peroxidase-mimic activity against guaiacol and antimicrobial activity towards E. faecium and E.
faecalis were investigated. We concluded that although all HNFs showed peroxidase like activity through
Fenton like reaction, peptide HNF exhibited higher catalytic activity than AAs HNFs due to its highly porous
structure and the high surface area. Moreover, peptide HNF showed much inhibition for the bacterial cell
growth compared to AAs HNFs. This encouraging breakthrough in immobilization and structural and
functional properties of the HNFs have a great potential to vary type of biomolecules and inorganic salt for
producing new hybrid nanostructures and widen their use in various scientific and technical fields.
ACKNOWLEDGEMENTS
This work was supported by grants from the Erciyes University Scientific Research Office (FBA-20166899).
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
Altinkaynak C, Tavlasoglu S, Ozdemir N, Ocsoy I 2016. A new generation approach in enzyme
immobilization: Organic-inorganic hybrid nanoflowers with enhanced catalytic activity and stability,
Enzyme and Microbial Technology, 93–94:105–112.
Altinkaynak C, Yilmaz I, Koksal Z, Ozdemir H, Ocsoy I, Ozdemir N 2016. Preparation of lactoperoxidase
incorporated hybrid nanoflower and its excellent activity and stability, International Journal of Biological
Macromolecules, 84:402–409.
Avan I 2016. Microwave-assisted synthesis of β,β′-azopyridine-labeled amines, amino acids, and peptides,
Synthesis 48:365–378.
Avan I, Hall C.D, Katritzky A.R, 2014. Peptidomime-tics via modifications of amino acids and peptide
bonds, Chemical Society Reviews, 43:3575-3594.
Baldemir A, Köse B, Ildız N, İlgün S, Yusufbeyoğlu S, Yilmaz Y, Ismail O 2017. Synthesis and
characterization of green tea (Camellia sinensis (L.) Kuntze) extract and its major components-based
nanoflowers: a new strategy to enhance antimicrobial activity. RSC Advances, 7: 44303-44308.
Ge J, Lei J, Zare R.N 2012. Protein–inorganic hybrid nanoflowers, Nature Nanotechnolog 7:428– 432.
Ildiz N, Baldemir A, Altinkaynak C, Özdemir N, Yilmaz V and Ismail O 2017. Self-assembled snowballlike hybrid nanostructures comprising Viburnum opulus L. extract and metal ions for antimicrobial and
catalytic applications, Enzyme and Microbial Technology, 102:60–66.
Lin Z, Xiao Y, Wang L, Yin Y, Zheng J, Yang H, Chen G 2014. Facile synthesis of enzyme-inorganic
hybrid nanoflowers and their applica-tion as an immobilized trypsin reactor for higly efficient protein
digestion, RSC Advances, 4:13888.
Lloyd R.V, Hanna P.M, Mason R.P 1997. The origin of the hydroxyl radical oxygen in the Fenton
reaction, Free Radical Biology and Medicine, 22:885–888.
POSTER PRESENTATION
278
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Ocsoy I, Dogru E, Usta S 2015. A new generation of flowerlike horseradish peroxides as a nanobiocatalyst
for superior enzymatic activity, Enzyme and Microbial Technology, 75–76:25–29.
Somturk B, Hancer H, Ocsoy I, Özdemir N 2015. Synthesis of copper ion incorporated horseradish
peroxidase-based hybrid nanoflowers for enhanced catalytic activity and stability, Dalton Transactions,
44:13845–13852.
Somturk B, Yilmaz I, Altinkaynak C, Karatepe A, Özdemir N, Ocsoy I 2016. Synthesis of urease hybrid
nanoflowers and their enhanced cataly-tic properties, Enzyme and Microbial Technology, 86:134–142.
Sutton H.C, Winterbourn C.C 1989. On the participation of higher oxidation states of iron and copper in
Fenton reactions. Free Radical Biology and Medicine, 6:53–60.
Tsai C.Y, Chen Y.J, Fu Y.S, Chang L.S 2015. Antibacterial and membrane-damaging activities of
mannosylated bovine serum albümin, Archives of Biochemistry and Biophysics, 573:14–22.
Vlieghe P, Lisowski V, Martinez J, Khrestchatisky M 2010. Synthetic therapeutic peptides: science and
market, Drug Discovery Today, 15:15-40.
Wu Z.F, Wang Z, Zhang Y, Ma Y.L, He C.Y, Li H, Chen L, Huo Q. S, Wang L, Li Z.Q 2016. Amino
acids-incorporated nanoflowers with an intrinsic peroxidase-like activity, Scientific Reports, 6:1- 7.
Yao H.B, Fang H.Y, Wang X.H, Yu S.H 2011. Hierarchical assembly of micro-/nano-building blocks:
bio-inspired rigid structural functional materials, Chemical Society Reviews, 40:3764–3785.
Ye R, Zhu C, Song Y, Lu Q, Ge X, Yang X, Zhu M.J, Du D, Li H, Lin Y 2016. Bioinspired synthesis of
All-in-one organic–inorganic hybrid nanoflowers combined with a handheld pH meter for on-site
detection of food pathogen, Small, 12:3094–3100.
Yu Y, Fei X, Tian J, Xu L, Wang X, Wang Y 2015. Self-assembled enzyme-inorganic hybrid nanoflowers
and their applicaiton to enzyme purification, Colloids and Surfaces B: Biointerfaces, 130:299–304.
Zhu L, Gong L, Zhang Y, Wang R, Ge J, Liu Z, Zare R.N 2013. Rapid detection of phenol using a
membrane containing laccase nanof-lowers, Chemistry – An Asian Journal, 8:2358–60.
POSTER PRESENTATION
279
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Chemical Treatability of Olive Oil Mill Wastewater (OMW)
Ezgi Oktav Akdemir1*
*1
Dokuz Eylul University, Engineering Faculty, Environmental Engineering Department, İzmir, Turkey
ezgi.oktav@deu.edu.tr
Abstract
Olive oil production is one of the most important agricultural activities in the Mediterranean
area and it is economically important for several countries. Olive mill wastewater (OMW) is a
major waste stream resulting from numerous operations that occur during the production stages
of olive oil. The disposal of OMW is a serious environmental problem in particular in the
Mediterranean Sea region with its high organic matter, suspended solid, phenolic compound
content and acidic pH. In this study, chemical treatability of OMW with ferric trichloride
(FeCl3) was investigated. In experimental studies, jar test experiments were carried out with
different concentrations of FeCl3 (100-500 mg/l) with rapid mixing, slow mixing and
precipitation processes. Chemical treatment with FeCl 3 was applied to raw OMW and filtered
OMW, separately. The maximum COD removal efficiency was achived at high FeCl 3
concentration and filtered OMW. COD removal efficiency was 32% when 500 mg/l FeCl3 was
added to raw OMW, but this efficiency increased to 50% when FeCl 3 was added to the filtered
OMW at the same concentration.
Keywords: Olive oil industry, olive mill wastewater, FeCl3.
1. INTRODUCTION
Olive oil extraction produces vast amount of liquid and solid wastes, which are called as olive mill
wastewater (OMW), and olive mill residue (OMR). Although olive oil is an exceptional nutritional value, a
high amount of OMW is produced during production, which in turn affects the environment negatively.
Approximately 30 million m3 of OMW is produced annually in the Mediterranean region. A high pollutant
load also occurs in this case (Chiavola et al., 2014). Particularly Mediterranean countries face serious
problems in the management of OMW.
The chemical composition of OMW varies considerably depending on various factors such as olive type, tree
age, cultivation system, fruit maturity level, geographical and climatic conditions, type of oil extraction
process applied, use of pesticides and fertilizers, etc. (Yay et al., 2012). OMW is characterized by dark
brown color, characteristic unpleasant odor, low pH, a high suspended solids content, high turbidity and high
organic load (Amor et al. 2015).
Several investigative projects have been carried out in order to create an appropriate and effective treatment
method for the produced olive mill wastewaters (OMW). Some of the proposed methods are direct
application on soil or evaporation in lagoons. Biological methods contain several methods of OMW
management, such as microbiological treatment, composting, aerobic digestion, anaerobic digestion
(Paraskeva and Diamaduopulos, 2006). Advanced oxidation processes includes the Fenton reaction, photo–
Fenton reaction and ozonation are the other treatment processes for OMW (Mantzavinos, 2005; Giannis
et.al., 2007). Furthermore, the physico‐ chemical treatment methods such as membrane filtration,
coagulation/flocculation and electro‐ coagulation are very prevalent (Iakovides et.al.,2016).
There are many studies that OMW has been purified by coagulation and flocculation. Curi et al. (1980) have
tested the treatment of OMW with a mixture of aluminum sulfate and ferric chloride, calcium hydroxyde
solution and also acidifying of the waste with hydrochloride acid solution. They have determined the
claryfying percent of the wastewater. Calcium hydroxide and aluminium sulfate has also been used besides
magnesium sulfate in another study (Tsonis et.al., 1989). The values of pH, fixed solids, total solids, volatile
solids and COD have been determined after the treatment of OMW with the chemicals. They have reported
that COD value dropped to 20 –30% with calcium hydroxide, when it was added until the pH of the waste
POSTER PRESENTATION
280
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
reached 11. Sarika et.al. (2005) studied coaulation and flocculation of OMW with cationic and anionic
polyelectrolytes, lime and FeCl3. They found minimum coagulant dosage to attain solid-liquid seperation
was 2.5-3 g/l. 40% COD removal and 45%BOD removal efficiencies were obtained in their work. Alver
et.al. (2015) investigated coagulation with FeSO 4 and Fenton reaction. They obtained higher removal
effficiency, such as 65.5 % COD removal by sequantial coagulation and Fenton process.
In the content of this study FeCl3 was used as a coagulant for chemical treatment of olive mill wastewater.
Different concentration of FeCl3 was added to raw and filtered OMW and chemical treatability of OMW was
investigated in term of COD removal efficiency.
2. MATERIALS AND METHODS
2.1. Sample Collection
Olive oil mill wastewater was taken from a 3-phase continuous olive oil mill plant located in Izmir-Turkey.
Samples were collected in December from the effluent of the horizontal decanter. Fresh sample was kept in
dark at 4C.
2.2. Coagulation-Flocculation Experiments
Coagulation and flocculation experiments were performed using Jar-test equipment (VelpScientifica
Flocculation Test Unit) given in Figure 1. pH value of wastewater was increased from 5.5 to 9 with the
addition of 10 % Ca(OH)2 solution. Ca(OH)2 consumption was 300 ml/L of wastewater. Then jar tests were
carried out. Desired concentration of FeCl3 (100-500 mg/l) and 300 ml of OMW were added to beaker each
containing 500 ml volume. First, three minutes rapid mixing at 225 rpm for 3 minutes and then 45 minutes
slow mixing at 45 rpm were applied. Subsequently, the stirring was stopped and 120 minute settling time
was applied. Following the settling time, samples were collected from clear supernatant using a syringe.
Figure 1. Jar Test Equipment
2.3. Analytical Methods
COD, TOC, pH, SS, oil and grease measurements were carried out on the influent and COD measurements
was applied on effluent samples for the characterization and treatment studies. COD, SS, oil and grease
analyses carried out according to Standard Methods (APHA, AWWA). Dohrmann DC-190 High
POSTER PRESENTATION
281
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Temperature TOC Analyzer was used for TOC measurements. pH measurement was done by using 890 MD
pH meter.
3. RESULTS AND DISCUSSIONS
3.1. Characterization of Olive Oil Mill Wastewater
Fresh OMW used in this work was obtained from three phase continuous plant. The main physicochemical
characteristics of the used OMW are given in Table 1. OMW has dark brown color and characteristic smell.
Table 1. The Main Characteristics of OMWW Used in this Study
Parameter
unit
value
pH
-
5.5
COD
mg/l
108000
TOC
mg/l
48580
TS
mg/l
65120
TSS
mg/l
12310
Oil and grease
mg/l
2720
3.2. Chemical Treatability Studies with FeCl3
In the first part of experiments, FeCl3 was added to raw OMW sample in different doses between
100-500 mg/l. pH value of wastewater was increased from 3.5 to 9 with the addition of 10 % Ca(OH) 2
solution, then jar tests were carried out. Results of this experiment are given in Table 2. The removal
efficiency of FeCl3 was increased with increasing FeCl3 doses. Initial COD concentration was 108000 mg/l
for raw OMW sample. COD concentration of wastewater after adding 300 mg/l FeCl3 was 95000 mg/l. It
decreased to 86000 mg/l and 73000 mg/l by adding 400 mg FeCl3/l and 500 mg FeCl3/l, respectively. The
results indicated that FeCl3 is an effective coagulant for COD removal from olive mill wastewater at high
doses.
Table 2. COD Removal Efficiency of Coagulation Experiments with FeCl3
Dosage of FeCl3
(mg/l)
COD (mg/l)
COD (mg/l)
COD removal efficiency
(%)
before treatment
after treatment
100
108000
100000
7
200
108000
97000
10
300
108000
95000
12
400
108000
86000
20
500
108000
73000
32
In the second part of experiments, raw OMW sample was filtered from filter paper in 0.80 mm pore
diameter. In this case, COD concentration of raw OMW decreased from 108000 mg/l to 88000 mg/l with
18% COD removal efficiency. pH value was increased to around pH=6-7 with the addition of 10 % Ca(OH)2
solution in order to reach neutral pH. Then different dosage of FeCl 3 (100-500 mg/l) was added to
wastewater and jar test was carried out. After settlement, supernatant was taken and COD concentration was
measured. All results are given in Table 3. As it can be seen from table, filtration positively affected COD
removal efficiency. Also, COD removal efficiency was increased by increasing the FeCl3 concentration.
POSTER PRESENTATION
282
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 3. COD Removal Efficiency of Coagulation Experiments with FeCl3 on Filtrated Wastewater
COD (mg/l)
COD (mg/l)
Dosage of FeCl3
(mg/l)
COD (mg/l)
raw OMW
after filtration
108000
88000
100
81000
25
108000
88000
200
78000
28
108000
88000
300
72000
33
108000
88000
400
63000
42
108000
88000
500
54000
50
after treatment
COD removal
efficiency (%)
4. CONCLUSION
The aim of this study was to investigate the characterization and treatability of the olive mill wastewater with
FeCl3 coagulation. 32% COD removal efficiency was achieved by chemical coagulation-flocculation
experiment with FeCl3 with raw OMW. When the filtered OMW was coagulated with FeCl3, COD removal
efficiency reached 50%. However, the COD concentration of OMW in the wastewater is still as high as
54000 mg/l.
As a result of all experimental studies, it was impossible to achieve the discharge standards with these
methods, since the discharge standard is 250 mg COD/l for olive oil industry. Therefore, further treatment is
needed to reduce the COD concentration. When chemical treatment methods were applied alone, significant
improvement in COD reduction was not observed. Physical, chemical, and biological treatment alternatives
should be applied sequentially for achieving wastewater discharge standards for olive mill wastewaters.
REFERENCES
Alver A, Bastürk E, Kılıc A, Karatas M 2015. Use of advance oxidation process to improve the
biodegradability of olive oil mill effluents., Process Safety and Environmental Protection, 98: 319–324.
Amor C, Lucas MS, García J, Dominguez JR, De Heredia JB, Peres JA 2015. Combined treatment of olive
mill wastewater by Fenton's reagent and anaerobic biological process. Journal of Environmental Science
and Healt: Part A, 50: 161-168.
APHA, AWWA Standard Methods for the Examination of Water and Wastewater (twentieth ed.), American
Public Health Association, Washington, DC, USA 1998.
Chiavola A, Farabegoli G, Antonetti F 2014. Biological treatment of olive mill wastewater in a sequencing
batch reactor. Biochemical Engineering Journal, 85: 71-78.
Curi K, Velioğlu S, Diyamandoğlu V 1980.Treatment of olive oil production wastes in:Treatment and
disposal liquid and solid industrial wastes ,ed. K. Curi, Pergamon Press,Oxford, 1980, pp.189 –205.
Giannis A, Kalaitzakis M and Diamadopoulos E 2007. Electrochemical treatment of olive mill
wastewater. Journal of Chemical Technology and Biotechnology, 82:663–671.
Iakovides, I C, Pantziaros, A G, Zagklis, D P, Paraskeva CA 2016. Effect of electrolytes/polyelectrolytes on
the removal of solids and organics from olive mill wastewater, Journal of Chemıcal Technology and
Bıotechnology, λ1 (1) β04-211.
Mantzavinos D and Kalogerakis N 2005. Treatment of olive mill effluents: Part I. Organic matter
degradation by chemical and biological processes: An overview, Environmental International, 31:289–
295.
Paraskeva P and Diamadopoulos E 2006. Technologies for olive mill wastewater (OMW) treatment: A
review. Journal of Chemical Technology and Biotechnology, 81:1475–1485.
Sarika R, Kalogerakis N, Mantzavinos D 2005. Treatment of olive mill effluents. Part II. Complete removal
of solids by direct flocculation with polyelectrolytes, Environmental International 31: 297–304.
Tsonis SP, Tsola VP, Grigoropoulos SG 1989. Systematic characterization and chemical treatment of olive
oil mill wastewater, Toxicological & Environmental Chemistry, 20-21: 437 –457.
Yay ASE, Oral HV, Onay TT, Yenigün O 2012. A study on olive oil mill wastewater management in
Turkey: a questionnaire and experimental approach. Resource Conservation Recycling 60: 64-71.
POSTER PRESENTATION
283
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Biyoçeşitliliğin İzlenmesi ve Korunmasında Coğrafi Bilgi Sistemlerinin (CBS) Kullanımı
Salih Doğan1, Meryem Bingül Türk1*, Sibel Doğan1, Ozan Arif Kesik2
Erzincan Üniversitesi, Fen Edebiyat Fakültesi, Biyoloji Bölümü, Erzincan, Türkiye
Erzincan Üniversitesi, Fen Edebiyat Fakültesi, Coğrafya Bölümü, Erzincan, Türkiye
1
2
*
Sorumlu yazar e-mail: mbingul@erzincan.edu.tr
Özet
Mekânsal teknolojilerin kullanımı günümüzde hayatımızı etkileyen ve yönlendiren boyuta gelmiştir. Bu
teknolojilerin kullanımı bilgi karmaşasını azaltmakta ve yapılan Coğrafi Bilgi Sistemlerine (CBS) dayalı
analizler sonucu yöneticiler, idareciler ve bilim için yeni bir bakış açısı ortaya çıkarmaktadır. CBS’nin
genel bir tanımı bulunmamakla birlikte en genel anlamdaν konuma dayalı gözlemlerle elde edilen
verilerin toplanması, veri tabanında saklanması, analiz edilmesi ve sunulmasını bir bütünlük içerisinde
gerçekleştiren bir bilişim teknolojisidir. Günümüzde mekânın bütün boyutları CBS ile analiz edilebildiği
için CBS’nin kullanım alanı her geçen gün artmaktadır. Biyolojik varlığa ilişkin verilerin saptanması ve
doğru bir şekilde analizi önem arz etmektedir. Bu çalışmada, literatür taramasıyla ulaşılan verilere dayalı
olarak biyoçeşitliliğin izlenmesi ve korunmasında CBS’nin kullanıldığı uygulamalara değinilmiştir.
Konuyla ilgili çalışmalar incelendiğinde, CBS teknolojisi kullanarak biyoçeşitlilik hakkında yapılan
araştırmaların 1λλ0’lı yıllarda başlandığı söylenebilir. Türkiye’de ise CBS kullanarak yapılan
biyoçeşitlilik çalışmaların son yıllarda gerçekleştirildiği ve genellikle bitkilerin dağılımı ve korunmasıyla
alakalı olduğu gözlenmektedir. Fauna elemanlarının dağılımıyla ilgili CBS çalışmaları ise oldukça sınırlı
olduğu anlaşılmaktadır. Biyolojik çeşitliliğin korunması, sürdürülebilirlik ilkelerine bağlı kalınarak
doğanın korunması ve çevre kalitesinin artırılmasıyla birlikte gerçekleşecektir. CBS analizleri
günümüzde özellikle türün bulunduğu yerin tespitinde, korunmasında bilim insanlarını yönlendirmekte
ve yeni bir bakış açısı ortaya çıkarmaktadır.
Anahtar Kelimeler: Coğrafi Bilgi Sistemleri, Biyoçeşitlilik, Mekânsal Teknolojiler
1. GİRİŞ
Biyolojik çeşitliliğin kısaltılmasından türetilen “biyoçeşitlilik” terimi, 1λ80’lerin ortalarında tropik yağmur
ormanları gibi doğal ortamların hızlı bir biçimde ortadan kalkmasından kaygı duyan ve bu ortak mirasın
korunması için toplumun önlem almasını da talep eden doğaseverler tarafından ortaya atılmıştır. Başlangıçta
doğanın korunması ile sınırlı olan bu kavram giderek sosyal, ekonomik ve etik boyutlarla derinlik
kazanmıştır (Lévêque ve Mounolou, β008).
Bir bölgedeki organizmaların gösterdiği farklılıklar ile tür ve sayı bakımından büyüklüğü biyoçeşitlilik
olarak tanımlanabilir. Bu çeşitlilik, doğal bir zenginlik olmasının yanında her ekosistem kendi
biyoçeşitliliğini oluşturur. Ayrıca bir bölgedeki biyoçeşitlilik hem kendi ülkesinin hem de dünyanın
zenginliğidir. Farklı özelliklere, unsurlara ve canlı çeşidine sahip olan bir doğa parçası, tekdüze yapıda bir
doğa parçasına göre daha zengin, daha dirençli ve daha kararlıdır. Diğer taraftan, bir ekosistemin biyolojik
çeşitliliğinin fazla olması diğer ekosistemlere göre üstünlüğünün kanıtı değildir (Erten, 2004ν Doğan ve ark.,
2010).
Coğrafi Bilgi Sistemleri (CBS), konuma dayalı gözlemlerle elde edilen grafik ve grafik olmayan bilgilerin
toplanması, veri tabanında saklanması, analizi ve sunumu işlevlerini bir bütünlük içerisinde gerçekleştiren
etkin bir bilişim teknolojisidir (Yomralıoğlu, β000ν Bingül ve ark., β016). CBS ilk olarak Coğrafya bilimi
içerisinde ortaya çıkmasına ve büyümesine rağmen, farklı disiplinlerle de bütünleşme ve kendi gelişim
dinamiklerini oluşturma ihtiyacı ortaya çıkmıştır (Şeremet ve Alaeddinoğlu, β017). CBS mekânın çok farklı
yönlerden araştırılması, anlaşılması ve analiz edilmesine imkân sağladığı için mekânla ilgili tüm alanlarda
kullanılmaktadır (Bingül ve ark., β016).
Biyoçeşitlilik Çalışmalarında CBS Kullanımı
CBS biyoçeşitliliğin izlenmesi ve denetlemesinde çok fazla kullanılmaktadır (Per ve ark., β015). Özellikle
UNEP (United Nations Environment Program) ve IUCN (International Union for the Conservation of
POSTER PRESENTATION
284
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Nature) gibi birçok kurum bu konular hakkında detaylı incelemeler ve çalışmalar gerçekleştirmektedir
(McNeely, 1993). UNEP ve Dünya Koruma İzleme Sistemi (World Conservation Monitoring System) ile
beraber yapılan “Biodiversity data management capacitation in developing countries and networking
biodiversity information (BDM)” başlıklı proje ile biyoçeşitliliğin korunmasında bilgi sistemlerinden
yararlanılması fikri ortaya atılmıştır. Buna göre bilgi sistemi kurularak türlerin ve habitatların tespiti, riskli
olan türlerin belirlenmesi, arazi kullanım rehberleri ve alternatif koruma yasaları yapılmalı ve bunun
sayesinde izleme ve yönetme gerçekleştirilmelidir (National Biodiversity Institutions/Units, 1994).
Biyolojik çeşitliliğin korunması, sürdürülebilirlik ilkelerine bağlı kalınarak doğanın korunması ve çevre
kalitesinin artırılmasıyla birlikte gerçekleşecektir. Buna ek olarak CBS analizleri günümüzde özellikle türün
bulunduğu yerin tespitinde, korunmasında bilim insanlarını yönlendirmekte ve yeni bir bakış açısı ortaya
çıkarmaktadır. Ayrıca CBS analizlerinde elde edilen verilerin kalitesi ve hangi analiz metodunun
kullanılacağını belirlemek doğru sonuca ulaşmak için çok önemlidir. Günümüzde biyolojik çeşitlilik
çalışmalarında genellikle verilerin toplanmasında küresel yer belirleme (The Global Positioning System GPS) teknolojisi kullanılmaktadır. Elde edilen veriler sayısallaştırılıp, veri tabanının oluşturulduktan sonra
mekânsal teknolojilerinin kullanılmasına hazır hale getirilir. Veri tabanından oluşturulmasından sonra
biyolojik varlığın zamansal ve mekânsal dağılımı tespit edilip üzerinde çok farklı analizler
gerçekleştirilebilir. Böylece CBS sayesinde yerel yöneticilere biyolojik çeşitliliğin korunmasında
yönlendirici bilgiler verilebilmesine imkân sağlanır (Bingül ve ark., β016).
Çevresel ve ekolojik verilen toplanması yönetilmesi analizinin yapılmasında coğrafi bilgi sistemleri kullanılır
(Aspinall, 1λλ5). Çeşitli zamanlarda alınan veriler ve türlerin konumlarındaki yer değişimi CBS sayesinde
tespit edilebilir ve ölçümler yapılabilir. Bu sayede potansiyel veriler elde edilebilir (Maguire ve ark., 1991).
Davis ve ark. (1λλ0) bilgi sistemleri ölçeğinde taksonomik, ekolojik ve kültürel değişkenlerin biyolojik
çeşitliliğe etkisini araştırmışlardır. Walker ve Faith (1λλ4) biyoçeşitliliğin belirlenmesinde CBS tabanlı
uygulama geliştirmişlerdir. Bu uygulamada türlerin dağılımı verilerek coğrafi değişkenlerin bu türlerin
dağılımına etkisini araştırılmıştır. Masoud ve Miller (β005) toprak içesindeki bütün organizmaların
dağılımını etkileyen zararlı maddeleri CBS kullanarak çalışmışlardır. Smith-Ramirez ve ark. (2007) CBS
kullanarak Şili yağmur ormanlarının flora ve fauna dağılımının değişimlerini hangi faktörlerin etkilediğini
belirlemişlerdir. Salem (β00γ) biyoçeşitliliğin izlenmesinde ve yönetilmesinde CBS analizlerini kullanmıştır.
Bu çalışmada Mısır çalışma alanı seçilerek Overlay (bindirme) analizleri kullanılmış ve biyoçeşitlilik
türlerine göre gruplara ağırlık verilmiştir. En son olarak ise bu ağırlığa göre mekânsal analizlerin sonuçları
haritalarla gösterilmiştir. Vásquez ve Parsa (β014) “A geographic distribution database of Mononychellus
mites (Acari, Tetranychidae) on cassava (Manihot esculenta)” isimli çalışmasında akarların dağılımı
konusunda CBS veri tabanı oluşturmuştur. Bunnell ve ark. (2003) ABD’nin Orta Atlantik Bölgesinde CBS
yardımıyla Ixodes scapularis (Acariμ Ixodidae) erginlerinin mekânsal dağılımına bakmışlardır. Yine
Almanya’da başka bir kene türünün (Ixodes ricinus) CBS yardımıyla dağılım analizi gerçekleştirilmiştir
(Schwarz ve ark., 2009).
Ülkemizde CBS, türlerin ve yaşam alanlarının belirlenmesi, korunması, izlenmesi ve biyolojik çeşitlilikle
ilgili bazı çalışmalarda kullanılmıştır. Kargıoğlu ve ark. (β008) Akarçay Havzası (Afyonkarahisar) vasküler
endemik bitkilerinin, rekabet ve yayılış durumlarına göre, ekolojik isteklerini mukayese etmek ve bu
türlerinin situ korunması için öncü bir envanter oluşturmasını amaçlamıştır. Sivrikaya ve ark. (β004)
tarafından yaşlı ormanların korunması ve yaşlı orman değerinin hesaplamasında CBS kullanılmıştır. Ayrıca
Selim ve Sönmez (β015) tarafından sığla ağacının (Liquidambar orientalis) Köyceğiz-Dalyan Havzasındaki
doğal yayılış alanı ve peyzaj yapısı CBS teknolojisi kullanılarak incelenmiştir. Kandemir (β01β) tarafından
Erzincan iline özgü bitki türlerine ait popülâsyonların CBS ile analizini gerçekleştirmiş ve analiz sonucunda
türlerin dağılımlarının büyük oranda jeolojik yapıya bağımlı olduğu ortaya konmuştur. Peşkircioğlu (β016)
CBS yazılımlarının verileri görsel hale getirerek biyolojik olguların daha rahat anlaşılması sağladığını
belirterek, Tarla Bitkileri Merkez Araştırma Enstitüsü web sayfasında CBS yardımıyla hazırlanan çeşitli
haritaların bulunduğunu ve bunların biyoloji alanındaki çalışmalara ışık tutacağını bildirmektedir. Şenol ve
Eroğlu (β017) tarafından bildirilen bir proje çalışması kapsamında Seferihisar’da yayılış gösteren 551 çiçekli
bitki taksonu tespit edilmiş ve elde edilen veriler coğrafi bilgi sistemi veri tabanında depolanarak Seferihisar
Doğa Mirası CBS Veri Tabanı oluşturulmuştur.
Ülkemizde flora çalışmalarının yanı sıra fauna elemanlarının dağılımında da CBS ile alakalı çalışmalar
bulunmaktadır. Bahadır ve Emet (β01γ) CBS’de yüzey sorgulama analizleri kullanarak omurgalı endemik
fauna elemanlarının Anadolu ve Trakya’daki yayılış alanlarını haritalamışlardır. CBS ayrıca türlerin
korunması ve takibinde kullanılmaktadır. Onmuş (β006) önemli kuş alanlarından birisi olan Gediz
POSTER PRESENTATION
285
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Deltasında CBS analiz yöntemleriyle kuş alanları incelenmiştir. Demirel ve ark. (β010) tarafından yapılan
çalışmada Göksu Deltası’nın çok amaçlı ve dinamik bir coğrafi bilgi sisteminin oluşturulması hedeflenmiş ve
tematik haritalar oluşturulmuştur. Per ve ark. (β015) bir kuş türü olan Karabaşlı çinte (Emberiza
melanocephala)’nin iklimsel parametrelerden yararlanarak ve CBS kullanarak Türkiye’deki potansiyel
dağılım alanlarını ve sınırlarını belirlemiştir. Mert ve Kıraç (β017) tarafından CBS yazılım ile Sütçüler
(Isparta) yöresinde endemik bir kertenkele türü olan Anatololacerta danfordi için uygun habitatlar
belirlenerek haritalandırılmış ve hedef organizmanın dağılımını etkileyen çevresel değişkenler ortaya
konmuştur. Denizhan ve ark. (β00λ), Google Earth tabanlı CBS’yi kullanarak gal akarlarının (Acariμ
Eriophyoidea) popülasyon gelişimleri, dağılımları, konakçı tercihleri ve doğal doğal düşmanlarını
belirlemeye çalışmışlardır. Bingül ve ark. (β016) ve Doğan ve ark. (β016) Erzincan il merkezindeki bazı akar
(Acari) türlerini belirleyerek, kent yaşamına uyum sağlamış olan akarları CBS ile analiz etmiş, konuma
dayalı analiz tekniklerini kullanarak kent merkezindeki familya ve tür seviyesindeki dağılışlarını dijital
haritalar üzerinde göstermiş ve farklı habitatların barındırdığı akar çeşitliliğini ortaya çıkarmıştır. Adil ve
ark. (2016) ve Sevsay ve ark. (2017) CBS’yi trombidioid akarların (Acari) dağılımı ve haritalanmasında
kullanmıştır. Sarı ve Ceylan (β017) tarafından Konya ili Beyşehir ilçesinde en uygun arıcılık yerlerinin
belirlenmesi amacı ile CBS yardımıyla arıcılık için gerekli şartlar, kısıtlamalar ve gereksinimler göz önüne
alınarak bir uygulama gerçekleştirilmiştir. Çalışma kapsamında eğim, yükseklik, su kaynakları, yerleşim,
yollar, bakı, flora ve yağış gibi kriterler için en uygun aralıklar uzman görüşleri ile belirlenerek
haritalandırılmış, analitik hiyerarşi yöntemi ile en uygun arıcılık yerleri belirlenmiştir.
2. SONUÇ
CBS teknolojileri coğrafi olan (Geographic) ya da olmayan bilgilerin (Spatial) toplanması, yönetilmesi,
analiz edilerek topluma sunulmasına imkân sağlar (Çağatay ve ark., β01β). Günümüz bilgi iletişim
teknolojilerinin gelişimine bakıldığında bu teknolojilerin kullanımı artık zorunlu hale gelmiş ve günlük
hayatın vazgeçilmez bir aracı olmuştur (Kapluhan, β014). Buna ek olarak sağladığı birçok imkân ve kolaylık
sayesinde, CBS teknolojileri günümüzde yerel yönetimleri yönlendiren bir teknolojidir (Çabuk, β015). CBS
artık mekanla ilgili bütün alanda kullanılmakta bu teknolojinin kullanılması günlük hayatımızı
kolaylaştırmada ve hayatımıza yön vermektedir (Koçak, β00λν Bingül ve ark., β016ν Azizoğlu ve Adızel,
2017). Şehir planı, arazi kullanımı, hukuk, tıp, diş hekimliği mühendislik, savunma, tarım, sağlık, su
kaynakları turizm ve ormancılık gibi alanlar başta olmak üzere yaklaşık 100’den fazla disiplinde CBS
kullanılmakta ve son yıllarda birçok üniversite ve kurumda CBS üzerine yoğun çalışmalar yapılmaktadır
(Phoenix, β000ν Bingül ve ark., β016).
Biyoçeşitliliğin korunması ve bununla ilgili faaliyetlere yönelik ilgi dünya genelinde hızla artmaktadır.
Biyoçeşitliliğin sürdürülebilir kullanımı için çeşitlilik unsurlarının rolü iyi tespit edilerek, uzun vadede bu
unsurların ve fırsatların biyoçeşitliliğin azalmasına yol açmayacak ölçüde kullanımı gerekmektedir (Aslan ve
ark., β008). Avrupa’da CBS kullanarak biyoçeşitlilik hakkında yapılan araştırmaların 1λλ0’lı yıllarda
başlandığı söylenebilir (Davis ve ark., 1λλ0ν Walker ve Faith, 1λλ4ν Bingül ve ark., β016). Türkiye’de ise
CBS teknolojisi kullanarak yapılan biyoçeşitlilik çalışmaların ancak son yıllarda ve genellikle endemik
bitkilerin dağılımı ve korunmasıyla alakalı olduğu gözlenmektedir (Sivrikaya ve ark., β004ν Kargıoğlu ve
ark., β008ν Kandemir, β01βν Selim ve Sönmez, β015). Fauna elemanlarının dağılımıyla ilgili CBS
çalışmaları ise oldukça sınırlıdır (Onmuş, β006ν Demirel ve ark., β010ν Bahadır ve Emet, β01γν Per ve ark.,
β015ν Mert ve Kıraç, β017). Buna ek olarak konuyla ilgili yurtiçi ve yurtdışı çalışmalar incelendiğinde CBS
kullanımına yönelik akarlar gibi eklembacaklı canlılarla ilgili bazı çalışmaların da olduğu anlaşılmaktadır
(Bunnell ve ark., 2003; Schwarz ve ark., β00λν Vásquez ve Parsa, β014ν Denizhan ve ark., β00λν Bingül ve
ark., β016ν Doğan ve ark., β016ν Adil ve ark., β016ν Sevsay ve ark., 2017).
KAYNAKLAR
Adil S, Sevsay S, Kesik OA 2016. Coğrafik Bilgi Sistemi (CBS) kullanılarak Ergan Dağı trombidioid
akarlarının haritalanması. 23. Ulusal Biyoloji Kongresi, 5-λ Eylül, Gaziantep, 46γ.
Aslan B, Aslan EG, Karaca İ, Kaya M β008. Kasnak meşesi tabiatı koruma alanında (Isparta) farklı
habitatlarda çukur tuzak yöntemi ile yakalanan Carabidae ve Tenebrionidae (Coleoptera) türleri ile
biyolojik çeşitlilik parametrelerinin karşılaştırması. SDÜ Fen Edebiyat Fakültesi Fen Dergisi, γ (β)μ 1ββ132.
Aspinall R 1995. Geographic information systems: their use for environmental management. Parks, 20-31.
POSTER PRESENTATION
286
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Azizoğlu E, Adızel Ö β017. Yüksekova Nehil Sazlığı (Hakkâri-Türkiye) ve çevresinde tespit edilen kuş
türlerinin mevsimsel habitat kullanımı ve populasyon dağılımlarının belirlenmesi. ADYÜTAYAM, 5 (1)μ
10-19.
Bahadır M, Emet K β01γ. Anadolu’da yayılış gösteren omurgalı endemik fauna elemanlarının CBS ile
dağılış alanlarının haritalanması. Uluslararası Sosyal Araştırmalar Dergisi, 34-50.
Bingül M, Doğan S, Dilkaraoğlu S, Kesik OA β016. Kent akarlarının (Acari) belirlenmesi ve Coğrafi Bilgi
Sistemi (CBS) kullanılarak haritalandırılmasıμ Erzincan Örneği. Uluslararası Erzincan Sempozyumu, 28
Eylül-01 Ekim, Erzincan, 3: 943-954.
Bunnell JE, Price SD, Das A, Shields TM, Glass GE 2003. Geographic information systems and spatial
analysis of adult Ixodes scapularis (Acari: Ixodiae) in the middle atlantic region of the U.S.A. Journal of
Medical Entomololgy, 40 (4): 570-576.
Çabuk SN β015. CBS’nin yerel yönetimlerde kullanımı ve kent bilgi sistemleri. Harita Teknolojileri
Elektronik Dergisi, 7 (3): 69-87.
Çağatay A, Terzioğlu E, Ekmen Zİ, Erdoğan E β01β. Biyolojik çeşitliliği izleme ve değerlendirme raporu.
T.C. Orman ve Su İşleri Bakanlığı Doğa Koruma ve Milli Parklar Genel Müdürlüğü, Lazer Ofset Matbaa
Tes. Ltd. Şti., Ankara.
Davis F, Storms D, Estes J, Scepan J, Scott J 1990. An information systems bapproach to the preservation of
biological diversity. International Journal of Geographic Information, 55-78.
Demirel Z, Özer O, Dabanlı S β010. Göksu Deltası’nın tarım, hayvancılık, arazi kullanımı ile ilgili γ boyutlu
haritalarının ve CBS’nin oluşturulması. Biyoloji Bilimleri Araştırma Dergisi, 3 (2): 175-179.
Denizhan E, Çobanoğlu S, Kotaoğlu Ç β00λ. One example about using geographic information system’s
studies in Acarology: Google Earth. 1st International Workshop in Taxonomic Acarology, 3-5 June,
Ankara, 28.
Doğan S, Bingül M, Ayyıldız N, Kesik OA β016. An evaluation in terms of urban mite (Acari) diversity:
some mites in peridomestic habitats of Erzincan city (Turkey). 8th Symposium of the European
Association of Acarologists (EURAAC-2016), 11-15 July, Valencia, Spain, 40-41.
Doğan S, Özçelik S, Dolu Ö, Erman O β010. Küresel ısınma ve biyolojik çeşitlilik. İklim Değişikliği ve
Çevre γμ 6γ-88.
Erten S β004. Uluslararası düzeyde yükselen bir değer olarak biyolojik çeşitlilik. Hacettepe Üniversitesi
Eğitim Fakültesi Dergisi, β7μ λ8-105.
Kandemir A 2012. Erzincan ili endemik bitkilerin CBS ile tespiti. Erzincan: Tubitak.
Kapluhan E β014. Coğrafi Bilgi Sistemleri’nin (CBS) Coğrafya öğretiminde kullanımının önemi ve
gerekliliği. Marmara Coğrafya Dergisi, βλμ γ4-59.
Kargıoğlu M, Serteser A, Şenkul Ç, Özdemir MA β008. Akarçay havzası (Afyonkarahisar)’ındaki tehlike
altındaki (CR, EN, VU) endemik bitkilerin Coğrafi bilgi sistemleri (CBS) ile haritalandırılması ve
koruma statüleri. Biyoloji Bilimleri Araştırma Dergisi, 1 (2): 33-36.
Koçak H β00λ. Coğrafi bilgi sistemlerinin kentsel yaşam kalitesinin yükseltilmesine etkileri üzerine bir
değerlendirme. Dumlupınar Üniversitesi Sosyal Bilimler Dergisi, 25: 141-148.
Lévêque C, Mounolou JC β008. Biyoçeşitlilik. Biyolojik devinimler ve koruma. Başıbüyük, HH, Yılmaz A,
Kılınç S (Eds), Palme Yayıncılık, β01γ, 1-259.
Maguire DJ, Goodchild M, Rhind D 1991. Geographic information systems. Longman, Londra.
Masoud S, Miller WM 2005. Precision application technology for monitoring soil applied pesticides in
Florida citrus production. FRUTIC 05, Information and Technology for Sustainable Fruit and Vegetable
Production, Montpellier, France, 633-641.
McNeely JA 1993. Parks for Life: Report of the IVth world congress on national parks and protected areas,
IUCN, 1-252.
Mert A, Kıraç A β017. Isparta-Sütçüler yöresinde Anatololacerta danfordi (Günter, 1876)’nin habitat
uygunluk haritalaması. Bilge Uluslararası Fen ve Teknoloji Araştırmaları Dergisi, 1 (1)μ 16-22.
National Biodiversity Institutions/Units 1994. Biodiversity data management capacitation in developing
countries and networking biodiversity information. Global: National Biodiversity Institutions/Units.
Onmuş O β006. Göksu deltası’nın tarım, hayvancılık, arazi kullanımı ile ilgili γ boyutlu haritalarının ve
Cbs’nin oluşturulması. 4. Cografi bilgi sistemleri bilisim günleri, İstanbulμ Fatih Üniversitesi, 1-8.
POSTER PRESENTATION
287
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Peşkircioğlu M β016. Coğrafi Bilgi Sistemi ve Biyoloji. 23. Ulusal Biyoloji Kongresi, 5-λ Eylül, Gaziantep,
40.
Per E, Erciyas Yavuz K, Demirtaş S β015. Karabaşlı çinte (Emberiza melanocephala Scopoli, 176λ)’nin
ekolojik niş modeli ve Türkiye’deki durumu. Erciyes Üniversitesi Fen Bilimleri Enstitüsü Dergisi, γ1 (β)μ
89-96.
Phoenix M 2000. Learning with GIS. Arcuser Online, 6-24.
Salem B 2003. Application of GIS to biodiversity monitoring. Journal of Arid Environments, 54: 91-114.
Sarı F, Ceylan DA β017 Beyşehir ilçesi için coğrafi bilgi sistemleri yardımıyla en uygun arıcılık yerlerinin
bulunması. II. Uluslararası Beyşehir ve Yöresi Kongresi, 06-08 Ekim, Konya, 107.
Schwarz A, Maier WA, Kistemann T, Kampen H 2009. Analysis of the distribution of the tick Ixodes ricinus
L. (Acari: Ixodidae) in a nature reserve of western Germany using Geographic Information Systems.
International Journal of Hygiene and Environmental Health, 212: 87-96.
Selim S, Sönmez NK β015. Sığla (Liquidambar orientalis Miller) popülasyonları dağılımının CBS ile
belirlenmesi ve habitat kalitesinin peyzaj metrikleri kullanılarak değerlendirilmesiν Muğla Köyceğiz
Örneği. Tekirdağ Ziraat Fakültesi Dergisi, 12 (1): 30-38.
Sevsay S, Kesik OA, Adil S. 2017. Akarların dağılımı ve haritalanmasında coğrafi bilgi sistemlerinin
kullanılması. XIII. Uluslararası Katılımlı Ekoloji ve Çevre Kongresi (UKECEK), 1β-15 Eylül, Edirne,
409.
Sivrikaya F, Yolasığmaz HA, Başkent EZ β004. Doğal yaşlı ormanlar ve coğrafi bilgi sistemleri yardımıyla
belirlenmesi. KSÜ Fen ve Mühendislik Dergisi, 7 (1): 45-52.
Smith-Ramirez C, Diaz I, Pliscoff P, Valdovinos C, Méndez MA, Larrain J, Horacio S β007. Distribution
patterns of flora and fauna in southern Chilean Coastal rain forests: Integrating Natural History.
Biodiversity and conservation, 16: 2627-2648.
Şenol SG, Eroğlu V β017. Seferihisar Doğa Mirası Projesi (Flora). XIII. Uluslararası Katılımlı Ekoloji ve
Çevre Kongresi (UKECEK), 1β-15 Eylül, Edirne, 186.
Şeremet M, Alaeddinoğlu F β017. Coğrafi Bilgi Sistemlerinde (CBS) farklı bir perspektifμ Eleştirel CBS’ye
yönelik bir literatür analizi. Batman Üniversitesi Yaşam Bilimleri Dergisi, 7μ 187-194.
Vásquez-Ordóñez AA, Parsa S β014. A geographic distribution database of Mononychellus mites (Acari,
Tetranychidae) on cassava (Manihot esculenta). ZooKeys, 407: 1-8.
Walker P, Faith DP 1994. Diversity: a software package for sampling phylogenetic and environmental
diversity. version 2.1. CSIRO, Division of Wildlife and Ecology, 1-52.
Yomralıoğlu T 2000. Coğrafi bilgi sistemleri, İstanbulμ Seçil Ofset.
POSTER PRESENTATION
288
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The solution and extractant properties of metal-free and metallophthalocyanines substituted
by four macrocycles containing piperazinedion moiety
Yaşar Gök, Halil Zeki Gök*
Department of Biomedical Engineering, Faculty of Technology, Mehmet Akif Ersoy University, 15030
Bucak/Burdur, Turkey
halilzekigok@gmail.com
Abstract
Metal-free phthalocyanine 3 and metallophthalocyanines 4 and 5 substituted in peripheral position with
macrocycles containing piperazine moiety have been synthesized by cyclotetramerization of the
phthalonitrile precursor. Electronic absorption properties for all phthalocyanines were studied in various
organic solvents. The liquid-liquid extraction of metal picrates such as Ag(I), Hg(II), Cd(II), Zn(II),
Cu(II), Ni(II), Pb(II), Co(II), K(I), and Na(I) from aqueous phase to the organic phase was carried out
using 2 and 4. The highest extractability from aqueous phase to organic phase was found for Hg(II)
cation over the other metal cations with zinc(II) phthalocyanine 4.
Keywords: Macrocyclization, Mixed-donor macrocycle, Phthalocyanine, Aggregation, Metal picrates,
Solvent extraction
1. INTRODUCTION
Since their first synthesis and cation complexing characteristic was reported by Pedersen (Pedersen, 1967),
hundreds of macrocycle have been synthesized in order to investigate the unusual properties of these cyclic
ligands such as their metal-ion chemistry, spectral, electrochemical, structural, kinetic and thermodynamic
stabilities (Izatt et al., 1985). The understanding of principles of metal-ion chemistry of macrocycles has
important because the macrocyclic ligand and their complexes play critical roles in a number of biological
systems such as biological cation transport system, transport of oxygen in mammalian and mechanism of
photosynthesis (An et al., 1992; Lindoy, 1989). Designing of macrocycle ligand is a key step for selective
complexation of metal ion. Selection of donor atoms in macrocycle is of primary importance. The hard-soft
acid-base concept provides preliminary guide for donor atom selection (Hancock and Martell, 1989).
Macrocycles with “hard” ether-oxygen are selective against alkali and alkaline earth metal cation whereas the
“soft” sulfur containing macrocycles show a binding preference toward “soft” transition metal cation (Chartes
et al., 2006). To enhance the coordination properties of macrocycles, different parameters have been modified
such as the ring size, the nature of substituents, and the type of donor atoms present (An et al., 1992; Qui et
al., 2009; Banfi et al., 2007).
The chemistry of phthalocyanines has developed rapidly since Linstead reported their first synthesis (Byrne
et al., 1934). The synthesis and subsequent study of a large number of phthalocyanines have presented due to
their high potential applications in several areas such as photodynamic reagent for cancer theraphy (Master et
al., 2010), optical read-write discs (Luo et al., 2007), gas sensor (Sizun et al., 2011), corrosion inhibitors
(Zhao et al., 2005) and electrochromic displays (Mortimer et al., 2006). The first introduction of crown ether
into a phthalocyanine was reported in 1986 (Koray et al., 1986) and the ability of this molecule to bind alkali
metal cations was investigated (Musluoğlu et al., 1λλ1). The synthesis of phthalocyanine-bearing
macrocycles has found potential applications in biochemistry and materials science (Bekaroğlu, 1λλ6).
Particularly, the attachment of a macrocycle containing nitrogen and sulphur donor atoms to phthalocyanines
increases their selectivity towards alkaline-earth and soft transition metal cations (Ertem et al., 2008).
The synthesis of phthalocyanines containing a macrocycle unit usually needs a multi-step reaction sequence
(Gök et al., β007a). Especially, the macrocyclization step requires high dilution techniques (Gokel and
Korzeniowski, 1982) or template effect (Cook et al., 1974). We have described the synthesis and
characterization of metal-free and metallophthalocyanines substituted by four macrocycles containing
piperazine moiety on peripheral positions (Gök and Gök, β014). We have also investigated the solvent
extraction properties of macrocyclic ligand 2 and zinc(II) phthalocyanine 4 for metal cations such as Ag(I),
Hg(II), Cd(II), Zn(II), Cu(II), Ni(II), Pb(II), Co(II), K(I), and Na(I) from aqueous phase to the organic phase.
POSTER PRESENTATION
289
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATERIALS AND METHODS
2.1. Materials
N,N'-(2,2'-(4,5-dicyano-1,2-phenylene)bis(sulfanediyl)bis(2,1-phenylene))bis(2-chloroacet-amide) 1 was
prepared according to the literature report (Gök and Farsak, β01γ). All reagents and solvents were reagent
grade quality and were obtained from commercial suppliers. All solvents were dried and purified as
described by Perrin and Armarego (Perrin and Armarego, 1989).
2.2. Equipment
FTIR spectra were measured on a Perkin Elmer Spectrum 65 spectrometer in KBr pellets. 1H and 13C NMR
spectra were recorded on a Varian Mercury 400 MHz spectrometer in CDCl 3 and DMSO-d6 (99.9%). Mass
spectra were measured on a Micromass Quatro LC/ULTIMA LC-MS/MS and a Bruker Daltonics MALDITOF spectrometer. Optical spectra were recorded in the UV-Vis region with a PG-T80+ spectrophotometer
in 1 cm path length cuvettes at room temperature. The elemental analyses were obtained with a LECO
Elemental Analyzer (CHNS 0932) spectrophotometer. The melting points were determined with an
electrothermal apparatus and are reported without correction. In solvent extraction experiment Selecta type
shaker with thermostat was used.
2.3. Synthesis
2.3.1. 1,4-bis(2-(4,5-dicyano-1,2-pheylene)sulfanediyl)piperazine-2,5-dione (2)
A mixture of 1 (β.5 g, 47.5 mmol) and NaOH (4 g, 104 mmol) in 100 ml of DMF were heated to 65 °C for
16 h under nitrogen atmosphere. The reaction was monitored by thin layer chromatography using ethyl
acetate-hexane (4:6) as the solvent system. At the end of this period, the mixture was filtered and the filtrate
was evaporated to dryness under reduced pressure. The yellowish oil was dissolved in CH 2Cl2. The organic
layer was washed twice with 100 ml portions of a 5% NaCl solution and then twice with water. The
combined organic layer was dried over anhydrous Na2SO4 and the solvent was evaporated under reduced
pressure to give a crude product that was purified by silica gel chromatography. The elution was carried out
with hexane-ethyl acetate (7:3). The product was obtained as pale yellow solid and then dried in vacuum.
The yield was 1.5 g (70%). Mp 251-252 oC. Anal. calcd for C24H14N4O2S2: C, 63.42; H, 3.10; N, 12.33%.
Foundμ Cμ 6γ.64ν Hμ γ.λ4ν Nμ 11.β8%. IR (KBr disc) θ max/cm-1: 3046 (CHAr), 2922 (CH3), 2235 (CN), 1692
(C=O), 1583, 1475, 1443, 1320, 1260, 1134, 1039, 897, 744, 657, 583, 530. 1H NMR (CDCl3) : 7.43 (d, J =
7.78 Hz, 2H, ArH), 7.38 (t, J = 7.65 Hz, 2H, ArH), 6.90-6.84 (m, 6H, ArH), 4.31(s, 4H, O=CCH 2N). 13C
NMR (CDCl3) : 164.84 (C=O), 140.49, 138.23, 137.68, 128.83, 127.32, 125.28, 123.60, 118.94, 115.75,
114.21 (ArC), 31.28. MS (LC-MS/MS) m/z: 455.26 [M+H]+, 477.29 [M+Na]+.
2.3.2. Metal-free phthalocyanine (3)
A mixture of 2 (0.3 g, 0.660 mmol) and a few drops of 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in dry npentanol (1.5 ml) were placed under a nitrogen atmosphere in a standard Schlenk tube. The reaction mixture
was heated and stirred under nitrogen at 145 ºC for β4 h. After cooling to room temperature, the mixture was
diluted with ethanol (10 ml) until the product precipitated. The precipitated crude product was filtered. The
crude product was refluxed with ethanol (25 ml) in a Soxhlet extractor for 4 h. The product was then filtered
and washed with ethanol and diethyl ether and then dried under vacuum. Finally, pure metal-free
phthalocyanine was obtained by silica gel column chromatography using dichloromethane : methanol solvent
systems in different ratios ranging from (99:1) to (95:5). The yield was 0.075 g (25%). Mp > 300 0C. Anal.
calcd. for C96H58N16O8S8: C, 63.35; H, 3.21; N, 12.31%. Found: C, 61.15; H, 3.15; N, 11.33%. IR (KBr
disc) θmax/cm-1: 3296 (NH), 3058 (CHAr), 2925 (CH3), 1729 (C=O), 1584, 1499, 1439, 1349, 1299, 1229,
1095, 1019, 870, 746. 1H NMR (DMSO-d6) : 7.54-6.82 (m, 40H, ArH), 3.70 (br, s, 16H, O=CCH2N). UVVis (DMF): max, nm (log ): 733 (4.97), 701 (4.84), 688 (4.63), 640 (4.40), 554 (4.66), 370 (5.04). MS
(MALDI-TOF) m/z: 1823.18 [M+5H]+, 1914.09 [M+4Na+4H]+, 1957.69 [M+6Na+H]+, 2028.18
[M+9Na+3H]+.
POSTER PRESENTATION
290
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2.3.3. Zinc(II) phthalocyanine (4)
A mixture of 2 (0.3 g, 0.660 mmol), anhydrous anhydrous Zn(CH 3CO2)2 (0.035 g, 0.200 mmol) and
quinoline (2 ml) was placed in a well-stoppered schlenk tube under an argon atmosphere. The mixture was
heated and stirred gently to °C and then refluxed at this temperature for 7 h. The crude product was cooled to
room temperature and ethanol (10 ml) was added to this mixture. The resulting dark green precipitate was
filtered off. The crude product was refluxed with ethanol (25 ml) in a Soxhlet extractor for 4 h. The product
was then filtered and washed with ethanol and diethyl ether and then dried under vacuum. Finally, pure
zinc(II) phthalocyanine was obtained by silica gel column chromatography using dichloromethane:methanol
solvent systems in different ratios ranging from (99:1) to (95:5). The yield was 0.070 g (23%). Mp > 300 0C.
Anal. calcd. for C96H56N16O8S8Zn: C, 61.22; H, 3.00; N, 11.90%. Found: C, 58.01; H, 3.17; N, 10.87%. IR
(KBr disc) θmax/cm-1: 3064 (CHAr), 2925 (CH3), 1727, 1688 (C=O), 1613, 1583, 1476, 1442, 1325, 1258,
1134, 1097,746. 1H NMR (DMSO-d6) : 9.62 (m, 4H, O=CCH2N), 9.13 (m, 4H, O=CCH2N), 7.76-6.39 (m,
40H, ArH), 3.80 (m, 4H, O=CCH2N), 3.29 (m, 4H, O=CCH2N). 13C NMR (DMSO-d6) : 165.46 (C=O),
153.55, 139.35, 137.41, 137.07, 129.01, 127.18, 126.62, 123.38, 122.91, 119.58 (ArC), 30.74 (O=CCH 2N).
UV-Vis (DMF): max, nm (log ): 688(4.83), 620 (4.02), 360 (4.42). MS (MALDI-TOF) m/z: 1881.68
[M+H]+, 1902.99 [M+Na]+.
2.3.4. Cobalt(II) phthalocyanine (5)
The procedure is the same as above with 0.035 g (0.200 mmol) of anhydrous Co(CH3CO2)2 (instead of
Zn(CH3CO2)2). Yield was 0.050 g (18%). Mp > 300 0C. Anal. calcd. for C96H56N16O8S8Co: C, 61.43; H,
3.01; N, 11.94%. Found: C, 60.25; H, 3.24; N, 10.97 %. IR (KBr disc) θmax/cm-1: 3060 (CHAr), 2916 (CH3),
1688 (C=O), 1583, 1519, 1475, 1442, 1327, 1259, 1225, 1103,748. UV-Vis (DMF): max, nm (log ): 679
(4.86), 335 (4.87). MS (MALDI-TOF) m/z: 1876.80 [M+H]+.
2.4. Extraction method
The metal ion binding properties of macrocycle 2 and zinc(II) phthalocyanine 4 were investigated by liquidliquid solvent extraction method. Picrate extraction experiments were performed following published
procedures (Gök et al., β007b) Solvent extraction experiments were carried out using the aqueous metal
picrate solutions, which were prepared from a mixture of the metal nitrates (KNO 3, NaNO3, Pb(NO3)2,
Co(NO3)2.6H2O, Cu(NO3)2.3H2O, Zn(NO3)2.6H2O, Ni(NO3)2.6H2O, Cd(NO3)2.4H2O,
AgNO3,
Hg(NO3)2.H2O) and picric acid in deionized water. Dichloromethane and chloroform were tested as organic
solvents in extraction experiments. An organic solution (10 mL) of ligand (1.25 x 10 -4 M) and an aqueous
solution (10 mL) containing 1.25 x 10 -5 M picric acid and 1 x 10-2 M metal nitrate were placed in stoppered
flask and shaken for 2 h at 25 ± 0.1 °C. Then, the resulting mixtures were allowed to stand for least β h at
that temperature in order to complete the phase separation. The concentration of the picrate ion remaining in
the aqueous phase was then determined by UV-Vis spectrophotometer at 355 nm. Blank experiment was
performed in the absence of host and showed that no picrate extraction occurred. The extractability (E%) was
determined based on absorbance of picrate in aqueous solutions. The extractability was calculated from the
following equation:
E(%) = [(A0-A)/A0] x 100
Where A0 is the absorbance in the absence of ligand and A the absorbance in the aqueous phase after
extraction.
3. RESULTS AND DISCUSSION
3.1. Synthesis and Characterization
The synthetic pathway for the preparation of the target metal-free phthalocyanine 3 and
metallophthalocyanines 4 and 5 is summarized in Scheme 1. The structures of novel compounds were
characterized by a combination of elemental analysis and 1H NMR, 13C NMR, IR, UV-vis and MS spectral
data. N,N'-(2,2'-(4,5-dicyano-1,2-phenylene)bis(sulfanediyl)bis(2,1-phenylene))bis(2-chloroacet-amide) 1
was prepared according to the literature report (Gök and Farsak, β01γ).
POSTER PRESENTATION
291
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Scheme 1. Synthetis of phthalocyanines 3-5.
3.2. Absorption spectra
The phthalocyanines show typical electronic spectra with two absorption bands. One of them is in UV region
at about 300-500 nm (B band) and the other one is in the visible region at 600-800 nm (Q band) (Leznoff and
Lever, 1989). In the case of metal-free phthalocyanine, the Q band splits into two bands in the visible region
as a result of D2h symmetry (Hanack et al., 1998). Metal complexes of substituted and unsubstituted
phthalocyanines with D4h symmetry show an intense single Q band in the visible region (Hanack et al.,
1998).
The electronic absorption spectra of the studied phthalocyanine were recorded in different solvents. The
results are summarized in Table 1. Electronic absorption spectrum of metal-free phthalocyanine 3 is shown
in Fig. 1a. The characteristic split Q band for metal-free phthalocyanine 3 was observed at max = 733 and
701 nm in DMF. In addition of that, the broad absorption at max = 554 nm can be attributed to the (S) -*
transition of the non-bonding electrons associated with the peripheral sulfur atoms (Kabay et al., 2011). B
band absorption of the metal-free phthalocyanine 3 was observed at max = 366 nm.
0,8
0,8
0,5
b
0,4
0,4
0,3
Diethylether
DCM
DMF
THF
EtOH
0,6
Diethylether
DCM
DMF
THF
EtOH
Absorbance
Absorbance
Absorbance
a
DMF
THF
DCM
0,6
0,2
c
0,4
0,2
0,2
0,1
0,0
0,0
0,0
300
400
500
600
700
800
300
400
Wavelength (nm)
500
600
700
800
300
400
500
600
700
800
Wavelength (nm)
Wavelength (nm)
Figure 1. UV-Vis spectrum of phthalocyanines 3 (Fig 1a), 4 (Fig 1b) and 5 (Fig 1c) in different solvents
Table 1. Location of the Q bands and B bands (in nm) of metal-free phthalocyanines 3 and
metallophthalocyanines 4 and 5 in various solvents at concentration of 8 x 10 -6 mol.dm-3.
Solvent
Pcs
DMF
THF
DCM
DMF
THF
DCM
DMF
THF
DCM
3
3
3
4
4
4
5
5
5
POSTER PRESENTATION
Q band, max, (nm)
733, 701, 688, 640
734, 704, 634
734, 707
688, 620
688, 644, 617, 590
686, 646, 618, 590
679
675, 639
680, 644
log
4.97, 4.84, 4.63, 4.40
4.69, 4.58, 4.24
4.79, 4.68
4.83, 4.02
4.53, 4.54, 3.96, 3.60
4.70, 4.58, 4.09, 3.72
4.86
4.82, 4.86
4.80, 4.87
B band,
max, (nm)
370
366
366
360
350
350
335
329
335
log
5.04
4.83
4.98
4.42
4.45
4.58
4.87
4.92
4.82
292
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The metallophthalocyanine compounds 4 and 5 show solvent-dependent spectra. The recorded UV-Vis
spectra of metallophthalocyanine 4 and 5 in different solvents are illustrated in Fig.1b and Fig.1c,
respectively. In DMF, phthalocyanine complexes showed the expected absorptions with the main peaks of
the Q and B bands, appearing a strong band at max = 688 nm for 4 and 679 nm for 5 with a shoulder at max
= 620 nm and 615 nm, respectively. Appearance of single intense Q band is characteristic for
metallophthalocyanines with D4h symmetry (Takahashi et al., 1995). B band absorptions of
metallophthalocyanines 4 and 5 were observed at max = 360 and 335 nm, respectively. In the UV-Vis spectra
of 4 and 5 in diethyl ether, ethanol, dichloromethane and tetrahydrofuran solvents, new strong bands at max
= 644 nm for 4 and 635 nm for 5 appeared in addition to the main Q bands at max = 688 nm and 680 nm,
respectively. The effects of solvents on the state of aggregation of soluble phthalocyanines have been studied
by several groups and reported in numerous papers (Palewska and Sworakowski, 2012; Ogunsipe et al.,
β004ν Durmuş and Nyokong, β007). Phthalocyanines are known to exist in solutions in the form of
monomers, dimers, trimers and oligomers. Dimerization/oligomerization of symmetrical phthalocyanines
results in spectral effects that extend from band broadening, to a blue-shift of the Q band, to an observed
splitting of the Q band (Leznoff and Lever, 1986). It has been shown that the tendency of the phthalocyanine
to dimerize is greater in solvents of low dielectric constant (Allcock and Neenan, 1986). Changes in the
solvent from diethylether to DMF (thereby raising the dielectric constant of the medium) moved the
monomer-dimer equilibrium toward higher monomer ratios. The bands at around 690 nm and 640 nm can be
attributed to monomeric and oligomeric phthalocyanine species for 4 and 5.
3.3. Extractability and selectivity
The metal ion-binding properties of macrocycle 2 and zinc(II) phthalocyanine 4 was performed by using
solvent extraction experiments in order to estimate the extractability of metal ions such as Ag+, Hg2+, Cd2+,
Zn2+, Cu2+, Ni2+, Pb2+, Co2+, K+, and Na+ from aqueous phase to the organic phase. Two different organic
solvents were tested to reveal extraction efficiency. The organic solvents are dichloromethane and
chloroform. The results related to the extractability of above metal picrates from aqueous phase to organic
phases are given in Table 2 and Fig.4.
Table 2. The extractability of aqueous metal picrates for compounds 2 and 4 into organic phasea
Metal ion
Na+
K+
Nı2+
Cu2+
Hg2+
Zn2+
Ag+
Cd2+
Pb2+
Co2+
Extractabilityb (%)
(2)
(4)
β.1 ± 0.γ
5.0 ± 0.γ
γ.λ ± 0.γ
0
6.7 ± 0.5
8.7 ± 0.γ
λ.4 ± 0.γ
ββ.β ± 0.8
17.1± 0.8
71.5 ± 0.5
0
γ0.7 ± 1.7
0
44.7 ± 0.5
1.7 ± 0.5
8.5 ± 0.γ
0
β4.γ ± 0.7
1.γ ± 0.5
6.0 ± 0.7
Extractabilityc (%)
(2)
(4)
4.7 ± 0.γ
0
0
0
0
γ.0 ± 0.β
0
1β.γ ± 0.β
γ.5 ± 0.6
67.λ ± 0.6
4.1 ± 0.λ
βγ.β ± 0.8
λ.6 ± 0.γ
γ1.6 ±0.5
0
1.1 0.1
5.1 ± 0.7
5.1 ± 0.γ
0
0
Temperatureμ β5.0±0.1 oC; aqueous phase (10 ml); [pic-] = 1.25 x 10-5 M, organic phase (10 ml); [L] = 1.25 x 10-4 M; The
values calculated from three independent extraction experiments.
b
Organic solvent: dichloromethane.
c
Organic solvent: chloroform.
a
POSTER PRESENTATION
293
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
(a)
Extractibility into dichloromethane phase
100
50
Macrocycle
(2)
0
(b)
Extractibility into chloroform phase
100
80
60
40
20
0
Macrocycle
(2)
(c)
Fig. 4. Extraction of 2 and 4 towards metal picrate salts. (a) organic phase, dichloromethane. (b) organic
phase, chloroform. (c) comparison of extraction of 4 toward metal cations in dichloromethane and
chloroform.
As seen from Table 2, macrocyclic ligand 2 exhibited the lowest extraction efficiency for all the metal ions
in both solvents. The best extractability belongs to Hg2+ ion in dichloromethane and Ag+ ion in chloroform,
but they were only 17.1% and 9.6%, respectively. The cation binding properties of the macrocycles depend
upon different factors such as macrocylic effect, cavity size, and the type and number of donor atoms (Izatt
et al., 1985; Hancock and Martell, 1989). As seen from Scheme 1, the zinc(II) phthalocyanine 4 contains
four macrocycle bearing piperazine unit and it is expected to transport metal cations more effectively with
respect to macrocycle 2 for the same conditions. In addition to that, the zinc(II) phthalocyanines has a planar
structure. The E% values obtained for zinc(II) phthalocyanine 4 was higher than those of macrocycle 2 in
both organic solvents. The obtained extraction values in the presence of zinc(II) phthalocyanine 4 for Ag+,
Hg2+, Pb2+ and Cu2+ in both organic solvents were high when compared to other metal cations. The highest
extractability belongs to Hg2+ and Ag+ cations with zinc(II) phthalocyanine 4 in both organic solvents. The
values of extractability belonging to Hg2+ and Ag+ are 71.5% and 44.7% in dichloromethane and 67.9% and
31.6% in chloroform, respectively. The percentage of extractability of Hg 2+ ion to the dichloromethane and
chloroform for compound 4 is almost equal. However, compound 4 extracted Ag+ ion 44.7% to the
POSTER PRESENTATION
294
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
dichloromethane phase. This value was higher than that of chloroform. In the case of zinc(II) phthalocyanine
4, increasing in extraction capability may be due to the result of planarity of zinc(II) phthalocyanine 4 or the
number of donor atoms in compound 4. From the experimental results, we can conclude that the zinc(II)
phthalocyanine is much more effective than macrocyclic ligand 2 in the extractability of metal cations from
aqueous phase to organic phase under these conditions.
4. Conclusions
In conclusion, the synthesis of a macrocycle containing piperazine moiety and its metal-free and
metallophthalocyanine derivatives has been described. The metal ion binding properties of 2 and 4 were
evaluated using the liquid-liquid extraction technique. Ligand 2 has low cation binding capacity for all metal
cations tested. The extraction percentage for all metal cations with zinc(II) phthalocyanine 4 is higher than
those of macrocyclic ligand 2. The cation-binding avidity of 4 for Hg2+ over other cations in both organic
solvents was found to be the highest. Zinc(II) phthalocyanine 4 extracts Hg2+ ion to dichloromethane phase
with 71.5% and chloroform phase with 67.9%.
Acknowledgements
We would like to thank Dr. Hasan Demir from Department of Chemical Engineering in Osmaniye Korkut
Ata University for his technical assistance with extraction studies.
References
Allcock HR, Neenan TX 1986. Synthesis of polyphosphazenes bearing covalently linked copper
phthalocyanine units. Macromolecules, 19:1495-1501.
Alp H, Bıyıklıoğlu Z, Ocak M, Ocak Ü, Kantekin H, Dilber G β007. New Heavy Metal Ion‐Selective
Macrocyclic Ligands with Nitrogen and Sulfur Donor Atoms and their Extractant Properties.
Separation Science and Technology, 42 835-845.
An H, Bradshaw JS, Izatt RM 1992. Macropolycyclic polyethers and related compounds. Chemical Reviews,
92:543-572.
Banfi S, Carous E, Buccafurni L 2007. Zinc phthalocyanines-mediated photodynamic therapy induces cell
death in adenocarcinoma cells. Journal of Organometallic Chemistry, 692:1269–1276.
Bekaroğlu Ö 1996. Phthalocyanines Containing Macrocycles. Applied Organometallic Chemistry, 10: 605622.
Byrne GT, Linstead RP, Lowe AR 1934. The preparation of phthalocyanine and some metallic derivatives
from o-cyanobenzamide and phthalimide. Journal of Chemical Society, 1017-1022.
Chartres JD, Davies MS, Lindoy LF, Meehan GV, Wei G 2006. Macrocyclic ligand design, the interaction of
selected transition and post-transition metal ions with a 14 membered N2S2-donor macrocycle.
Inorganic Chemistry Communications, 9:751-754.
Cook FL, Caruso TC, Byrne MP, Bowers CW, Speck DH, Liotta CL 1974. Facile syntheses of 12-crown-4
and 15-crown-5. Tetrahedron Letters, 46:4029-4032.
Durmuş M, Nyokong T 2007. Synthesis and solvent effects on the electronic. absorption and fluorescence
spectral properties of substituted zinc phthalocyanines. Polyhedron, 26:2767–2776.
Ertem B, Bilgin A, Kantekin H, Gök Y β008. Synthesis and characterization of new soluble phthalocyanines
containing macrocycle units. Polyhedron, 27:2186-2192.
Gök HZ, Farsak B β01γ. Synthesis, characterisation and aggregation properties of novel metal-free and
metallophthalocyanines containing four 21-membered oxatetrathiadiaza macrocycles. Journal of
Organometallic Chemistry, 735:65-71.
Gök HZ, Gök Y 2014. Synthesis and characterization of new organosoluble metal-free and
metallophthalocyanines substituted by four macrocycles containing piperazine moiety. Inorganic
Chemistry Communications, 40:164-167.
Gök HZ, Kantekin H, Gök Y, Herman G. β007a. The synthesis and characterization of novel metal-free and
metallo-phthalocyanines bearing four 27-membered dioxadiazapentathia macrocycles. Dyes and
Pigments 74:699-705.
Gök HZ, Ocak Ü, Kantekin H, Alp H β007b. The synthesis and characterization of ββ-membered
diazapentathia macrocycles and investigation of their ion extraction capability from aqueous media.
Transition Metal Chemistry, 323:1073-1078.
POSTER PRESENTATION
295
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Gokel GW, Korzeniowski SH 1982. Macrocyclic polyether syntheses. Vol 13. In: Hafner K. et al. eds.
Reactivity and structure concepts in organic chemistry, Berlin: Springer-Verlag.
Hanack M, Heckman H, Polley R 1998. In: Methods of organic chemistry: additional supplementary volume.
Stutgard: Georg Thieme Verlag.
Hancock RD, Martell AE 1989. Ligand design for selective complexetion of metal ions in aqueous solution.
Chemical Reviews, 89:1875-1914.
Izatt RM, Bradshaw JS, Nielsen SA, Lamb JD, Christensen JJ 1985. Thermodynamic and kinetic data for
cation-macrocycle interaction. Chemical Reviews, 85:271-339.
Kabay N, Karadeniz H, Demirayak N, Gök Y β011. Synthesis and characterization of new metallo and
metal-free porphyrazines containing dioxadithia (O2S2) and tetrathia (S4) macrocyclic moieties.
Inorganic Chemistry Communications, 14:641-644.
Koray AR, Ahsen V, Bekaroğlu Ö 1λ86. Preparation of a novel, soluble copper phthalocyanine with crown
ether moieties. Chemical Communications, 932-933.
Leznoff CC, Lever ABP 1986-1989.Phthalocyanines: properties and applications. vol. 1–4. Weinheim: VCH.
Lindoy LF 1989. The chemistry of macrocyclic ligand complexes. Cambridge: Cambridge University Press.
Luo Q, Tian H, Chen B, Huang W 2007. Effective non-destructive readout of photochromic
bisthienylethene–phthalocyanine hybrid. Dyes and Pigments, 73:118-120.
Master AM, Rodriguez ME, Kenney ME, Oleinick NL, Gupta AS 2010. Delivery of the photosensitizer Pc 4
in PEG–PCL micelles for in vitro PDT studies. Journal of Pharmaceutical Sciences, 99:2386-2398.
Mortimer RJ, Dyer AL, Reynolds JR 2006. Electrochromic organic and polymeric materials for display
applications. Displays 27:2-18.
Musluoğlu E. Ahsen V, Gül A, Bekaroğlu Ö 1λλ1. Water-Soluble Phtalocyanines Containing Aza-Crown
Ether Substituents. Chemische Berichte, 124:2531-2536.
Ogunsipe A, Chao JY, Nyokong T 2004. Photophysical and photochemical studies of zinc(II)
phthalocyanine derivatives—effects of substituents and solvents. New Journal of Chemistry, 28:822–
827.
Palewska K, Sworakowski J, Lipiński J β01β. Molecular aggregation in soluble phthalocyanines - Chemical
interactions vs. π-stacking. Optical Materials, 34:1717–1724.
Pedersen CJ 1967. Cyclic polyethers and their complexes with metal salts. Journal of American Chemical
Society, 89: 7017-7065
Perrin DD, Armarego WL 1989. Purification of laboratory chemicals. 2nd ed. Oxford: Pergamon Press.
Qiu T, Xu X, Liu J, Qian X 2009. Chemical Probes for Molecular Imaging and Detection of Hydrogen
Sulfide and Reactive Sulfur Species in Biological Systems. Dyes and Pigments, 83:127–133.
Sizun T, Bouvet M, Chen Y, Suisse JM, Barochi G, Rossignol J 2011. Differential study of substituted and
unsubstituted cobalt phthalocyanines for gas sensor applications. Sensors and Actuators B: Chemical,
159:163-170
Takahashi K, Kawashima M, Tomita Y, Itoh M 1995. Synthesis and spectral and electrochemical properties
of 2,3,9,10,16,17,23,24-octabutylthiophthalocyaninatozinc(II). Inorganica Chimica Acta, 232:69-73.
Zhao P, Liang Q, Li Y 2005. Electrochemical, SEM/EDS and quantum chemical study of phthalocyanines as
corrosion inhibitors for mild steel in 1 mol/l HCl. Applied Surface Science, 252:1596-1607.
POSTER PRESENTATION
296
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
New Locality Records of Oribatid Mites (Acari) from Balıkesir province of Turkey
Şule BARAN
Sakarya University, Arts and Sciences Faculty, Biology Department, Sakarya, Turkey.
Corresponding author e-mail: sbaran@sakarya.edu.tr
Abstract
New locality records for the two species of oribatid mites Carabodes (C.) pirinensis Kunst, 1961 and
Passalozetes (P.) inlenticulatus Mihelčič, 1λ5λ were given from Balıkesir province.
The mite materials were collected from soil and litter samples taken from Balıkesir province and
extracted using a Berlese funnel apparatus. Mites were fixed and stored in 75% ethanol. The compound
microscopic examinations of specimens were made in lactic acid, mounted in temporary cavity slides.
The light and scanning electron microscopes were used to examine mites. For each species,
morphological features and distributions were given. Previously any study was done on the oribatid
mites of Balıkesir province.
Keywords: Acari, Oribatida, New Locality, Balıkesir, Turkey.
1. INTRODUCTION
Oribatid mites are among the most important decomposer microarthropods in soil ecosystems. Oribatid mites
can be found in very different microhabitats such as litter and humus layers, dead woods, bark of trees and
mosses (Aoki 1967, Hammer 1972, Wunderle 1992, Hansen 2000). Their densities in forest floors of the
temperate region range between 20,000 and 400,000 ind per m2.
While the number of species known all over the World is about 11.000 (Subias 2004), aproximately 250 of
these known from Turkey (Baran et al., 2018). This is a very restrictive number, in order to record the real
number of oribatid mite species found in Turkey much more study is to be required. Balıkesir province is in
the midwestern Turkey, having coastlines on both the Sea of Marmara and the Aegean and there isn't any
study on oribatid mites in this province up tu date.
The main goal of this study is to contribute to the knowledge of the Turkish oribatid fauna from Balıkesir
province. New locality records for the two species of oribatid mites Carabodes (C.) pirinensis Kunst, 1961
and Passalozetes inlenticulatus Mihelčič, 1λ5λ were given from this province.
2. MATERIALS AND METHODS
Soil samples taken from Balıkesir were placed on the Berlese funnel and the light source were opened for
seven days. The samples were stored in 70% ethanol bottle at the bottom of Berlese funnel. Mites were
sorted from the samples under a stereomicroscope and mounted on slides in modified Hoyer’s medium or
35% lactic acid. The light and scanning electron microscopes were used to examine mites.
3. RESULTS
Carabodidae Koch, 1837
Carabodes (Carabodes) Koch, 1835
Carabodes (C.) pirinensis Kunst, 1961
Body darkbrown in color. Rostrum board. Lamellar setae strong, rough, inwardly curved. Interlamellar setae
long and sickle-shaped. İnterlamellar region with broad, roughly sculpted and leaf-shaped longitudinal
grooves (Figure 1B). Bothridia strong, cup-shaped and placed on the outer sides of the lamellae. Sensilli
short, strong and with fine trichomes (Figure 1C).
POSTER PRESENTATION
297
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Notogaster oval (Figure 1A), ten pairs of leaf-shaped notogastral setae with dentate margins; bases are
narrow, wider at the apices (Figure 1D). Epimeral formula: 3-1-3-3.
Distributionμ Bulgaria and Turkey (Kunst 1λ61, Toluk and Ayyıldız β016)
Figure1. Carabodes (C.) pirinensis A- dorsal view, B- prodorsum, C- sensillus, D- Notogastral setae
Passalozetidae Grandjean, 1954
Passalozetes Grandjean, 1932
Passalozetes inlenticulatus Mihelčič, 1λ5λ
Body brown in color. Sensilli filiform with small barb. The surface of prodorsum and notogaster with three
or four branched linear ridges (Figure 2). Ten pairs of notogastral setae.
Distribution: Mediterranean
Figure 2. Passalozetes inlenticulatus dorsal view
POSTER PRESENTATION
298
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4. DISCUSSION
The length and shape of interlamellar setae and the leaf-shaped longitudinal formations on the prodrum are
the distinctive features of the species Carabodes (C.) pirinensis. This species only recorded from Bulgaria
and Turkey. The species Carabodes (C.) piri was previously recorded in Turkey only from the Bolu province
(Toluk and Ayyıldız, β016). This study comprises a new locality record of the species from Balıkesir
province.
The filiform sensillus and small humeral projection of notogaster are are the distinctive features of the
species Passalozetes inlenticulatus. This species previously recorded from Mediterranean region and was
previously recorded in Turkey only from the Sivas province (Toluk and Akin, 2017). This study comprises a
new locality record of the species from Balıkesir province.
ACKNOWLEDGEMENTS
I wish to thank Department of Metallurgical and Materials Engineering and Thermal Spray Covering and
Research Laboratory (SAÜ-TESLAB) for the Scanning Electron Microscopy investigations.
REFERENCES
Aoki J, 1967. A preliminary revision of the family Otocepheidae (Acari, Cryptostigmata). II. Subfamily
Tetracondylinae. Bulletin of the National Museum of Natural Science, Tokyo, 10(3), 297–359.
Baran Ş, Bezci T, Ayyıldız N β018. Supplementary checklist of oribatid mites (Acari) from Turkey. Mun.
Ent. Zool. Vol. 13(1):91-97.
Hammer M (1972) Investigations on the oribatid fauna of Tahiti, and some oribatids found on the Atoll
Rangiroa. Det Kong. Dansk. Vidensk. Selsk. Biol. Skr. 19 (3): 1-66.
Hansen RA (2000) Effects of litter habitat complexity and composition on a diverse litter microarthropod
assemblage. Ecology 81, 11201132.
Kunst, M., 1961. Bulgarische Oribatiden IV. (Acari: Oribatei). Acta Universitatis Carolinae – Biologia, 8:
151–183.
Subías LS β004. Listado sistemático, sinonímico y biogeográfico de los ácaros oribátidos (Acariformesμ
Oribatida) del mundo (excepto fósiles). Available atμ httpμ//bba.bioucm.es/cont/docs/RO_1.pdf [Erişim
15.02.18]
Toluk A and Ayyıldız N β016. New records of the genus Carabodes (Acari, Oribatida, Carabodidae) from
Turkey. 8th Symposium of the European Association of Acarologists (EURAAC), 11-15 July 2016,
Spain.
Toluk A and Akin AT 2017. Oribatid mite fauna (Acari) of Cat Forest, Sivas Province, Turkey. Turk.
entomol. derg., 2017, 41 (3): 293-307.
Wunderle I (1992) Die baum- und bodenbewohnenden Oribatiden (Acari) im Tieflandregenwald von
Panguana, Peru. Amazoniana 12(1): 119–142.
POSTER PRESENTATION
299
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Bazı Oribatid Akar Türlerinin Trichobothrium Setalarının Taramalı Elektron Mikroskobu
ile İncelenmesi
Merve YAŞA1*, Şule BARAN1
1*
Sakarya Üniversitesi, Fen Edebiyat Fakültesi, Biyoloji Bölümü, Sakarya, Türkiye.
Sorumlu Yazar e-mail: merve.yasa1@ogr.sakarya.edu.tr
Özet
Oribatid akarların teşhisinde morfolojik özellikler kullanılmaktadır. Trichobothrium kıllarının yapı ve
dizilişi oribatid akarların sistematiğinde önemlidir. Bu çalışmada oribatid akarlarda trichobothrium
kılları taramalı elektron mikroskobu ile incelenmiş ve bazı örnekler verilmiştir.
Anahtar Kelimeler: Acari, Oribatida, SEM, Trichobothrium, Seta.
1. GİRİŞ
Oribatid akarlar, bugüne kadar tanımlanmış yaklaşık 11.000’in üzerinde türü ile akarların en zengin
gruplarından birini oluşturmaktadır ( Subías, 2018 ). Kolaylıkla görülebilen daha büyük arthropodlarla
karşılaştırıldıklarında çok küçük olan oribatid akarlar mezofaunada en çok bulunan ve en fazla çeşit içeren
gruplardan olmasına rağmen hala çok az bilinmektedirler ( Schantz ve Behan, 2007 ).
Oribatid akarların morfolojik tanımlamasında sırttan ve karından görünüşü ile bacaklar esas alınır. Sırt
bölgesinde prodorsum ve notogaster olmak üzere iki bölgeye ayrılır. Notogasterde kılların sayısı ve yapısı,
prodorsumda trichobothrium yapısının şekli morfolojik tanımlamada önem taşımaktadır ( Balogh ve Balogh,
1992 ).
2. MATERYAL VE METOD
Çeşitli toprak örnekleri poşetlere konularak etiketlendi. Berlese hunilerine örnekler yerleştirildi. Hunilerin
dip kısmında % 70’lik etil alkol çözeltisi olan şişelere akarlar düştü. Örnekler, lambaların altında bir hafta
bekletildi. Şişelerdeki akarlar, petri kaplarına boşaltılıp stereo mikroskop altında ayıklandı. Örnekler ışık
mikroskobunda incelenmesi için % 50’lik laktik asitle ağartıldı. SEM incelemesi için örnekler 6 ile 1β saat
arasında toprak kalıntısı temizleyen deterjanda bekletilip, 1-2 saniye ultrasonic banyoda işlem gördü.
Kuruma noktasına dikkat edilen örnekler, stublara yerleştirildi ve altın tozu ile kaplanıp SEM’de resimler
çekildi. Teşhisleri yapılan örnekler, muhafaza altına alındı.
3. SONUÇ
İncelediğimiz türlerde 1.Carabodes sp. Silli, 2. Suctobelba sp. Uzun fusiform, 3. Platyliodes sp. Ensiform,
4.Ctenobelba sp. Tarak şeklinde, 5. Berniniella sp. Radiate, 6. Licnobelba sp. Clavate- verrucose, 7.
Zetorchestes sp. Auriculate- spiculate, 8. Zetorchestes sp. Auriculate- spiculate, 9. Gymnodamaeus sp. Uzun
clavate- iğneli, 10. Adrodamaeus sp. İnce uzun- yoğun dikenli, 11. Zygoribatula sp. İnce- fusiform başlısilli, 12. Liacarus sp. Spiniform, 13. Scheloribates sp. Uzun ince- fusiform başlı- silli, 14. Sphaerochthonius
sp. Auriculate- spiculate, 15. Cymbaeremaeus sp. Topuz şeklinde, 16. Porobelba sp. Setiform- kerotegüment
kaplı, 17. Epilohmannia sp. Setiform- dikenli, 18. Licnodamaeus sp. Kısa saplı clavate- verrucose, 19.
Chamobates sp. Kısa saplı clavat, β0. Tectocepheus sp. Geniş clavat- granüllü.
POSTER PRESENTATION
300
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
POSTER PRESENTATION
301
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
POSTER PRESENTATION
302
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil
1. Bazı oribatid akarların trichobotrium yapısı 1.Carabodes sp. 2. Suctobelba sp. 3. Platyliodes sp.
4.Ctenobelba sp. 5. Berniniella sp. 6. Licnobelba sp. 7. Zetorchestes sp. 8. Zetorchestes sp. 9.
Gymnodamaeus sp. 10. Adrodamaeus sp. 11. Zygoribatula sp. 12. Liacarus sp. 13. Scheloribates sp. 14.
Sphaerochthonius sp. 15. Cymbaeremaeus sp. 16. Porobelba sp. 17. Epilohmannia sp. 18. Licnodamaeus sp.
19. Chamobates sp. 20. Tectocepheus sp.
4. TARTIŞMA
Oribatid akarlarda trichobothrium kutikuladan oluşan, bothridium adı verilen boşluktan çıkan reseptör
organdır ( Alberti, 1998 ). Bu yapının en iyi oribatidlerde bulunduğu bilinmektedir. Işık, dokunma, işitme ve
solunum ile ilişkili olduğu düşünülmektedir. Bu yapılar ilkel ve gelişmiş oribatidlerde farklılık gösterir.
Gelişmiş oribatidlerde trichobothrium daha fazla pteromorfun içine yerleşmiştir. Böylece daha rahat hareket
ettiği varsayılmaktadır ( Alberti ve ark., 1λλ4 ). Sensillus yapısı basit, tüylü, testere dişli, diken şeklinde, iki
tarafı tarak şeklinde, spatül şeklinde, oraksı, mızraksı, mızraksı testere dişli, kama şeklinde görülebilir (
Mahunka ve Zombori, 1985 ).
KAYNAKLAR
Alberti G 1998. Fine Structure of Receptor Organs in Oribatid Mites (Acari). Arthropod Biology:
Contributions to Morphology, Ecology and Systematics.- Biosystematics and Ecology Series 14: 27-77.
Alberti G, Moreno A, Kratzmann M, 1994. The Fine Structure of Trichobotria in Moss Mites with Special
Emphasis on Acrogalumna longipluma. Acta Zoologıca Vol.75, No. 1, pp. 57- 74.
Balogh J, Balogh P, 1992. The Oribatid Mites Genera of the World. Vol. I. Hungarian Natural History
Museum, Budapest, 263 pp.
Mahunka S, Zombori L 1985. The variability of some morphological features in Oribatid mites. Folia
Entomologica Hungarica Vol.46, pp. 115- 128.
Schantz H., Behan-Pelletier V. Global Diversity of Oribatids (Oribatida:Acari: Arachnida) Hydrobiologia,
Volume 5958 (1)., 323-328.
Subías S β018. Listado Sistemático, Sinonímico y Biogeográfico de los. Ácaros Oribátidos (Acariformesμ
Oribatida) Del Mundo. http://bba.bioucm.es/cont/docs/RO_1.pdf
POSTER PRESENTATION
303
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Walter DE, Latonas S 2011. Almanac of Alberta Acari Part I. Ver. 2.1. The Royal Alberta Museum,
Edmonton, AB:http://www.royalalbertamuseum.ca/natural/insects/research/research.htm.
Walter DE, Latonas S 2011. Almanac of Alberta Acari Part II. Ver. 2.1. The Royal Alberta Museum,
Edmonton, AB:http://www.royalalbertamuseum.ca/natural/insects/research/research.htm.
POSTER PRESENTATION
304
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Newly Synthesized Thiazolidinones and Evaluation of their Genotoxic Potential
by the E. coli WP2 Bacterial Reverse Mutation Assay
Kadir Turhan1, Fatma Tülay Tuğcu1, Mehmet Karadayı2*, Medine Güllüce2
1
Yildiz Technical University, Faculty of Science and Art, Department of Chemistry, İstanbul, Turkey
*2
Atatürk University, Faculty of Science, Department of Biology, Erzurum, Turkey
Corresponding author e-mail: mkaradayi@atauni.edu.tr
Abstract
The thiazolidinone ring system has been widely employed in the investigation of pharmacologically
active heterocyclic compounds. These heterocycles display diverse biological activities, which make
them valuable for industrial applications. Although each newly synthesized molecule in this group
appears to be an important drug candidate due to these valuable properties, it is necessary to determine
the genotoxic properties of these molecules before conducting more complex pharmacological studies.
Thus, the current study was designated to synthesize new thiazolidinone derivatives and assess their
hazardous potentials by using the E. coli WP2 bacterial reverse mutation assay. Mutagenicity assays
were performed without metabolic activation system to check the directly gene mutation causing
capabilities, and with metabolic activation system to check the indirectly gene mutation causing
capabilities of the test materials. According to the results, the synthesized thiazolidinone derivatives did
not show any mutagenic effect on the tester strain with or without metabolic activation system at any
tested concentrations up to 1 mM/plate. The highest revertant colony count was observed as 46 ± 1.7 for
C2 (0.8 mM/plate – with metabolic activation), insignificant when compared to the control groups. In
conclusion, the test compounds newly synthesized in the present study can be considered as
genotoxically safe at the tested concentrations and the findings reported here are valuable for further new
drug development studies.
Keywords: Genotoxicity, Thiazolidinone derivatives, WP2 Assay.
1. INTRODUCTION
Synthetic chemicals have the most important role in meeting the rising raw material demands of the modern
world. Uses of these raw materials include many industrial fields such as agriculture, health-care, paint,
cosmetics, energy, and environmental management (Gosh 2015). Among them, synthetic pharmaceuticals
constitute the most interesting group as a result of having a wide range of usage in both medicine and
pharmacy. One of the strongest features of these materials is their cheaper and more stable production
processes than their natural counterparts. In addition, the formation of derivatives of these molecules by
various methods creates an infinite number of potentials to gain them various biological activities (Trosset
and Carbonell 2015).
In this regard, the thiazolidinones are one of the useful scaffolds in medicinal chemistry. Their derivatives
can be found as a pharmacophore in a wide variety of biologically active compounds, such as antitumorals,
antibacterials, antivirals, anticonvulsant, anti-inflammatory, antidiabetic, anti-HIV and many other
therapeutic agents (Barecca et al. β001ν Küçükgüzel et al. β00βν Pawar and Mulwad β004ν Rahman et al.
2005). As a result of these beneficial properties, the number of studies to develop new thiazolidinone
derivatives is increasing day by day. On the other hand, the recent studies that certain derivatives of these
substances may have adverse effects on human health and the environment and the lack of work to determine
their harmful effects raise public concern. Hence, determination of the hazardous potential of newly
synthesized chemicals remains a challenge against their commercialization (Tugcu et al. 2017; Turhan et al.
2012).
Today, as the number of synthesized derivatives rapidly grows, short-term toxicology test systems play a key
role in determining the potential hazards of these chemical substances and contribute to the elimination of
the existing concerns. In this context, the E. coli WP2 bacterial reverse mutation assay is widely accepted
because it gives accurate and reproducible results. Another important advantage of this assay is that it is
POSTER PRESENTATION
305
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
compatible with the metabolic activation system, which allows the understanding of the possible effects of
test chemicals on the human body (Baris et al. 2011).
Thus, the present study was designed to synthesize new derivatives of thiazolidinones that can be used in the
pharmaceutical industry in the future, and assess their potential hazardous effects by using E. coli WP2 assay
with or without metabolic activation system.
2. MATERIALS AND METHODS
2.1 Synthesis of Thiazolidinone Derivatives
To synthesize thioureas, a mixture of the appropriate amine (1 mmol) and substitue phenylisothiocyanate
(1.2 mmol) was stirred in CH2Cl2 at room temperature for 24 h. The crude product was concentrated under
vacuum and recrystallized from ethanol. Then, to synthesize the test compounds (C1-C4), the appropriate
thiourea (1 mmol), chloroacetic acid (1.2 mmol) and thiophene-2-carbaldehyde (1 mmol) was stirred with a
magnetic stirrer at 40 °C for 24 h. The crude product was purified by column chromatography (CHCl 3 or
CH2Cl2) (Kasmi-Mir et al. 2006). This method is summarized in Figure 1.
R
R
S
R1
HN
R1
S
S
H
+
HN
HO
O
+
O
S
N
24 h, 40 oC
Cl
solvent free
O
N
R2
R2
R = H, CH3, Cl
(C1-C4)
R1, R2= H, CH3
Figure 1. Synthesis of thiazolidinone derivatives
2.2 The E. coli WP2 Bacterial Reverse Mutation Assay
Chemicals: Direct acting mutagen N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) was purchased from
ABCR GmbH & Co. KG and indirect acting mutagen 2-aminofluorene (2-AF) from Sigma-Aldrich. Other
solvents and pure chemicals, including magnesium sulfate (MgSO 4), sodium ammonium phosphate
(Na2NH2PO4), D-glucose, sodium chloride (NaCl), L-tryptophane, sodium phosphate-dibasic (Na2HPO4),
citric acid monohydrate, potassium phosphate-dibasic (K2HPO4), and sodium phosphate-monobasic
(NaH2PO4) were purchased from Sigma-Aldrich. S9 metabolic activation system was purchased from
MOLTOX.
Tester Strain: E. coli WP2uvrA (ATCC® Number: 49979) strain was purchased from LGC Standards
Middlesex, UK. The tester strain was stored at -80 ºC as stock cultures. The working cultures were prepared
by inoculating nutrient broth with the frozen cultures followed by an overnight incubation at γ7 ºC with
gentle agitation (Ozturkcan et al. 2012).
Determination of Test Concentrations: The toxicity of test materials toward the E. coli WP2uvrA tester strain
was determined as described by Mortelmans and Zeiger (2000). These tests confirmed that there was normal
growth of the background lawn, spontaneous colony numbers within the regular range, and no significant
reduction in cell survival. Thus, for the concentrations and conditions reported here, no toxicity or other
adverse effects were observed.
Bacterial Reverse Mutation Assay: The mutagenicity assay was performed according to the procedure
described by Mortelmans and Riccio (β000). MNNG (1 µg/plate for the assay without Sλ) and β-AF (600
µg/plate for the assay with Sλ) were used as positive controls. 10% Dimethyl sulfoxide (DMSO) was also
used as negative control.
In the mutagenicity test performed with E. coli WP2uvrA without S9 metabolic activation, 100 µL of the
overnight bacterial culture, 50 µL of test compound solution at different concentrations (0.β, 0.4, 0.6, 0.8 and
1 mM/plate in 10% DMSO), and 500 µL of phosphate buffer were added to β mL of the top agar containing
POSTER PRESENTATION
306
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
0.05 mM L-tryptophan. The mixture was poured onto minimal glucose agar plates. Tryptophan independent
revertant colonies and viable cells were scored on the plates after incubation at γ7ºC for 48 h. This procedure
was all applicable to the mutagenicity assay performed with S9 metabolic activation. Two procedural
differences were the addition of S9 mix instead of phosphate buffer and 2-AF instead of direct acting
mutagen MNNG (Mortelmans and Zeiger 2000).
The plate incorporation method was used to assess the results (Maron and Ames 1983). The mutagenic index
was calculated for each concentration, which is the average number of revertants per plate divided by the
average number of revertants per plate with the negative (solvent) control. A sample was considered as
mutagenic when observed a dose-response relationship and a two-fold increase in the number of mutants
with at least one concentration was observed (Vargas et al. 1993; Varella et al. 2004; Evandri et al. 2005;
Santos et al. 2008). The results were presented as the mean and standard deviation of three experiments with
duplicate plates/dose experiment.
3. RESULTS
The synthesis studies gave four thiazolidinone derivatives (C1-C4). The structures and purities of these
compounds were elucidated based on the analysis of their physical and spectroscopic data. Chemical
properties of these newly synthesized compounds are summarized in Table 1.
Table 1. Chemical properties of the newly synthesized thiazolidinone derivatives.
Formula
Name
FW
Structure
S
S
C21H16N2OS2
3-(3-methylphenyl)-2-(phenylimino)-5-(thiophen2-yl methylidene)-1,3-thiazolidin-4-one
376.494 g/mol
C21H16N2OS2
2-[(3-methylphenyl)imino]-3-phenyl-5-(thiophen2-yl methylidene)-1,3-thiazolidin-4-one
376.494 g/mol
C21H15ClN2OS2
2-[(4-chlorophenyl)imino]-3-(3-methylphenyl)-5(thiophen-2-yl methylidene)-1,3-thiazolidin-4-one
410.940 g/mol
C22H18N2OS2
3-(3-methylphenyl)-2-[(4-methylphenyl)imino]-5(thiophen-2-yl methylidene)-1,3-thiazolidin-4-one
390.521 g/mol
N
N
O
CH3
(C1)
S
CH3
S
N
N
O
(C2)
Cl
S
S
N
N
O
CH3
(C3)
CH3
S
S
N
O
N
CH3
(C4)
POSTER PRESENTATION
307
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3-(3-Methylphenyl)-2-(phenylimino)-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C-1): Yellow
layer crystal, m.p. 165-6 0C; FTIR (near) max/cm-1: 3083, 2956, 2919, 1709, 1629, 1592, 1367, 1355, 1267,
1152, 1138, 854, 786; 1H NMR (500MHz, CDCl3): δ (ppm) 2.47 (3H, s), 7.02 (2H, d), 7.17 (1H, dd), 7.21
(1H, dt), 7.30 (4H, brd), 7.38 (1H, d), 7.54 (2H, brd), 7.59 (1H, d), 8.02 (1H, s); 13C NMR (100MHz,
CDCl3): δ (ppm) 21.98, 119.51, 120.96, 122.15, 128.19, 128.42, 129.53, 130.52, 131.65, 132.77, 133.98,
135.76, 137.84 138.38, 139.68, 143.74, 149.02, 159.92, 166.23; MS (m/z): 378 (M+2), 377(M+1),
376(M+), 208, 140, 104, 96, 77.
2-[(3-Methylphenyl)imino]-3-phenyl-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C-2): Yellow
powder, m.p. 186-7 0C; FTIR (near) max/cm-1: 3086, 2919, 2852, 1707, 1635, 1591, 1369, 1356, 1287, 1149,
1136, 851, 787; 1H NMR (500MHz, CDCl3): δ (ppm) 2.37 (3H, s), 6.83 (1H, d), 7.02 (1H, d), 7.18 (1H,
dd), 7.29 (1H, t), 7.38 (1H, d), 7.47 (2H, brd), 7.56 (4H, m), 7.59 (1H, d), 8.03 (1H, s); 13C NMR (100MHz,
CDCl3): δ (ppm) 21.68, 119.07, 121.04, 122.15, 123.19, 128.42, 129.03, 130.52, 131.65, 132.77, 133.98,
135.76, 137.84 138.38, 139.68, 143.74, 148.92, 158.34, 169.93; MS (m/z): 378 (M+2), 377(M+1), 376(M+),
208, 140, 104, 96, 77.
2-[(4-Chlorophenyl)imino]-3-(3-methylphenyl)-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C3): Yellow needle crystal, m.p. 151-2 0C; FTIR (near) max/cm-1: 3060, 2932, 2846, 1705, 1621, 1589, 1364,
1352, 1277, 1145, 1138, 861, 798; 1H NMR (500MHz, CDCl3): δ (ppm) 2.41 (3H, s), 6.88 (1H, brs), 7.02
(2H, d), 7.17 (1H, dd), 7.24 (1H, brd), 7.31 (1H, brd), 7.38 (1H, d), 7.49 (2H, brd), 7.59 (1H, d), 8.00 (1H, s);
13
C NMR (100MHz, CDCl3): δ (ppm) 21.82, 120.51, 122.96, 124.15, 125.19, 128.32, 128.83, 129.02,
129.65, 130.18, 130.56, 132.67, 132.84, 137.83, 138.62, 143.31, 147.12, 158.30, 167.34; MS (m/z): 412
(M+2), 411 (M+1), 410 (M+), 242, 140, 96, 65.
3-(3-Methylphenyl)-2-[(4-methylphenyl)imino]-5-(thiophen-2-ylmethylidene)-1,3-thiazolidin-4-one (C4): Yellow layer crystal, m.p. 148-9 0C; FTIR (near) max/cm-1: 3065, 2917, 2842, 1703, 1634, 1595, 1505,
1353, 1152, 863; 1H NMR (500MHz, CDCl3): δ (ppm) 2.35 ve 2.41 (3H, s), 6.87 (2H, brd), 7.13 (1H, dd),
7.15 (2H, brd), 7.33 (1H, brd), 7.34 (4H, brd), 7.54 (1H, brd), 7.99 (1H, s); 13C NMR (100MHz, CDCl3): δ
(ppm) 21.03, 21.35, 119.63, 120.10, 121.54, 125.38, 127.22, 127.57, 129.01, 130.07, 131.43, 131.92, 134.57,
137.74, 139.45, 151.08, 155.34, 166.02; MS (m/z): 392 (M+2), 391 (M+1), 390 (M+), 222, 140, 96, 91, 65.
The E. coli WP2 assay results showed that none of the test compounds has mutagenic potential at the tested
concentrations (0.2, 0.4, 0.6, 0.8 and 1 mM/plate) with or without metabolic activation (Figure 2 and Figure
3).
N.C.
C1
C2
C3
C4
28
29
30
30
31
28
29
30
0.2
0.4
0.6
0.8
33
32
33
32
25
29
30
26
CONTROLS
27
34
31
27
355
29
COUNT OF REVERTANTS
P.C.
1
CONCENTRATIONS (MILLIMOLAR/PLATE)
Figure 2. Mutagenicity assay results of the newly synthesized thiazolidinone derivatives, performed without
metabolic activation system.
POSTER PRESENTATION
308
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
N.C.
C1
C2
C3
C4
43
40
39
37
44
46
37
36
0.2
0.4
0.6
0.8
41
45
39
44
43
44
40
44
CONTROLS
39
45
40
41
40
COUNT OF REVERTANTS
397,16
P.C.
1
CONCENTRATIONS (MILLIMOLAR/PLATE)
Figure 3. Mutagenicity assay results of the newly synthesized thiazolidinone derivatives, performed with
metabolic activation system.
4. DISCUSSION
Synthetic thiazolidinone derivatives possess important biochemical and pharmacological properties such as
antitumorals, antibacterials, antivirals, anticonvulsant, anti-inflammatory, antidiabetic and anti-HIV activities
(Barecca et al. β001ν Küçükgüzel et al. 2002; Pawar and Mulwad 2004; Rahman et al. 2005). These
beneficial effects cause them to be synthesized in large quantities and their use spread. However, the lack of
adequate knowledge of the true toxic potential of these synthesized chemicals raises concerns in social and
scientific communities. In the middle of this dilemma, determination of toxicological properties of newly
synthesized derivatives has become a very important strategy for the improvement of their human healthcare applications (Tugcu et al. 2017; Turhan et al. 2012).
In the present study, four thiazolidinone derivatives were newly synthesized, purified and characterized to
serve the pharmaceutical industry as useful raw materials for drug development studies. On the other hand,
their hazardous potential was assessed by using the E. coli WP2 bacterial reverse mutation assay with or
without metabolic activation system. The tester strain was E. coli WP2uvrA with a single base substitution
mutation (A=T). In the assays performed without metabolic activation system, the tester strain determines
directly gene mutation causing capabilities of the test materials. In these studies, MNNG, a well-known
mutagen and carcinogen, was chosen as positive control. It is known that its mutagenic and lethal effects
closely related to methylation of DNA. Earlier studies showed that formation of O6-methylguanine, which is
one of its important products, appears to be responsible for its mutagenic activity (Kumaresan et al. 1995). In
this study, contrary to the MNNG, none of the derivatives showed any mutagenic potential at tested
concentrations. These results demonstrate that these newly synthesized derivatives are lack of the 2-AF like
mutation mechanism
In the assays performed with metabolic activation system, the tester strain determines indirectly gene
mutation causing capabilities of the test materials. In these studies, 2-AF, a synthetic arylamine and widely
used in laboratory researches as a model compound for studying the relationships among metabolic
activation requirements, DNA adduct structure, mutagenesis and carcinogenesis, was chosen as positive
control. In biological systems, it is known that 2-AF can be converted its metabolite acetylaminofluorene (2AAF) through acetylation and electrophiles that can react with DNA and form adducts. It is thought that 2AAF and 2-AF-DNA adduct formation leads to mutation, and eventually tumor formation (Garner et al.
1984; Novak and Rangappa 1992; Heflich and Neft 1994). In the present study, contrary to the 2-AF, the
derivatives did not show any mutagenic potential at the tested concentrations. These results demonstrate that
the test compounds are also lack of the 2-AF like mutation mechanism.
5. CONCLUSION
In conclusion, newly four thiazolidinone derivatives were synthesized in the present study. Besides,
hazardous potential of these compounds was determined by using the E. coli WP2 bacterial reverse mutation
POSTER PRESENTATION
309
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
assay with or without metabolic activation system. According to the genotoxicity assay results, these
derivatives can be considered as genotoxically safe at the tested concentrations and the findings reported here
are valuable for further new drug development studies.
ACKNOWLEDGEMENTS
Thanks for Yıldız Technical University Scientific Research Projects Coordination's support in this study.
Project No: 2010-01-02-GEP01.
REFERENCES
Baris O, Karadayi M, Yanmis D, Guvenalp Z, Bal T, Gulluce M 2011. Isolation of 3 Flavonoids from
Mentha longifolia (L.) Hudson subsp. longifolia and Determination of their genotoxic potentials by using
the E. coli WP2 test system. Journal of Food Science, 76(9): 212-217.
Barreca M, Chimirri A, Luca L, Monforte A, Monforte P, Rao A, Zappala M, Balzarini J, Clercq E,
Pannecouquec C, Witvrouwc M 2001. Discovery of 2,3-diaryl-1,3-thiazolidin-4-ones as potent anti-HIV1 agents. Bioorganic & Medicinal Chemistry Letters, 11: 1793-1796.
Evandri MG, Battinelli L, Daniele C, Mastrangelo S, Bolle P, Mazzanti G 2005. The antimutagenic activity
of Lavandula angustifolia (lavender) essential oil in the bacterial reverse mutation assay. Food and
Chemical Toxicology, 43: 1381-1387.
Garner RC, Martin CN, Clayson DB 1984. Carcinogenic aromatic amines and related compounds. In: Searle
CE (ed), Chemical carcinogens Vol. I, Washington DC; American Chemical Society, pp. 175-276.
Gosh SK 2015. Application of synthetic chemicals in agriculture and their toxic effect on the environment.
Bulletin of Environment, Pharmacology and Life Sciences, 4(9): 1-6.
Heflich RH, Neft RE 1994. Genetic toxicity of 2-acetylaminofluorene, 2-aminofluorene and some of their
metabolites and model metabolites. Mutation Research, 318(2): 73-114.
Kasmi-Mir S, Djafri A, Paquin L, Hamelin J, Rahmouni M 2006. One-pot synthesis of 5-arylidene-2-imino4-thiazolidinones under microwave irradiation. Molecules, 11: 597-602.
Kumaresan KR, Springhorn SS, Lacks SA 1995. Lethal and mutagenic actions of N-methyl-N’-nitro-Nnitrosoguanidine potentiated by oxidized glutathione, a seemingly harmless substance in the cellular
environment. Journal of Bacteriology, 177: 3641-3646.
Küçükgüzel SG, Oruç EE, Rollas S, Şahin F, Ozbek A β00β. Synthesis, characterization and biological
activity of novel 4-thiazolidinones, 1,3,4-oxadiazoles and some related compounds. European Journal of
Medicinal Chemistry, 37: 197-206.
Maron DM, Ames BN 1983. Revised methods for the Salmonella mutagenicity test. Mutation Research, 113:
173-215.
Mortelmans K, Riccio ES 2000. The bacterial tryptophan reverse mutation assay with Escherichia coli WP2.
Mutation Research, 455: 61-69.
Mortelmans K, Zeiger E 2000. The Ames Salmonella/microsome mutagenicity assay. Mutation Research,
455: 29-60.
Novak M, Rangappa KS 1992. Nucleophilic substitution on the ultimate hepatocarcinogen N-(sulfonatooxy)2-(acetylamino)fluorene by aromatic amines. Journal of Organic Chemistry, 57: 1285-1298.
Ozturkcan SA, Turhan K, Turgut Z, Karadayi M, Gulluce M 2012. Antigenotoxic properties of two newly
synthesized ί-aminoketones against N-methyl-N′-nitro-N-nitrosoguanidine and 9-aminoacridine-induced
mutagenesis. Journal of Biochemical and Molecular Toxicology, 26: 258-263.
Pawar RB, Mulwad VV 2004. Synthesis of some biologically active pyrazole, thiazolidinone, and
azetidinone derivatives. Chemistry of Heterocyclic Compounds, 40: 219-226.
Rahman VPM, Mukhtar S, Ansari WH, Lemiere G 2005. Synthesis, stereochemistry and biological activity
of some novel long alkyl substituted thiazolidin-4-ones and thiazan-4-one from 10-undecenoic acid
hydrazide. European Journal of Medicinal Chemistry, 40: 173-184.
Santos FV, Tubaldini FR, Cólus IMS, Andréo MA, Bauab TM, Leite CQF, Vilegas W, Varanda EA β008.
Mutagenicity of Mouriri pusa Gardner and Mouriri elliptica Martius. Food and Chemical Toxicology, 46:
2721-2727.
POSTER PRESENTATION
310
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Trosset JY, Carbonell P 2015. Synthetic biology for pharmaceutical drug discovery. Drug Design,
Development and Therapy, 9: 6285-6302.
Tugcu FT, Turhan K, Karadayi M, Gulluce M 2017. Genotoxic evaluation of newly synthesized
iminothiazolidinones, Toxicology and Industrial Health, 33(11): 811-820.
Turhan K, Ozturkcan SA, Turgut Z, Karadayi M, Gulluce M 2012. Protective properties of five newly
synthesized cyclic compounds against sodium azide and N-methyl-N’-nitro-N-nitrosoguanidine
genotoxicity. Toxicology and Industrial Health, 28: 605-613.
Varella SD, Pozetti GL, Vilegas W, Varanda EA 2004. Mutagenic activity in waste from an aluminum
products factory in Salmonella/microsome assay. Toxicology In Vitro, 18: 895-900.
Vargas VMF, Motta VEP, Henriques JAP 1993. Mutagenic activity detected by the Ames test in river water
the influence of petrochemical industries. Mutation Research, 319: 31-45.
POSTER PRESENTATION
311
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Mechanical Properties of Polycarbonate (PC)/Acrylonitrile-Butadiene-Styrene (ABS)/Waste Urea
Formaldehyde (WUF) Polymer Blends
Sena YUCE*, Nevriye Seyma AKYOL, Ezgi TASDEMIR, Munir TASDEMIR
Marmara University, Technology Faculty, Metallurgy and Materials Eng. Dep., Istanbul, 34722, Turkey
*
yuccesena@gmail.com
Abstract
In this study, polycarbonate/acrylonitrile butadiene styrene polymer blend matrix contributes to ground urea
formaldehyde powder is handled as 0, 5, 10, 20 and 30 wt% ratio will be mixed in the extruder. Mixture
obtained from the extruder to be granulated and then the granules will be obtained as appropriate standard
test sample of the injection molding machine. Mechanical and morphological tests will be applied such as
elasticity modulus, tensile strength at break, % elongation, Izod impact strength, hardness, density. Also,
SEM examination will be conducted to evaluate the microstructure of urea formaldehyde particles as well as
material distribution in these experiments.
Key words: polycarbonate, acrylonitrile butadiene styrene, urea formaldehyde, mechanical
properties, polymer blends.
1 INTRODUCTION
Polymer alloys and blends are studied extensively in recent years. In a various polymers, it is desired to
establish a good balance between hardness and toughness. Hardness of most of the synthetetic polymers is
characterized with brittleness and crack growth on a sudden loading. Therefore, wide research is being
conducted around the world to toughen brittle materials [1]. Recycled plastic are potentially the most
inexpensive polymer materials. However, the recycled plastics in general do not perform at sufficient level.
Blending of polymers is a common technology often used to develop a product with superior mechanical
properties from inexpensive polymer material with small amount of compatibilizers [2]. The increased
amount of polymer waste has become a serious issue globally and also caused depletion of petroleum
resources without which the modern life become impossible for mankind. In many applications thermosets
are the materials of choice for long-term use because they are insoluble and infusible high-density networks.
Recycling of thermosetting polymers is regarded as one of the urgent problems to be settled because of its
technological difficulty. The increased production of thermoset blends and composites in recent years has
greatly increased the amount of waste materials [3]. PC/ABS blends have been investigated with respect to
compatibility and mechanical behavior aspects [4-7].
Urea-formaldehyde (UF) accounts for about 15% of the total thermoset resin production. Currently, one of
its major applications is in molded products, including electrical equipment, dinner ware, buttons, cosmetic
caps, and bottles. However, the same factors that make UF a good choice for many applications, namely its
chemical, thermal, and mechanical stability, are also what make recycling such a big challenge [8]. In this
study, PC/ABS matrix contributes to ground urea formaldehyde powder is handled as 5, 10, 20 and 30 %
ratio will be mixed in the extruder. Mixture obtained from the extruder to be granulated and then the granules
will be obtained as appropriate standard test sample of the injection molding machine.
2 EXPERIMENTAL
2.1 Compositions and Materials
Five different polymer blends were prepared. Compositions of PC/ABS/waste urea formaldehyde (WUF)
polymer blends that were formed are given in Table 1.
POSTER PRESENTATION
312
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 1. Composition of the PC/ABS/WUF Polymer Blends Formulations
Groups
1
2
3
4
5
PC(wt %)
50
47.5
45
40
35
ABS (wt %)
50
47.5
45
40
35
WUF (wt %)
5
10
20
30
PC used in this study was obtained from GE (USA), with the trade name Lexan and the code number 144 R.
MFI value is 1λ g/10 min (ββ0°C, 10 kg), vicat softening point is 14β°C. ABS is also a GE (USA) product
with 750 SW code number. Melting point is 230–β60°C. Waste urea formaldehyde was supplied Viko by
Panasonic Company (Istanbul-Turkey).
2.2 Sample Preparation
UF was dried in a Yamato vacuum oven ADP-31 (Yamato/VWR Scientific Products, Japan) at 105 oC for 24
hours before being blended with PC/ABS. Mechanical premixing of solid compositions was done using a
LB-5601 liquid-solids blender (The Patterson-Kelley Co., Inc. east Stroudsburg, PA-USA) brand batch
blender for 25 min. Samples with various proportions of PC/ABS/WUF polymer blends were produced
between 250-300 oC at 25-35 bar pressure, and a rotation rate of 25 rpm, with a Microsan co-rotating twinscrew extruder (Microsan Instrument Inc. Kocaeli - Turkey). PC/ABS/WUF polymer blends were also dried
in vacuum oven at 105 oC for 24 hours after extrusion. Subsequently, test samples were molded in injection
molding machine. Extrusion and injection conditions are given in Table 2.
Table 2. Extrusion and Injection Conditions of the PC/ABS/WUF Polymer Blends
Process
Temperature (o C)
Pressure (bar)
Waiting time in mold (s)
Screw speed (rpm)
Mould temperature (oC )
Extrusion
250–300
25-35
25
-
Injection
250–300
110–130
20
25
40
Waste urea formaldehyde dry grinded with Siemens simatic C7-621 control system device to obtain
unsegregated powders. The size of urea formaldehyde particles varied between 10–80µm. Powder
preparations steps are given in Figure 1.
WUF
granulation
powder
Figure 1 Waste Urea Formaldehyde Powder Preparation Steps
2.3 Test Procedure
Tensile tests were performed according to ASTM D638 specification. They were carried out using a Zwick
Z010 (Germany) testing machine with a load cell capacity of 10 kN at a cross-head speed of 50 mm/min.
The elastic modulus, strength at break and percent elongation was determined from the stress–strain curves.
Seven samples were tested in each set and the average value was reported. The hardness test was done
POSTER PRESENTATION
313
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
according to the ASTM D2240 method with Zwick hardness measurement equipment. To investigate
fracture behavior, Izod impact test (notched) was done at room temperature according to the ASTM D256
method with Zwick B5113 impact test device. Determination of density was done according to ISO 2781
test standard. The fractured surfaces of the PC/ABS/WUF polymer blends were coated to thickness of β0 Å
of a gold (Au) to prevent electrical charging by Polaron SC7640 (high resolution sputter coater) (United
Kingdom). The surfaces of the prepared samples were observed by the FEI Sirion XL30 FEG (Nederland)
scanning electron microscopy (SEM) at an acceleration voltage of 20 kV.
3. RESULT and DISCUSSION
3.1 Mechanical properties of PC/ABS /WUF blends
The relationship between the elasticity modulus and the percentage of the waste urea formaldehyde powder
of PC/ABS blend is shown in the Figure 2-A. The elasticity modulus of PC/ABS/WUF blend increases as
the urea formaldehyde concentration increases from 0 to 30 wt %. The maximum elasticity modulus is
observed at the 30 wt % WUF concentration for PC/ABS. In comparison with the elasticity modulus of
PC/ABS, the elasticity modulus increased by 130% for the composites with a 30 wt % UF concentration. The
relationship between the ratio percentage of the waste urea formaldehyde and tensile strength at break of
PC/ABS blends is shown in the Figure 2-B. Tensile strength at break of blends shows an decrement as the
waste urea formaldehyde concentration increases from 0 to 30 wt %. The minimum tensile strength at break
is observed at the 30 wt % waste urea formaldehyde concentration for PC/ABS. In comparison with the
tensile strength at break of PC/ABS, the tensile strength at break decreased by 64 % for the composites with
a 30 wt % urea formaldehyde concentration. The elongation at break of waste urea formaldehyde filled
blends was measured, as shown in Figure 2-C. With increased loading, the elongation at break of blends
filled with waste urea formaldehyde is decreased. The minimum elongation at break is observed at the 30 wt
% waste urea formaldehyde concentration for PC/ABS. In comparison with the elongation at break of virgin
PC/ABS, the elongation at break decreased by 63 % for the blends with a 30 wt % waste urea formaldehyde
concentration.
Group 1 PC/ABS (50/50)
Group 2 PC/ABS/WUF (47,5/47,5/5)
Group 3 PC/ABS/WUF (45/45/10)
Group 4 PC/ABS/WUF (40/40/20)
Group 5 PC/ABS/WUF (35/35/30)
Elasticity Modulus (MPa)
2400
50
Tensile strength at break (MPa)
2800
2348
2000
1600
1355
1463
1214
1200
1021
Grup 1 PC/ABS (50/50)
Grup 2 PC/ABS/WUF (47,5/47,5/5)
Grup 3 PC/ABS/WUF (45/45/10)
Grup 4 PC/ABS/WUF (40/40/20)
Grup 5 PC/ABS/WUF (35/35/30)
40
30
25
20
17
12
10
0
10
20
Ureaformaldehyde (wt%)
0
30
10
20
Ureaformaldehyde (wt%)
A
4
Hardness (Shore D)
2
1,3
1
Group 1 PC/ABS (100)
Group 2 PC/ABS/WUF (47,5/47,5/5)
Group 3 PC/ABS/WUF (45/45/10)
Group 4 PC/ABS/WUF (40/40/20)
Group 5 PC/ABS/WUF (35/35/30)
72
2,7
1,4
30
B
74
Group 1 PC/ABS (50/50)
Group 2 PC/ABS/WUF (47,5/47,5/5)
Group 3 PC/ABS/WUF (45/45/10)
Group 4 PC/ABS/WUF (40/40/20)
Group 5 PC/ABS/WUF (35/35/30)
3
% Elongation
9
0
800
2
11
1
0
70
69,2
68,2
69,5
68,2
68
67,3
66
64
0
10
20
Ureaformaldehyde (wt%)
C
POSTER PRESENTATION
30
0
10
20
Ureaformaldehyde (wt%)
30
D
314
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
1,60
Group 1 PC/ABS (100)
Group 2 PC/ABS/WUF (47,5/47,5/5)
Group 3 PC/ABS/WUF (45/45/10)
Group 4 PC/ABS/WUF (40/40/20)
Group 5 PC/ABS/WUF (35/35/30)
9
8
7,8
7
6
6
5
5
Group 1 PC/ABS (100)
Group 2 PC/ABS/WUF (47,5/47,5/5)
Group 3 PC/ABS/WUF (45/45/10)
Group 4 PC/ABS/WUF(40/40/20)
Group 5 PC/ABS/WUF (35/35/30)
1,40
Density (g/cm3)
Izod impavt strength (kJ/m2)
10
5,4
1,2419
1,20
1,1045
1,1176
1,1246
1,0692
1,00
4,6
0,80
4
0
10
20
Ureaformaldehyde (wt%)
30
0
10
20
Ureaformaldehyde (wt%)
30
E
F
Figure 2. Mechanical Properties of the PC/ABS/WUF Polymer Blends
The relationship between the waste urea formaldehyde content and the hardness of the polymer blends is
shown in Figure 2-D. The hardness of the blends increased (from 0 to 30wt %) with an increase weight
percentage of urea formaldehyde powder. The maximum hardness is observed at the 30 wt % urea
formaldehyde concentration for PC/ABS. In comparison with the hardness of virgin PC/ABS, the hardness
increased by 3% for the composites at a 30 wt % urea formaldehyde concentration. Figure 2-E illustrates the
effect of urea formaldehyde on the Izod impact strength (notched) of PC/ABS blends. The Izod impact
strength decreased as the urea formaldehyde particle concentration increased from 0 to 30 wt %. In
comparison with the Izod impact strength of virgin PC/ABS, the Izod impact strength decreased by 23% for
the composites at a 30 wt % urea formaldehyde concentration. Figure 1-F illustrates the effect of urea
formaldehyde on the density of PC/ABS blends. The density increased as the urea formaldehyde particle
concentration increased from 0 to 30 wt %. In comparison with the density of virgin PC/ABS, the density
increased by 16% for the composites at a 30 wt % urea formaldehyde concentration.
3.2 Morphological properties of PC/ABS /UF polymer blends
The SEM study was carried out to study the dispersion of waste urea formaldehyde in the PC/ABS matrix.
The boundaries and the contrast can be obviously seen between the urea formaldehyde and PC/ABS matrix
on the fractured surfaces of polymer matrix (Figure 3). The micrographs indicate that the UF particulates are
homogeneously dispersed on the fractured surfaces of PC/ABS polymer matrix.
Urea formaldehyde powder
Group 3ABS/PC/WUF (45/45/10)
Group 1 PC/ABS (50/50)
Group 2 ABS/PC/WUF (47.5/47.5/5)
Group 4ABS/PC/WUF (40/40/20) Group 5 ABS/PC/WUF (35/35/30)
Figure 3. SEM Micrographs of the PC/ABS/WUF Polymer Blends
POSTER PRESENTATION
315
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
4 CONCLUSION
The effects of waste urea formaldehyde on the mechanical properties, such as elastic modulus, tensile
strength at break, % elongation, hardness, Izod impact strength, and density of PC/ABS/UF blends were
investigated. The following results were obtained: Elastic modulus, hardness and density increased gradually
as the waste urea formaldehyde content increased. Tensile strength at break, % elongation and Izod impact
strength decreased gradually as the waste urea formaldehyde content increased. The micrographs indicate
that the urea formaldehyde particulates are homogeneously dispersed on the fractured surfaces of PC/ABS
polymer matrix.
Acknowledgement: This work has been supported by the Scientific Research Project Program of Marmara
University
References
[1] Tasdemir, M., Karatop, S., Journal of Applied Polymer Science 2006. Effect of styrene–
isopren–styrene addition on the recycled polycarbonate/acrylonitrile–butadiene–styrene polymer
blends, 101, 559–566.
[2] Tasdemir, M., Miskioglu, I., Int. J. Of Mat. And Manufacturing 2016. Friction and wear
behaviors of HIPS/SBS polymer blends, Vol. 4/2, 95-99.
[3] Thomas, R., Vijayan, P., Thomas, S., Recent Developments in Polymer Recycling 2011.
Recycling of thermosetting polymers: their blends and composites: 121-153.
[4]W.N. Kim and C.M. Burns, Polym. Eng. Sci., 1988. Thermal behavior, morphology, and some
melt properties of blends of polycarbonate with poly(styrene-co-acrylonitrile) and
poly(acrylonitrile-butadiene-styrene), 28, 1115.
[5] T. A. Callaghan, K. Takakuwa, and D.R. Paul, Polymer, 1993. Polycarbonate-SAN copolymer
interaction. 34, 3796.
[6] J.D. Keitz, J.W. Barlow, and D.R. Paul, J. Appl. Poly. Sci. 1984. Polycarbonate blends with
styrene/acrylonitrile copolymers, 29, 313.
[7] H. Suarez, J. W. Barlow, and D.R. Paul, J. Appl. Poly. Sci. 1984. Mechanical Properties of
ABS/polycarbonate blends, 29, 3253.
[8] Evelin, D. B., Chris, C. W., Montgomery, T. S., Journal of Applied Polymer Science,
Mechanical properties of blends of HDPE and recycled urea-formaldehyde resin, 2000. 77, 3220.
POSTER PRESENTATION
316
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Birincil ve İkincil Arıtma Çamurlarının Mezofilik Sıcaklıkta Ayrı Anaerobik Çürütme
Potansiyeli ve Stabilize Çamur Kalitesinin Araştırılması
Cansu Bayhan, Dilek Erdirençelebi*
Selçuk Üniversitesi, Mühendislik Fakültesi, Çevre Mühendisliği Bölümü, Konya, TR
*dbaktil@hotmail.com
Özet
Bu çalışmada kentsel atıksu arıtma tesislerinde (AAT) oluşan birincil (ön çöktürme) ve ikincil (fazla
biyolojik) çamur fraksiyonlarının ayrı anaerobik stabilizasyonu laboratuvar ölçekli yarı-kesikli anaerobik
reaktörlerde mezofilik sıcaklıkta (γ5 oC) farklı yükleme hızlarında çalışılmış ve proses performans
parametreleri (metan üretim ve dönüşüm oranı, yağ-gres ve uçucu katı madde (UKM) giderimi, susuzlaşma)
incelenmiştir. Birincil çamur (BÇ) beslenen ardışık kesikli reaktörde (AKR) hidrolik bekletme süreleri
(HBS) γ0 ve β5 gün, UKM yüklemeleri 1.1 ve 1.γ kg UKM/m 3.g değerlerinde çalışılmıştır. İkincil çamur
(İÇ) beslenen reaktör için HBS β8 ve β4 gün, UKM yükleme hızları 0.γ ve 0.γγ kg UKM/m 3.g olarak
çalışılmıştır. Çalışmanın amacı arıtma çamuru fraksiyonlarının ayrı anaerobik stabilizasyonunun farklı
bekletme sürelerinde hem biyogaz üretimine hem de son ürün stabilize çamurun kalitesine yönelik iyileşme
sağlaması ile mevcut AAT çamur hattı işletimine yeni bir model ortaya koymaktır. Artan yükleme ile her iki
çamur fraksiyonu için de metan dönüşüm oranında artış ve BÇ için UKM gideriminde düşüş ve susuzlaşma
özelliğinde artış, İÇ için UKM gideriminde artış ve susuzlaşma kabiliyetinde düşüş trendi, her iki çamur
fraksiyonu için ayrı stabilizasyon modelinin yüksek yükleme ve düşük HBS/hacimde uygulanabilirliğini
göstermiştir. Ayrıca BÇ’un yoğunlaşma ihtiyacının olmadığı ve çamur hattı geri devir probleminin ayrı
sistemle ortadan kaldırılabileceği belirlenmiştir.
Anahtar Kelimelerμ Arıtma çamurları, anaerobik, stabilizasyon.
1.GİRİŞ
Arıtma çamurlarının artması, atık biyolojik çamurun ön arıtım yöntemleri, birincil çamurun diğer organik
atıklar ile birlikte çürütülmesi ve tek veya çok kademeli termofilik+mezofilik anaerobik stabilizasyon
çalışmaları ile çamur çürütme prosesinin enerji eldesi ve stabilizasyon derecesinin iyileştirilmesi
çalışmalarına önem kazandırırken yaygınlaştırmaktadır. Uluslararası çalışmalarda farklı sistemlerin
fizibilitesi lab ölçekli çalışmalarla yürütülmekte ise de gerçek ölçekli uygulamalar için maliyet-enerji
etkinliği henüz uygulanabilir seviyede olmamaktadır. A.B.D. kaynaklı gerçek ölçekli tesislerde termofilik
sıcaklık veya kademeli termofilik-mezofilik uygulaması ile çıkış biyokatı kalitesinin yükseltilmesi tercih
edilmektedir (Iranpour ve ark., β004ν Shao ve ark., β00βν Krugel ve ark. 1λλ8). Literatürde ise termofilik
çürütücülerin kararsız işletim özelliği nedeniyle farklı sonuçlar elde edilmiştir. Ulusal ölçekte ise mevcut
anaerobik çürütücüler için öncelikli olarak orta ve üst mezofilik sıcaklık seviyesinde birincil ve ikincil çamur
fraksiyonların ayrı çürütülmesinin sağlayacağı faydaların araştırılması gerekmektedir. Atıksu arıtma
tesislerinin (AAT) sayısındaki artış ve üretilen atık çamur için gereken kalite, çamurun anaerobik çürütme
verimliliğini arttırmayı gerekli kılmaktadır. İkincil çamurun (İÇ) ön işlemleri, çamurdan uçucu katıların ve
patojen mikroorganizmaların giderilmesinde önemli avantajlar göstermiş ve biyogaz üretimi üzerinde de
olumlu bir etkisi olmuşturν 55°C’de, 1β ve β4 sa süre ile işlem sonucunda çamur yapısının hidrolizi % 40,
metan verimliliği %βγ oranında ve çamur akışkanlığında genel bir iyileşme olmuştur (Carvajal ve ark.,
β01γ). Biyokimyasal metan potansiyeli deneyleri, ikincil çamurun metan üretim potansiyelinin hafif termal
ön işlemle büyük ölçüde arttırılabileceğini, ön işlem sıcaklığı 100°C ve çürütme süresi β0 gün ile metan
veriminin 14β.6 ± β.5 mL/g uçucu katı maddeye kadar yükselebileceğini göstermiştir (Yan ve ark., β01γ).
İki kademeli anaerobik çürütme işleminde karışık çamur (KÇ) için termofilik + mezofilik sistemde sırasıyla
2-3 ve 10-1γ g’lük çamur bekletme sürelerinde tek kademeli klasik anaerobik çürütme işlemine göre patojen
gideriminde A sınıfı biyokatı eldesinin mümkün olabileceği gösterilmiştir (Rubio-Loza ve ark,, 2010).
POSTER PRESENTATION
317
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
BÇ’nin anaerobik çözünürlüğü üzerine pH’ın etkisi kesikli anaerobik reaktörlerde β0 g ve γ5°C’de
incelendiğinde pH’nın kontrol edilmediği işletimde toplam katı madde (TKM) ve uçucu askıda katı madde
(UAKM) giderimi beklendiğinden daha yüksek gerçekleşmiştir (Gomec ve Speece β00γ). Buna karşın İÇ’un
pH kontrollü çürütülmesinde daha yüksek TKM ve uçucu katı madde (UKM) giderimi elde edilmiştir. pH
kontrolü altında BÇ’un hidroliz ve asitlenme periyodunda azalma gözlenmiştir. İÇ için ise asidojenik safha,
pH korunumu ve uçucu yağ asiti (UYA) oluşumu gözlenmemiştir. Sonuçlar BÇ ve İÇ’un yapısal farkının
farklı anaerobik stabilizasyon özellikleri gerektirdiğini göstermektedir.
Yağ-gres ve lipid (YGL) içeriği arıtma çamurlarının susuzlaşma kabiliyetini düşürmektedir. Bu tip
çamurların ilave katkı maddeleriyle susuzlaşma seviyesinin arttırılması birçok farklı madde ile literatürde
çalışılmıştır (Ziels ve Karlsson, β016).
Yapısı ve debisi oldukça farklı BÇ ve İÇ fraksiyonlarının çamur hattında birleştirilerek yoğunlaştırma ve
ardından anaerobik çürütme prosesine tabi tutulması AAT işletiminde ciddi problemlere yol açmaktadır
(Tomei ve ark., β016). Yapılan çalışmanın amacı, ayrık stabilizasyon modelinin potansiyel avantaj ve
kısıtlamalarını belirlemektir.
2. MATERYAL VE METOT
Laboratuvar ölçekli gaz ve numune çıkışları olan β000 mL paralel reaktörler, 1500 mL aktif hacimde BÇ ve
İÇ ile günlük olarak beslenerek mezofilik (35oC) sıcaklık seviyesinde inkübe edilmiştir. Hidrolik bekletme
süresi (HBS) sırasıyla BÇ ve İÇ için γ0, β5 ve β8, β4 g olarak çalışılmıştır. UKM yüklenme hızı sırasıyla BÇ
ve İÇ için 1.1, 1.γ ve 0.γ, 0.33 kg UKM/m3.g olarak uygulanmıştır. Karıştırma, besleme ve gaz ölçümleri
günlük olarak gerçekleştirildi. Metan, sıvı yer değiştirme yöntemi ile günde iki kez doğrudan ölçülmüştür.
Her UKM yüklenme hızında kararlı halee ulaşıldığında UKM, yağ-gres ve çamur susuzlaşma analizleri
yapılmıştır. Bikarbonat, UYA, pH ve çözünmüş sülfür günlük olarak belirlenmiştir. TKM (2540-B), UKM
(2540-C), yağ-gres (55β0 E), çözünmüş sülfür (4500 Sβ- F) ve susuzlaşma (β710 H) standart metotlara göre
belirlenmiştir (APHA, β005). Yağ-gres UKM’nin %’si olarak hesaplanmıştır.
Çalışma kapsamında 15 günlük periyotlarla KOSKİ AAT ön çöktürme çıkışından alınan BÇ ve biyolojik
arıtım geri devir hattından alınan İÇ ham çamur numunelerinin karakterizasyonu TKM/ UKM, yağ-gres, pH
ve susuzlaşma parametreleri ile belirlenmiştir. Anaerobik aşı çamuru KOSKİ ATT dekantör girişinden
alınmıştır. BÇ, İÇ’a göre daha geniş bir aralıkta salınım, yüksek UKM içeriği ve düşük susuzlaşma kabiliyeti
göstermiştir. Çökelme deneylerinde BÇ’un çökmediği ve İÇ’un 400-500 mL/L değerine kadar çökelme
kabiliyeti gösterdiği belirlenmiştir.
Ham Çamur
BÇ
İÇ
Aşı
pH
6.3-7.0
7.2-8.0
8.2-8.4
Tablo 1. Ham Çamur Özellikleri
TKM
UKM
(mg/l)
(mg/l)
30000-50000
20000-35000
7000-11000
5000-7000
17720-19000
10900-12000
Susuzlaşma Süresi
(dk)
5-10
1.67-2.5
3.SONUÇ
Adaptasyon döneminde BÇ ve İÇ için sırasıyla 0.57 ve 0.β6 kg UKM/m 3.g yükleme hızlarında çalışılmıştır
(Şekil 1-a). Ortalama metan dönüşüm oranı BÇ ve İÇ için sırasıyla β00-400 ve 84-494 ml metan/g
UKMbeslenen olarak gerçekleşmiştir (Şekil 1-b). İlk yükleme hızında (1.1λ ve 0.γ kg UKM/m 3.g UKMbeslenen)
ise bu değerler BÇ için 400-640 ml metan/g UKMbeslenen aralığına artarken, İÇ için β00 ml metan/g
UKMbeslenen‘nin altında gerçekleşmiştir. Bu reaktöre aşı takviyesi yapılarak bakteriyel bozulma
iyileştirilmiştir. Sonraki dönemde yükleme hızında BÇ için 1.64 kg UKM/m 3.g’e artış ve İÇ için 0.2 kg
UKM/m3.g UKMbeslenen’a düşüş gerçekleşmiştir. Bu dönemde BÇ için metan dönüşümü 640-740
seviyesinden 540 ml metan/g UKMbeslenen seviyesine düşmüştür. Bu düşüşte toksisite etkisi oluştuğu kabul
edilerek yükleme değeri 1.γ’e düşürülmüştür. İÇ için performans 390(+/-)50 ml metan/g UKMbeslenen
seviyesine yükselmiştir. Sonraki yükleme hızında ise İÇ için 0.γ5 kg UKM/m 3.g olarak gerçekleşirken elde
edilen metan dönüşüm oranı 500’den 8β4 ml metan/g UKM beslenen‘e kadar yükselmiştir (Şekil 1-b). Artan
yükleme ile metan dönüşümünde artış, özellikle İÇ için oldukça yüksek gerçekleşmiştir. Bunda da İÇ’un
düşük hidroliz hızı sebebiyle besin içeriğinin anaerobik biyokütle için düşük yüklemelerde yetersiz kaldığı
POSTER PRESENTATION
318
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
kabul edilebilir. İÇ’un UKM konsantrasyonundaki değişimin genel olarak düşük gerçekleşmesi AAT
biyolojik arıtım hattının tasarım değerlerinin kararlı şekilde sağlanmasının sonucudur ve bu çamur
fraksiyonunun etkin metan üretimi sağlaması için yüksek yükleme/düşük HBS ile mümkün olabilir.
Susuzlaşma değeri (Time-to-filter (TTF)) çıkış numuneleri için BÇ ve İÇ için sırasıyla 5-5.3 ve 2.45-3.45 dk
olarak gerçekleşmiştir (Şekil 1-a). BÇ’un anaerobik stabilizasyonla susuzlaşma özelliği artarken, İÇ’un
susuzlaşma özelliği düşmüştür.
Reaktörlerdeki çözünmüş sülfür ise metan üretimine ters yönde değişim göstermiştir. Özellikle
besleme çamurunun değişmesi ile değişkenlik göstermiştir. Adaptasyon sürecinde çözünmüş sülfür
BÇ ve İÇ için 5 mg/L’nin altında oluşurken, yükleme hızının artması ile BÇ için β0-25 mg/L ve İÇ
için 10-15 mg/L seviyesine yükselmesini sonraki yüklemede γ6-51 ve 55-62 mg/L seviyeleri takip
etmiştir. Çözünmüş sülfürün toksik etki oluşturduğu aynı dönemde metan dönüşüm oranındaki
azalma ile belirlenmiştir. Bu durum demir klorür tuzu ilavesi ile kontrol edilmeye başlanmıştır.
Reaktörlerden çıkış çamur UKM konsantrasyonları BÇ ve İÇ için sırasıyla 16000 mg/L’ye artış ve
4000 mg/L seviyesine düşüş şeklinde gerçekleşmiştir (Şekil β-a). Bu sonuçta BÇ’un besi içeriğinin
yüksek ve İÇ’un yetersiz kaldığı veya düşük hidroliz seviyesinin etkisi gözlenmektedir. UKM
giderimi BÇ için artan yükleme ile %60’dan %γ5-40 seviyesine düşüş göstermiştir (Şekil β-b). İÇ
için %5γ(+/-)10 seviyesinde gerçekleşmiştir. Ham İÇ’un UKM değeri reaktördeki çamurun UKM
değerinden daha düşük olduğu için İÇ için ilk süreçte giderim hesaplanamamıştır.
Yağ gres içeriği BÇ beslenen reaktör için yükleme arttıkça %7.6’dan β4’e yükselmiş, gelen
çamurun UKM değerindeki artış ile paralellik göstermiştir. İÇ beslenen çürütücüde yağ gres içeriği
daha düşük seviyede artışla %10’dan %14.5’a yükselmiştir.
Çıkış numunelerinin pH aralığı ise BÇ için 7.4-8.0 ve İÇ için 7.λ-8.4 aralığında gerçekleşmiştir.
4. TARTIŞMA
Çalışmada her iki çamur fraksiyonu için aynı HBS fakat farklı yükleme değerlerinde çalışılmış,
reaktörler stabil hale ulaştığında yeni yüklemeye geçilmiştir. BÇ, İÇ’a göre oldukça yüksek UKM
içeriği ile yüksek besleyici yapısından dolayı daha stabil işletim sağlamış, yükselen yükleme hızı ile
artan metan üretimi sağlarken UKM gideriminde düşüş göstermiştir. Bunda BÇ için hidroliz hızının
çürütme hızına kısıtlayıcı etkisi ve/veya artan reaktör biyokütle konsantrasyonunun etkisi
belirtilebilir. Bunun yanı sıra ham çamur daha geniş bir aralıkta değişim göstermiştir.
İÇ’un anaerobik stabilizasyonu BÇ ile karşılaştırıldığında artan yüklemelerin metan dönüşüm
oranında daha etkin olduğunu ve oldukça yüksek değerler elde edilebileceğini göstermiştir. Her iki
fraksiyonun da yakın metanlaşma oranı ayrışabilirlik olarak çok farklı olmadıklarını ortaya
koymuştur. Bu da İÇ’un düşük UKM içeriği ve yüksek susuzlaşma kabiliyeti gözönüne alındığında
ayrı mekanik yoğunlaştırma sonrası anaerobik stabilizasyonunun düşük HBS değerlerinde oldukça
verimli bir çürütme reaksiyonu sağlayacağını göstermektedir. Bu sonuca
göre BÇ’un yüksek UKM içeriğinden dolayı yoğunlaştırma tankına alınmadan doğrudan
çürütücülere beslenmesi ile yoğunlaştırılarda yaşanan çökelme problemi ve taşkanla tesis girişine
çamur geri devrinin önüne geçilmiş olacaktır.
POSTER PRESENTATION
319
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
UKM YH (kg UKM/m3.g)
1,80
(a)
1,60
1,40
1,20
1,00
TTF (BÇ)μ5.15 dk
TTF (İÇ)μβ.45 dk
0,80
BÇ
TTF (BÇ)μ5.08 dk
TTF (İÇ)μγ.45 dk
İÇ
0,60
0,40
0,20
0,00
21.12 26.12 31.12 5.1 10.1 15.1 20.1 25.1 30.1 4.2
9.2 14.2 19.2 24.2 1.3
6.3
1400
(b)
Metan Üretimi (mL/g
UKMeklenen)
1200
1000
800
BÇ
İÇ
600
400
200
0
21.12
31.12
10.1
20.1
30.1
9.2
19.2
1.3
11.3
Çözünmüş Sülfür (mg S2-/L)
80
(c)
70
60
50
40
BÇ
30
İÇ
20
10
0
21.12
31.12
10.1
20.1
30.1
9.2
19.2
1.3
Tarih
Şekil 1. (a) UKM yükleme hızı, (b) metan dönüşüm oranı, (c) çözünmüş sülfür konsantrasyonu
POSTER PRESENTATION
320
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
18000
(a)
16000
Çıkış UKM mg/L
14000
12000
10000
BÇ
8000
İÇ
6000
4000
2000
% UKM GİDERİMİ
0
31.12
100
90
80
70
60
50
40
30
20
10
0
31.12
10.1
20.1
30.1
9.2
19.2
1.3
11.3
(b)
BÇ
İÇ
10.1
20.1
30.1
Tarih
9.2
19.2
1.3
11.3
Şekil 2. (a) Çıkış çamur UKM konsantrasyonu, (b) % UKM giderimi
KAYNAKLAR
Anderson GK, Yang, G 1992. Determination of bicarbonate and total volatile acid concentration in anaerobic
digesters using a simple titration. Water Environment Research, 64:53–59.
APHA 2005. Standard Methods for the Examination of Water and Wastewater, American Public Health
Association (APHA), American Water Works Association (AWWA) and Water Environment
Federation (WEF), 21st Edition, Washington, USA.
Carvajal A, Pena M, Pérez-Elvira S 2013. Autohydrolysis pretreatment of secondary sludge for anaerobic
Digestion, Biochemical Engineering Journal, 75: 21– 31.
Gomec CY, Speece RE 2002. Organic material solubilization of domestic sludge in anaerobic digestion of
domestic primary sludge in anaerobic digestion at controlled pH. Water Science and Technology, 49(4):
195-198.
Iranpour R, Cox HHJ, Fan S, Mundine JE 2004. Full-scale conversion of Hyperion Treatment Plant to
thermophilic anaerobic digestion for Class A biosolids by several alternatives. Proceedings 10th World
Congress on Anaerobic Digestion; Aug 29–Sep 2, Montreal, Canada; International Water Association:
London, UK.
Krugel S, Nemeth L, Peddie C 1998. Extending thermophilic anaerobic digestion for producing Class A
biosolids at the greater Vancouver regional districts annacis island wastewater plant. Water Science
Technology, 38(8–9): 409–416.
Rubio-Loza LA, Noyola A 2010. Two-phase (acidogenic–methanogenic) anaerobic thermophilic/mesophilic
digestion system for producing Class A biosolids from municipal sludge, Bioresource Technology, 101:
576–585.
POSTER PRESENTATION
321
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Shao YJ, Kim HS, Seung O, Iranpour R, Jenkins D 2002. Full-scale sequencing batch thermophilic
anaerobic sludge digestion to meet epa class a biosolids requirements. Proceedings of the Water
Environment Federation, WEFTEC 2002: Session 21-30, pp. 573-591.
Tomei MC, Bertanza G, Canato M, Heimersson S, Laera G, Svanstrom M 2016. Techno-economic and
environmental assessment of upgrading alternatives for sludge stabilization in municipal wastewater
treatment plants. Journal of Cleaner Production, 112: 3106-3115.
Yan Y, Chen H, Xu W, He Q, Zhou Q 2013. Enhancement of biochemical methane potential from excess
sludge with low organic content by mild thermal pretreatment. Biochemical Engineering Journal, 70:
127-134.
Ziels RM, Karlsson A, David AC, Ejlertsson B, Yekta S, Bjorn A, Stensel H, Svensson A 2016. Microbial
community adaptation influences long-chain fatty acid conversion during anaerobic codigestion of fats,
oils, and grease with municipal sludge. Water Research, 103: 372-382.
POSTER PRESENTATION
322
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Synthesis and Characterization of Poly(Vinyl Chloride)/Organozeolite Composite
Ceyda Bilgiç1, Bengi Bozkır2
1,2
Eskişehir Osmangazi University, Engineering and Architecture Faculty, Department of Chemical
Engineering, , β6480 Eskişehir, Turkey
Corresponding author e-mail: bozkirbengi@gmail.com, ceydabilgic@gmail.com
Abstract
Polymer/clay nanocomposites are a class of hybrid materials composed of organic polymer matrix in
which inorganic particles with nanoscale dimension are embodied. The natural zeolite (clinoptilolite) of
Gördes–Manisa (in Western Anatolia of Turkey) used in this work. The O-zeolite was obtained through
the purification of zeolite and was organically modified by hexadecyltrimethyl ammonium bromide
(HTAB) with certain surfactant concentration. Poly(vinyl chloride)/O-zeolite composites were prepared
using the solution blending method with the application of ultrasound and using trichloromethane as
solvent. Ultrasonic waves were used to enhance the nanoscale dispersion of the silicate. Polymer
composite of a poly(vinyl chloride) (PVC) matrix containing 5% Organozeolite (OZ) by mass was
investigated using X-ray diffraction (XRD) Scanning electron microscopy (SEM) and transmission
electron microscopy (TEM). Polymer nanocomposites of a PVC matrix containing 5% organozeolite
(OZ) by mass was investigated using inverse gas chromatography (IGC). IGC was applied to
characterize the surface of PVC/OZ composite.
Keywords: Poly(vinyl chloride); Nanocomposites; Characterization, TEM, SEM, XRD,IGC
1. INTRODUCTION
The synthesis and development of polymer/silicate composites have attracted considerable attention from
both basic research and commercial applications, as they often exhibit remarkable improvements in the
mechanical properties, thermal stability, gas barrier properties, enhanced ionic conductivity, reduced
flammability and biodegradation, etc., as compared with the pure polymers or conventional micro- and
macro-composites (Giannelis et al., 1999; Gilman et al., 2000; Alexandre and Dubois, 2000; AnnabiBergaya, 2008; Pavlidou, 2008). These improvements in the properties are the result of the nanometer scale
dispersion of silicate in the polymer matrix. The dispersion of zeolite layers in a monomer or polymer matrix
can result in the formation of three types of composite materials. The first type is a intercalated, that can be
formed if the interlayer distance increases but the layer morphology remains unchanged, an intercalated
nanocomposite structure is obtained. The other type is intercalated-and-flocculated conceptually the same as
intercalated nanocomposites. However, silicate layers are sometimes flocculated due to hydroxylated edge–
edge interaction of the silicate layer. The last type is the exfoliated structure, which can only be obtained if
the silicate layers totally disperse in the polymer matrix. Exfoliated polymer–silicate nanocomposites are
especially desirable for improved properties because of the homogeneous dispersion of clay and huge
interfacial area between polymer and silicate (Balazs et al., 1999; Kim et al., 2002; Zhang et al., 2006; Pavia
et al., 2008).
Poly(vinyl chloride) (PVC), as an important commercial polymer, has been studied and used widely in
industrial fields for many years. However, due to its inherent disadvantages, such as low thermal stability
and brittleness, PVC and its composites are subject to some limitations in certain applications (Dietrich,
2001). Therefore, it is necessary to develop new PVC products with altered properties in order broaden PVC
applications. Recently, the development of PVC/layered silicate nanocomposites presents a new way to
prepare high performance PVC composites. Wang et al., 2001; Wang et al., 2002, reported the preparation
and characterization of PVC-clay nanocomposites formed by both melt and solution blending. The effects of
the clay loading level, the presence and amount of plasticizer, melt blending time and annealing time, etc., on
the structure of the nanocomposite and the thermal and mechanical properties have also been investigated.
Trilica et al., 2001, took dioctylphthalate (DOP) as cointercalater for organic montmorillonite (MMT) and
PVC because they found alkylammonium salts between the interlayers of organic MMT, could catalyze PVC
degradation. Although DOP prevented the degradation of PVC, the MMT only acted as a plasticizer carrier
POSTER PRESENTATION
323
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
and the mechanical properties of the composites were not enhanced significantly. Du et al., 2003, reported
more information concerning the thermal degradation and charring of PVC/MMT nanocomposite in the
presence of DOP by the use of X-ray photoelectron spectroscopy and the acquisition of the carbon (C1s),
chlorine (Cl2p), and oxygen (O1s) spectra. For PVC–clay nanocomposites the surface at high temperatures is
dominated by carbon, and not the oxygen of the clay. The presence of the clay does retard the chain-stripping
degradation of the PVC and the enhanced char formation accounts for the observation of enrichment of
carbon. Wan at al., 2003, investigated the effect of silicate modification and MMT content on the
morphology development, relaxation behavior, optical clarity and mechanical properties of the PVC/MMT
nanocomposites. Despite the widespread use of the clays for preparations of composites, has not done much
work on zeolites in the literature.
In the present work, Polymer nanocomposites of a PVC matrix containing 5% organozeolite (OZ) by mass
were prepared using the solution blending method with sonication. Hexadecyl trimethyl ammonium bromide
was used to modify the montmorillonite after its surface was saturated with Na + ions. X-ray diffraction and
transmission electron microscopy revealed the mixed morphology of composites. The majority of O-Zeolite
is dispersed in the polymer matrix in the form of an ordered tactoid (multilayer particles) structure consisting
of few silicate layers and intercalated-and-flocculated structure was achieved. Characterization studies were
performed by use of XRD, TEM, SEM and IGC.
Inverse gas chromatography (IGC) method at infinite dilution is applied for dispersive component of the
surface free energy ( Sd )of PVC nanocomposites containing 5 wt. % OZ.
2. MATERIALS AND METHODS
PVC was provided by Sigma–Aldrich. Hexadecyltrimethylammonium bromide (HTAB,C 19H42BrN, Purity
%98) and sodium chloride (NaCl, Purity %99.5) were provided by Merck and used as received.
Tetrahydrofuran (THF, Purity %99.8) was purchased from Sigma–Aldrich. The natural zeolite
(clinoptilolite) of Gördes–Manisa (in Western Anatolia of Turkey) used in this work was supplied from Rota
Mining Corporation. Because it was received as it was taken out of the ground, without having been
processed, it contained many impurities. In order to purify it and also increase its zeolite content, a
decantation process was applied. Following this process, the clay had been dried in an oven at 90 oC and it
was ground.
2.1. Preparation of organo-zeolite and composite
In order to prepare the organic-intercalated zeolite firstly, 1l of 2M NaCl solution was added to 20g of
purified clay and was mixed at 500rpm with a Heidolph magnetic stirrer for 24h at room temperature. Then
the mixture was centrifuged and rinsed three times with distilled water. The obtained Na-zeolite was dried at
110 oC. Na- zeolite aqueous suspension and a certain amount of HTAB were mixed for 24h by adding
distilled water heated at 60 oC. Next, th e mixture was centrifuged and the obtained white solid was dried in
an oven after being rinsed with distilled water. After being ground, it was sieved to pass through a λ0 ηm
sieve.
Organo zeolite /PVC nanocomposites were prepared by the solution blending method. The organo zeolite
was dissolved in tetrahydrofuran (THF) and the solution was magnetically stirred until all the clay appeared
to be completely dispersed at 50 °C. After stirring, the mixture was placed in an ultrasonic bath for
sonication at room temperature, for 1 h. PVC was dissolved in toluene at room temperature. Zeolite solution
was added slowly to PVC solution and then it was stirred until the solution became homogeneous. Ozeolite/PVC mixture was placed in an ultrasonic bath, for 20 min. After sonication it was poured in glass
moulds and toluene was then evaporated which was performed by two consecutive steps: air drying for 12 h,
and in an oven at 60 °C, for γ h. For comparison, polystyrene was dissolved in toluene, then sonicated and
dried using the same procedure described above, obviously without adding O-zeolite. Finally, samples were
cryo-milled using a Retsch cryogenic jar mill. The samples were labelled to describe the amount of OZ and
PVC 5 mean, PVC contained and 5 wt. % of OZ, respectively.
2.2 Characterization techniques
The XRD patterns were recorded between 5° and β0° (βθ) at a scanning speed of 0.0β° min−1 using a Rigaku
Ultima-IV diffractometer (Akishima, Japan) with CuKα radiation (40 kV/γ0 mA). Scanning electron
microscopy (SEM) observation of the sample was done by a Jeol JSM-5600 LV (Tokyo, Japan). Prior to
POSTER PRESENTATION
324
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
SEM observation, sample was coated with a thin layer of gold using a Polaron SC7620 (Quorum
Technologies Ltd., East Sussex, UK). For transmission electron microscopy (TEM), a single drop of dilute
solution of sample was deposited on a copper TEM grid and dried overnight at room temperature, and
examined by a Jeol JEM-1220 Electron Microscopy (Tokyo, Japan, at an accelerating voltage of 80 kV).
The chromatographic experiments were performed with Agilent 7890 gas chromatography equipped with a
flame ionization detector (FID). Nitrogen with high purity was used as the carrier gas with a flow rate of 40
ml min-1. IGC measurements were carried out in the temperature range of 30–60 °C. About 3 g of sample
particles of 150-β00 µm was filled into the stainless steel column (2.00 m long, 5.35 mm I.D.) via the aid of
vacuum. Stainless steel column washed with methanol and acetone before packing with powders. The
adsorbents were conditioned at the highest temperatures in the nitrogen gas flow for 4 h before the
measurements. Methane is used for determining the dead volume. At least four determinations were used in
averaging the net retention volume (VN).
2.3 IGC theory
Inverse gas chromatography (IGC) is a derivation of conventional gas chromatography. However, unlike
analytical chromatography, the material being investigated is the solid in the gas chromatography column.
The retention volume of the mobile phase (probe) indicates the interaction between the probe and the surface
of the material in the column (Cordeiro et al., 2011; Matsushita et al., 2006). IGC provides an excellent
method to measure the surface energy of rough and porous powders (Hole et al., 2006). The surface energy is
the result of the unbalanced molecular forces at the surface of the solid. It can be considered to be formed by
two different contributions: dispersive and specific. The retention time of a series of homologous n-alkanes
is used to determine the dispersive component of the surface free energy ( γ dS ) of PVC/OZ. In IGC literature,
γ dS is commonly determined from the following equation, which was introduced by Lavielle and Schultz,
1991:
RTLnVN 2 N .( Sd )1/ 2 .a.( Ld )1/ 2 C
(2.1)
Here, R is the gas constant, T is the absolute column temperature, a is the molecular surface area coated with
a kind of adsorbed alkane, N is the Avogadro’s number, Ld is the dispersive component of the surface free
energy of the probe, C is a constant, and VN is the net retention volume of the n-alkane probe. The net
retention volume (VN) is calculated using the equation below (Thielmann, 2004):
2
T 3 Pi Po -1
(2.2)
VN =Fo
t A -t 0
To 2 Pi Po 3 -1
Here, tA is the retention time of the probe, while t0 is the retention time of the probe which has no interaction
with the solid in the column (marker). Pi and Po are, respectively, the inlet and outlet pressures of the carrier
gas, while the T/To ratio is used in order to get the value of the flow rate at the column temperature (T) from
the measurement of the flow rate at ambient temperature (To). The flow rate of the carrier gas which is
measured at the column outlet and at ambient temperature is expressed as Fo.
3. RESULTS and DISCUSSION
The adsorption runs were performed at infinite dilution conditions. The chromatographic peaks of n-alkanes
on PVC/OZ were symmetrical. So retention time is independent of the amount of injected. The value of γ dS
represents the interaction of the surface with n-alkanes and hence is a measure of how easily the surface can
d
polarize the probe (Price and Ansari, 2003). The dispersive component of the surface free energy, S , was
determined by injection of a homologous series of n-alkanes having between 8 and 10 carbon atoms. One of
the most commonly measured parameters for the description of the energy situation on the surface of a solid
is the surface energy. The surface energy can affect, e.g. catalytic activity or the strength of particle-particle
interaction. The dispersive components of PVC/OZ at experimental temperatures were calculated from Eq.
(2.1). Plotting RTlnVN against a. Ld
1/ 2
yields a straight line with the slope of γ S , which can be seen for
d
PVC/OZ in Figure 1. Table 1 shows the dispersive component of the surface free energy, γ S , of PVC/OZ. It
d
was observed that γ dS values decrease with increasing temperature.
POSTER PRESENTATION
325
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 1. Values of Dispersive Component of the Surface Energy Measured on %5OZ-PVC at Various
Temperatures
T (°C)
γ
30
40
d
S
27,264
26,478
50
60
22,816
17,825
2
(mJ/m )
8
6
4
2
0
250
270
290
310
Figure 1. The RT ln(VN ) – a. Ld
1/ 2
330
350
370
graphs for %5OZ-PVC
Complementary to XRD, TEM is the most popularly employed technique to determine composite
morphology, using TEM one can image the composite structure. In general, one collects several images at
high and low magnification and at several positions in the nanocomposite sample. Both a low magnification
image, to show the global dispersion of the additives in the polymer, and a higher magnification image, to
evaluate the registry of additives are needed. The ordered intercalates exhibit microstructures very similar to
the unintercalated organically modified layered silicate. Polymer intercalation occurs as a front which
penetrates the primary organically modified layered silicate particle from the external edge. The disordered
composites exhibit heterogeneous microstructures with increased layer disorder and spacing towards the
polymer-primary particle boundary. In these hybrids, individual silicate layers are observed near the edge
whereas small coherent layer packets separated by polymer-filled gaps are prevalent toward the interior of
the primary particle. The heterogeneous microstructure indicates that the formation of these disordered
composites occurs by a more complex process than simple sequential separation of individual layers starting
from the surface of the crystallites and primary particles. In general, the features of the local microstructure
from TEM give useful detail to the overall picture that can be drawn from the XRD results and enhance the
understanding of various thermodynamic and kinetic issues surrounding composite formation (Pourabas et
al., 2005; Wang et al., 2009; Morgan et al., 2004).
40000
Zeolite
30000
Intensity cps
%5OZ-PVC
20000
10000
0
5
7
9
11
13
2-theta (deg)
15
17
19
Fig. 3. X-ray diffraction patterns of %5OZ-PVC and Zeolite
POSTER PRESENTATION
326
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
It is well known that only materials ordered enough to diffract X-ray can be detected; disordered materials
will show no pattern with the X-ray technique. Generally, the formation of an intercalated nanocomposite
results in an increase in basal spacing in the XRD pattern, while the formation of an exfoliated
nanocomposite leads to the complete loss of registry between the layers and therefore no peak can be
observed (Pourabas et al., 2005).
Figure 3 shows the XRD patterns of zeolite, and PVC/Ozeolite. Dispersion of the zeolite particles in the
polymer matrix is very important because the filler dispersion has a main effect on the final morphology and
properties of the polymer nanocomposites. In study, the XRD peak of PVC-OZ composites appeared at the
βθ . However, the OZ/PVC composites, prepared using 5wt% of OZ, did not showed any noticeable
diffraction peak at the βθ values from 1 to β0°. This result suggests that the zeolite platelets was able to
intercalated and-flocculated dispersed in the PVC matrix. Because the peak intensity is very low; indicating
that an insignificant amount of agglomeration was present, probably due to zeolite platelet reorganization
during ring-opening polymerization in the absence of shear flow. The XRD patterns suggest that the strongly
hydrophobic PVC was inserted into the galleries of the hydrophilic zeolite through emulsion polymerization
(Noh and Lee; 1999; Pan et. al., 2004).
Figure 4. SEM images of 5% O-zeolite/PVC nanocomposites at magnifications of a) ×100 and b) x500
The morphology of the composites is evaluated by using SEM and TEM. The images of SEM give
information about the reinforcement aggregates, adhesive failures and phase boundaries in composites,
surface roughness, and fractured surfaces. The roughness like recesses and protrusions on the surface is very
important because it intensively affects the wettability property. This property is known as the tendency of
fluids to stick to the surface and can be determined by the characteristics of the surface structure (Sayyad
Amin et al., 2009, Sajini et al., 2011). In this study, SEM analysis is performed to display the surface of
materials and the distribution of reinforcement in polymer matrix. The SEM images of composites are given
at magnifications of ×100 and ×500 in Figure 4. SEM images of composite exhibit quite well dispersion.
Some bridges within the polymer matrix and dangling structures are also observed. These results may be
attributed to the good dispersion of the zeolite and the compounding ratio seems not to be a prominent
parameter within this phenomena.
Figure 5. TEM micrographs of 5% O-Zeolite/PVC nanocomposites (a) at low magnification (b) at higher
magnification.
POSTER PRESENTATION
327
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The dispersion microstructure of the intercalated and-flocculated zeolite layers was also examined by means
of TEM. Direct evidence for the dispersion of the O-zeolite in the final polymer composites can be obtained
from TEM. The intercalated and flocculated trend of the zeolite in the PVC/zeolite nanocomposites was
confirmed by TEM, as shown in Fig. 5. Figure 5 shows the TEM image of 5% O-zeolite/PVC, which
demonstrates that the zeolite layers are structured in good order and are well, dispersed in the polymer matrix
(Kim et al., 2003; Karayıldırım et al., β006ν Hoffman et al., 2000). The image confirms that the synthesized
composite is a nanoscale material and no delamination of the O-zeolite layers took place during intercalation.
5. CONCLUSION
The composite’s surface usually has different chemical and physical properties from both matrix and filler,
probably due to changing surface roughness and chemical heterogeneity. It is important to understand the
zeolite-filled polymer surfaces to control adhesion, wettability, and printability properties of these
nanocomposites. In this study, O-zeolite/PVC composites were prepared by solution blending method using
TCM as solvent. Solution blending is widely used in composite preparation. It is a simple way to obtain
silicate/polymer composites if both the polymer and the nanoparticles are dissolved or dispersed in solution.
The toxic solvent in the process could be recycled. In solution blending method, it is easy to control the
concentrations of the polymer and inorganic components. In the present work, ultrasonication is applied to
further improve the exfoliation of the O-zeolite.
It is important to understand the zeolite-filled polymer surfaces to control adhesion, wettability, and
printability properties of these composites. IGC is a very sensitive and reliable technique for distinguishing
nanocomposite surfaces. IGC at infinite dilution was used to find how PVC/OZ would change the dispersive
component of the composite. The experimental results indicate that γ S values of studied materials gradually
decreased with increasing column temperature which is consistent with the fundamental concept of Gibbs
free energy.
d
A combination of XRD, SEM and TEM studies showed that the nanocomposites obtained have a mixed
nanomorphology. From SEM, TEM and XRD results, the PVC was intercalated and-flocculated into the
zeolite layers, and had fine dispersion in the PVC matrix. HTAB-zeolite in the PVC/O-zeolite
nanocomposite indicates that the zeolite was transformed into fine particles and dispersed homogeneously in
the PVC matrix after polymerization. SEM, TEM and XRD analyses provided a high depth of focus to the
morphology and the quite well dispersions are observed. This will provide the necessary flexibility for the
potential applications of these new composites.
ACKNOWLEDGEMENTS
This study is the part of a project (2017-1426) supported by the Research Fund of Eskişehir Osmangazi
University.
REFERENCES
Alexandre M, Dubois, P, 2000, Polymer-Layered Silicate Nanocomposites: Preparation, Properties
and Uses of a New Class of Materials, Materials Science and Engineering R Reports, 28, 1-63.
Annabi-Bergaya F, 2008, Layered clay minerals. Basic research and innovative composite
applications. Microporous Mesoporous Material, 107:141–8.
Balazs AC, Singh C, Zhulina E, Lyatskaya Y, 1999, Modeling the Phase Behavior of Polymer/Clay
Nanocomposites, Accounts of Chemical Research, 32, 651-657.
Cava D, Gavara R, Lagaron JM, 2007, Surface characterization of poly(lactic acid) and
polycaprolactone by inverse gas chromatography. J. Chromatogr. A., 1148:86–91.
Cordeiro N, Gouveia C, John MJ, 2011, Investigation of Surface Properties of Physico-Chemically
Modified Natural Fibres Using Inverse Gas Chromatography, Industrial Crops and Products, 33, 108-115.
Dietrich B, 2001, PVC -Origin, Growth, And Future, Journal of Vinyl & Additive Technologyvinyl
And Addit. Technol., 7 (4 ), 168-176.
Du J, Wang D, Wilkie CA, Wang J, 2003, An XPS investigation of thermal degradation and charring
on poly(vinyl chloride)–clay nanocomposites, Journal Polymer Degradation and Stability, 79, 319-324.
Giannelis EP, Krishnamoorti R, Manias E, 1999 Polymer-Silicate Nanocomposites: Model Systems
for Confined Polymers and Polymer Brushes, Advances in Polymer Science, 138, 107-147.
POSTER PRESENTATION
328
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Gilman JW, Jackson CL, Morgan AB, Harris, RH, Manias E, Giannelis EP, Wuthenow M, Hilton D,
Phillips S, 2000, Flammability Properties of Polymer-Layered-Silicate Nanocomposites, Polypropylene and
Polystyrene Nanocomposites. Chemistry of Materials, 12, 1866-1873.
Hoffman B, Dietrich C, Thomann R, Friedrich C, Mülhaupt R, β000, Morphology and rheology of
polystyrene nanocomposites based upon organoclay, Macromol Rapid Commun, 21(1):57–61.
Karayıldırım T, Yanık J, Yuksel M, Sağlam M, Vasile C, Bockhorn H, β006, The effect of some fillers
on PVC degradation, Journal of Analytical and Applied Pyrolysis, 75:112–119.
Kim TH, Jang, LW, Lee DC, Choi HJ, Jhon MS, 2002, Synthesis and Rheology of Intercalated
Polystyrene/Na+-Montmorillonite Nanocomposites, Macromolecular Rapid Communications, Macromol
Rapid Commun, 23, 191-196.
Kim TH, Lim ST, Lee CH, Choi HJ, Jhon MS, 2003, Preparation and rheological characterization of
intercalated polystyrene/organophilic montmorillonite nanocomposite, Journal of Applied Polymer Science,
87, 2106-2112.
Lazarevic S, Radovanovic Z, Veljovic Dj, Onjia A, Janackovic Dj, Petrovic R, 2009, Characterization
of sepiolite by inverse gas chromatography at infinite and finite surface coverage. Applied Clay Science, 43,
41–48.
Lavielle L, Schultz J, 1991, Surface properties of carbon fibers determined by inverse gas
chromatography: role of pretreatment. Langmuir, 7:978–981.
Matsushita Y, Wada S, Fukushima K, 2006, Surface characteristics of phenol–formaldehyde–lignin
resin determined by contact angle measurement and inverse gas chromatography. Ind. Crop. Prod., 23:115–
121.
Morgan AB, Harris JD, 2004, Exfoliated polystyrene–clay nanocomposites synthesized by solvent
blending with sonication. Polymer, 45:8695–8703.
Noh, MW, Lee, DC, 1999, Synthesis and characterization of PS-clay nanocomposite by emulsion
polymerization, Polymer Bulletin (Berlin), 42, 619–626.
Pan M, Shi X, Li X, Hu H, Zhang L, 2004, Morphology and properties of pvc/clay nanocomposites
via in situ emulsion polymerization. Journal of Applied Polymer Science, 94:277–86.
Pavia LB de, Morales AR, Díaz FRV. Organoclaysμ Properties, preparation and applications. Applied
Clay Science, 2008;42:8–24.
Pavlidou S, Papaspyrides CD, 2008, A review on polymer-layered silicate nanocom-posites. Progress
Polymer Science, 33:1119–98.
Price GJ, Ansari DM, 2003, An inverse gas chromatography study of calcination and surface
modification of kaolinite clays. Phys. Chem. Chem. Phys., 5:5552–5557.
Pourabas B, Raeesi V, 2005, Preparation of ABS/montmorillonite nanocomposite using a solvent/nonsolvent method., Polymer, 46, 5533-5540.
Sajini V, Paul J, Mahanta N, Valiyaveettil S, 2011, Flexible conductive graphene/poly(vinyl chloride)
composite thin films with high mechanical strength and thermal stability. Carbon. 49: 198–205.
Sayyad Amin J, Ayatollahi SH, Alamdari A, 2009, Fractal characteristics of an asphaltene deposited
heterogeneous surface. Applied Surface Science, 256:67–75.
Thielmann F, 2004, Introduction into the characterisation of porous materials by inverse gas
chromatography. J. Chromatogr. A., 1037:115–123.
Trillica J, Kalendova A, Malac Z, Simonik J, 2001, in: Proc. of SPE ANTEC, Dallas, Texas, May 6–
10, p. 2162.
Wan C, Qiao X, Zhang Y, Zhang YX, 2003, Effect of different clay treatment on morphology and
mechanical properties of PVC-clay nanocomposites, Polymer Testing, 22, 446–453.
Wang D, Parlow D, Yao Q, Wilkie CA, 2001, PVC-Clay Nanocomposites: Preparation, Thermal and
Mechanical Properties, J. Vinyl and Addit. Technol., 7, 203-213.
Wang D, Parlow D, Yao Q, Wilkie CA, 2002, Melt Blending Preparation of PVC-Sodium Clay
Nanocomposites, J. Vinyl and Addit. Technol., 8, 139.
Wang LJ, Su SP, Chen D, Wilkie CA, 2009, Variation of anions in layered double hydroxides: effects
on dispersion and fire properties, Journal Polymer Degradation and Stability, 94, 770-781.
Zhang J, Jiang DD, Wang D, Wilkie CA, 2006, Styrenic polymer nanocomposites based on an
oligomerically-modified clay with high inorganic content, Polymer Degradation and Stability, 91, 26652674.
POSTER PRESENTATION
329
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
ACKNOWLEDGEMENTS
This work was funded by FRGS under vote USIM/FRGS-FST-32-51312. The authors would like to thank
Faculty of Science and Technology, Universiti Sains Islam Malaysia for the facilities provided.
REFERENCES
Ariffin N. A., A. S. A. Khiar. 2015. Effect of BMITFSI to the Electrical Properties of Methylcellulose/
Chitosan/ NH4TF Based Polymer Electrolyte. Proc. of SPIE.9668.
Buraidah, M. H., A. K. Arof. 2011. Characterization of Chitosan/PVA Blended Electrolyte Doped with
NH4I. Journal of Non-Crystalline Solids, 357:3261-3266.
Buraidah, M. H., L.P. Teo, S.R. Majid, A.K. Arof. 2009. Ionic Conductivity by Correlated Barrier
Hopping of NH4I Doped Chitosan Solid Electrolyte. Physica B, 404:1373-1379.
Hafiza, M. N., & Isa, M.I.N., Solid polymer electrolyte production from 2-hydroxyethyl cellulose: Effect
of
NH4NO3
composition on its
structural
properties.
Carbohydrate
Polymers
http://dx.doi.org/10.1016/j.carbpol.2017.02.03.
Hamdan K Z, A. S A Khiar. 2014. Conductivity and Dielectric Studies of Methylcellulose/ChitosanNH4CF3SO3 Polymer Electrolyte. Key Engineering Materials, 594-595: 818-822.
Ibrahim S., S.M. Mohd Yasin, N.M. Nee, R. Ahmad, M.R. Johan. 2011. Conductivity and dielectric
behaviour of PEO-based solid nanocomposite polymer electrolytes. Solid State Communications,
doi:10.1016/j.ssc.2011.11.037.
Kadir M. F. Z., L.P. Teo, S.R. Majid, A.K. Arof. 2009. Conductivity studies on plasticized
PEO/chitosan proton conducting polymer electrolyte, Materials Research Innovations,
13:191-194.
Kaith Balbir S., Reena Sharma, Susheel Kalia and Manpreet S. Bhatti. 2014 Response surface
methodology and optimized synthesis of guar gum-based hydrogels with enhanced swelling
capacity. Royal Society of Chemistry Advanced 4: 40339.
Khiar, A.S.A., R.Puteh, A.K. Arof. 2006. Conductivity Studies of a Chitosan-Based Polymer
Physica B. 373:23-27.
Electrolyte.
Nik Aziz N.A, N. K. Idris, & M. I. N. Isa. 2010. Solid polymer electrolytes based on methylcellulose: FTIR and ionic conductivity studies. International Journal of Polymer Analysis and
Characterization,
15(5): 319-327.
Pinotti A, M A Garcia, M N Martino, N E Zarithzky. 2007. Study on microstructure and physical
properties of composite films based on chitosan and methylcellulose. Food Hydrocolloids,
21:66-72.
Sahli N. and A. M. M. Ali. 2012. Effect of Lithium Triflate Salt Concentration in Methyl Cellulose
based Solid Polymer Electrolytes. IEEE Colloquium on Humanities, Science & Engineering
Research.
Salleh N. S., Shujahadeen B. Aziz, Z. Aspanut, M. F. Z. Kadir. 2016 .Electrical impedance and conduction
mechanism analysis of biopolymer electrolytes based on methyl cellulose doped with ammonium
iodide.Ionics. DOI 10.1007/s11581-016-1731-0.
Shanti, R. 2011. Invstigation on the Effects of Ionic Liquid and Ionic Mixture in Biodegradable Polymer
Electrolytes. Master of Science Thesis. University Tunku Abdul Rahman.
Shuhaimi N. E. A., L.P. Teo, S.R. Majid, A.K. Arof. 2010. Transport studies of NH 4NO3 doped methyl
cellulose electrolyte. Synthetic Metals, 160: 1040–1044.
Vincent C. A. 1987. Polymer Electrolytes. Progress in Solid State Chemistry, 17:145-261.
POSTER PRESENTATION
330
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Cr(VI) removal from aqueous solutions using native and triethylenetetramine modified
biomasses of Lentinus edodes: Isotherms and kinetics studies
Ilhan Dorukhan Coker, Gulay Bayramoglu, Merve Oztekin*, M. Yakup Arica*
Gazi University, Faculty of Science, Biochemical Processing and Biomaterial Research Laboratory, 06500
Teknikokullar Ankara, Turkey
merve.oztekin2012@gazi.edu.tr; yakuparica@gmail.com
Abstract
Heavy metals such as lead, cadmium, arsenic, and chromium are continuously discharged into the
environment, and these metals are stable and can survive for long time periods in the environment.
Among them, chromium(VI) has high toxicity to living organisms. The potential use of the native and
triethylenetetramine (TETA) modified biomasses of Lentinus edodes to remove Cr(VI) ions from
aqueous solutions was studies in a batch system. Experimental parameters affecting the adsorption
process such as pH, contact time, adsorbent dosage, ionic strength and temperature were studied. SEM,
FTIR, and BET were used to assess the physical properties the adsorbents. The surface area of the native
and TETA modified fungal biomass was found to be 18.6 and 14.3 m 2/g, respectively. The FTIR studies
show that the functional groups involved for adsorption of Cr(VI) are -OH, -COO-, -NH2, C=O, -C-N,
and S=O. The adsorption of Cr(VI) ions on the native and TETA modified adsorbents showed a highest
value at around pH 2.0-3.0. The amount of adsorbed Cr(VI) on both native and modified biomasses of L.
edodes (mg/g) was increased as the initial concentration of Cr(VI) ions increased in adsorption medium.
Adsorption equilibrium was established in about 60 min. The determined maximum adsorption
capacities of the native and modified biomasses were found to be 34.7 and 92.4 mg/g dry weight,
respectively. The Langmuir, and Freundlich, isotherm models were applied to describe the adsorption of
Cr(VI) onto native and modified L.edodes biomasses. According to the RL and n parameters of the
studied isotherms, the Cr(VI) adsorption process was physical and desirable. The adsorption of Cr(VI)
on these biomasses follows pseudo-second-order kinetics. The calculated thermodynamic parameters
(ΔG°, ΔHº, and ΔS°) indicated that the adsorption of Cr(VI) onto native and modified fungal biomasses
were feasible, spontaneous, and exothermic under given experimental conditions.
Keywords: Fungal biomass, Modification, Adsorption, Cr(VI), Isotherms, Kinetics.
1. INTRODUCTION
The toxic heavy metals like cadmium, lead, nickel, mercury and chromium can cause serious impact on the
living organisms. The later and its compounds are widely used in plating, leather tanning, dye, cement, and
photography industries producing large quantities of toxic pollutants (Foroutan et al., 2018). Like all
transition metals, chromium can exist in the form of several oxidation states. Chromium (VI) can diffuse as
CrO4−2 or HCrO4− through cell membranes and oxidize biological molecules resulting toxicity (Chen et al.,
2006). The Cr(VI) species are approximately 100 times more toxic and 1000 times more mutagenic and
cytotoxic than Cr(III). For removal of heavy metal ions like Cr(VI) from solutions, several methods have
been proposed such as precipitation, ion exchange, reverse osmosis, electro-dialysis, coagulation,
electrolysis, and adsorption. Among them, the adsorption method has been largely used for the removal of
heavy metals from water and wastewater. This method, compared with other physical and chemical methods,
is facile, low-cost, efficient, and easy-design (Arica and Bayramoglu, 2005). In the adsorption process a
variety of adsorbent can be used, because the efficiency and effectiveness of the adsorption process is
dependent on the nature and characteristics of the adsorbent. Therefore, the removal of Cr(VI) from
wastewater before discharge is necessary and vital.
In recent years, biomasses of bacteria, fungi, yeast, algae (Arica and Bayramoglu, 2005) have been used to
remove heavy metals from aqueous solutions by adsorption. The use of these microbial biomasses for
removal of toxic heavy metals from aqueous solution has emerged as an alternative to the existing methods
as a result of the search for low cost, innovative methods. In case of adsorption, several chemical processes
POSTER PRESENTATION
331
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
can be involved with the adsorptive sites of the microbial biomass surface including carboxyl, hydroxyl,
sulfhydryl, amino and phosphate groups (Bayramoglu and Arica MY, 2008). Fungi are abundant in natural
environments and important industrial processes. Their most important roles are as decomposers of organic
macromolecules, with concomitant nutrient cycling as pathogens and symbiotic with animals and plants, and
as spoilage organisms of natural and synthetic materials (Bayramoglu and Arica 2008a). Among the fungi
species, the white rot fungi are highly specialized groups of organisms. They are Basidomycetes, which
include all the higher fungi that are characterized by their sexual fruiting bodies. The fungi subspecies
Lentinus edodes is a well-known white rot fungus whereas a little attention has been paid to the ability of its
potential for the removal of mixed pollutants from environment. The fungus is an edible mushroom native
to East Asia, which is cultivated and consumed in many Asian countries. It is considered a medicinal
mushroom in some forms of traditional medicine. Triethylenetetramine (TETA) is a cationic molecule
containing four amino groups on the linear molecular chain, can be a promising ligand for Cr(VI) removal.
For this, the TETA ligand can be used for modification of adsorbents to increase the adsorption capacity and
reusable.
In this work, to remove Cr(VI) ions from an aqueous solution, the biomass of L. edodes a white rot fungus
which chemically modified with TETA ligand. The polyamine TETA ligand was chosen as fungal biomass
modifier as it can increase the adsorption capacity of adsorbent and increase the stability of the adsorbent
material after glutaraldehyde cross-linking for ligand immobilization. To evaluate the adsorption process of
Cr(VI) by the adsorbents, the effects of parameters such as initial pH, ionic strength, adsorbent dosage,
temperature, initial Cr(VI) concentration, and contact time were evaluated. The kinetic of the adsorption
process was studied by pseudo-first order and -second order kinetics models. To define the adsorption
isotherm of Cr(VI) by native and modified biomasses, Langmuir, and Freundlich models were verified.
Further, the thermodynamic parameters such as enthalpy (ΔHº), entropy (ΔSº), the Gibbs free energy (ΔGº),
and the activation energy (Ea) were studied for determining the reaction mechanism of Cr(VI) adsorption.
2. MATERIALS AND METHODS
2.1 Microorganism and media
Triethylenetetramine and glutaraldehyde (25% in water) was purchased from Sigma-Aldrich Chemical Co.
Potassium dichromate (K2Cr2O7) and 1,5 diphenyl carbazide were obtained from Sigma-Aldrich. All of the
other chemicals used in this study were of analytical grade and obtained from Merck AG.
Pure culture of Lentinus edodes (MAFF 430012) was obtained from MAFF GENE BANK Culture
Collection (Kannondai, Tsukuba, Ibaraki, Japan), and was maintained by subculturing on malt dextrose agar
slants. The growth medium and growth conditions for white rot fungi were previously described elsewhere
(Arica MY, Bayramoglu G 2005.). The cultivated fungus pellets of L. edodes were washed with sterile
physiological saline solution several times to remove dirt particles. The resulting product was directly used
as native fungal biomass.
2.2 Modification of fungal biomass
In order to prepare TETA modified fungal biomass following procedure was applied. The L. edodes biomass
was dried in a vacuum oven at 45 ºC until constant weight, and then the fungal biomass was used for
activation with glutaraldehyde as reported earlier (Arica MY, Bayramoglu G 2005). After the reaction, the
activated biomass with glutaraldehyde (about 5.0 g, dry weight) was transferred in a solution (200 mL, pH
10) containing TETA ligand (β.0 g), and the reaction was carried out at 50 ºC shaking for 6 h. After this
period, the TETA modified fungal biomass was removed from the medium by simple filtration and washed
with 1.0 M NaCl and purified water and then dried in the oven at 50 ºC under reduced pressure for 24 h. The
leakage of the TETA from the fungal biomass was followed by incubating the fully wetted biomass
preparation with 10 mL of HCl solution (10 mM) for 24 h at room temperature. The leakage experiment was
carried out at room temperature while continuous stirring at 50 rpm. The TETA released in the liquid phase
after this incubation was measured spectrophotometrically at 230 nm.
2.3 Adsorption studies
A stock solution (1000 mg/L) of Cr(VI) was prepared from K 2Cr2O7. Experimental solutions of the desired
concentration were obtained by further dilution. The batch adsorption experiments were undertaken in a
series of Erlenmeyer flasks (100 mL). A predefined amount of fungal biomass (1.0-5.0 g) was placed into 1.0
POSTER PRESENTATION
332
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
L Cr(VI) solution at 400 mg/L initial concentration. The solution was rotated in an orbital shaker at 150 rpm
for different time (5-1β0 min) at given temperature (15, β5, γ5 and 45 °C). The pH of solutions was adjusted
between 2.0 and 10 using 1.0 mol/L NaOH or 1.0 mol/L HCl solutions. After adsorption period, the
adsorbent was separated by filtration. The remaining Cr(VI) in the solutions were measured at 540 nm using
a double-beam UV–vis spectrophotometer (Model T80+; PG Instrument Ltd., PRC) after complexation with
1,5 diphenyl carbazide. Before determination of the total quantity of chromium Cr(VI) in the adsorption
medium, Cr(III) and Cr(II) were converted to Cr(VI) using KMnO 4. The amount of Cr(VI) adsorbed per unit
mass of adsorbent (mg metal ions/g beads) and the percentage removal of chromium were calculated by
using the determination data in described earlier (Arica MY, Bayramoglu G 2005).
2.4 Characterization of the adsorbents
The surface morphology of the fungal biomasses was examined using scanning electron microscope
(SEM/EDX) (JEOL, JMS 5600, Tokyo, Japan) after coating with thin layer gold under reduced pressure. The
samples were scanned at a desired magnification to study the morphology of the native and modified fungal
biomasses. To evaluate the degree of TETA incorporation on the modified fungal biomass was analyzed
using the native biomass as a control system, it was subjected to elemental analysis using a Leco Elemental
Analyzer (Model CHNS-932). The FTIR spectra of the native and modified fungal biomasses particles were
obtained using a FTIR spectrophotometer (Shimadzu, FTIR 8000 Series, Japan). The specific surface areas
of the native and modified fungal biomasses were determined by N 2 adsorption isotherm and application of
the Brunauer–Emmer–Teller (BET) method. During the zeta potential measurement, 0.1 g of the samples
was transferred in purified water (100 mL), and mixed for about 1.0 h. The solution pH was adjusted with
either NaOH or HCl. The suspension of adsorbents was used to conduct potential measurement with a
Zetasizer instrument (NanoZS, Malvern Instruments Ltd., Malvern, UK). The samples were dispersed in
solutions and sonicated in a sonic water-bath for 10 min at room temperature. For each set of data, the
arithmetic mean values and standard deviations were calculated and the margin of error for each data set was
determined according to a confidence interval of 95% using the statistical package under Excel for Windows.
A value of P < 0.05 was considered to be statistically significant.
2.5 Tables and Figures
Table 2. Isotherm models constants and correlation coefficients for adsorption of Cr(VI) by the native and
TETA modified fungal biomass.
Experimental
Langmuir
Freundlich
Biomass
T
qexp
qm
bx102
R2
RL*
KF
n
R2
(K)
(mg/g) (mg/g) (L/mg)
Native
298
261.4
36.4
0.49
0.998 0.362 0.19 1.09 0.993
TETA modified
298
487.9
88.5
6.67
0.989 0.119 6.90 1.41 0.886
*Initial concentrations (C0) of Cr(VI) ions, 500 mg/L
Figure 1. FTIR spectra of the native (A) and TETA modified (B) fungal biomasses.
POSTER PRESENTATION
333
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 2. The adsorption capacities of the native and TETA modified fungal biomasses for Cr(VI) onto the
native and TETA modified fungal biomasses (A); The effect of the ionic strength on Cr(VI) ions adsorption
onto the native and TETA modified fungal biomasses (B).
2.3 Equations
Two isotherm equations have been tested in the present study, namely Langmuir and Freundlich. The
mathematical expression of Langmuir (Eq. 1), and Freundlich (Eq. 1) equations are:
qe = qmCe / (b + C)
(1)
where qe is the amount of adsorbed metal ions at time t (mg/g), Ce is the equilibrium concentration (mg/L).
qm (mg/g) and b (L/mg) are the maximum adsorption capacity and energy of adsorption, respectively.
qe = KF (Ce)1/n
(2)
KF (mg/g) and n (g/L) are the equilibrium constants indicative of adsorption capacity and adsorption
intensity.
The separation factor called RL value, which is used to predict if an adsorption system is “favorable” or
“unfavorable. It is by the following relationshipμ
RL = (1/1 + bCe)
(3)
where RL and Ce are the dimensionless constant separation factor or equilibrium parameter and initial metal
ions concentration, respectively. The value of RL indicates the shape of isotherm to be either unfavorable (RL
> 1) or linear (RL = 1) or favorable (0 < RL < 1) or irreversible (RL = 0).
The first-order rate equation of Lagergren is one of the most widely used for the sorption of solute from a
liquid solution. It may be represented as follows:
log (qe-qt) = logqe – (k1t/2.303 )
(4)
where k1 is the rate constant of first-order adsorption (min−1) and qe and qt denote the amounts of adsorption
at equilibrium and at time t (mg/g), respectively. In a true first-order process log qe should be equal to the
intercept of a plot of log(qe −qt) against t.
Ritchie proposed a second-order rate equation for the kinetic adsorption of gases on solids (Bayramoglu and
Arıca, β008a).
1/qt=1/(k2 qe t) + 1/qe
(5)
where k2 (g/(mg min)) is the rate constant of the second-order adsorption. The rate constant (k2) and
adsorption at equilibrium (qe) can be obtained from the intercept and slope, respectively, and there is no
need to know any parameter beforehand.
3. RESULTS
3.1. Characterization of the native and modified fungal biomasses
The mechanism of Cr(VI) ions adsorption by the native and TETA modified fungus biomass was explained
using FT-IR, SEM and BET methods. The surface morphology of the native L. edodes biomass was studied
by the scanning electron micrograph. As can be seen from SEM micrograph, the fungal biomasses have
rough and porous surface. The porous surface structure of the fungal biomass should be considered as a
POSTER PRESENTATION
334
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
factor providing an increase surface area. In addition, these pores reduce the mass transfer resistance and
facilitate the diffusion of Cr(VI) ions because of high internal surface area with low diffusional resistance in
the biomass.
The native and modified fungal biomasses can have different functional groups where coordination
complexes and/or ion exchange with metal ions can be formed. In order to confirm the presence of these
functional groups such as amino (-NH2), carboxyl (-COO-), thiol (-SH), hydroxy (-OH) and phosphate (-PO42
) on the native and modified fungal biomasses, the FT-IR spectra of both fungal biomasses were obtained.
In general, the FT-IR spectra of the native, and TETA modified fungal biomasses have intense peaks at a
frequency level of 3267 and 1548 cm−1 representing amino groups stretching vibrations. The strong peaks at
around 1635, 1405 and 1238 cm−1 are caused by the C=O stretching band of carbonyl groups. The phosphate
groups show some characteristic adsorption peaks around 1152 and 1025 cm −1 representing P=O and P–OH
stretching, respectively. The band at around 598 cm −1 for the fungal biomasses C–N–C scissoring and it is
only found in protein structure. After covalent attachment of TETA ligand via glutaraldehyde coupling
reaction, the spectrum of the modified fungal biomass exhibits some changes. Four peaks were observed at
3450, and 3300 cm-1 due to the incorporation of TETA ligand. The peaks at 1665 and 1584 cm -1 are
attributed to the -NH2 scissoring and C–C- stretching, respectively. These peaks show the involvement of
amine, hydroxyl and carboxyl groups in the binding of Cr(VI) ions. In a comparison of the spectra of fungal
biomass preparation with that contacted with Cr(VI) ions, some shift in peak position was observed. These
changes were due to the binding of Cr(VI) ions with amino and hydroxyl groups of the fungal biomasses.
The most remarkable difference in these spectra is at an intensity of 3450–3300 cm-1 representing amine and
hydroxyl stretching, and the band at around 1655 cm -1 represents carbonyl (C-O) stretching (data not shown).
The studies for the determination of the average particle size of the native and modified fungal biomass were
realized by using a Zeta-Sizer instrument. The average particle size of the particles was β45 and 465 ηm,
respectively. The BET surface area of the native and modified fungal biomass was calculated by the nitrogen
adsorption/desorption isotherms. The pore size of the synthesized the native and modified fungal biomass
was found to be 45 and 24 nm, respectively. The total surface area and total pore volume of the native fungal
biomass were found to be 19.8 m2 g-1 and 2.1 cm3 g-1, and after modification with TETA, the apparent
surface area and pore volume were significantly reduced to 12.4 m 2 g-1 and 1.33 cm3 g-1, respectively. The
reduction in surface area and pore volume of TETA modified fungal biomass may be due to the presence of
grafted TETA ligand in the vicinity of the pores near the surface of the fungal biomass.
The total available surface amino group contents of the native and modified fungal biomasses were found to
be 0.17 and 3.21 mmol g-1 dry fungal biomass. After TETA ligand attachment, the available amine group
content of the fungal biomass increased about 18.9-folds compared to the native counterpart.
To investigate the change of L. Edodes biomass surface charge before and after the TETA ligand attachment,
the zeta potentials as a function of solution pH (i.e. between 2.0 and 11.0) were measured. As observed in the
figure, the zeta potential values for the native and modified fungal biomasses decrease with increasing
solution pH. The zero potential point value for the native algal biomass was found to be at around pH 4.5; on
the other hand, the zero potential values for TETA modified algal biomass were observed at around pH 8.5.
The positive charge density on the TETA modified fungal biomass surface significantly decreased with
increasing medium pH due to the deprotonation of the amine groups on the ligand molecules. The charge
density in this pH range changed from -26.4 to 5.7 mV for the native fungal biomass. On the other hand, for
the TETA modified fungal biomass changed from -11.2 to 37.4 mV. Thus, the medium pH is an important
parameter to control in the adsorption of Cr(VI) ions.
3.2. Effect of contact time and adsorbent concentration on adsorption
The effect of contact time on the adsorption of Cr(VI) on the native and TETA modified fungal biomasses
was studied and it was quick and, after 60 min, the complete adsorption equilibrium. The amount of Cr(VI)
ion removal efficiency reached a maximum of 62%, and 97%, respectively.
The effect of adsorbent dose on Cr(VI) removal efficiency as well as the adsorption capacity was
determined. The Cr(VI) removal efficiency was increased from 45 to 97 % with increasing of the adsorbent
dose from 1.0 to 5.0 g/L, while the adsorbent capacity declined from 180.0 to 77.6 mg/g. The elevation of
removal efficiency with increasing of the adsorbent dose is a result of the number of available active sites on
the adsorbent surface (Hassanpour et al., 2018).
POSTER PRESENTATION
335
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3.3 Effect of pH and ionic strength
There was maximum adsorption of Cr(VI) on the native and modified adsorbents at pH 2.0, but above this,
Cr(VI) removal declined. At pH 2.0, protonation of amino groups on the native and modified fungal biomass
increase the net positive charge and enhances the adsorption of negatively charged Cr(VI) anions by
electrostatic binding (Bayramoglu and Arica 2009).
The adsorbed amount of Cr(VI) ions decreased with increasing ionic strength. The Cr(VI) ions adsorption
capacity of the native and modified fungal biomass decreased by about 49% and 58%, respectively, when the
NaCl concentration in the adsorption medium was 1.0 mol/L.
3.4 Effect of initial Cr(VI) concentration on the adsorption capacity
In order to investigate the effect of initial Cr(VI) concentration on the adsorption capacity of the native and
modified fungal biomasses, this work was carried out in the initial Cr(VI) concentration range 10-500 mg/L
at a pH of β.0 and a temperature of β5 °C. The adsorption capacity of both adsorbent increased with increase
of initial Cr(VI) concentration, and the plateau values of the native and modified fungal biomasses were
obtained at the Cr(VI) concentration of 400 mg/L, respectively. The maximum adsorption capacity of the
native and modified fungal biomasses reached 261.4 and 487.9 mg/g, respectively.
4. DISCUSSION
Removal of Cr(VI) anions by fungal based adsorbent has been found to vary as a function of pH of the
solution. The Cr(VI) adsorption depends on protonation or un-protonation of various functional groups on
the surface of the native and modified biomass. The protonation of certain functional groups of the tested
adsorbents and the presence of hydronium ions around the binding sites can cause an enhanced attraction of
Cr(VI) ions to adsorbents surface at this acidic pH. As the solution pH increases, the surface of the
adsorbents becomes negatively charged due to functional groups, which repulse negatively charged chromate
ions (HCrO4−, Cr2O7β−, and Cr4O13β−). The involvement of amino group in the adsorption of Cr(VI) ions also
confirmed these adsorbents by the FTIR analysis as presented above. As the pH increased, the overall
surface charge on the cell walls became negative, and adsorption decreased. Finally, the removal efficiency
of all the tested adsorbents remained at a low level through the tested pH range; all subsequent adsorption
experiments were conducted at pH 2.0, the optimum pH for adsorption of Cr(VI) ions on the tested
adsorbents.
The presence of other competing ions in the adsorption medium can reduce the adsorption efficiency of the
adsorbent for the target metal ions. The Cr(VI) ions adsorption capacity of the native and modified fungal
biomass decreased by about 49% and 58%, respectively, when NaCl concentration in the adsorption medium
was 1.0 mol/L. The lower adsorption capacity at higher ionic strength may be explained by the competition
between Cr(VI) ions and chloride ions (Cl -) for the same binding sites present on the adsorbent surface. This
behavior indicated that the ion exchange could be responsible for the Cr(VI) removal process. Another way
to explain it is that the adverse effect of ionic strength may change the activity coefficient of chromium on
species and thus would limit their transfer to the adsorbent surface (Arica and Bayramoglu, 2005 ).
Another effective parameter for evaluation of adsorption processes is equilibrium adsorption. The
equilibrium adsorption is stated when the concentration of metal ions in the aqueous solution is in a dynamic
equilibrium with the amount of metal ion connected to the adsorbent surface (Arica and Bayramoglu, 2008).
With increase the initial chromium concentration from 10 to 500 mg/L, the adsorption capacity increased
from 51.3 to 487.9 mg/g. The reduction of removal efficiency and the elevation of adsorption capacity with
increasing the initial chromium concentration can be explained by the limitation of active sites available on
the adsorbent surface and completion of all active sites, respectively (Arica and Bayramoglu, 2005).
The Langmuir and Freundlich adsorption constants calculated from the corresponding isotherms with the
correlation coefficients are presented above. The correlation coefficients show that the adsorption process
could be described by the Langmuir equation. The Langmuir constant (qm) values were fit the experimental
values. On the other hand, the magnitudes of KF and n show easy separation of Cr(VI) ions from aqueous
medium and indicate favorable adsorption. The intercept KF value is an indication of the adsorption capacity
of the adsorbent; the slope 1/n indicates the effect of concentration on the adsorption capacity and represent
adsorption intensity (Mullick et al., 2018). All experimentally tested biosorbents, n values were found high
enough for separation.
POSTER PRESENTATION
336
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Comparing the equilibrium capacities (qeq) of the kinetic models “namely first and second order” with the
experimental equilibrium capacities of the adsorbents, the calculated maximum capacities from second-order
equation seems to describe best he experimental data (data not shown).
5. CONCLUSION
To investigate the characteristics of the adsorbent, FTIR, SEM, and specific surface analysis were studied.
The removal efficiency increased with increase in the initial Cr(VI) concentration. Pseudo-second order
kinetic was well fitted with a higher correlation coefficient compared to other kinetic models. The adsorption
capacity of TETA modified fungal biomass was found to be 487.9 mg/g. Hereby, considering the abundance
and availability as well as based on the obtained results, it can be concluded that the modified L. edodes
biomass can be used as an inexpensive, facile, and suitable sorbent for removing Cr(VI) ions from aqueous
media. The proposed modified fungal biomass can be recycled and finally the used adsorbent can be
disposed in a secure landfill.
REFERENCES
Arica MY, Bayramoglu G 2005. Cr(VI) biosorption from aqueous solutions using free and immobilized
biomass of Lentinus sajor-caju: preparation and kinetic characterization Colloids and Surfaces A:
Physicochemical. Engineering Aspects, 253:203–211.
Bayramoglu G, Arica MY 2008. Adsorption of Cr(VI) onto PEI immobilized acrylate-based magnetic beads:
Isotherms, kinetics and thermodynamics study. Chemical Engineering Journal, 139:20-28.
Bayramoglu G, Arıca MY β008. Removal of heavy mercury(II), cadmium(II) and zinc(II) metal ions by live
and heat inactivated Lentinus edodes pellets. Chemical Engineering Journal. 143:133–140.
Foroutan R, Mohammadi R, Ramavandi B 2018. Treatment of chromium-laden aqueous solution using
CaCl2-modified Sargassum oligocystum biomass: Characteristics, equilibrium, kinetic, and
thermodynamic studies. Korean Journal Chemical Engineering 35:234-245.
Gui-Qiu Chen, Guang-Ming Zeng, Xiang Tu, Cheng-Gang Niu,Guo-He Huang, Wen Jiang Application of a
by-product of Lentinus edodes to the bioremediation of chromate contaminated water Journal of
Hazardous Materials B135 (2006) 249–255
Hassanpour S, Taghizadeh M, Yamini Y 2018. Magnetic Cr(VI) ion imprinted polymer for the fast selective
adsorption of Cr(VI) from aqueous solution Journal of Polymer Environment, 26:101–115.
Mullick A, Moulik S, Bhattacharjee S 2018. Removal of hexavalent chromium from aqueous solutions by
low-cost rice husk-based activated carbon: Kinetic and thermodynamic studies. Indian Chemical
Engineering, 60:58-71.
POSTER PRESENTATION
337
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Yenidoğan Hiperbilirubinemi Otizm Spektrum Bozukluğu ile İlişkili midir?
Başak Özlem PERK1*, Naile Merve GÜVEN1, Benay CAN EKE1
*1
Ankara Üniversitesi, Eczacılık Fakültesi, Farmasötik Toksikoloji ABD, Ankara, Türkiye
*perk@ankara.edu.tr
Özet
Yenidoğanların yaklaşık %50’sinde görülen hiperbilirubinemi, çoğunlukla reversible olmakla birlikte bazı
durumlarda kan-beyin engelini geçebilecek yüksek düzeye ulaşabilmektedir. Bu durumda kısa veya uzun
dönem devam eden akut/kronik bilirubin ensefalopatisi, bilirubinle indüklenen nörolojik disfonksiyon gibi
nörogelişimsel yetersizliklere neden olabilmektedir. Nörodejeneratif bir rahatsızlık olan Otizm Spektrum
Bozukluğu’nun (OSB) da yenidoğan hiperbilirubinemi ile ilişkili olduğu düşünülmektedir. Genetik
yatkınlık ve çevresel faktörlerin OSB gelişimindeki rolünün yanı sıra hiperbilirubinemi düzeyi ile olan
ilişkisinin belirlenmesi, hastalığın etiyolojisinin netleştirilmesinde önemli bir basamak olacaktır.
Anahtar Kelimeler: Otizm, Yenidoğan Sarılığı, Hiperbilirubinemi
Amerikalı çocuk psikiyatristi Leo Kanner, 1λ4γ yılında ‘yalnızlık için güçlü bir istek’ duyan ve ‘sürekli
tekdüzelik üzerine takıntılı’ davranış sergileyen 11 çocuk ile yaptığı çalışmada ilk defa otizmi tanımlamıştır
(Kanner, 1λ4γ). Kanner otizmin soğuk ve ilgisiz ebeveynlerin çocuk yetiştirme tarzından kaynaklandığını
savunmuştur. Yıllar içerisinde bu sav çürütülmüş, otizmli çocukların kendilerini çevreden bilinçli olarak
soyutladıkları inanışı hakim olmuştur. 1λ80’li yıllarda ise otizmin genetik ve nörobiyolojik bir bozukluk
olduğu kabul edilmeye başlanmıştır (Petaş, β016). β01γ yılına kadar Amerikan Psikiyatri Derneği otizmi
Yaygın Gelişimsel Bozukluklar çatısı altında değerlendirmiş, mayıs β01γ’te yayımladıkları Ruhsal
Bozuklukların Tanısal ve Sayımsal Elkitabı, Beşinci Basımında (DSM-5) Otizm Spektrum Bozukluğu (OSB)
tanısı kullanılacağını duyurmuştur (Özkaya, 2013).
OSB’li çocuğu olan ailelerde OSB yıkıcı etkilere ve zorluklara kaynaklık etmektedir (Meral ve Cavkaytar,
β014). Amerika’da bir OSB’li bireyin ömür boyu maliyeti 1.4- β.4 dolardır (Wu ve ark., 2016). Tedavisi
henüz mümkün olmayan ve kesin nedeni bilinmeyen OSB’nin erken teşhis ve müdahale ile çocukların
gelişim kaydetmeleri mümkün olmaktadır (Koçbeker ve Saban, β005).
Bu kısa derlemedeν patogenezi genetik, immünolojik, çevresel ve enfeksiyöz ajanlar gibi pek çok nedenle
açıklanmaya çalışılan OSB’nin Yenidoğan Hiperbilirubinemi ile ilişkisi değerlendirilmiştir (Esnafoğlu ve
ark., 2017).
OSBν tekrarlayan davranışlar, iletişim ve sosyal etkileşim bozukluklarıyla karakterize nörodejeneratif bir
rahatsızlıktır (Amin ve ark., β011ν McElhanon ve ark., β014ν Rubenstein ve ark., β018). Sınırlı ve yineleyici
ilgi, davranış ve etkinlikler ile sosyal etkileşim/iletişim eksiklikleri OSB’nin temel özelliklerinden olmasına
rağmen bu probleme neden olan faktörler yeterince anlaşılabilmiş değildir (Özdemir ve ark., β017ν Özkaya,
2013).
OSB risk faktörleri epidemiyolojik araştırmalarla aydınlatılmaya çalışılmıştır. Anne ve babanın yaşı, annenin
gebelik öncesi ve/veya sırasında geçirdiği enfeksiyonlar, folik asit eksikliği, ilaç kullanımı gibi çevresel
etkenler ile diyabet, preeklempsi gibi rahatsızlıklar ve erken doğum gibi pek çok faktörün OSB için risk
teşkil edebileceği gösterilmiştir (Fernell ve ark., β015). Tek yumurta ikizlerinde her iki kardeşte OSB
görülme olasılığı %60-90 iken tek yumurta ikizlerinde bu oran %0-10 olarak bulunmuştur. Bu bakımdan
OSB’nin genetik kökenli olduğu gösterilmiş, ancak genetik yatkınlığın çevresel faktörler ile etkileşimi
sonucu ortaya çıktığı saptanmıştır (Gardener ve ark., β011) (Şekil 1).
POSTER PRESENTATION
338
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 1. Hallmayer ve ark.nın OSB’li ikizler üzerinde yaptıkları çalışmada otizm risk faktörleri oranı
(Hallmayer ve ark., 2011)
Nörobiyolojik bir sendrom olan OSB’nin etiyolojisinin anlaşılabilmesi için nöropatolojik mekanizmaları
üzerine çeşitli çalışmalar yapılmıştır (Korkmaz, β010). OSB’li bebeklerde görülen en yaygın nöropatolojik
bulgu çeşitli ajanlara maruziyetle oluşan serebellar hasar olduğu gösterilmiştir. Otopsilerden elde edilen
bulgular OSB’li çocukların beyinlerinde serebellar displazi geliştiğini ortaya koymuştur. Ayrıca otistik
çocuklarda serebellar displazi in vivo nörogörüntüleme çalışmaları ile de kanıtlanmıştır. Bu nedenle perinatal
ve/veya postnatal dönemde serebellar hasara neden olan risk faktörleri OSB ile ilişkili olabileceği
düşünülmüştür. Yapılan meta-analizlerle çevresel ve genetik faktörler dışlandığında serebellar hasara neden
olabilen yenidoğan hiperbilirubineminin bireyde OSB oluşumuna zemin hazırlayabileceği gösterilmiştir
(Amin ve ark., β011) (Şekil β).
Yenidoğan Hiperbilirubinemi (YH) yaşamın ilk β haftası içerisinde görülen deri ve mukozada bilirubin
birikmesiyle ortaya çıkan bir durumdur. Bilirubin hem katabolizması sonucu meydana gelmektedir. Hem
hemoksijenaz enzimi ile biliverdine oksitlenir ve bu sırada karbonmonoksit ve Fe +3 açığa çıkar. Biliverdin de
biliverdin redüktaz ile indirekt bilirubine dönüşür. Oluşan indirekt bilirubin dolaşımda albümine bağlanarak
taşınır ve karaciğere getirilir. Karaciğerden safra aracılığıyla glukuronik asitle konjuge halde direkt bilirubin
olarak duodenuma boşaltılır. Barsaklarda direkt bilirubini indirekt bilirubine çeviren mukozal betaglukuronidaz enzimi mevcuttur. Yenidoğanda bu enzim erişkinlerin aksine yüksek konsantrasyonlarda
bulunur ve direkt bilirubini tekrar indirekt bilirubine dönüştürür. Barsaktan portal dolaşıma geçen bu indirekt
bilirubin tekrar karaciğere gelir. Barsak lümeninde kalan diğer indirekt bilirubinler, bakteriler tarafından
barsaklardan geri emilmeyen sterkobiline dönüştürülür. Yenidoğan barsağında yararlı bakterilerin yeterince
kolonize olmaması nedeniyle bu dönüşüm gecikir ve dolaşımda indirekt bilirubin düzeyi artar. İndirekt
bilirubin kan-beyin engelini aşar ve beyinde ganglionlar, globus pallidus, hipokampus, serebellum ve
subtalamik çekirdeklerde birikerek geçici veya kalıcı nöronal hasarlara neden olabilir (Sivaslı β00λ, Brites
2012).
POSTER PRESENTATION
339
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 1. Bilirubin metabolizması ve otizme neden olduğu düşünülen sarılığın patogenezine genel bir bakış
(Amin ve ark., 2011).
Bilirubinle indüklenen nörolojik disfonksiyon (BIND) ile OSB’nin benzer klinik özellikleri bulunmaktadır.
Her iki rahatsızlıkta da davranış bozuklukları, nöromotor, konuşma ve dil anomalileri görülmektedir (Lozada
ve ark., β015). Araştırmalar yüksek bilirubin düzeyinin OSB’nin karakteristik özelliği olan sosyal ve iletişim
eksikliğine neden olabileceğini göstermektedir. YH ile OSB arasındaki ilişkiyi araştıran metaanaliz
sonuçlarına göre hiperbilirubinemi OSB riskini %4γ arttırmaktadır (Wu ve ark., 2016).
OSB ile YH arasındaki ilişkiyi araştıran pek az çalışma mevcuttur. Üstelik bu çalışmaların oldukça önemli
kısıtlılıkları bulunmaktadır. Bu kısıtlılıklar arasında kontrol grubunun olmaması, OSB’li çocukların
yenidoğan bilirubin düzeyleri hakkındaki bilgilerin sadece ebeveyn görüşmelerinden sağlanması ve küçük
gruplarda (n<200) yapılan çalışmaların populasyonu yansıtmaması sayılabilir. Bunun yanısıra YH
tedavisinde standart olarak kullanılan fototerapinin de DNA hasarına, sitokin seviyelerinde değişikliğe ve
oksidatif stres artışına bağlı olarak OSB’nin tetiklenmiş olabileceğini gösteren çalışmalar mevcuttur (Wu ve
ark., 2016).
OSB’nin YH ile ilişkisinin kanıtlanması amacıyla yenidoğan kan bilirubin düzeyi ile buna bağlı yapılan
tedavi şekilleri ve maternale ait faktörler göz önüne alınarak daha geniş populasyonlarda yapılacak
çalışmalar OSB prevelansının azaltılmasına önemli katkı sağlayacaktır (Amin, 2011).
Kaynaklar
Amin SB, Smith T, Wang H 2011. Is Neonatal Jaundice Associated with Autism Spectrum Disorders: A
Systematic Review. J Autism Dev Disord, 41: 1455-1463.
Brites D 2012. The Evolving Landscape of Neurotoxicity by Unconjugated Bilirubin: Role of Glial Cells and
Inflammation. Front Pharmacol., 3:88.
POSTER PRESENTATION
340
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Esnafoğlu E, Demir EY, Çetinkol Y, Çalgın MK, Erdil A, Ertürk EY, Dağlı A β017. Otizmli çocuklarda
Toxoplasma gondii antikorlarının seroprevalansı. Dusunen Adam The Journal of Psychiatry and
Neurological Sciences, 30:309-315.
Fernell E, Bejerot S, Westerlund J, Miniscalco C, Simila H, Eyles D, Gillberg C, Humble MB 2015. Autism
spectrum disorder and low vitamin D at birth: a sibling control study. Molecular Autism, 6:3.
Gardener H, Spiegelman D, Buka SL 2011. Perinatal and neonatal risk factors for autism: a comprehensive
meta-analysis. Pediatrics, 128:2.
Hallmayer J, Cleveland S, Torres A, Phillips J, Cohen B, Torigoe T, Miller J, Fedele A, Collins J, Smith K,
Lotspeich L, Croen LA, Ozonoff S, Lajonchere C, Grether JK, Risch N 2011. Genetic heritability and
shared environmental factors among twin pairs with autism. Archives of general psychiatry, 68(11), 10951102.
İnce G β017. Otizm Spektrum Bozukluğu Olan Çocuğa Sahip Ebeveynlerin Spor İle İlgili Görüşleri. Ankara
Üniversitesi Eğitim Bilimleri Fakültesi Özel Eğitim Dergisi, 18(1)μ 10λ-124.
Kanner L 1943. Autistic disturbances of affective contact. The Nervous Child, 2: 217-250.
Korkmaz B 2010. Otizmμ Klinik ve nörobiyolojik özellikleri, erken tanı, tedavi ve bazı güncel gelişmeler.
Türk Ped Arş, 45μ 80. Yılμ γ7-44.
Lozada LE, Nylund CM, Gorman GH, Hisle-Gorman E, Erdie-Lalena CR, Kuehn D 2015. Association of
Autism Spectrum Disorders With Neonatal Hyperbilirubinemia. Global Pediatric Health,2: 1–5.
McElhanon BO, McCracken C, Karpen S, Sharp WG 2014. Gastrointestinal Symptoms in Autism Spectrum
Disorder: A Meta-analysis. Pediatrics, 133( 5).
Meral BF, Cavkaytar A 2014. Otizmli Çocuk Ailelerinin Aile Yaşam Kalitesi Algıları. K. Ü. Kastamonu
Eğitim Dergisi, βγ (γ), 1γ6γ-1380.
Özdemir S, Selimoğlu ÖG, Töret G, Suna HE β017. Otizm Spektrum Bozukluğu Olan Çocuklar ve Normal
Gelişim Gösteren Çocukların Statik ve Hareketli Materyallerde Yüz İşlemelerinin Karşılaştırılması. Ankara
Üniversitesi Eğitim Bilimleri Fakültesi Özel Eğitim Dergisi, 18( β)μβ71-290.
Özkaya B. T., Yaygın Gelişimsel Bozukluklardan Otizm Spektrum Bozukluğuna Geçişμ DSM-5’te
Karşımıza Çıkacak Değişiklikler, Psikiyatride Güncel Yaklaşımlar-Current Approaches in Psychiatry
2013;5(2):127-139
Pektaş S., Otizm Spektrum Bozukluğu Tanısı Almış Çocuklarda Müzik Eğitiminin Önemi, sed, β016, Cilt 4,
Sayı 1, Volume 4, Issue 1
Rubenstein E., Wiggins L.D., Schieve L.A., Bradley C., DiGuiseppi C., Moody E., Pandey J., Pretzel R.E.,
Howard A.G., Olshan A.F., Pence B.W., Daniels J., Associations between parental broader autism phenotype
and child autism spectrum disorder phenotype in the Study to Explore Early Development, Autism. 2018
Sivaslı E β00λ. Yenidoğan Bebeklerde Uzamış Sarılık. Gaziantep Tıp Dergisi, 15(β)μ4λ-55.
Wu YW, Kuzniewicz MW, Croen L, Walsh EM, McCulloch CE, Newman TB 2016. Risk of Autism
Associated With Hyperbilirubinemia and Phototherapy. Pediatrics, 138(4).
Koçbeker BN, Saban A β005. Otistik Bir Çocuğun Yabanci Dil Öğrenimine İlişkin Örnek Olay
İncelemesi. Selçuk Üniversitesi Sosyal Bilimler Enstitüsü Dergisi, (14), 401-427.
POSTER PRESENTATION
341
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Catalytic enzyme-reactor operated with immobilized-laccase for oxidative degradation of microorganic pollutants
Gulay Bayramoglu1,2*, Meltem Yilmaz3* and M. Yakup Arica2
1
Gazi University, Biochemical Processing and Biomaterial Research Laboratory, Ankara, Turkey
2
Gazi University, Faculty of Science, Department of Chemistry, Ankara, Turkey
3
Gazi University, Polatlı Faculty of Sciences and Arts, Department of Biology, Ankara Turkey
Corresponding author e-mail: g_bayramoglu@hotmail.com; meltemalev@gmail.com
Abstract
The uncontrolled discharge of micro-pollutant containing effluents is considered to be one of the biggest
threats to the human health and natural environments. The presence of aryl groups in the hydrocarbon
molecular structure makes it an environmentally persistent and mutagenic substance affecting a wide
range of organisms (Majeau et al., 2010.). Currently, the removal methods of micro-pollutants are
conventional physical and chemical treatment modes such as adsorption, photodegradation, ozonation,
precipitation and electrochemical. Alternatively, enzyme mediated biodegradation of aromatic micropollutant by oxidoreductase enzymes such as laccase, lignin peroxidases and manganese peroxidases can
involve in the catalytic reduction of synthetic organic pollutants with a low energy requirement, a wide
range of pH, temperature and ionic strength.
In the presented study, poly(styrene-co-divinylbenzene)-g-poly(cyclic carbonate-methacrylate), p(SDVB)-g-CCMA), microbeads were prepared as described previously. Laccase enzyme was covalently
immobilized using cyclic carbonate groups of the beads. The immobilized enzyme was investigated for
the degradation of the ί-skatole in a batch system. The degradation studies were realized in the presence
and absence a laccase-mediator system. In the presence of acetosyringone mediator the immobilized
laccase was actively removed skatole from the reaction medium compared to the mediator free system.
This can be due to the presence of the relatively strong withdrawing electron groups such aryl, –NH, and
CH3 in the chemical structure of skatole. The removal performance of the skatole by the immobilized
laccase was increased from 0.28 to 1.33 mg/g enzyme-microbeads. Increasing the skatol concentration
from 5 ppm to 50 ppm increased the removal efficiency and reached a plateau value at around 40 ppm
skatole concentration. The pH value and temperatures during skatole degradation had not a significant
effect on of the immobilized laccase, activity. This study showed that laccase-mediator systems could
effectively enhance the degradation rate of skatole.
Keywords: Biocatalytic microbeads; Laccase; Enzyme immobilization; Micro-pollutant.
1. INTRODUCTION
Several methods have been proposed for removal of the organic pollutants from disposed wastes such as
microbial and enzymatic degradation, adsorption, and chemical processes (Barrios-Estrada et al.,2018;
Bayramoglu et al., 2018). For oxidative degradations of organic pollutants several oxidative enzymes have
been used such as laccase, tyrosinase, manganese peroxidase, horseradish peroxidase etc. Among them,
laccase can oxidase a wide spectrum of aromatic organic compounds in the presence of molecular oxygen
(Celikbicak et al., 2014; Bayramoglu et al., 2010). An addition, the laccase based enzymatic reactions can be
realized with the high concentrations of substrates with low energy requirements, a wide range of pH,
temperature and ionic strength, which are considered as green chemistry approach via the reduction of
molecular oxygen to water, and this process can be further extended and improved by the addition of redox
mediators (Bayramoglu et al., 2018). The enzyme “laccase” is belonging to the multi-copper oxidases family
commonly found in plants, insects, fungi and bacteria. The most known laccase producers are nearly all
wood-rotting fungi, such as Trametes versicolor, Phanerochaete chrysosporium, and Bjerkandera adusta.
Therefore, laccase has many possible applications, including textile effluent discoloration, and the
detoxification of different xenobiotics (Karagoz et al., 2011; Fernandez-Fernandez et al., 2013). ί-skatole is
a toxic pollutant produced by bacteria as a degradation product of the amino acid tryptophan. It occurs
naturally in human feces and has an intense fecal odor. It is a toxic white crystalline organic compound. It
causes a bad smelling around the summery home where sewer storage. The bad odor of skatole can be
POSTER PRESENTATION
342
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
removed using immobilized laccase from the summery home sewer storage On the other hand, in low
concentrations; skatole has a flowery smell and is found in several flowers and essential oils, including those
of orange blossoms, and jasmine.
Immobilization of enzymes and microorganism on insoluble support materials is accepted as useful approach
for improvement of their reusability and stability. Various inorganic and organic support materials for
immobilization of enzyme have been used such as polymeric microbeads, magnetic nano-particles, silica
nanoparticles, zeolite/polymer etc. Whereas comb type polymer grafted support materials may be more
effective matrixes for enzyme immobilization, because of having large surface areas and permitting large
amount of enzyme attachment. An addition, the fixed enzyme on the fibrous polymer can be dispersed in the
reaction medium likes a free enzyme. Therefore, immobilization of enzyme on fibrous polymer grafted
support can provide high retained enzyme activity, high enzyme loading and fast enzymatic reaction kinetics
compared with other supports. The fibrous polymer on the shell can be functionalized with different reactive
groups, such as epoxy, hydroxyl, amine, thiol, carboxyl, chloride, bromide and cyclic carbonate (Rahmani et
al 2015; Teerpatsakul et al., 2017; Zhang et al., 2014). Among them, the cyclic carbonate carrying support
materials are the most suitable support materials for large scale enzyme immobilization. The immobilized
laccases have been used in the several studies to remove aromatic organic pollutants from wastes. T.
versicolor laccase was used for covalent immobilization via the cyclic carbonate coupling reaction on the
[PS-co-DVB-g-P(CCMA)] microbeads.
The cyclic carbonate group of the [PS-co-DVB-g-P(CCMA)] microbeads was used for covalent
immobilization of laccase. The immobilized laccase was used for removal of two skatole in aqueous
medium. The complete degradation time of the skatole was determined using UV–vis spectrophotometer.
2. MATERIALS AND METHODS
2.1 Materials
Laccase (EC 1.10.3.2): (T. versicolor about 20 U/mg), syringaldazine, CuBr, bromoacetyl bromide,
triethylamine, tetrahydrofuran, aqueous ammonia, ί-skatole, and - azobisizobutyronitrile (AIBN) were
obtained from Sigma-Aldrich Chem. Co. The monomers, divinylbenzene (DVB), styrene (S) and
glycidylmethacrylate (GMA)), were supplied from Sigma-Aldrich Co. All other chemicals were of analytical
grade and supplied from Merck (Darmstadt, Germany) and all these chemicals were used as purchased.
2.2 Immobilization of laccase
Polystyrene-divinyl benzene, PS-co-DVB, as the starting polymeric microbeads was synthesized by
suspension polymerization using styrene and divinyl-benzene monomers as described in the previous work
(Bayramoglu et al., 2018). The synthesized microbeads were dried and sieved, and the 210– 422 mm size
fraction was used in further reactions. ATRP initiator sites, bromoacetyl groups were then tethered to the
surface of the PS-co-DVB microspheres by acetoxy mercury method as reported previous (Bayramoglu et
al., 2018). The P(GMA) grafted microbeads were dried in an oven for 24 h. Then, epoxy groups of the
P(GMA) chains on the PS-co-DVB microbeads were converted into cyclic carbonate groups according to a
procedure described in the literature (Bayramoglu et al., 2018). The immobilization of laccase using the
cyclic groups of PS-co-DVB-g-P(CCMA) microbeads, was studied under different experimental conditions
as described previously (Bayramoglu et al., 2018).
The activity of free and immobilized laccase was determined spectroscopically by standard assay method of
the Ride (1983) based on the increase in absorbance at 530 nm from the oxidation of syringaldazine.
2.3 Degradation studies of skatole
Degradation of skatole was studied with the immobilized laccase on the [PS-co-DVB-g-P(CCMA)]
microbeads in acetate buffer (50 mMν pH 5.0) at β5 °C with continuous stirring. Before the reaction
initiation, skatole solutions were saturated with oxygen for 10 min. The amount of degraded skatole was
determined by removing samples at different time intervals. The initial concentration of skatole was 5 ppm.
Before and after enzymatic degradation, the spectra of skatole was obtained by UV–vis spectrophotometer,
and the percentages of degradation of skatole were calculated. Under the same experimental conditions, the
free enzyme was used as blank control system for skatole. The reaction mixture containing of skatole (50
ppm) in acetate buffer solution (pH 5.0, 50 mmol/L, 5.0 mL) or same buffer solution containing 50 mmol/L
POSTER PRESENTATION
343
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
acetosyringone (as a mediator) was incubated with the free enzyme solution (0.2 mL) or laccase immobilized
[PS-co-DVB-g-P(CCMA)] microbeads (0.2 g). The free and immobilized enzymes solutions containing
skatole solutions were placed on an orbital shaker, and shaken 150 rpm, at β5 °C, and for 1β0 min.
2.2 Figures
Figure 1. ί-skatole synthesis pathway
Figure 2. SEM photos of the microbeads
Figure 3. Covalent immobilization of laccase on cyclic carbonate group containing PS-coDVB-g-P(CCMA) microbeads
POSTER PRESENTATION
344
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
1,5
60
1
40
0,5
20
Degradation (%)
q (mg/g)
Figure 4. ί-skatole degradation spectra with PS-co-DVB-g-P(CCMA) microbeads after 60 min incubation
period. (Skatole concentration: 5 ppm; pH: 5,0; Enzyme-support: 50 mg; Solution volume: 5 mL)
0
0
0
10
20
30
40
50
60
Skatole concentration (ppm)
Figure 5. Effect of ί-skatole concentration on the percent degradation and removal performance of the
laccase immobilized on PS-co-DVB-g-P(CCMA) microbeads
POSTER PRESENTATION
345
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 6. Effect of medium temperature on ί-skatole degradation (A); Effect of pH on skatole
degradation (B) of immobilized laccase on PS-co-DVB-g-P(CCMA) microbeads
2.3 Equations
ί-skatole, and their stock solutions were prepared at pH 5.0, and calibration curves were obtained using UV–
vis spectrophotometer at maximum wavelengths 280 nm. The amount of skatole remaining in the solution
before and after enzymatic treatment was calculated according to the following equation:
Q = [(C0 - C) V]/m
(1)
where Q is the amount of skatole (mg/g); C0 and C are skatole concentration (mg/mL) in solution before and
after enzymatic treatment, respectively; V is the solution volume (mL), and m indicates the amount of
enzyme immobilized microbeads (g). As noted above, calibration curves were obtained using stock solution
of skatole (solutions prepared from 5 to 50 ppm of skatole).
3. RESULTS and DISCUSSION
3.1. Characterization of the PS-co-DVB microbeads
The PS-co-DVB microbeads with a size distribution of 210– 422 mm and a specific surface area of 32.4 m2/g
were used for immobilization of laccase. The surface of PS-co-DVB was grafted with polymer chains of
P(GMA) via SI-ATRP. Firstly, the surface of the PS-co-DVB microbeads modified with acetoxy mercury
groups followed by reaction with bromoacetyl bromide. The attached bromo-acetyl group was used as the
SI-ATRP initiating point. The P(GMA) grafting efficiency was found to be about 168% on the surface of the
PS-co-DVB microspheres when the polymerization time was 6.0 h. It was found to be 173% for 12.0 h
polymerization time (Bayramoglu et al., 2018). This comb type pGMA grafted polymer was modified in to
cyclic carbonate groups and then used for the covalent immobilization of laccase. Finally, the microbeads
were well characterized by using FTIR, BET, SEM and analytical methods and presented in the previous
work (Bayramoglu et al., 2018).
3.2 Degradation studies of skatole
Degradation of ί-skatole was investigated by the immobilized laccase on the cyclic carbonate groups
carrying microspheres. The degradation rates of skatole by the free and immobilized laccase preparations
were followed by taking samples at different time intervals and analysed as described above. As a control the
heat-treated immobilized laccase did not show any decomposition of skatole, but in the presence of active
POSTER PRESENTATION
346
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
immobilized laccase, significant changes observed in the UV–vis absorbance spectra of skatole. ί-skatole
showed two major absorbance peaks at 210 and 280 nm. After 120 min incubation period, approximately
61% of the spectra areas decreased after degradation of skatole with the immobilized enzyme compared to
initial spectrum.
3.3 Effect of initial skatole concentration on the degradation efficiency of immobilized laccase
The effect of initial ί-skatole concentration on degradation rate was studied using the laccase immobilized
PS-DVB-g-pGMA-SC microbeads. The initial skatole concentration was varied between 5 and 50 ppm. The
variation in the starting skatole concentration resulted in a reduction in the percent removal efficiency from
49.8 to 28, 3, respectively. It should be noted that the removal performance of the immobilized laccase for
the model substrate increased from 0.28 to 1.33 mg/g enzyme immobilized microbeads. Increasing the
skatole concentration from 5 ppm to 50 ppm increased the removal capacity and reached a plateau value at
around 40 ppm skatole concentration.
3.4 Effect of temperature and pH on skatole degradation by immobilized laccase
The degradation rates of ί-skatole in the presence of a mediator compound with the laccase immobilized on
the [PS-co-DVB-g-P(CCMA)] microbeads were studied at different pH and temperature. The degradation
rate of the laccase immobilized on the [PS-co-DVB-g-P(CCMA)] microbeads for skatole was highly
efficient in the presence of a mediator compared with the mediator-free system (data not shown).
When the enzyme-immobilized [PS-co-DVB-g-P(CCMA)] microbeads were used for scatole degradation in
a batch system, it was observed that more than 45% removal could be achieved after the first 2.0 h and it was
determined that the skatole degradation was not highly dependent on the medium pH. It should be stated that
the skatole degradation percentage did not change with increasing temperature using laccase immobilized
[PS-co-DVB-g-P(CCMA)] microbeads.
3.2 Degradation studies of β-skatole
For large scale applications, the advantage of immobilized enzyme over its free counterpart is its capacity to
be reused in the operation. Therefore, the reusability of the immobilized enzyme should be determined. In
the presented work, the activity of the immobilized laccase was stable over 10 repeated uses for ί-skatole
degradation. After four cycles, the relative activity of immobilized laccase was 96%. After ten repeated uses,
the retained activity of the immobilized enzyme was found to be 63%. The immobilized enzyme gradually
lost its activity with increased use. Such loss in activity could be attributed to the natural lost its activity,
conformational changes, and denaturation of enzyme.
5. CONCLUSION
The comb type p(GMA) grafted PS-co-DVB microbeads were prepared via SI-ATRP method, and the epoxy
groups of the grafted pGMA converted in to cyclic carbonate group under CO 2 atmosphere. The immobilized
laccase was proved to be an effective enzyme in degradation of ί-skatole compared to the free enzyme. For
example, in the presence of acetosyringone mediator, the free and immobilized laccase degraded about 45%
scatole within 1β0 min at β5 °C. Thus, the presented work provides a promising way for large scale
production of reactive microbeads, which, are good candidate as supports for enzyme immobilization. The
immobilized laccase can be used as a reusable reactive enzyme support for various micro-pollutant
degradation.
ACKNOWLEDGEMENTS
This work was supported by a project grant number 113Z427 from The Scientific and Technological
Research Council of Turkey.
POSTER PRESENTATION
347
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
REFERENCES
Barrios-Estrada C, Rostro-Alanis M.J, Munoz-Gutierrez BD, Iqbal HMN, Kannan S, Parra-Saldivar R 2018.
Emergent contaminants: Endocrine disruptors and their laccase-assisted degradation– A review. Science
of the Total Environment, 612:1516–1531.
Bayramoglu G, Karagoz B, Arica MY 2018. Cyclic-carbonate functionalized polymer brushes on polymeric
microspheres: Immobilized laccase for degradation of endocrine disturbing compounds. Journal of
Industrial and Engineering Chemistry, 60:407–417.
Bayramoglu G, Yilmaz M, Arica MY 2010. Reversible immobilization of laccase to poly(4-vinylpyridine)
grafted and Cu(II) chelated magnetic beads: Biodegradation of reactive dyes. Bioresource Technology,
101:6615–6621.
Celikbicak O, Bayramoglu G, Yılmaz M, Ersoy G, Bicak N, Salih B, Arica MY β014. Immobilization of
laccase on hairy polymer grafted zeolite particles: Degradation of a model dye and product analysis with
MALDI–ToF-MS. Microporous and Mesoporous Materials, 199:57–65.
Fernandez-Fernandez M, Sanroman MA, Moldes D 2013. Recent developments and applications of
immobilized laccase. Biotechnology Advances, 31:1808–1825.
Karagoz B, Bayramoglu G, Altintas B, Bicak N, Arica MY 2011. Amine functional monodisperse
microbeads via precipitation polymerization of N-vinyl formamide: Immobilized laccase for benzidine
based dyes degradation. Bioresource Technology, 102:6783–6790.
Majeau JA, Brar SK, Tyagi RD 2010. Laccases for removal of recalcitrant and emerging pollutants.
Bioresource Technology 101: 2331–2350.
Rahmani K, Faramarzi MA, Mahvi AH, Gholami M, Esrafili A, Forootanfar H, Farzadkia M 2015.
Elimination and detoxification of sulfathiazole and sulfamethoxazole assisted by laccase immobilized on
porous silica beads. International Biodeterioration & Biodegradation, 97:107-114.
Ride JP, 1983. Cell walls and other structural barriers in defence. In: Callow, J.A. (Ed.), Biochemical Plant
Pathology. John Wiley and Sons, New York, pp. 215– 236.
Teerapatsakul C, Parra R, Keshavarz T, Chitradon L 2017. Repeated batch for dye degradation in an airlift
bioreactor by laccase entrapped in copper alginate. International Biodeterioration & Biodegradation, 120
52-57.
Zhang X, Pan B, Wu B, Zhang W, Lu L 2014. A new polymer-based laccase for decolorization of AO7:
Long-term storage and mediator reuse. Bioresource Technology, 164:248–253.
POSTER PRESENTATION
348
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Characterization of some food legumes' water-soluble proteins
Bouakkadia Hayette 1*, Chentouh Mouhamed Mounir2, Boutebba Aissa2
1
2
Department of Biology, Badji Mokhtar University, Faculty of sciences, Annaba, Algeria.
Department of Biochemistry, Badji Mokhtar University, Faculty of sciences, Annaba, Algeria.
e- mail: hayett_biotech@yahoo.fr
Abstract
1 Water-soluble proteins fraction of peanut, soybean, sesame and lens seeds are characterized. The
Kjedahl method is used to determine the proteins content. The characterization of the
physicochemical properties of the proteins is carried out using the electrophoretic migration of
proteins in One-dimensional SDS-polyacrylamide gel and the isoelectric focusing under native
conditions. The total protein level of peanut, soybean, sesame and lens are 45.50%, 25.37%, 20.65%
and 23.86 % respectively. Electrophoresis and isoelectric focusing, two techniques for protein
analysis, revealed a number of protein fractions of varying intensity, relative molecular masses (Mr)
and isoelectric points (pI). The seed proteins of these legumes are of low molecular weight. As for pI,
for peanut, soy and lentil, they are acidic. For sesame they varied from acidic to basic.
2
Key words: Food legumes, water-soluble proteins, one-dimensional electrophoresis, isoelectric
focusing
1. INTRODUCTION
Food legumes are grown for human and animal consumption. They are particularly rich in starch and have
low lipid content. They are characterized by high protein content. They contain globulins and albumins.
Globulins are the dominant proteins and constitute 50 to 90% of the seed's proteins. Albumin is a watersoluble protein. It is distinguished albumines 2S, 11S and rarely 7S. Protein content is one of the main
criteria for the quality of these foods. Legumes such as peanut, soy, sesame, green pea, chickpea, lupine,
bean, bean, etc. are consumed worldwide and constitute a substantial part of protein intake. The peanut
Arachis hypogaea is an herbaceous legume native to Brazil belonging to the papilionaceae subfamily
(Guerin et al., 1995). The peanut seed contains 23-27% protein (Souci, 1994). Peanut proteins are
thermostable (Dubuisson et al., 2002). 10% of the proteins are of albumin type and the remaining 90%
contain two major globulins, arachine and conarachine as well as minor components such as lectins and
oleosins (Guéant et al., 1λλ5). Soybean, an annual legume, native to China is widely used around the world
because of its nutritional quality (Cucu et al., 2012). The protein content of this seed varies between 30% and
50%. The proteins extracted by solubilization in alkaline medium and then purified by pH-precipitation at
4.5 are richer in sulfur amino acids than those of other legumes. They represent 90% of globulins and 10% of
albumins (Patricia, 2008). Sesame, Sesamum indicum L or Oriental Sesamum L, belongs to the Pedaliaceae
family (Agne et al., 2003). It is probably the oldest oilseed crop grown by humans (Johnson et al. 1979). It is
native to India. Today, it is exploited in many countries (Wolff et al., 2003). Its protein content is 22 to 25%.
The amino acid composition is unique and rare because of its high sulfur content. It contains methionine and
cysteine. Its lysine content is low (Johansson and Bennich 1λ67, Orruño and Morgan β007). The levels of
albumin, globulin, prolamins and glutelins are successively 8.9%, 67.3%, 1.3% and 6.9% (Rivas et al.,
1981). They have a pI between 4.9 and 6.4 (Fremont et al., 2002). Lens Culinaris is an annual herbaceous
legume belonging to the Papilionaceae family. It is Mediterranean specie. It is also grown in Algeria (Baba
Aissa, 2000). It is one of the important sources of vegetable protein and has a protein content of 21 to 31%
(Urbano et al., 2007, Joshi et al., 2011). The amino acid composition is characterized by a high content of
lysine, arginine, glutamine, aspartic acid and leucine. It is characterized by low levels of methionine,
cysteine and tryptophan (Swason, 1990). The lentil reserve proteins are mainly globulins (Osborne et al,
1898, Joshi et al., 2011, Joshi et al., 2012). Legume proteins are studied, but little work is done on the
proteins of the water-soluble fraction. It is in this context that our work devoted to the caractirization of the
water-soluble proteins of certain food legumes by electrophorisis and Isoelectric focusing.
POSTER PRESENTATION
349
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2. MATRIALS AND METHODS
a. Preparation and delipidation of samples:
The peanut, soybean, sesame and lentil seeds studied are purchased from the local market. Using a mill
(Analytical Mill 11A, Ika, USA) each legumes seeds are ground finely. 50g of the flours of arachis, soya,
sesame defatted at hot with hexane using soxhlet extractor for 8, 12, 16 hour. Same quantity the flour of lens
defatted with acetone for 1 hour at 4°C until they are used.
b. Determination of protein levels :
The total protein level is determined by multiplying the nitrogen content by the coefficient 6.25 according to
the Kjeldhal nitrogen determination method (A.O.A.C., Official Methods of Analysis, 1984).
c. Water-solubles protein extraction:
2g of flour are suspended in 15 ml of distilled water. After stirring for 20 hours at room temperature and
centrifugation at 18000 g at 4 ° C for β0 min, the separated supernatant is stored at -β0 ° C. The pellet is
subjected to 4 successive extractions during 2h. The optical density (OD) of each extract is measured at =
280 n.m using a spectrophotometer (UV-Visible) to record the extraction of all the proteins.
3.3. One-dimensional electrophorisis (1-DE) and Isoelectric focusing (IEF) :
Protein extracts are diluted 1/γ0 and 1/β70. 1 µl of each protein solution and 1µl of the mixture of control
protein macromolecules is used. Monodimensional electrophoresis of proteins is carried out under denaturing
conditions on Gradient 8-18% polyacrylamide gel [ExcelGelTM SDS GE Healthcare]. Molecular weights
markers cover a range of Mr ranging from 14.4 kDa to 97 kDa are used as reference. The revelation of the
electrophoretic bands is obtained by staining with blue of comassie R.250 or with a silver nitrate solution.
The bleaching is done overnight with a solution composed of 30% ethanol and 10% acetic acid.
The IEF separation performed in native condition on a flat bed electrophoretic chambre, Multiphor G.E
Helthcare (repsale Sweden) in a polyacrylamide gel 4% hydrated in a solution containing urea 4M, 2% to
5% thiourea and 125ml of ampholytes. Isoelectric point (pI) standards from 4,25 to 9,6 are used as
references. The migration is conducted at a voltage of 53V and at a current intensity of 4 mA for 4 hours at
18 ° C (Bouakkadia et al,β015).
3. RESULTS AND DISCUSSION
Figure 1, shows the total protein levels of the delipidated flours of the legumes studied. The total protein
contents of soybean, peanut, sesame and lentil flours are respectively 45.50%, 25.37%, 20.65% and 23.86%.
These results are comparable to those obtained by (Souci, 1994, Johnson et al., 1979, Urbano et al., 2007,
Joshi et al., 2011). They go down from the richest soybean to peanut and sesame, and then to the lentil.
The analysis of the electrophoretic diagrams of the total proteins of delipidated flours obtained by onedimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of the 1/10 and 1/30
diluted protein extracts revealed distinct fractions for peanut, soy and sesame (Figure 2).
POSTER PRESENTATION
350
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
50
45
40
35
30
25
Seri 1
20
15
10
5
0
Peanut
Soybean
Sesame
Lentil
Figure 2 : Total protein levels of Peanut, Soybean, Sesame and Lentil flours
Figure 3 : Electrophoretic Diagrams of protein extracts diluted 1/10 and 1/30, with proteins markers, stained
by comassie blue R-250
1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers.
Compared to the lentil protein extract, band detection required 1/270 dilution and staining with silver nitrate
solution (Figure 3). The molecular weights of the highlighted peanut, soybean, sesame and lentil protein
macromolecules are successively located between 14 and 67 kDa, 14 and 50 kDa, 14 and 76 kDa and 14 and
43 kDa respectively.
POSTER PRESENTATION
351
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 4. Electrophoretic Diagrams of protein extracts diluted 1/270 with proteins markers, stained by silver
nitrate
1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers.
The analysis of the water-soluble protein diagrams of the delipidated flours of these products, for the protein
extracts diluted 1/10 , strips for sesame, soybean and peanut are detected of 14 at 30. kDa, 14 at 67 kDa and
14 at 67 kDa respectively. The fractions are well resolved. They are of different intensities compared to the
results obtained with the sample concerning the water-soluble proteins undiluted. Regarding the lens,
according to the profile made with the undiluted protein extract, it is localized 3 electrophoretic bands of Mr
ranging from 14 kDa to 30 kDa (Figure 4).
Figure 5. Electrophoretic Diagrams of water-soluble protein extracts not diluted and diluted 1/10, with
proteins markers, stained by comassie bleu R-250
1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers.
POSTER PRESENTATION
352
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3 According to the isoelectric focusing diagrams (Figure 5) the extracts of the water-soluble proteins
diluted 1/10 revealed with a silver nitrate solution, distinct fractions of pHi located between 4.25 and 6.5 in
the soybean lentil and peanut are visualized. Protein macromolecules with pHi between 4.25 and 9.6 are
found in sesame. The exploration of the water-soluble fraction by sodium dodecyl sulfate polyacrylamide gel
electrophoresis and isoelectric focusing under native conditions revealed a number of protein fractions of
varying intensity, Mr and pI. the seed proteins of these legumes have low molecular weight. As for pI, for
peanut, soybean and lentil, they are acidic. For sesame they varied from acidic to basic.
Figure 6. isoelectric focusing diagrams of water-soluble protein extracts with pI markers, stained by silver
nitrate
1: soybean; 2: lentil; 3: peanut; 4: sesame; Mr: molecular weight markers.
4
Conclusion:
Legumes (Fabaceae family) such as peanut, soybean, sesame and lentil are consumed worldwide and
constitute a substantial part of the protein intake. The total protein levels of peanut, soy, Sesame and lentil
are 45.50%, 25.37%, 20.65% and 23.86% respectively. The water-soluble protein entities detected by
electrophoresis (1-D) and IEF are characterized by low relative molecular weights ranging from 14-94 kDa.
The pI of the determined proteins differs from one food to another. For soy, peanut and lentil, they are acidic
from 4.25 to 6.5. For sesame they vary from acid to basic (4.25 to 9.6).
Acknowledgement
Authors express sincere thanks to Pascal Poncet and Hélène Sénéchal (Institut Pasteur, Paris, France,
Laboratoire de Biochimie, Equipe de Recherche “Allergie & Environnement”, Hôpital Armand Trousseau,
Paris, France) for the assistance in electrophoresis analysis.
REFERENCES
Agne PSE, Rancé F, Bidat, E β00γ. Allergie au sésame. Revue française d’allergologie et
d’immunologie clinique, 4γ : 507–516.
Baba Aissa F 2000. Encyclopédie des plante utilesμ Flore d’Algérie et du Maghreb, substances
végétales d’Afrique d’Orient et d’Occident. Ed. Librairie Moderne Rouiba, Edas.Alger, 368 pp.
POSTER PRESENTATION
353
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Bouakkadia H, Boutebba A, Haddad I, Vinh J, Guilloux l, Sutra JP, Sénéchal H,Poncet P β015. Analyse
immunoprotéomique des allergènes non-hydrosolubles de farines de quatre légumineuses μ arachide, soja,
sésame et lentille. Ann Biol Clin β015 ν 7γ (6) μ 6λ0-704
Cucu T, De Meulenaer B, Devreese B 2012. MALDI based identification of soybean protein markers –
Possible analytical targets for allergen detection in processed foods.Peptides; 33 :187–196.
Dubuisson C, La Vieille, S,Martin A 2002 .Allergies alimentaires :Etat des lieux et propositions
d’orientations. Nutrition humaine. Paris (FR) : AFSSA, 104 pp.
Guéant JL, Moutété F, Olszewski A, Pons L, Gastin I, Moneret-Vautrin DA 1995. Allergie à l'arachide et à
l'huile d'arachide. Rev. ft. Allergol ; 35 : 312-319.
Guerin B, Guerin L 1995.L'arachide.L'une des principales sources d'allergénes alimentaires. Rev. fr.
Allergol ; 35 : 39-43.
Fremont S, Zitouni N, Kanny G, Veneri V, Metche M, Moneret-Vautrin DA, Nicolas JP 2002. Allergenicity
of some isoforms of white sesame proteins. Clin.Exper.Allergy. 32:1211-1215.
Joshi M, Adhikari B, Aldred P, Panozzo JF, Kasapis S, Barrow CJ 2012. Interfacial and emulsifying
properties of lentil protein isolate. Food Chemistry;134:1343–1353.
Joshi M, Adhikari B, Aldred P, Panozzo JF, Kasapis S 2011.Physicochemical and functional properties of
lentil protein isolates prepared by different drying methods. Food Chemistry;129:1513–1522.
Johansson SG, Bennich H 1967.Immunological studies of an atypical (myeloma) immunoglobulin.
Immunology.13:381-394.
Johnson LA, Suleiman TM, Lusas EW 1979. Sesame protein: a review and prospectus. Journal of
the American Oil Chemists Society ; 56 :463–468.
Patricia F 2008 .Influence de procédés industriels sur l'allergénicitédes aliments. Thèse de doctoratμ Biologie
cellulaire et Nutrition. Nancyμ Université Henti Poincaré-Nancy I,157 pp.
Orruño E, Morgan MR 2007. Purification and characterisation of the 7S globulin storage protein from
sesame (Sesamum indicumL). Food Chemistry; 100: 926–934.
Osborne TB, Campbell GF 1898. Proteins of lentils. Journal of the American Chemical Society. 20- 362.
Rivas NR, Dench JE, Caygill JC 1981. Nitrogen extractability of sesame (Sesamum indicumL.) seed and the
preparation of two protein isolates. Journal of the Science of Food and Agricultur. 32:565–571.
Souci S W 1994. Food composition and nutrition table. Medpharm Scientific publications Ref Type: Journal
(Full).
Swason BG 1990. Pea and lentil protein extraction and functionality. Journal. American.Oil
Chemists.Society; 67:276-280.
Urbano G, Porres JM, Frias J, Vidal-Valverde C 2007. Lentil: An ancient crop for modern times. Nutritional
value. In S. S. Yadav, D. L. McNeil, & P. C. Stevenson (Eds.).47–93.
Wolff N, Cogan U, Admon A, Dalal I, Katz Y, Hodos N, and al 2003. Allergy to sesame in humans is
associated primarily with IgE antibody to a 14 kDa 2S albumin precursor. Food and Chemical
Toxicology. 41: 1165–1174.
POSTER PRESENTATION
354
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Surface Properties of Perlite and Perlite/ Polystyrene Composite by Inverse Gas
Chromatography
Ceyda Bilgiç1, Özge Kanık2, Naile Karakehya3
Eskişehir Osmangazi University, Engineering and Architecture Faculty, Department of Chemical
Engineering, , β6480 Eskişehir, Turkey
3
Eskişehir Osmangazi University, Environmental Control and Protection Programme, Eskişehir
Vocational School, β6480 Eskişehir,Turkey
Corresponding author e-mail: ozgedgnknk@gmail.com, ceydabilgic@gmail.com
1,2
Abstract
Polystyrene (PS) is a commercialized and mass productive polymer and PS/clay nanocomposites may
have wide applications. Polystyrene (PS) /Perlite composite was prepared using the solution blending
method with the application of ultrasound and using chloroform as solvent. Ultrasonic waves were used
to enhance the nanoscale dispersion of the perlite. Polymer nanocomposite of a PS matrix containing
2% perlite (P) by mass was investigated using inverse gas chromatography (IGC). IGC was applied to
characterize the surface of P/PS composite. The dispersive component of the surface energy ( Sd ), and
the acid/base character of composite surface were estimated by using the retention time of different
non-polar and polar probes at infinite dilution region. The specific free energy of adsorption ( G sp ), the
specific enthalpy of adsorption ( H sp ), and the specific entropy of adsorption ( S sp ) of polar probes
on PS/P were determined. G sp were correlated with the donor and acceptor numbers of the probes to
quantify the acidic K A and the basic KD parameters of the P/PS surface. The values obtained for the
parameters KA and KD indicated a basic character for perlite surface and the values obtained for the
parameters KA and KD indicated a basic character for P/PS surface.
Keywords: Polystyrene (PS); perlite; nanocomposites; inverse gas chromatography
1. INTRODUCTION
Perlite is a glassy volcanic rock, commonly light gray, with a rhyolitic composition and 2 to 5%
combined water. Chemically, perlite ore consists of SiO 2, Al2O3, and lesser amounts of several metal oxides
(sodium, potassium, iron, calcium, and magnesium). It contains 70-75% SiO2 which chemically inert in
many environments and hence are excellent filter aids and fillers in various processes and materials. Perlite is
basically the mineral obsidian. Perlite mineral deposits exist in many countries of the world, but the
expanded product is only available in countries which have commercial expanding plants. The production of
perlite around the world is that in descending order of production, Turkey, Greece, and The United States,
41%, 26%, %18, respectively. When looked around the world, the reserve of perlite is more in Turkey. The
amount of perlite reserve is considerably higher than the world; show us that it can contribute substantially to
the economy of Turkey. World perlite reserves are estimated to be around 8 billion tons and 5.7 billion tons
of it exist in Turkey corresponding to more than about 70% of the world reserves (Saad et al., 2010, Bolen,
2011).
Polystyrene (PS) is one the most widely used plastics due to its superior thermal and electrical properties,
low moisture absorption, being easy to produce, formability, and high stiffness and roughness. PS is
preferred in many fields, such as the automotive industry, electronics, food packaging, domestic appliances,
and toys due to its low cost (Fu et al., 2008) In recent years, clay/PS nanocomposites have received much
attention in both academia and in industry (Akbari and Tehrani, 2014). Zhong et al., 2005 synthesized
exfoliated organo-montmorillonite (OMt)/PS nanocomposites via in situ free radical bulk polymerization and
found that OMt/PS nanocomposites exhibit a higher decomposition temperature, higher dynamic modulus,
stronger shear-thinning behavior, and a smaller die swell ratio compared with pure PS. Remili et al., 2011
studied the effect of repeated extrusion cycles on the structure and properties of Cloisite 15A (commercial
OMt modified by dimethyl dihydrogenated tallow)/PS nanocomposite. Fu et al., 2008 synthesized layered
silicate/PS nanocomposites from three new organically modified clays using the emulsion polymerization
method. Morgan and Harris, 2004 investigated solvent blending, which is facilitated by high-power
POSTER PRESENTATION
355
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
sonication to prepare an exfoliated clay/PS nanocomposite. They reported that the clay type and energy of
mixing play a key role in clay exfoliation when using solvent blending. Yang et al., 2014 and Zhao and
Samulski, 2006 used supercritical carbon dioxide to improve clay dispersion in OMt/PS nanocomposites.
Zhang et al., 2003 investigated the effects of reactive intercalating agents with different lengths of alkyl
chains on the morphology and properties of clay/PS nanocomposites obtained by in situ bulk polymerization
initiated via γ-ray irradiation. Noh and Lee, 1999 reported X-ray diffraction (XRD) pattern, infrared spectra,
and differential scanning calorimetry, and thermogravimetric analysis thermograms, and mechanical
properties of Na+-Mt/PS nanocomposites prepared by emulsion polymerization.
To understand the characteristics and composition of the solid surface, the surface characterization tools are
required. Many techniques such as, X-ray photoelectron spectroscopy (XPS), zeta potential measurements,
microcalorimetry, titration, contact angle and inverse gas chromatography (IGC) have been used to obtain
detailed information on solid surfaces. IGC has frequently been applied for surface characterization of solids,
in particular, for their thermodynamic behavior, surface energy and their Lewis acidic–basic character.
Knowledge of the surface free energy at a given temperature and surface enthalpy of a solid has recently
allowed significant progress in the fields of adsorption, wettability, catalysis, friction, and adhesion. The
surface energy can be obtained by, liquid adsorption measurements, flow microcalorimetry or contact angle
measurements, but these methods are not easily and widely applicable and are difficult to use for finely
powder solids. IGC method is based on the study of physical adsorption of appropriate molecular probes by
means of chromatographic (dynamic) experiments. In contrast to static methods, dynamic systems utilize a
flowing gas system. The most common flow methods are IGC, gravimetric instruments, and permeability
measurement systems. The principle of dynamic gravimetric systems is the measurement of the amount of
solute adsorbed from a flowing gas stream using a microbalance. In comparison to static sorption equipment,
the main benefits of the dynamic sorption technique are shorter measurement time and a wider range of
experimental possibilities. Compared to other techniques (static measurements), IGC has attracted a lot of
attention because of its simplicity and the rich information provided (Mohammadi-Jam and Waters, 2014).
In the present work, polymer nanocomposites of a Polystyrene (PS) matrix containing 2% perlite (P) by mass
were prepared using the solution blending method with sonication. Composites prepared via solvent solution
blending method, by mixing PS and perlite in chloroform. Inverse gas chromatography (IGC) method at
infinite dilution is applied for dispersive component of the surface free energy ( Sd ) and the acid/base
character of perlite and PS nanocomposites containing 2 wt. % P. The specific free energy of adsorption (
G sp ), the specific enthalpy of adsorption ( H sp ), and the specific entropy of adsorption ( S sp ) of polar
probes on composite were determined. G sp were correlated with the donor and modified acceptor numbers
of the probes to quantify the acidic K A and the basic KD parameters of the composite surface. The values
obtained for the parameters K A and KD indicated a basic character for perlite surface. The values obtained for
the parameters K A and KD indicated a basic character for P/PS surface.
2. MATERIALS AND METHODS
2.1. Materials
PS with a low molecular weight was provided by Sigma-Aldrich (MW=280,000 by GPC). The perlite
sample were obtained from Cumaovası Processing Plants Perlite of Etibank (İzmir, Turkey).
Because it was received as it was taken out of the ground, without having been processed, it
contained many impurities. In order to purify it and also increase its content, a decantation process
was applied. Following this process, the perlite had been dried in an oven at 90 oC and it was
ground. For the IGC analysis, the polar probes used were heptane, octane, nonane and decane. The polar
probes used were tetrahydrofuran (THF), acetone (AC), diethyleter (DEE), trichloromethane (TCM), and
ethyl acetate (Et.Ac.). All of these chemicals were analytical reagent grade and used without further
purification. Properties were taken from literature of the probes (Cordeiro et al., 2011). These probes are
commonly used for solid surface characterizations by IGC method.
The chromatographic experiments were performed with Agilent 7890 gas chromatography equipped
with a flame ionization detector (FID). Nitrogen with high purity was used as the carrier gas with a
flow rate of 40 ml min-1. IGC measurements were carried out in the temperature range of 60–λ0 °C
for perlite and in the temperature range of 40–70 °C for P/ PS. About γ g of sample particles of 150-
POSTER PRESENTATION
356
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
β00 µm was filled into the stainless steel column (2.00 m long, 5.35 mm I.D.) via the aid of
vacuum. Stainless steel column washed with methanol and acetone before packing with powders.
The adsorbents were conditioned at the highest temperatures in the nitrogen gas flow for 4 h before
the measurements. Methane is used for determining the dead volume. At least four determinations
were used in averaging the net retention volume (VN).
2.2. Preparation of composite
PS/P composite were prepared by the solution blending method. The perlite was dissolved in chloroform and
the solution was magnetically stirred until all the perlite appeared to be completely dispersed at 50 °C. After
stirring, the mixture was placed in an ultrasonic bath for sonication at room temperature, for 1 h. PS was
dissolved in chloroform at room temperature. Perlite solution was added slowly to PS solution and then it
was stirred until the solution became homogeneous. PS/P mixture was placed in an ultrasonic bath, for 20
min. After sonication it was poured in glass moulds and chloroform was then evaporated which was
performed by two consecutive stepsμ air drying for 1β h, and in an oven at 60 °C, for γ h. Finally, samples
were cryo-milled using a Retsch cryogenic jar mill. The samples were labelled to describe the amount of P
and PS2 mean, perlite and PS contained 2 wt.% of perlite, respectively.
2.3 IGC theory
Inverse gas chromatography (IGC) is a derivation of conventional gas chromatography. However, unlike
analytical chromatography, the material being investigated is the solid in the gas chromatography column.
The retention volume of the mobile phase (probe) indicates the interaction between the probe and the surface
of the material in the column (Cordeiro et al., 2011; Santos et al., 2002; Matsushita et al., 2006). IGC
provides an excellent method to measure the surface energy of rough and porous powders (Hole et al., 2006).
The surface energy is the result of the unbalanced molecular forces at the surface of the solid. It can be
considered to be formed by two different contributions: dispersive and specific. The retention time of a series
of homologous n-alkanes is used to determine the dispersive component of the surface free energy ( γ dS ) of P
/PS. In IGC literature, γ dS is commonly determined from the following equation, which was introduced by
Lavielle and Schultz, 1991:
RTLnVN 2 N .( Sd )1/ 2 .a.( Ld )1/ 2 C
(2.1)
Here, R is the gas constant, T is the absolute column temperature, a is the molecular surface area coated with
a kind of adsorbed alkane, N is the Avogadro’s number, Ld is the dispersive component of the surface free
energy of the probe, C is a constant, and VN is the net retention volume of the n-alkane probe. The net
retention volume (VN) is calculated using the equation below (Thielmann, 2004):
2
T 3 Pi Po -1
(2.2)
VN =Fo
t A -t 0
To 2 Pi Po 3 -1
Here, tA is the retention time of the probe, while t0 is the retention time of the probe which has no interaction
with the solid in the column (marker). Pi and Po are, respectively, the inlet and outlet pressures of the carrier
gas, while the T/To ratio is used in order to get the value of the flow rate at the column temperature (T) from
the measurement of the flow rate at ambient temperature (To). The flow rate of the carrier gas which is
measured at the column outlet and at ambient temperature is expressed as Fo. According to the following
equation, specific components of the adsorption enthalpy ( H sp ) and entropy ( S sp ) can be determined
from G sp 's relationship with the temperature:
G sp H sp
S sp
T
T
(2.3)
A plot of G sp / T versus 1/T should yield a straight line with slope H sp and intercept S sp . The acidic–
basic parameters can be obtained from the calculated H sp values using the following equation ( Lazarevic
et al., 2009) The values of KA and KD were calculated using Equation (2.4):
POSTER PRESENTATION
357
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
H sp
DN
KA
KD
AN
AN
(2.4)
Here, ΔHsp is the specific component of the adsorption enthalpy and the KA and KD parameters define acid
and base constants of the analyzed surface, respectively, AN* shows the acceptor number of the adsorbed
probe while DN shows the donor number. The KA and KD values can be calculated with the aid of probes
which have acidic, basic, and amphoteric properties. According to the above equation, representing the
(ΔHsp/AN*) versus (DN/AN*), one gets KA as the slope and KD as the intercept. Finally, KD/KA is known as
SC. According to the values obtained from these parameters, it is accepted that SC ≤ 0.λ means the surface is
acidic, SC ≥ 1.1 means basic, and if it is between 0.9 and 1.1, the surface is amphoteric (Cava et al., 2007).
3. RESULTS and DISCUSSION
IGC experiments can be conducted under two chromatographic conditions: infinite dilution and finite
concentration. Infinite dilution, also called zero surface coverage, was found to be suitable for evaluating the
surface energy and heat of sorption of particulates. Infinite dilution refers to very low concentrations of
probe and is obtained by introducing a very small quantity of the probe molecule into the system. Since the
amount of probe molecule or adsorbate is limited, it is assumed that interactions occur only with the highenergy sites on the surface and therefore interactions with the lower energy sites are negligible. This mode
has the benefit of high sensitivity, which makes it an excellent method for determining thermodynamic
parameters and most of the IGC experiments are carried out under this condition. In ideal conditions, no
probe-probe interactions are considered and Henry’s Law is obeyed. Hence, a linear adsorption isotherm and
a symmetrical (Gaussian) chromatographic peak are expected (Thielmann, 2004). A chromatographic
diagram of symmetrical peaks for interaction of alkanes with the stationary phase is generated. The measured
parameter in this method is net retention time and it has been successfully used to determine the dispersive
components of surface free energy, acid-base properties of surfaces. The basic value in IGC is the net
retention volume. The net retention volume is the volume of carrier gas required to elute a given probe. The
net retention volume (VN) is calculated using the following equation:
The adsorption runs were performed at infinite dilution conditions. The chromatographic peaks of n-alkanes
on P/PS were symmetrical. So retention time is independent of the amount of injected. The value of γ dS
represents the interaction of the surface with n-alkanes and hence is a measure of how easily the surface can
d
polarize the probe. The dispersive component of the surface free energy, S , was determined by injection of
a homologous series of n-alkanes having between 7 and 10 carbon atoms. One of the most commonly
measured parameters for the description of the energy situation on the surface of a solid is the surface
energy. The surface energy can affect, e.g. catalytic activity or the strength of particle-particle interaction.
The dispersive components of perlite and P/PS at experimental temperatures were calculated from Eq. (2.1).
Plotting RTlnVN against a. Ld
1/ 2
yields a straight line with the slope of γ S , which can be seen for perlite
d
and P/PS in Figure 1 and Figure 2. Table 1 shows the dispersive component of the surface free energy, γ dS ,
of perlite and 2% P/PS. The γ dS values of PS0 ranged from 40 mJ m−2 at 40 °C to 35.3 mJ m−2 at 70 °C.
A comprehensive insight into the Lewis acid-base surface interactions provides a better understanding of the
influence of the catalytic and sorption capabilities of P/PS, as well as their ability to change via chemical
modifications, which is of great importance for their applications. The application of the Schultz’s method to
sp
our experimental results, gave us the value of G sp , H and S sp . The variation of free energy of
specific interactions, G sp , perlite and polar probes for different temperatures is given Table 2. The
variation of free energy of specific interactions, G sp , P/PS and polar probes for different temperatures is
sp
given Table 3. The average G values of polar probes on P/PS in the following order: Acetone < Et.
Ac< THF< TCM < DEE.
The values of K A and K D were calculated using Eq. (2.4). Representing H sp / AN versus DN / AN ,
one gets K A as the slope and K D as the intercept (Fig. 3 and Fig. 4). The values of K A and K D for P/PS
found to be 0.049 and 0.528 with the correlation coefficient of 0.8803. The overall acid-base character of
POSTER PRESENTATION
358
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
perlite can be evaluated from K D / K A ratio. According to the values obtained for of K A and K D , the
surface of exhibits basic character with the ratio of K D / K A = 10.78 . From the values obtained for KA and
KD (Table 4), the surfaces of perlite, PS0 and PS2 are shown to be a basic character (KD > KA).
Table 1. Values of dispersive component of the surface energy measured on Perlite, PS and 2%P/PS PS5 at
various temperatures
d
Dispersive component of the surface free energy, γ S (mJ/m2)
Sampl
e
a
40 ºC
50 ºC
60 ºC
70 ºC
Perlite
40_ºC
_
34.21
30.89
PS0a
33.71
30.78
27.78
25.09
PS2
40
37.75
40.13
35.29
Bilgiç and Karakehya, β016
10
RTlnVN
8
6
y = 0,069x - 15,91 R² = 0,λλλ
y = 0,066x - 15,91 R² = 0,λλλ
(a)
y = 0,063x - 15,72 R² = 0,λλ8
y = 0,060x - 15,59 R² = 0,λλ7
70 ºC
60 ºC
50 ºC
40 ºC
4
2
0
170
220
RTlnVN
Figure 1. The RT ln(VN ) – a. Ld
16
14
12
10
8
6
4
2
0
a(
1/ 2
270
320
370
d 0.5
2
0.5 -1
L ) (Å mJ m )
graphs for Perlite
(a)
y = 0,069x - 15,91 R² = 0,λλλ
y = 0,063x - 15,72 R² = 0,λλ8
y = 0,066x - 15,91 R² = 0,λλλ
y = 0,060x - 15,59 R² = 0,λλ7
70 ºC
60 ºC
50 ºC
40 ºC
170
220
Figure 2. The RT ln(VN ) – a. L
d 1/ 2
POSTER PRESENTATION
a(
270
320
370
d 0.5
2
0.5 -1
L ) (Å mJ m )
graphs for 2% P/PS
359
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Table 2. The variation of ΔGsp with temperature, and ΔHsp and ΔSsp values of polar probes on Perlite
-Gsp (kJ mol-1)
-H sp
-Ssp103
Adsorbent Polar probes
60 oC
70 oC
80 oC
90 oC
(kJ mol-1)
(kJ mol-1K-1)
Perlite
TCM
0.58
0.52
0.47
0.40
2.58
5.99
DEE
10.50
10.50
10.43
10.38
12.01
4.48
Acetone
12.46
12.53
12.57
12.52
11.64
2.52
THF
11.18
11.18
11.18
11.14
11.51
0.99
Et. Ac
11.04
11.00
11.06
10.97
11.54
1.49
Table 3. The variation of ΔGsp with temperature, and ΔHsp and ΔSsp values of polar probes on P /PS
-Gsp (kJ mol-1)
-H sp
-Ssp103
Adsorbent Polar probes
40 oC
50 oC
60 oC
70 oC
(kJ mol-1)
(kJ mol-1K-1)
PS-2%
TCM
10.69
10.81
11.43
11.28
3.13
24.16
DEE
8.25
8.19
8.66
8.09
8.16
0.44
Acetone
14.44
14.34
15.08
14.39
12.34
6.78
THF
11.52
11.37
12.13
11.96
4.98
4.98
Et. Ac
12.57
12.24
13.16
12.18
13.1
1.70
6,0
y = 0,1327x + 0,2108
R² = 0,λλ85
DHsp/AN*
5,0
4,0
3,0
2,0
1,0
0,0
0
10
20
30
40
50
DN/AN*
Figure 3. Plots of ΔHsp/AN*versus (DN/AN *) for Perlite
POSTER PRESENTATION
360
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
6,0
DHsp/AN*
5,0
4,0
3,0
y = 0,049x + 0,5283
R² = 0,880γ
2,0
1,0
0,0
0
10
20
30
40
50
DN/AN*
Figure 4. Plots of ΔHsp/AN*versus (DN/AN *) for P/PS
Table 4. Acid and base interaction constants of the Perlite, PS and P/PS
Sample
KA
KD
SC=KD/KA
Perlite
0.133
0.175
1.318
PS0a
0.131
0.528
4.025
PS2
0.049
0.528
10.775
a
Bilgiç and Karakehya, β016
5. CONCLUSION
IGC as an independent field of study has certainly proven beneficial to many industries. Despite a long
history and several hundred publications in the last 50 years, it is still evolving and considered a modern
technique that is quite attractive to chemical engineers, analytical chemists and material scientists in various
fields. Results of a large quantity of research experiments on a wide range of materials have evidenced that
IGC is successfully applied to characterizing different surface and bulk properties of solids in different
shapes and morphologies. One of the greatest advantages of this method is that no special sample preparation
is required. In fact, IGC requires the minimum sample preparation when compared to other surface energy
analysing techniques. Therefore, various forms of solids and even semi-solids can be characterized quickly
and efficiently.
The composite’s surface usually has different chemical and physical properties from both matrix and filler,
probably due to changing surface roughness and chemical heterogeneity. It is important to understand the
perlite-filled polymer surfaces to control adhesion, wettability, and printability properties of these
composites. In this study, perlite/PS nanocomposites were prepared by solution blending method using
chloroform as solvent. Solution blending is widely used in nanocomposite preparation. It is a simple way to
obtain for polymer composites if both the polymer and the nanoparticles are dissolved or dispersed in
solution. In solution blending method, it is easy to control the concentrations of the polymer and inorganic
components and ultrasonication is applied to further improve the exfoliation of the perlite. It is important to
understand the perlite-filled polymer surfaces to control adhesion, wettability, and printability properties of
these composites. IGC is a very sensitive and reliable technique for distinguishing nanocomposite surfaces.
IGC at infinite dilution was used to find how perlite and perlite/PS would change the dispersive component
POSTER PRESENTATION
361
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
of the surface free energy and surface acidity (KA) and basicity (KD) of the composite. The experimental
results indicate that γ S values of studied materials gradually decreased with increasing column temperature
which is consistent with the fundamental concept of Gibbs free energy. The overall acid-base character of
perlite and P/PS can be evaluated from K D / K A ratio. According to the values obtained for of K A and K D ,
the surface of exhibits basic character.
d
ACKNOWLEDGEMENTS
This study is the part of a project (2017-1426) supported by the Research Fund of Eskişehir Osmangazi
University.
REFERENCES
Akbari A, Tehrani MA, 2014, Cherghibidsorkhi H Polysterene layered silicate nanocomposites. In:
Pandey JK, Reddy KR, Mohanty AK, et al., editors. Handbook of polymernanocomposites. Processing,
performance and application. Berlin Heidelberg: Springer; p. 205–221.
Bilgic C, Karakehya N, 2016, Inverse gas chromatographic characterization of polystyrene and
organo-montmorillonite/polystyrene nanocomposites, Journal of Adhesion Science and Technology, 30: 18,
1945-1956.
Bolen P W, 2011. USGS Mineral Commodity Summaries 2011, U.S. Department of the Interior, U.S.
Geological Survey, Reston, Virginia-USA.
Cava D, Gavara R, Lagaron JM, 2007, Surface characterization of poly(lactic acid) and
polycaprolactone by inverse gas chromatography. Journal of Chromatography A., 1148:86–91.
Cordeiro N, Gouveia C, John MJ, 2011, Investigation of Surface Properties of Physico-Chemically
Modified Natural Fibres Using Inverse Gas Chromatography, Industrial Crops and Products, 33, 108-115.
Fu X, Ding M, Tang C, 2008, Toughening of recycled polystyrene used for TV backset. Journal of
Applied Polymer Science, 109:3725–3732.
Fu H-K, Huang C-F, Huang J-M, 2008, Studies on thermal properties of PS nanocomposites for the
effect of intercalated agent with side groups. Polymer. 49:1305–1311.
Hole BB, Keller DS, Burry WM, 2011, Surface energetics of bone mineral and synthetic
hydroxyapatite using inverse gas chromatography. J. Chromatogr. B., 2011, 879:1847–1850.
Kim KY, Lim HY, Park SM, Lee SJ, 2003, Synthesis and characterization of high impact
polystyrene/organically modified layered silicate nanocomposites, Polymer-Korea, 27:377.
Lavielle L, Schultz J, 1991, Surface properties of carbon fibers determined by inverse gas
chromatography: role of pretreatment. Langmuir, 7:978–981.
Lazarevic S, Radovanovic Z, Veljovic Dj, Onjia A, Janackovic Dj, Petrovic R, 2009, Characterization
of sepiolite by inverse gas chromatography at infinite and finite surface coverage. Applied Clay Science, 43,
41–48.
Matsushita Y, Wada S, Fukushima K, 2006, Surface characteristics of phenol–formaldehyde–lignin
resin determined by contact angle measurement and inverse gas chromatography. Ind. Crop. Prod., 23:115–
121.
Mohammadi-Jam S, Waters KE, 2014. Inverse gas chromatography applications: a review, Advanced
Colloid Interface, 212, 21–44.
Morgan AB, Harris JD., 2004, Exfoliated polystyrene–clay nanocomposites synthesized by solvent
blending with sonication. Polymer. 45:8695–8703.
Noh MW, Lee DC, 1999, Synthesis and characterization of PS-clay nanocomposite by emulsion
polymerization, Polymer Bulletin, Polym Bull (Berlin), 42:619–626.
Price GJ, Ansari DM, 2003, An inverse gas chromatography study of calcination and surface
modification of kaolinite clays. Phys. Chem. Chem. Phys., 5:5552–5557.
Remili C, Kaci M, Benhamida A, 2011. The effects of reprocessing cycles on the structure and
properties of polystyrene/Cloisite15A nanocomposites. Polymer Degradation and Stability. 96:1489–1496.
Saad Z, Al-Mashaikie AK, Al-Hawbanie AM. 2010. Petrography and geochemical study of the perlite
rocks from Bait Al-Qeyarie, Kawlan Area, Yemen. JAKU: Earth Sci 21:195–217.
POSTER PRESENTATION
362
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Santos, JMRCA, Fagelman K, Guthrie JT, 2002, Characterization of the surface Lewis acid–base
properties of poly(butyleneterephthalate) by inverse gas chromatography. Journal of Chromatography A.,
969(1-2), 111-118.
Sohn, JI, Lee CH, Lim ST, Kim TH, Choi HJ, John MS, 2003, Viscoelasticity and Relaxation
Characteristics Of Polystyrene/Clay Nanocomposite, Journal Of Materıals Science, J Mater Sci, γ8, 184λ1852.
Thielmann F, 2004, Introduction into the characterisation of porous materials by inverse gas
chromatography. Journal of Chromatography A., 1037:115–123.
Yang F, Manitiu M, Kriegel R, 2014, Structure, permeability, and rheology of supercritical CO 2
dispersed polystyrene–clay nanocomposites. Polymer. 55:3915–3924.
Zhang WA, Chen DZ, Xu HY, 2003. Influence of four different types of organophilic clay on the
morphology and thermal properties of polystyrene/clay nanocomposites prepared by using the γ-ray
irradiation technique. European Polymer Journal. 39:2323–2328.
Zhao Q, Samulski ET.,2006, A comparative study of poly(methyl methacrylate) and polystyrene/clay
nanocomposites prepared in supercritical carbon dioxide. Polymer. 47:663–671.
Zhu J, Morgan AB, Lamelas FJ, Wilkie CA, 2001, Fire properties of polystyrene− clay
nanocomposites, Chemistry of Materials, 13, 3774-3780.
Zhong Y, Zhu Z, Wang S-Q., 2005, Synthesis and rheological properties of polystyrene/layered
silicate nanocomposite. Polymer. 46:3006–3013.
POSTER PRESENTATION
363
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Production and Characterization of Functionalized Carbon Nanotube-Loaded Polyvinyl
Alcohol Membranes for Desalination
Beyzanur Yılman1*, Filiz Uğur Nigiz1, Ayşe Aytaç1,2, Nilüfer Durmaz Hilmioğlu1
*1
2
Kocaeli University, Faculty of Engineering, Chemical Engineering, Kocaeli, Turkey
Polymer Science and Technology Programme, Kocaeli University, Kocaeli, Turkey
beyzayilman@gmail.com
Abstract
In this study, functionalized multi-walled carbon nanotube (F-CNT) loaded polyvinyl alcohol (PVA)
membranes were synthesized and applied for desalination by means of pervaporation technique.
Membranes were characterized using thermo-gravimetric analysis (TGA), fourier transform infrared
spectroscopy (FTIR) and differential scanning calorimetry (DSC). Sorption studies were carried out to
determine the degree of swelling of the F-CNT/PVA membranes into different types of salt solution.
Pervaporation experiments were carried using the F-CNT membranes. Effect of F-CNT concentration
and salt concentration on flux and salt rejection were investigated at the constant temperature of 40 °C.
As a result, greater than 99.5% rejections were obtained using all membrane. The incorporation of FCNT into PVA matrix, improved the flux with a percentage of 40% at low salt concentration.
Keywords: Desalination, Carbon Nanotubes, Pervaporation
1. INTRODUCTION
Water is a necessity for people to survive and in most parts of the world, people are facing with the water
scarcity. In the last century, the use of water increased almost two times. It is estimated two billion people in
48 countries will have to overcome water scarcity in 2050 (Goh et al., 2013). More than 96.5% of the earth's
water is on the surface; however, only 2.5 % of the total water is drinkable without deep purification
(Kaminski et al., 2018). To convert the saline water into potable water, salt and minerals must be removed.
Various desalination systems have been developed to produce drinking water from the saline water. In the
last 20 years, significant developments have been made in order to obtain more attractive and affordable
water supply using the membrane technology. Thus, the numbers of membrane desalination plants have
gained momentum in recent years. It has been reported that the number and the size of desalination plants
have increased by 5-6% in the year since 2010 (Voutchkov et al.,2018).
Basically, there are two main categories of desalination methods; thermal methods and membrane
technologies. The common membrane based desalination technique is reverse osmosis (RO) and it
constitutes of 60% of total desalination capacity (Irena, 2013). Reverse osmosis technology based on the
pressurized water purification by using a semi-permeable membrane. Thermal separation techniques such as
multi effect distillation (MED) and multi-stage flash (MSF) distillation depend on the heating and
condensing of the seawater by the heat energy (Nigiz et al., 2017). It is reported that the thermal desalination
techniques consume high energy compared to the RO (Zhou et al., 2016).
Contrary to thermal techniques, membrane based techniques offer many advantages. It is preferred over
traditional distillation techniques due to its high efficiency and potential energy saving separation route
(Wang et al., 2016). However, there are some disadvantages such as membrane fouling and low yield in high
salinity water (Chaudhri et al., 2018). Pervaporation is another membrane technology that attracts attention
as a potential desalination method. In this system, water is preferably pass through a selective membrane.
During the transition, water evaporates and then liquefied in the nitrogen traps. The driving force in the
pervaporation is provided by the formation of a concentration gradient between the two sides of the
membrane. Because of the permeate is removed by the vacuum or air sweep, high pressure is not required.
POSTER PRESENTATION
364
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Pervaporation has been found to be quite promising technique for desalination. Recently, many of
pervaporative desalination studies have been made by Researchers. Chaudhri et al. (2015) used an ultra-thin
polyvinyl alcohol membrane supported on polysulfone hollow fiber membrane and obtained a rejection of
99.9%. Li et al. (2017) prepared a graphene oxide incorporated PVA/PVDF membrane and obtained 99.99%
of rejection. Xie. et al. (2011) obtained 99.5% of rejection with a hybrid PVA/maleic acid/silica membrane.
Although many polymers and nanomaterials such as graphene oxide have been used in the desalination with
pervaporation, carbon nanotubes (CNTs) have not yet been used (Wang et al., 2016). It is mostly used in
membrane processes such as reverse osmosis, ultrafiltration (Daer et al., 2015).
Carbon nanotubes (CNT) discovered in 1991 attracted interest in a wide range of applications due to their
durability, electrical conductivity, high adsorption properties. There are two main constructed types of CNT
as single-walled (SWCNT) and multi-walled carbon nanotubes (MWCNT) (Aqel et al., 2012). Carbon
nanotubes have applications such as sensors, adsorbents, membranes, and catalysts (Sarkar et al., 2018). It
has been reported that CNT has advantages of increasing water flow, maximizing the salt rejection and
extend the life of membrane by preventing the membrane contamination and biological fouling (Rashid et
al., 2017). It has also been reported that the CNTs have excellent absorbent properties against both chemical
and biological contaminants such as heavy metals, phenols, organic chemicals and various natural organic
substances (Teow et al., 2017). In addition to these beneficial properties, carbon nanotubes have a property
of affecting the membrane performance. Recently, CNT incorporated mixed matrix membranes have been
prepared and used for many of membrane application. Owing to the chemically inert property and
agglomeration tendency of CNT, it is difficult to achieve a homogeneous distribution within a base matrix.
Therefore, the surfaces of CNTs are treated with strong acids to achieve a good compatibility (Wang et al.,
2014). Thus, the functionalized carbon nanotubes (F-CNT) can be homogenously distributed to the polymer
matrix of the membrane. CNTs have been used with polymers such as polyamide (PA), polyether sulfonate
(PES), polyvinylidene fluoride (PVDF) and polyvinyl alcohol (PVA) to synthesize mixed matrix membrane
for applications of reverse osmosis, forward osmosis and ultrafiltration (Daer et al., 2015). Any study has
not been reported yet on the use of functionalized CNT for pervaporative desalination. Hence, in this study,
F-CNT loaded PVA non porous membrane has been produced and used for synthetic water desalination
including NaCl, KCl, MgCl2.
2. MATERIALS AND METHODS
2.1. Materials
COOH functionalized CNTs (F-CNT) were supplied from Grafen Co. with diameters ranging from 10 to 30
nm and lengths ranging from 10 to 30 nm. Polyvinyl alcohol (MW= 125,000 g/mol) was supplied from
Aldrich Chemistry, Turkey. Hydrochloric acid was supplied from J.T.Baker Inc. 2-propanol and magnesium
chloride hexahydrate (MW=203,3 g/mol) were supplied from Merck Chemicals, Turkey. Sodium Chloride
was supplied from Carlo Erba Reagents. Potassium chloride (MW=74,55 g/mol) was supplied from Sigma
Aldrich, Turkey. Gluteraldehyde %50 aq. sol. was supplied from Alfa Aesar, Turkey.
2.2 Preparation of Hybrid Membranes Containing Functionalized MWCNTs
Functionalized MWCNTs incorporated PVA membranes were prepared by casting and solvent evaporation
technique by adding different concentrations of functionalized MWCNTs. 6 wt% PVA was prepared and
stirred for three hours at 85°C. MWCNTs were added with the varying concentration from 0.1 wt% to 0.5
wt% respect to the polymer’s weight. Prior to incorporate functionalized MWCNTs into the polymer
solution, functionalized MWCNTs were kept in an ultrasonic bath for 15-20 minute to prevent the
agglomeration of nanotubes in the polymeric matrix. Following the homogenization, membrane solution was
poured onto a polymethyl metacrylate surface and allowed to dry for two days at the room temperature. The
dried membranes were cross-linked in a glutaraldehyde-containing cross-linking bath for three hours.
POSTER PRESENTATION
365
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
2.3. Membrane Characterization
Thermal behavior of the membrane was analyzed using differential scanning calorimetry (DSC). The
analysis was done with the temperature rising from 40 °C to β00 °C at a heating rate of β0 °C/min under
nitrogen atmosphere. The cross-linking evidence of the membrane was investigated using Fourier-transform
infrared spectroscopy.
2.4. Sorption Test
In order to investigate the swelling properties of the membranes in the different concentration of saline
solutions, membranes were cut into pieces with an area of 2 cm 2. Membranes were immersed in 20.000 ppm
NaCl-water, 1000 ppm KCl-water, 1000 ppm MgCl2-water solutions. At an hour interval, membranes were
rapidly taken from the solution and after that dried the weighs were recorded. Swelling analysis were carried
out 24 hours. The degree of swelling (Sd) values of the membranes were calculated from in following Eq.
(1)
Ws – Wd
Sd = [
Wd
]x
(1)
Where Ws is the weight of swollen membrane, and Wd is the weight of the dry membrane.
2.5. Pervaporation Experiment
The pervaporation test was carried out at a constant temperature of 40⁰C. Membranes were tested with
different concentrations of salt-containing solutions. The effective surface area of the membrane was 19.6
cm2. The flux (J) and salt rejection (R) were calculated using the following Eq (2) and Eq(3).
�=
�=
��
(2)
�.�
�� −��
��
∗
(3)
Where, Wp is the weight of permeate (kg), A is the effective membrane area(m 2), t is the experiment period
(h), Gf is conductivity of the feed solution, Gp is the conductivity of permeate.
The conductance of the water before and after the desalination experiments at one hour interval was
measured using a conductivity meter. For the accuracy of the conductance, permeated water was measured at
least three times.
3.RESULT AND DISCUSSION
3.1 Membrane Characterization
Figure 1 shows the FTIR spectra of the membranes with and without F-CNT. The peaks between the range
of 3280-3295 cm-1 are corresponding to O-H stretching vibration in the membrane. The intense of O-H band
increased depending on the F-CNT incorporation in which functionalized with O-H groups. As is known
from the literature, the FTIR spectrum of the COOH-MWCNT exhibited a relatively weak C=O stretching
band at 1720 cm-1 and an O-H stretching band at 3300 cm-1 (Jang et al., 2015). The strong vibration peaks of
CH2 and CH3 were observed at 2928 cm-1. Asymmetric and symmetric carboxylate stretching was found at
1650 cm-1 and 1420 cm-1 respectively.
POSTER PRESENTATION
366
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 1. FTIR spectra of the pure and F-CNT incorporated PVA membranes
Thermal behaviour of the pure and F-CNT incorporated PVA membranes was analysed by DSC. DSC curves
of the prepared membranes were given in Figure 2. According to DSC results, pure PVA membrane show
one single broad glass transition peak (Tg) at about 55 ˚C, a Tm value at βββ,81˚C associated with a ∆H f
value of 45.24 J/g. The F-CNT incorporated PVA membrane shows a Tm at 1λ7.0λ ˚C with a ∆Hf of 21.06
J/g. The F-CNT incorporated PVA membrane compared to the pure PVA membrane, it has lower melting
temperature and enthalpy values. This case indicating that F-CNT incorporated PVA membrane has the
lower structural order of crystallinity.
Figure 2. DSC curves of the Pure and F-CNT loaded PVA membranes
3.2 Swelling Results
Time dependent degrees of swelling values of the membranes at different concentration of F-CNT in
different salt solutions are given in Figure 3. In the first plot, the effect of F-CNT concentration on swelling
indicated at 20.000 ppm NaCl-water solution. The highest degree of swelling values of 180% was obtained
when the pure (pristine) PVA was immersed.
POSTER PRESENTATION
367
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 3. Swelling degrees of the membrane immersed in different types of salt
The degree of swelling provides basic information about the membrane-solvent affinity. Higher swelling
degree mostly leads to higher membrane flux. Until a certain point, an acceptable value for swelling degree
contributes to enhancing the water permeation. However, membrane selectivity or salt rejection is damaged
owing to the excess amount of swelling degree regarding the enlargement of the space between the polymer
chains. Therefore, it is important to obtain a stable trend in membrane swelling. It is clearly seen from the
Figure 3 that the 0.3 wt% and 0.5 wt% F-CNT loaded membranes exhibited lower and instable swelling
behavior.
Membranes were also immersed in the saline water solution containing 1000 ppm of MgCl2. Due to the
different charge density occurred by the differ salt ions, the swelling behavior of the membrane changed. In
the MgCl2-water solution, the highest swelling of 350 % was obtained with the 0.3wt% of F-CNT
incorporated membrane. This swelling of the membrane was very high to be used for a selective
desalination. Other membranes also showed the high degree of swelling values varying from 180% to 240%.
Compared to the NaCl solutions, higher swelling was obtained in MgCl2 and KCl owing to the different type
and concentration of the immersing solutions. In the real seawater, the concentration of the NaCl is higher
compared to the MgCl2 and KCl. In order to obtain realistic results, concentrations of the solutions were
adjusted close to the seawater. In the case of NaCl-water solution, numbers of ions were more than those of
MgCl2 and KCl solutions. Salt ions could increase the toughness of the membrane structure and restricted the
excess swelling. According to the results obtained in Figure 3, 0.1 wt% F-CNT incorporated membrane
exhibited more stable and acceptable swelling degree compared to the other membranes.
POSTER PRESENTATION
368
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3.2 Desalination Results
Figure 4 shows the flux and total salt rejection results of the membranes in different concentration of NaCl
(10000, 15000 and 20000 ppm) and constant concentrations of MgCl 2 and KCl (1000 ppm). All membranes
exhibited superior salt rejection greater than 99%. This was due to the selective character of PVA membrane.
According to the size exclusion theory on desalination process through a selective membrane, structure of
PVA prevented a non-selective ion passage. There were not seen any remarkable difference between the
rejection values of pure and F-CNT loaded membranes. Therefore, performance-determinant factor was
considered to be the water flux.
Figure 4. Flux and rejection results of the membranes at varying concentration of NaCl and constant
concentration of MgCl2 and KCl
At the lowest salt concentration (10.000 NaCl), compared to the pure PVA membrane, flux increment was
found to be greater than 10% using F-CNT loaded membranes. The highest flux was obtained using 0.1 wt%
F-CNT loaded membrane with the salt rejection of >99. The increase in at 0.1 wt% F-CNT loaded membrane
flux was found to be 40% compared to the pure PVA. With increasing NaCl concentration from 10000 ppm
to 15000 ppm, an increase of 45% was obtained using 0.5 wt% F-CNT membrane due to the ease of water
permeability throughout the CNT.
4.CONCLUSIONS
This study focused on the preparation F-CNT incorporated PVA membranes and application for
pervaporative desalination. As a result, greater than 99.5% rejections were obtained using all membrane.
With increasing F-CNT amount in the membrane, rejection showed the very slight increase. This increase
can be neglected compared to the flux variation. With increasing nanotube concentration in PVA matrix, flux
values enhanced. Especially, at low NaCl concentration (10.000 and 15.000 ppm) improvement in the flux
POSTER PRESENTATION
369
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
was found to be 40%. These results show a correlation with the swelling values, at the higher NaCl
concentration, pure PVA membrane swelling was higher than those of F-CNT loaded membranes.
Consequently, in this study, the higher flux of 1.05 kg/m2.h was obtained with a rejection of >99.5 using 0.1
F-CNT loaded PVA membrane.
Abbreviations
CNTs
carbon nanotubes
DSC
differential scanning calorimetry
F-CNT
functionalized multi-walled carbon nanotube
FTIR
Fourier transform infrared spectroscopy
MED
multi effect distillation
MSF
multi-stage flash distillation
MWCNT
multi-walled carbon nanotubes
PVA
polyvinyl alcohol
PA
polyamide
PES
polyether sulfonate
PVDF
polyvinylidene fluoride
RO
reverse osmosis
SWCNT
single-walled
TGA
thermo-gravimetric analysis
Symbols
Sd
degree of swelling
Ws
weight of swollen membrane
Wd
weight of the dry membrane
J
flux
R
salt rejection
Wp
weight of permeate
A
effective membrane area
t
experiment period
Gf
conductivity of the feed solution,
Gp
conductivity of permeate
Tg
glass transition temperature
Tm
melting temperature
∆Hf
enthalpy of formation
ACKNOWLEDGEMENTS
The authors would like to thank to colleagues from the Polymer and Rubber Technology: Characterization,
Kocaeli University, for their support on use of characterization equipment.
POSTER PRESENTATION
370
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
REFERENCES
Aqel, A., Abou El-Nour, K. M. M., Ammar, R. A. A., Al-Warthan, A., 2012. Carbon nanotubes, science and
technology part (I) structure, synthesis and characterisation. Arabian Journal of Chemistry, 5: 1-23.
Chaudri, S.G., Rajai B. H., Singh, P. S., 2015. Preparation of ultra-thin poly(vinyl alcohol) membranes
supported on polysulfone hollow fiber and their application for production of pure water from seawater.
Desalination, 367: 272-284.
Chaudhri, S.G., Chaudhari, J.C., Singh, P.S., 2018. Fabrication of efficient pervaporation desalination
membrane by reinforcement of poly(vinyl alcohol)–silica film on porous polysulfone hollow fiber.
Journal of Applied Polymer Science, 135: 1-13.
Daer, S., Kharraz, J., Giwa, A., Hasan, S. W., 2015. Recent applications of nanomaterials in water
desalination: A critical review and future opportunities. Desalination, 367: 37-48.
Goh, P.S., Ismail, A.F., Ng, B.C., 2013. Carbon nanotubes for desalination: Performance evaluation and
current hurdles: Desalination, 308: 2-14.
International Renewable Energy Agency (IRENA), 2013. Water Desalination Using Renewable Energy.
Technology Policy Brief, 12: 1-10.
Jang, M.G., Lee, Y.K., Kim, W.N., 2015. Influence of Lactic Acid-Grafted Multi-Walled Carbon Nanotube
(LA-g-MWCNT) on the Electrical and Rheological Properties of Polycarbonate/Poly(lactic acid)/LA-gMWCNT Composites. Macromolecular Research, 23(10): 916-923.
Kaminski, W., Marszalek, J., Tomczak, E., 2018. Water desalination by pervaporation – Comparison of
energy consumption. Desalination, 433: 89-93.
Lin, L., Hou, J., Ye, Y., Mansouri, J., Zhang, Y., Chen, V., 2017. Suppressing Salt Transport through
Composite Pervaporation Membranes for Brine Desalination. Applied Sciences, 7: 856.
Nigiz, F., Veli, S., Hilmioğlu, N., β017. Deep purification of seawater using a novel zeolite 3A incorporated
polyether-block-amide composite membrane. Separation and Purification Technology, 188: 90-97.
Rashid, M., Ralph, S., 2017. Carbon Nanotube Membranes: Synthesis, Properties, and Future Filtration
Applications. Nanomaterials, 7: 99-126.
Sarkar, B., Mandal, S., Tsang, Y., Kumar, P., Kim, K., Ok, Y., 2018. Designer carbon nanotubes for
contaminant removal in water and wastewater: A critical review. Science of the Total Environment, 612:
561-581.
Shirazi, Y., Tofighy, M. A., Mohammadi, T., 2011. Synthesis and characterization of carbon nanotubes/poly
vinyl alcohol nanocomposite membranes for dehydration of isopropanol. Journal of Membrane Science,
378: 551-561.
Teow, Y. H., Mohammad, A. W., 2017. New generation nanomaterials for water desalination : A review.
Desalination, Article in press.
Voutchkov, N., 2018. Energy use for membrane seawater desalination – current status and trends.
Desalinastion, 431: 2-14.
Wang, T., Shen, J., Wu, L., Bruggen, B., 2014. Improvement in the permeation performance of hybrid
membranes by the incorporation of functional multi-walled carbon nanotubes. Journal of Membrane
Science, 466: 338-347.
Wang, Q., Li, N., Bolto, B., Hoang , M., Xie, Z., 2016. Desalination by pervaporation: A review.
Desalination, 387: 46-60.
Xie, Z., Hoang, M., Duong,T., Ng, D., Dao, B., Gray, S., 2011. Sol–gel derived poly(vinyl alcohol)/maleic
acid/silica hybrid membrane for desalination by pervaporation. Journal of Membrane Science, 383: 96103.
Zhou, C., Zhou, J., Huang, A., 2016. Seeding-free synthesis of zeolite FAU membrane for seawater
desalination by pervaporation. Microporous and Mesoporous Materials, 234: 377-383.
POSTER PRESENTATION
371
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Türkiye’de Yaygın Olarak Tüketilen Baharatların Antibakteriyel Etkileri
Emine KOÇYİĞİT1*, Gülçin SAĞDIÇOĞLU CELEP1
1
Gazi Üniversitesi, Sağlık Bilimleri Fakültesi, Beslenme ve Diyetetik Bölümü, Ankara, Türkiye
Sorumlu yazar e-mail: kocyigitem@gmail.com
Özet
Yüksek mortalite ve morbiditeye neden olan bulaşıcı hastalıkların temelinde bakteri, virüs, parazit ya da
mantar gibi mikroorganizmalar yer almakta, bu patojen mikroorganizmalar bir insandan diğerine hızlıca
yayılmaktadır. Patojen mikroorganizmalar gıdaların bozulmasına ve gıda kaynaklı hastalıkların görülme
sıklığının artışına neden olmaktadır. Gıda sanayinde bu patojenlere karşı kullanılan kimyasal koruyucular
gıda kaynaklı mikroorganizmaları kontrol altına alarak raf ömrünü uzatsa da çeşitli bakterilere karşı yeterli
koruma sağlayamamakta ve bakterilerin koruyuculara karşı direnç geliştirmesine sebep olmaktadır. Bu
durum, sentetik kimyasal koruyucuların yerine geçebilecek ve organizmada daha iyi tolere edilebilen
baharatların kullanımını gündeme getirmiş, bu doğal ürünlerin gıda endüstrisinde kullanımı giderek artmıştır.
Eski çağlardan bu yana baharatların aroma ve tat verici özelliğinin yanında besin koruyucu ve hastalıkları
tedavi edici olarak kullanıldığı bilinmektedir. Yapılan çalışmalar bakteri ve mantar gibi patojen
mikroorganizmalara karşı antibakteriyel aktivitesi kanıtlanan kimyon, tarçın, sarımsak gibi pek çok baharatın
enfeksiyon kaynaklı hastalıkların önlenmesinde ve tedavisinde olumlu sonuçlar oluşturduğunu
göstermektedir. Baharatlara bu özelliği yapılarında bulunan polifenoller, uçucu yağ asitleri, flavonoidler gibi
ikincil metabolitlerin kazandırdığı belirlenmiştir. Bu çalışmada Türkiye’de besin hazırlama, hastalıkları
önleme ve tedavi etme gibi çeşitli amaçlarla yaygın olarak kullanılan sarımsak, tarçın, kimyon, sumak ve
kekik gibi baharatların antibakteriyel özellikleri ve bu özelliği sağlayan ikincil metabolitlere yer verilmiştir.
Anahtar Kelimeler: baharat, antibakteriyal aktivite, esansiyel yağlar
1. GİRİŞ
Bulaşıcı hastalıklar özellikle gelişmekte olan ülkelerde morbidite ve mortalitenin önde gelen nedenleri
arasında yer almaktadır. Hastalıkların nedenleri arasında bakteri, virüs, parazit ya da mantar gibi
mikroorganizmalar yer alırken, direkt ya da indirekt olarak bir insandan diğerine hızlıca yayılabilmektedir.
Konakçı patojenin gelişiminin bir sonucu olarak ortaya çıkan bulaşıcı hastalıklar ciddi halk sağlığı
sorunlarına yol açmaktadır (Dhandapani ve Raghunath, 2016).
Gıdalardaki mikrobiyal patojenler gıdaların bozulmasına ve gıda kaynaklı hastalıkların görülme sıklığının
artışına neden olmaktadır. Gıda sanayinde bu patojenlere karşı kullanılan kimyasal koruyucular gıda
kaynaklı mikroorganizmaları kontrol altına alarak raf ömrünü uzatsa da Staphylococcus aureus, Escherichia
coli, ve Pseudomonas aeruginosa gibi bakterilere karşı tamamen koruma sağlayamamakta ve patojenlerin
koruyucu maddelere karşı direnç geliştirmesine neden olmaktadır. Bu durum, sentetik kimyasal
koruyucuların yerine geçebilecek, organizmada daha iyi tolere edilebilen baharatların kullanımını gündeme
getirmiş ve bu doğal ürünlerin gıda endüstrisinde kullanımı giderek artmıştır (Miladi ve ark., 2016; Silva ve
Domingues, 2017; Souza ve ark., 2005; Tajkarimi ve ark., 2010).
Baharatlar eski zamanlardan bu yana tat ve orama verici, tedavi edici ve besin koruyucu olarak
kullanılmaktadır (Lai ve Roy, 2004; Zheng ve ark., 2016). Yapılan çalışmalar bakteri ve mantar gibi patojen
mikroorganizmalara karşı antibakteriyel aktivitesi kanıtlanan kimyon, tarçın, sarımsak gibi pek çok baharatın
enfeksiyon kaynaklı hastalıkların tedavisinde olumlu sonuçlar oluşturduğunu belirtilmektedir (Chaudhary ve
ark., 2014; Daka, 2011; Keskin ve Toroglu, 2011). Baharatların yapısında bulunan polifenoller, uçucu yağ
asitleri, flavonoidler gibi ikincil metabolitler baharatlara antibakteriyel özellik kazandıran, güvenli kabul
edilen ve gıdalarla birlikte kullanıldığında yan etki oluşturmayan bileşenlerdir (Nabavi ve ark., 2015).
Ülkemiz coğrafi konum, iklim ve bitki çeşitliliği, tarımın yaygınlığı sayesinde tıbbi ve aromatik bitkilerin
yetiştirilmesinde ve ticaretinde önemli yere sahiptir. Besin hazırlama, hastalıklardan korunma, sağlığın
iyileştirilmesi, geleneksel tedavi ve inançların baharatların yaygın kullanımına birer örnektir. Bu çalışmada
POSTER PRESENTATION
372
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Türkiye’de yaygın kullanıma sahip sarımsak, tarçın, kimyon, sumak, kekik gibi baharatların antibakteriyal
etkinliği ve bu etkinliği sağlayan ikincil metabolitlerin özellikleri değerlendirilmiştir.
2. MATERYAL VE METOD
Bu çalışmada Türkiye’de yaygın olarak kullanılan sarımsak, tarçın, kimyon, sumak ve kekik gibi
baharatların antibakteriyal özelliği ve bu özelliği kazandıran bileşenler değerlendirilmiştir.
Sarımsak (Allium sativum L.)
Sarımsak (Allium sativum L.), eski çağlardan bu yana hastalıklardan koruyucu teröpatik bir bitki olarak ün
kazanmıştır. Sağlığı geliştirici ve iyileştirici etkisine olan inanç sayesinde modern tıpta da kullanımı
sürmektedir (Colín-González ve ark., β01β).
Allisin (allil 2-propenetiyosülfinat/diallil tiyosülfinat) sarımsağın biyoaktivite gösteren temel bileşenidir.
Doğrama ve ezme işlemleri ile aktive olan allinaz enzimi sarımsakta bulunan alliinin aliisine dönüşümünü
sağlamaktadır. Sarımsağın yapısındaki diğer önemli bileşenler 1-propenil allil tiyosülfonat, allil
metiltiyosülfonat, (E,Z)-4,5,9-tritiyadodesal, 6,11-trien-9-oksit (ajoen), ve γ-L-glutamil-S-allil-L-sistein’dir.
(Iciek ve ark., 2009; Lanzotti ve ark., 2012). Sarımsağın antibakteriyel aktivitesinin yapısında bulunan
allisin, allil grupları ve diallil sülfid, diallil disülfid, diallil trisülfid gibi suda ve yağda çözünen organosülfür
bileşiklerinden ileri geldiği belirlenmiştir (Casella ve ark., 2013; Goncagul ve Ayaz, 2010).
Sarımsağın yüzyıllardır bulaşıcı hastalıklarla savaşmak için kullanıldığı bilinmekte, kanıtlanmış veri
olmamakla birlikte Louis Pasteur’ün 1858 yılında sarımsağın antibakteriyel etkinliğini tanımladığına
inanılmaktadır. Yapılan çalışmalar sarımsağın gram pozitif (+), gram negatif (–) ve aside dayanıklı
bakterilerin çoğalmasına karşı etkili olduğunu kanıtlamıştır. Bu bakteriler arasında Salmonella, Escherichia
coli, Pseudomonas, Proteus, Staphylococcus aureus, Klebsiella, Micrococcus, Bacillus, Clostridium,
Mycobacterium, Helicobacter türleri yer almaktadır (Abubakar, 2009; Adler ve Beuchat, 2002; Chandra ve
ark., 2010; Daka, 2011).
Tarçın (Cinnamomum zeylanicum L.)
Tarçın antik çağlardan bu yana en yaygın kullanılan gıda katkı maddesi ve baharatlardan biri olarak
bilinmektedir. Diş ağrılarında ve enfeksiyonlarında, akne tedavisinde, gastrointestinal sistem
rahatsızlıklarında kullanıldığı belirtilen tarçının antioksidan ve antiinflamatuvar etkisi sayesinde
antibakteriyel, antifungal, bağırsak parazitlerini öldürücü etkinlik göstermektedir. Tarçının yapısında
bulunan temel biyoaktif bileşenler polifenoller ve uçucu fenol bileşenleri olmak üzere iki sınıfa
ayrılmaktadır. Başlıca polifenoller arasında kaffeik asit, gallik asit, protokateşik asit, p-kumarik asit ve
ferulik asit yer alırkenν sinnamaldehit, karyofilin, benzil benzoat, linalol, öjanol asetat ve sinnamil asetat
tarçından elde edilen uçucu hidrokarbon ve oksijenlenmiş bileşiklerdir (Muchuweti ve ark., 2007; Wong ve
ark, 2014).
Farklı dozlarda uygulanan tarçın ekstraktlarının ve tarçından elde edilen esansiyel yağların Klebsiella
pneumonia, Bacillus megaterium P. aeroginosa, Staphylococcus aureus, Escherichia coli, Enterobacter
cloaca, Corynebacterium xerosis, Streptococcus faecalis, Yersinia enterocolitica, Moraxella catarrhalis
türlerine karşı antibakteriyal aktivite gösterdiği yapılan çalışmalarca belirlenmiştir (Keskin ve Toroglu, 2011;
Mandal ve ark., 2011; Rasheed ve Thajuddin, 2011; Yap ve ark., 2013).
Tarçının yapısında bulunan bileşenler yüksek biyoaktivite göstermekte ve karaciğerde metabolize
olmaktadır. Bu nedenle karaciğer hastalığı olanlar, alkolizm öyküsü bulunanlar özellikle tarçın kabuğu
kullanmaktan kaçınmalıdır. Ayrıca parasetamol içeren ilaçlarla birlikte alınmaması gerekmektedir. Tarçın
yağı kullanılmadan önce çözeltinin içeriği %β’nin altında olacak şekilde dilüe edilmelidir (Price, 2007;
NCCIH, 2018).
Kimyon (Cuminum cyminum L)
Geleneksel tıpta, ses kısıklığı, sarılık, dispepsi ve diyare tedavisinde kimyona başvurulduğu, kimyon
çekirdeklerinin diüretik, vazokonstrüktif, gaz giderici ve abortif özellik gösterdiği bildirilmektedir (Leela,
2008; Prajapathi ve ark., 2003). Kimyonun biyolojik aktif özelliği çekirdeklerin zengin fitokimyasal
içerinden ileri gelmekte, fitokimyasal özelik gösteren başlıca bileşenler aldehitler (özellikle kumin aldehit),
kuminin alkol, γ-terpinen, p-kimen ve ί-pinen’dir (Johri, 2011).
POSTER PRESENTATION
373
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Kimyondan elde edilen esansiyel yağ asitlerinin Staphylococcus epidermidis, Staphylococcus aureus,
Staphylococcus haemolyticus, Propionibacterium acnes, Corynebacterium diphtheriae, Erysipelothrix
rhusiopathiae, Bacillus cereus, Clostridium tetani, Clostridium difficile, Escherichia coli, Salmonella typhi,
Klebsiella pneumonia, Vibrio cholerae, Aeromonas hpydrophila, Mycobacterium tuberculosis, Neisseria
gonorrhoeae, Asperigillus niger, Saccharomyces cerevisae ve Colletrotrichum gloeosporioides gibi birçok
bakteri türünün ortadan kaldırılmasında olumlu etki oluşturduğu saptanmıştır (Chaudhary ve ark., 2014).
Esansiyel yağ asitlerinin yanında kimyon çekirdeklerinin gallik asit, sinnamik asit, kumarik asit ve vanilik
asit gibi polifenoler ile luteolin, kateşin, kumarin, quersetin ve apijenin gibi flavonoidlerden zengin olduğu
belirtilmektedir (Rebey ve ark., 2012).
Sumak (Rhus typhina L.)
Hidroksibenzoik asit, hidroksisinnamik asit, gallik asit ve kaffeik asit sumağın yapısında bulunan başlıca
fenolik asitler olarak dikkat çekmektedir. Bunun yanında antosiyanin, piranoantosiyanin, quersetin,
quersetin-3-ramnosid, kamferol ve tannin içeriğince zengindir (Kirby ve ark., 2013; J. Lai ve ark., 2014;
Olchowik-Grabarek ve ark., 2014; Wu ve ark., 2013).
Sumağın uygulanan doza bağlı olarak Pseudomonas aeruginosa, Candida albicans, Escherichia coli,
Staphylococcus aureus, Bacillus cereus, Bacillus subtilis, Listeria monocytogenes, Salmonella typhimurium,
Helicobacter pylori, Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces lactis türlerinin
gelişimini inhibe ettiği yapılan çalışmalarca ortaya konmuştur. Özellikle gıda kaynaklı
patojen bakteriler olan Bacillus cereus ve H.pylori’ye karşı antinakteriyal etkinliği sayesinde tahıl, fermente
gıdalar, sebze ve yumurta için gıda güvenliğinin sağlanmasında önemli olabileceği gündeme gelmektedir
(Kossah ve ark., 2011; Lee ve ark., 2016; Techer ve ark., 2014) Sumağa antimikrobiyal özelliği gallik asit,
kaffeik asit, kuersetin ve tanninlerin kazandırdığı düşünülmektedir (Lee ve ark., 2016; Olchowik-Grabarek
ve ark., 2014; Vandal ve ark., 2015).
Kekik (Thymus L.)
Timol, karvakrol, c-terpinen ve p-kimen geniş çeşitliliğe sahip olan kekiğin antibakteriyal etkinliğinden
sorumlu başlıca bileşenlerdir (Sato ve ark., 2007). Antibakteriyal niteliğinin yanında antifungal, sitotoksik,
antiviral ve antioksidan gibi çeşitli biyolojik özelliği sayesinde öksürük, üst solunum yolu enfeksiyonu, akut
ve kronik bronşit, soğuk algınlığı ve boğmaca başta olmak üzere birçok hastalığın tedavisinde kullanıldığı
bilinmektedir (Basch ve ark., β004ν Šegvić Klarić ve ark., β007).
Kekiğin antibakteriyel etkisini araştıran ilk çalışma 60’lı yıllarda ortaya konmuş, özellikle β0 yılı aşkın
süredir kekik yağı, ekstraktı ve kekikten izole edilen bileşiklerin antibakteriyal etkisini değerlendirmek için
çok sayıda çalışma yapılmıştır (Li ve ark., 1963). Yapılan çalışmalarda Bacillus cereus, Escherichia coli,
Klebsiella pneumonia, S. aureus türlerine karşı ve özellikle Staphylococcus, Enterococcus, Escherichia ve
Pseudomonas türlerine karşı güçlü anltibakteriyel etki oluşturduğu belirtilmektedir (Abu-Darwish ve ark.,
2012; Tohidpour ve ark., 2010). Aynı zamanda Helicobacter pylori gelişimini inhibe ettiği saptanan
çalışmalar da mevcuttur (Eftekhar ve ark., 2009; Esmaeili ve ark., 2012).
Bunlara ek olarak, yaygın olarak tüketilen baharatlardan olan nane (Mentha), karabiber (Piper nigrum L.) ve
zerdeçalın (Curcuma Longa L.) antibakteriyel aktiviteleri olduğu yapılan araştırmalarda gösterilmiştir (Ali,
2017; Irshad ve ark., 2017; Zhang ve ark., 2017).
3. SONUÇ
Türkiye’de yaygın olarak tüketilen baharatların antibakteriyal etkileri özetlenmiştir. Sarımsak,
tarçın, kekik, kimyon, sumak, nane, karabiber ve zerdeçal Bacillus cereus, Staphylococcus aureus,
Escherichia coli, Pseudomonas aeruginosa ve antibiyotiğe dirençli pek çok bakteri türünü inhibe
edici özellik göstermektedir. Bu baharatlar gıda bozulmaları ve zehirlenmelerine azaltıcı etki
göstermekte, gıdaların raf ömrünü uzatmakta ve enfeksiyonları tedavi edici etki oluşturmaktadır.
Baharatların etki mekanizmalarının açıklığa kavuşturulduğu klinik çalışmalara ihtiyaç vardır.
Patojen mikroorganizmaların inhibisyonunun sağlanması için çeşitli gıdalarda baharatların birarada
kullanıldığı çalışmalar yapılmalıdır. Organizmada etkinliği kanıtlanan baharatlar bulaşıcı
POSTER PRESENTATION
374
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
hastalıkların tedavisinde antibiyotiğe alternatif oluşturabilir ancak toksik dozların belirlenmesi
gerekmektedir.
KAYNAKLAR
Abu-Darwish MS, Al-Ramamneh E, Kyslychenko VS, Karpiuk UV 2012. The antimicrobial activity of
essential oils and extracts of some medicinal plants grown in Ash-shoubak region-South of Jordan.
Pakistan Journal of Pharmaceutical Sciences, 25(1): 239-246.
Abubakar EmM 2009. Efficacy of crude extracts of garlic (Allium sativum Linn.) against nosocomial
Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniea and Pseudomonas aeruginosa.
Journal of Medicinal Plants Research, 3(4): 179-185.
Adler BB, Beuchat LR 2002. Death of Salmonella, Escherichia coli O157: H7, and Listeria monocytogenes
in garlic butter as affected by storage temperature. Journal of Food Protection, 65(12): 1976-1980.
Ali N 2017. In vitro studies of antimicrobial activity of (curcuma longa l.) rhizomes against helicobacter
pylori. Iraq Medical Journal, 1(1): 7-9.
Basch E, Ulbricht C, Hammerness P, Bevins A, Sollars D 2004. Thyme (Thymus vulgaris L.), thymol.
Journal of Herbal Pharmacotherapy, 4(1): 49-67.
Casella S, Leonardi M, Melai B, Fratini F, Pistelli L 2013. The role of diallyl sulfides and dipropyl sulfides
in the in vitro antimicrobial activity of the essential oil of garlic, Allium sativum L., and leek, Allium
porrum L. Phytotherapy Research, 27(3): 380-383.
Chandra H, Singh A, Srivastava J, Bishnoi P, Nautiyal A 2010. Antibacterial Activity of Allium sativum (L.)
Against Bacteria Isolated from Upper Respiratory Tract. IUP Journal of Life Sciences, 4(4):43-49.
Chaudhary N, Husain SS, Ali M 2014. Chemical composition and antimicrobial activity of volatile oil of the
seeds of Cuminum cyminum L. World Journal of Pharmacy and Pharmaceutical Science, 3: 14281441.
Colín-González AL, Santana RA, Silva-Islas CA, Chánez-Cárdenas ME, Santamaría A, Maldonado PD
2012. The antioxidant mechanisms underlying the aged garlic extract-and S-allylcysteine-induced
protection. Oxidative Medicine and Cellular Longevity, 2012:1-16.
Daka D 2011. Antibacterial effect of garlic (Allium sativum) on Staphyloccus aureus: An in vitro study.
African journal of Biotechnology, 10(4): 666-669.
Dhandapani KSV, Raghunath P 2016. Investigation on the mechanism of action of the leaves of trianthema
portulacastrum on human path only gens. Asian Journal of Pharmaceutical and Clinical Research,
9(3): 135-140.
Eftekhar F, Nariman F, Yousefzadi M, Hadiand J, Ebrahimi SN 2009. Anti-Helicobacter pylori activity and
essential oil composition of Thymus caramanicus from Iran. Natural Product Communications, 4(8):
1139-1142.
Esmaeili D, Mobarez AM, Tohidpour A. 2012. Anti-helicobacter pylori activities of shoya powder and
essential oils of thymus vulgaris and eucalyptus globulus. The Open Microbiology Journal, 6: 65-69.
Goncagul G, Ayaz E 2010. Antimicrobial effect of garlic (Allium sativum). Recent Patents on Anti-Infective
Drug Discovery, 5(1): 91-93.
Iciek M, Kwiecień I, Włodek L β00λ. Biological properties of garlic and garlic‐derived organosulfur
compounds. Environmental and Molecular Mutagenesis, 50(3): 247-265.
Irshad S, Ashfaq A, Muazzam A, Yasmeen A 2017. Antimicrobial and Anti-Prostate Cancer Activity of
Turmeric (Curcuma longa L.) and Black Pepper (Piper nigrum L.) used in Typical Pakistani
Cuisine. Pakistan Journal of Zoology, 49(5): 1665-1669.
Johri R 2011. Cuminum cyminum and Carum carvi: An update. Pharmacognosy Reviews, 5(9): 63-72.
Keskin D, Toroglu S 2011. Studies on antimicrobial activities of solvent extracts of different spices. Journal
of Environmental Biology, 32(2): 251-256.
Kirby CW, Wu T, Tsao R, McCallum JL 2013. Isolation and structural characterization of unusual
pyranoanthocyanins and related anthocyanins from Staghorn sumac (Rhus typhina L.) via UPLC–
ESI-MS, 1H, 13C, and 2D NMR spectroscopy. Phytochemistry, 94: 284-293.
Kossah R, Zhang H, Chen W 2011. Antimicrobial and antioxidant activities of Chinese sumac (Rhus typhina
L.) fruit extract. Food Control, 22(1): 128-132.
Lai J, Wang H, Wang D, Fang F, Wang F, Wu T 2014. Ultrasonic extraction of antioxidants from Chinese
sumac (Rhus typhina L.) fruit using response surface methodology and their characterization.
Molecules, 19(7): 9019-9032.
POSTER PRESENTATION
375
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Lai P, Roy J 2004. Antimicrobial and chemopreventive properties of herbs and spices. Current Medicinal
Chemistry, 11(11): 1451-1460.
Lanzotti V, Barile E, Antignani V, Bonanomi G, Scala, F 2012. Antifungal saponins from bulbs of garlic,
Allium sativum L. var. Voghiera. Phytochemistry, 78: 126-134.
Lee MH, Lee J, Nam YD, Lee JS, Seo MJ, Yi SH 2016. Characterization of antimicrobial lipopeptides
produced by Bacillus sp. LM7 isolated from chungkookjang, a Korean traditional fermented soybean
food. International Journal of Food Microbiology, 221: 12-18.
Leela N 2008. Chemistry of spices. UK: CAB International Press, 124 pp.
Li C, Prescott B, Chi L, Martino E 1963. Antiviral and antibacterial activity of thymus extracts. Proceedings
of the Society for Experimental Biology and Medicine, 114(2): 504-509.
Mandal S, DebMandal M, Saha K, Pal NK 2011. In vitro antibacterial activity of three Indian spices against
methicillin-resistant Staphylococcus aureus. Oman Medical Journal, 26(5): 319-323.
Miladi H, Zmantar T, Chaabouni Y, Fedhila K, Bakhrouf A, Mahdouani K, Chaieb K 2016. Antibacterial
and efflux pump inhibitors of thymol and carvacrol against food-borne pathogens. Microbial
pathogenesis, 99: 95-100.
Muchuweti M, Kativu E, Mupure C, Chidewe C, Ndhlala A, Benhura M 2007. Phenolic composition and
antioxidant properties of some spices. American Journal of Food Technology, 2(5): 414-420.
Nabavi SF, Di Lorenzo A, Izadi M, Sobarzo-Sánchez E, Daglia M, Nabavi SM β015. Antibacterial effects
of cinnamon: From farm to food, cosmetic and pharmaceutical industries. Nutrients, 7(9): 77297748.
Naitonal Center for Complementary and Integrative Health. Herbs at a glance. Cinnamon. Available at:
https://nccih.nih.gov/health/cinnamon [Erişim ββ.0β.18]
Olchowik-Grabarek E, Swiecicka I, Andreeva-Kovaleskaya Z, Solonin A, Bonarska-Kujawa D,
Kleszczyńska H, Saidmukhtar M, Zamaraeva M 2014. Role of structural changes induced in
biological membranes by hydrolysable tannins from sumac leaves (Rhus typhina L.) in their
antihemolytic and antibacterial effects. The Journal of Membrane Biology, 247(6): 533-540.
Prajapathi ND, Purohit S, Sharma AK, Kumar T 2003. A handbook of medicinal plants: A complete source
book. India: Agrobios Press, 396 pp.
Price L 2007. Aromatherapy for health professionals. China: Elsevier Press,69 pp.
Rasheed MU, Thajuddin N 2011. Effect of medicinal plants on Moraxella cattarhalis. Asian Pacific Journal
of Tropical Medicine, 4(2): 133-136.
Rebey IB, Zakhama N, Karoui IJ, Marzouk B 2012. Polyphenol composition and antioxidant activity of
cumin (Cuminum cyminum L.) seed extract under drought. Journal of food science, 77(6): 734-739.
Sato K, Krist S, Buchbauer G 2007. Antimicrobial effect of vapours of geraniol,(R)‐(–)‐linalool, terpineol, γ‐
terpinene and 1, 8‐cineole on airborne microbes using an airwasher. Flavour and Fragrance Journal,
22(5): 435-437.
Šegvić Klarić M, Kosalec I, Mastelić J, Piecková E, Pepeljnak S β007. Antifungal activity of thyme (Thymus
vulgaris L.) essential oil and thymol against moulds from damp dwellings. Letters in Applied
Microbiology, 44(1): 36-42.
Silva F, Domingues FC 2017. Antimicrobial activity of coriander oil and its effectiveness as food
preservative. Critical Reviews in Food Science and Nutrition, 57(1): 35-47.
Souza ELd, Stamford TLM, Lima EdO, Trajano VN, Barbosa-Filho JM 2005. Antimicrobial effectiveness of
spices: an approach for use in food conservation systems. Brazilian Archives of Biology and
Technology, 48(4): 549-558.
Tajkarimi M, Ibrahim SA, Cliver D 2010. Antimicrobial herb and spice compounds in food. Food Control,
21(9): 1199-1218.
Techer C, Baron F, Delbrassinne L, Belaïd R, Brunet N, Gillard A, Gonnet F, Cochet MF, Grosset N,
Gautier M 2014. Global overview of the risk linked to the Bacillus cereus group in the egg product
industry: identification of food safety and food spoilage markers. Journal of Applied Microbiology,
116(5): 1344-1358.
Tohidpour A, Sattari M, Omidbaigi R, Yadegar A, Nazemi J 2010. Antibacterial effect of essential oils from
two medicinal plants against Methicillin-resistant Staphylococcus aureus (MRSA). Phytomedicine,
17(2): 142-145.
Vandal J, Abou-Zaid MM, Ferroni G, Leduc LG 2015. Antimicrobial activity of natural products from the
flora of Northern Ontario, Canada. Pharmaceutical Biology, 53(6): 800-806.
POSTER PRESENTATION
376
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Wong Y, Ahmad-Mudzaqqir M, Wan-Nurdiyana W 2014. Extraction of essential oil from cinnamon
(Cinnamomum zeylanicum). Oriental Journal of Chemistry, 30(1): 37-47.
Wu T, McCallum JL, Wang S, Liu R, Zhu H, Tsao R 2013. Evaluation of antioxidant activities and chemical
characterisation of staghorn sumac fruit (Rhus hirta L.). Food Chemistry, 138(2-3): 1333-1340.
Yap PSX, Lim SHE, Hu CP, Yiap BC 2013. Combination of essential oils and antibiotics reduce antibiotic
resistance in plasmid-conferred multidrug resistant bacteria. Phytomedicine, 20(8-9): 710-713.
Zhang J, Ye KP, Zhang X, Pan DD, Sun YY, Cao JX 2017. Antibacterial activity and mechanism of action
of black pepper essential oil on meat-borne Escherichia coli. Frontiers in microbiology, 7: 20943004.
Zheng J, Zhou Y, Li Y, Xu DP, Li S, Li HB 2016. Spices for prevention and treatment of cancers. Nutrients,
8(8): 495.
POSTER PRESENTATION
377
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Enrofloksasinin TiO2/UV Prosesi ile Giderimi
Aslı Berktaş1, Özlem Esen Kartal2*
*1,2
İnönü Üniversitesi, Mühendislik Fakültesi, Kimya Mühendisliği, Malatya, Türkiye
asli.berktas@gmail.com
Özet
Günümüzde insan ve hayvanların tedavisinde antibiyotikler yaygın bir şekilde kullanılmaktadır. Canlılar
tarafından vücuda alınan bu antibiyotikler metabolizmada değişmeden ya da çok az değişime uğrayarak
vücuttan dışarı atılırlar. Bu nedenle, atılan insan ve hayvan dışkıları yüksek miktarda antibiyotik
içerebilir. Atılan antibiyotik içeren kalıntılar atıksu arıtma tesislerinde yeterince arıtılamadığı durumda,
antibiyotiğin özelliklerine bağlı olarak toprağa, yüzeysel ve yeraltı sularına karışabildiği bilinmektedir.
Karıştığı bu ortamlarda, düşük derişimde bulunan antibiyotik kalıntıları mikroorganizmaların antibiyotik
direnci kazanmasına, yüksek derişimlerde bulunan kalıntılar ise toksik etkilere neden olabilmektedir. Son
yıllarda atıksularda bulunan antibiyotik kalıntılarının gideriminde ileri oksidasyon proseslerinin (İOP)
kullanımına yönelik yapılan çalışmalar artmıştır. İOP özellikle biyolojik olarak giderilemeyen
bileşiklerin ya tamamen mineralizasyonunu sağlayarak CO 2 ve H2O gibi toksik olmayan ürünlere ya da
biyolojik olarak giderilebilen ara ürünlere dönüştürülmesini sağlamaktadır. Bu çalışmada florokinon
grubu bir antibiyotik olan enrofloksasinin TiO2 katalizörü varlığında fotokatalitik giderimi incelenmiştir.
γ,5,7 ve λ pH değerlerinde 60 dakika sonunda sırasıyla %84, %λ5, %λ6 ve %λ7 enrofloksasin
giderimi elde edilmiştir. Enrofloksasinin fotokatalitik oksidasyonla giderimine TiO2 miktarının etkisini
araştırmak için 0 - 1 g/L aralığında farklı miktarlarda TiO2 kullanılarak deneyler yapılmış ve TiO2
miktarı arttıkça giderimin de arttığı gözlenmiştir. 10, 20, 30 ve 40 ppm enrofloksasin derişimleri için 60
dakika sonunda sırasıyla %100, %λ7, %λγ ve %87 giderim elde edilmiştir. Karanlıkta (0 W) yapılan
deneyde 60 dakika sonunda %5 enrofloksasin giderimi elde edilirken, 56 W ve 11β W gücünde lambalar
kullanıldığında %78 ve %λ7 giderim elde edilmiştir.
Anahtar Kelimeler: Antibiyotik, fotokatalitik oksidasyon, enrofloksasin, titanyum dioksit
1. GİRİŞ
İnsan ve hayvanların tedavisinde antibiyotiklerin kullanımı günümüzde oldukça yaygındır. Canlılar
tarafından vücuda alınan bu antibiyotikler metabolizmada değişmeden ya da çok az değişime uğrayarak
vücuttan dışarı atılırlar. Bu nedenle, atılan insan ve hayvan dışkıları yüksek miktarda antibiyotik içerebilir
(Ötker ve Akmehmet-Balcıoğlu, β005ν Haque ve Muneer, β007). Atılan antibiyotik içeren kalıntılar atıksu
arıtma tesislerinde yeterince arıtılamadığı durumda, antibiyotiğin özelliklerine bağlı olarak toprağa, yüzeysel
ve yeraltı sularına karışabildiği bilinmektedir. Karıştığı bu ortamlarda, düşük derişimde bulunan antibiyotik
kalıntıları mikroorganizmaların antibiyotik direnci kazanmasına, yüksek derişimlerde bulunan kalıntılar ise
toksik etkilere neden olabilmektedir (Seven Yalap ve Akmehmet-Balcıoğlu,2008). Antibiyotikler
özelliklerine göre farklı şekilde sınıflandırılmaktadır. Enrofloksasin ise florokinolonlar grubuna dahil bir
antibiyotik olup geniş bir etki spektrumuna sahiptir (Ötker ve Akmehmet-Balcıoğlu, β005). Enrofloksasin
kanatlılar ve geviş getiren hayvan başta olmak üzere yaygın şekilde kullanılmakta olup % 10-50
kadarı değişmemiş halde olmak üzere vücudu idrar ve safrayla terk etmektedir. Son yıllarda
antibiyotik kalıntısı içeren atıksuların arıtımında OH. radikallerinin oluşumuna dayanan İleri Oksidasyon
Proseslerinin (İOP) kullanımı araştırılmaktadır (Homem ve Santos, β011ν Paul ve ark, β010). TiO 2’in
fotokatalizör olarak kullanıldığı heterojen İOP’lerinde, TiO2 eşik enerjisine eşit ya da daha büyük bir enerji
ile uyarıldığında elektronlar değerlik bandından iletkenlik bandına geçer ve böylece değerlik bandında
boşluklar oluşarak elektron (e-) ve boşluk (h+) çiftleri meydana gelir. Oluşan h+ yüzeyde adsorplanmış olan
H2O ve OH- ile reaksiyona girerek OH. radikalini oluştururlar. e- ise yüzeyde adsorplanmış olan O2 ile
reaksiyona girerek süperoksit radikalini (O2.-) oluşturur (Şekil 1). Oluşan e- - h+ çiftlerinden bazıları da tekrar
birleşebilir (Paola ve ark., β01βν Ohtani, β010ν Nakata ve Fujishima, β01β).
POSTER PRESENTATION
378
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 1. TiO2 fotokatalizörün foto aktivasyon mekanizması
2. MATERYAL VE METOD
2.1. Materyal
Deneysel çalışmalarda, fotokatalizör olarak Pβ5 Titanyum dioksit (TiO 2, Evonik), antibiyotik olarak
molekül yapısı Şekil β’de verilen enrofloksasin (Baytril %β.5 oral çözelti, Bayer) kullanılmıştır.
Şekil 2. Enrofloksasin molekül yapısı
2.2. Karakterizasyon
Fototakatalizör olarak kullanılan TiO2’in kristal yapısı Rigaku RadB-DMAX II model X-Işınları
Difraktometresi (XRDν 1.54050 Å CuKα) ile incelenmiştir. XRD analizi sonucu elde edilen verilerden %
anataz miktarı Eşitlik 1 ve kristal boyutu Scherrer denklemi olarak bilinen Eşitlik β ile hesaplanmıştır.
% X = 100 / ( 1+1.265 IR / IA )
Burada; X: % anataz miktarıν IAμ Anataz pik şiddetiν IRμ rutil pik şiddetidir.
(1)
L = Kλ / β cosθ
(2)
Buradaν Lμ kristal boyutuν Kμ Scherrer sabiti (0.λ)ν ζμ X ışını dalga boyu (1.54050 Å)ν ίμ yarı şiddet genişliğiν
θμ Bragg açısıdır.
2.3. Fotokatalitik Deney Yöntemi
Enrofloksasinin fotokatalitik oksidasyonla giderimi Şekil γ’de görülen deney sisteminde
gerçekleştirilmiştir. Kuvars camdan yapılmış ceketli fotoreaktör etrafına 8 W gücünde 14 adet UV-A lamba
(Topbulb EIKO F8T5/BL) yerleştirilmiştir. Belirlenen derişimde hazırlanan 500 ml enrofloksasin çözeltisi
reaktöre konulmuş ve sonra TiO2 fotokatalizörü eklenip lamba açılmadan γ0 dakika boyunca karıştırılarak
çözeltinin giderimine adsorpsiyonun etkisi incelenmiştir. γ0 dakika sonunda lamba açılmış ve reaksiyon
süresince belirli zaman aralıklarında sistemden örnekler alınmıştır. Bu örneklerden TiO 2 santrifüj işlemi ile
uzaklaştırıldıktan sonra enrofloksasin derişimi UV-1800 Shimadzu UV-VIS Spektrofotometresi ile ölçülen
absorbans değerlerinden belirlenmiştir.
Şekil 3. Deney düzeneği a) Kuvars fotoreaktör, b) Manyetik karıştırıcı, c) Gaz dağıtıcı,
d) pH metre, e) Sıcaklık probu, f) Biyolamba, g) Oksijen tüpü, h) Su banyosu
POSTER PRESENTATION
379
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3. SONUÇ
3.1.XRD Analizi Sonuçları
TiO2 fotokatalizörünün XRD kırınım diyagramı Şekil 4’te verilmiştir. βθ= β5.180 değerinde
karakteristik anataz piki, βθ= β7.γγλ değerinde de karakteristik rutil piki görülmüştür. Bu piklere ait
verilerden yararlanarak % anataz miktarı ile kristal boyutu hesaplanmıştır. Buna gore, Pβ5 fotokatalizörü %
81 anataz ve % 1λ rutil yapıda olup 18.54 nm kristal boyutuna sahiptir.
A: anataz
R: rutil
Şekil 4. TiO2 fotokatalizörü XRD kırınım diyagramı
3.2. Fotokatalitik Oksidasyon Deneyleri
3.2.1. pH’ın Etkisi
pH’ın etkisini incelemek için enrofloksasinin β0 ppm sulu çözeltisi hazırlanarak farklı pH değerleri
için fotokatalitik oksidasyon deneyleri yapılmış ve elde edilen sonuçlar Şekil 5’de sunulmuştur.
Şekil 5. pH’ın enrofloksasin giderimine etkisi
TiO2 miktarı=1 g/L, [Enrofloksasin]=β0 ppm, Lamba=UV-A (112 W)
3.2.2. Enrofloksasin Başlangıç Derişiminin Etkisi
Enrofloksasinin başlangıç derişiminin etkisini incelemek için pH=λ değerinde 10, β0, γ0, ve 40 ppm
derişimlerinde enrofloksasin çözeltisi kullanılarak deneyler yapılmıştır.
POSTER PRESENTATION
380
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 6. Enrofloksasin başlangıç derişiminin enrofloksasin giderimine etkisi
TiO2 miktarı=1 g/L, pH=9, Lamba=UV-A (112 W)
3.2.3. TiO2 Miktarının Etkisi
Enrofloksasinin fotokatalitik oksidasyonla giderimine TiO2 miktarının etkisini araştırmak için 0 - 1
g/L aralığında farklı miktarlarda TiO2 kullanılarak deneyler yapılmış ve sonuçlar Şekil 7’de verilmiştir.
Şekil 7. TiO2 miktarının enrofloksasin giderimine etkisi
[Enrofloksasin]=20 ppm, pH=9, Lamba=UV-A (112 W)
3.2.4. UV-A Lamba Gücünün Etkisi
Enrofloksasinin fotokatalitik oksidasyonla giderimine kullanılan UV-A lambanın gücünün etkisi
lamba kullanılmadan ve 56 W ile 11β W gücünde lambalar kullanılarak incelenmiş ve sonuçlar Şekil 8’de
verilmiştir.
POSTER PRESENTATION
381
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Şekil 8. UV-A lamba gücünün enrofloksasin giderimine etkisi
TiO2 miktarı=1 g/L, [Enrofloksasin]=β0 ppm, pH=9
4. TARTIŞMA
TiO2’nin yüzey özellikleri pH’a bağlı olarak değiştiğinden pH organik bileşiklerin fotokatalitik
oksidasyon ile gideriminde önemli parametredir. Pβ5 TiO2’in izoelektrik noktası pH=6.8 olduğundan,
TiO2’in yüzeyi pH< 6.8 olduğunda artı yüklü, pH>6.8 olduğunda ise eksi yüklü olmaktadır. Şekil 5’ten
görüldüğü gibi γ,5,7 ve λ pH değerlerinde 60 dakika sonunda sırasıyla %84, %λ5, %λ6 ve %λ7
enrofloksasin giderimi elde edilmiştir. Enrofloksasin zwiteriyon molekül olup pKa1(5.88-6.06) ve pKa2(
7.7-7.74) değerlerine sahiptir. Bu iki pH değeri arasında yüksüzdür. Çözelti pH’ının nötral ve bazik olduğu
koşullarda giderim asidik koşula göre daha yüksek olmuştur.
Şekil 6’dan görüldüğü gibi 60 dakika sonunda 10, 20, 30 ve 40 ppm enrofloksasin derişimleri için
sırasıyla %100, %λ7, %λγ ve %87 giderim elde edilmiştir. Başlangıç enrofloksasin derişiminin artması ile
katalizör yüzeyi üzerindeki aktif alanlar kaplanmakta ve katalizör yüzeyinde OH. radikali oluşumu
azalmaktadır. Bu nedenle enrofloksasin derişimi arttıkça giderim azalmaktadır.
Enrofloksasinin fotokatalitik oksidasyonla giderimine TiO2 miktarının etkisi incelendiğinde Şekil
7’den görüldüğü gibi 60 dakika sonunda TiO 2‘nin kullanılmadığı durumda %18 enrofloksasin giderimi elde
edilirken, 0.25 g/L, 0.50 g/L ve 1 g/L TiO2 miktarları için sırasıyla %81,%87 ve %λ7 giderim elde edilmiştir.
Organik bileşiklerin fotokatalitik olarak bozunma etkinliğinin fotokatalizör miktarı arttıkça katalizör
yüzeyindeki aktif kısımların sayısının da artması nedeniyle arttığı bilinmektedir. Ancak katalizör miktarı
çok fazla artırıldığında süspansiyonun UV ışını geçirgenliği azalmaktadır. Bu çalışmada katalizörün UV
ışınının geçirgenliğinde bir azalma görülmemiştir.
Şekil 8’den görüldüğü gibi karanlıkta (0 W) yapılan deneyde 60 dakika sonunda %5 enrofloksasin
giderimi elde edilirken, 56 W ve 11β W gücünde lambalar kullanıldığında %78 ve %λ7 giderim elde
edilmiştir. Lamba gücünün artmasıyla foton enerjisi arttığından giderim artmıştır.
KAYNAKLAR
Haque MM, Muneer M 2007. Photodegradation of norfloxacin in aqueous suspensions of titanium dioxide.
Journal of Hazardous Materials, 145: 51-57.
Homem V, Santos L 2011. Degradation and removal methods of antibiotics from aqueous matrices- A
review. Journal of Environmental Management 92: 2304-2347.
Nakata K, Fujishima A, 2012. TiO2 Photocatalysis: Design and Applications, Journal of Photochemistry and
Photobiology C: Photochemistry Reviews, 13: 169-189.
Ohtani B 2010. Photocatalysis A to Z-what we Know and what we do not know in a scientific sense. Journal
of Photochemistry and Photobiology C: Photochemistry Reviews, 11: 157-178.
POSTER PRESENTATION
382
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Ötker HM, Akmehmet-Balcıoğlu I β005. Adsorption and degradation of enrofloxacin, a veterinary antibiotic
on natural zeolite. Journal of Hazardous Materials, 122: 251-258.
Paola AD, Lopez EG, Marci G, Palmisano L 2012. A Survey of photocatalytic materials for environmental
remediation. Journal of Hazardous Materials, 211-212: 3-29.
Paul T, Dodd MC, Strathmann TJ. 2010. Photolytic and photocatalytic decomposition of aqueous
ciprofloxacin: Transformation products and residual antibacterial activity. Water Research, 44: 31213132.
Yalap Seven K, Akmehmet-Balcıoğlu I β008. Oksitetrasiklinin ileri oksidasyon ile arıtımına su
bileşenlerinin etkisi. Su Kirlenmesi Kontrolü, İTÜ Dergisi, 18(β-3): 51-60.
POSTER PRESENTATION
383
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Karanfil Çiçeğinin (Dianthus caryophyllus L.) Farklı Toprak Türlerinde Çimlenme
Fizyolojisinin İncelenmesi; Gaziantep’te Bir Sera Uygulaması
Kamil Mencik1*, Ömer Faruk Gecesefa1, Kenan Ercan1
*1
Gaziantep Üniversitesi, Nurdağı Meslek Yüksekokulu, Gaziantep, Türkiye
Sorumlu yazar e-mail: kercan@gantep.edu.tr
Özet
Bu çalışmada farklı toprak türlerinin Karanfil çiçeğinin (Dianthus caryophyllus L.) tohumdan
çimlenmesine etkisi araştırılmıştır. Tohumların çimlenmesi için perlitμtorf karışımı (1μβ oranında), açık
arazi toprağı ve torf-açık arazi toprağı karışımı (1μ1 oranında) kullanılmıştır. Toplam γ4 tohum uygun
büyüklükteki viyollere ekilmiştir. Bu tohumların 1β tanesi perlit-torf karışımına, 11 tanesi açık arazi
toprağına, 11 tanesi de torf-açık arazi toprağı karışımına ekilmiştir. Tohumlar sıcaklık nem ve ışık
miktarı gibi aynı fiziksel şartlara tabi tutulmuştur. Ekilen tohumlar periyodik olarak kontrol edilmiştir.
Yapılan çalışma sonucunda çimlenme oranları perli-torf karışımında %67, açık arazi topraklarında %γ6,
torf-açık arazi toprakları karışımında ise %6γ olarak tespit edilmiştir.
Anahtar Kelimeler: Karanfil, Dianthus caryophyllus, çimlenme fizyolojisi, toprak
1. GİRİŞ
Karanfil (Dianthus caryophyllus L.) anavatanı Akdeniz bölgesidir. Aynı zamanda Caryophllaceae
familyasının bir üyesidir. Ülkemizdeν karanfil, β46 milyon adet üretimi ve 18.β71.67λ USD üretim değeri ile
kesme çiçek türleri arasında birinci sırada yer almaktadır ve karanfil üretiminin en yaygın olarak yapıldığı
iller Antalya ve İzmir’dir (Kocabaş ve ark., β01β).
Karanfil de üretimν tohumla, çelikle ve meristem kültürü ile olmak üzere üç yolla yapılmaktadır. Ülkemizde
karanfil üreticilerinin büyük bir kısmı çelikle üretim yapmaktadır. Çelikle üretimde anaç bitkilerden alınan
çelikler tekrar anaç bitki olarak kullanılmaktadır. Bu işlem yıllarca devam etmektedir. Modern karanfil
yetiştiriciliği kurallarına aykırı olan bu durum sonucu kalite ve verim düşmektedir (Kocabaş ve Kaplan
2007).
Ülkemiz genelinde, gerek sera yetiştiriciliği gerekse açıkta yetiştiricilikte birim alandan düşük verim
alınmasının nedenlerinin başında kalitesiz fidelerle üretim yapılması gelmektedir. Sağlıklı ve kaliteli fide ile
üretim yapmak verimi olumlu yönde etkileyen en önemli faktörlerden birisidir (Kocabaş ve Kaplan β007).
Karanfil beslenmeye karşı toleranslı bir bitki olmasına rağmen, yetiştiriciliğinin yapıldığı toprakların pH
değerinin 5.5–7.5 ve toprakların saturasyon ekstraktlı elektriki kondaktivitelerinin 0.7– 1.3 mmhos/cm
olmasının karanfil üretiminde verim ve kaliteyi arttıracağı belirtilmiştir. Ancak karanfil yetiştirme ortamının
doygunluk ekstraktının elektriksel iletkenlik değerleri ortalama β.58, γ.βλ ve γ.5β mS.cm –1 olarak belirlemiş
ve bu yetiştirme ortamlarında karanfilin çiçek kalitesi ve veriminin etkilenmediği saptanmıştır. Karanfil
yetiştiriciliği için uygun toprak özelliğininν tınlı bünyeli, organik madde içeriği %γ–6, kireç içeriği %4–7, pH
6.0–7.5 arasında, tuzluluk ise 0.7–1.γ mmhos/cm olduğu bildirilmiştir (Kocabaş ve ark., β01β).
Bu çalışmanın konusu farklı çimlendirme alanlarında karanfil bitkisi tohumlarının çimlenme fizyolojisinin
incelenmesidir.
2. MATERYAL VE METOD
2.1. Materyal, Uygulamalar ve Denemenin Kurulması
Bu çalışmadaν bitki materyali olarak karanfil çiçeği (Dianthus caryophyllus) kullanılmıştır. Toplam 34 bitki
tohumu ile çalışma gerçekleştirilmiştir. Tohumların çimlenmesi için perlitμtorf karışımı (1μβ oranında), açık
arazi toprağı ve torf-açık arazi toprağı karışımı (1μ1 oranında) kullanılmıştır. Tohumların 1β tanesi perlit-torf
karışımına, 11 tanesi açık arazi toprağına, 11 tanesi de torf-açık arazi toprağı karışımına ekilmiştir. Tohumlar
sıcaklık nem ve ışık miktarı gibi aynı fiziksel şartlara tabi tutulmuştur.
POSTER PRESENTATION
384
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tohumlar 45’li viyollere doğrudan ekilmiştir. Tohumlar ortalama 1 cm’lik derinliğe bırakılmıştır. Viyoller
sera içerisinde güneş ışığını aynı oranda alacak şekilde konumlandırılmıştır. Sulamada ölçüt olarak tohum
alanının nemli kalacağı şekilde yağmurlama sistemi kullanılmıştır. Ekilen tohumların periyodik olarak
günlük (gündüz ve gece) kontrolleri yapılmıştır.
2.2. Ortam Parametrelerinin Belirlenmesi
Çalışmada γ farklı karakterde çimlenme ortamı seçilmiştir. Bunlardan biri ticari olarak satılan torf
ortamlarından seçilmiştir. Diğer ortam ise açık arazi topraklarından alınmıştır. Bir diğer ortam ise yukarıdaki
farklı kültürdeki iki toprağın bire bir oranında karıştırılması ile elde edilen topraktır. Bu farklı toprak
türlerinin pH, iletkenlik, toplam organik madde miktarı, toprak cinsi belirlemek üzere fizikokimyasal
analizleri yapılmıştır.
3. SONUÇ
3.1. Fizikokimyasal Değerler
Çimlenmenin gerçekleştiği ortamın pH değeri, ortamın toplam tuzluluk miktarı, toplam organik madde
miktarı ve toprağın cinsi gibi fizikokimyasal ve mineralojik özellikleri tohum çimlenmesi için büyük önem
taşımaktadır. Aynı zamanda nem ve sıcaklık gibi fiziksel şartlar da çimlenme fizyolojisini etkileyen
etmenlerdendir. Çalışmanın yapıldığı toprağın fizikokimyasal özellikleri Tablo.1’de verilmiştir.
Çimlenme ortamı
Torf
Açık Arazi Toprağı
Tablo 1. Toprağın fizikokimyasal özellikleri
pH
6.1
7.7
iletkenlik
550
1004
Toprak Cinsi
Humuslu
Killi
OM
90.0
6.6
Bu çalışma Kasım-Aralık aylarında 60 günlük bir dönem içerisinde gerçekleştirilmiştir. Çalışmanın yapıldığı
sera ortamında ortalama sıcaklık değerleri gündüz βγ oC, gece 15 oC olarak tespit edilmiştir. Gece ve gündüz
ortalama nem değeri %60 olarak görülmüştür.
3.2. Bitkinin Fizyolojik Gelişimi
Tohumların ekimi ile başlayan süreçte ilk topraküstü sürgünler β5. günde çıktığı gözlemlendi. Yapılan
çalışma sonucunda çimlenme oranları perlit-torf karışımında %67, açık arazi topraklarında %γ6, torf-açık
arazi toprakları karışımında ise %6γ olarak tespit edilmiştir.
Tablo 2. Farklı ortamlarda çimlenme oranları
Örnek sayısı
Çimlenen tohum
sayısı
Çimlenme yüzdesi
Torf-Perlit (2:1)
12
8
67
Açık Arazi Toprağı
11
7
63
Torf- Açık Arazi
Toprağı (1μ1)
11
4
36
Çimlenme ortamı
Farklı çimlenme ortamlarında çimlenme yüzdeleri şekil 1. de verilmiştir.
Bu çalışmada karanfil çiçeğinin çimlenmesi için farklı çimlenme ortamları denenmiştir. Bunun için öncelikle
çimlenme ortamlarının analizi yapılmıştır. Tablo 1.’de görüldüğü gibi torfun pH düzeyi açık arazi toprağına
göre daha düşük seviyede olduğu görülmektedir. Bunun yanında tuzluluk miktarının torf ortamında daha
düşük seviyede olduğu anlaşılmaktadır. Organik madde miktarı açısından torf oldukça zengindir. Ancak açık
arazi topraklarına bakıldığında torfa göre düşük oranda olduğu görülse de zengin organik madde miktarına
sahip olduğu anlaşılmaktadır. Toprağın yapısı incelendiğinde tofun humuslu yapıda olduğu, açık arazi
topraklarının ise aşırı killi olduğu anlaşılmaktadır.
POSTER PRESENTATION
385
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
100
90
80
70
60
50
Çi le
40
e yüzdesi
30
20
10
0
Torf-Perlit (2:1)
Açık Arazi Toprağı
Torf- Açık Arazi Toprağı
(1:1)
Şekil 1. Çimlenme yüzdesi
Yukarıda gösterilen toprak özelliklerine göre en yüksek çimlenme oranı %67 ile torf-perlit ortamındaν en
düşük çimlenme oranı ise %γ6 ile açık arazi topraklarında gözlemlenmiştir. Çimlenme oranına pH,
iletkenlik, toplam organik madde miktarı, besin elementleri gibi etmenlerin etki ettiği bilinmektedir.
4. TARTIŞMA
Sulama, nem, sıcaklık, ışık miktarı gibi etkenlerin sabit ve eşit koşullarda olduğu düşünülürse çimlenme
oranlarında en büyük etkiyi pH miktarının oluşturduğu söylenebilir. pH seviyesi azaldıkça makro ve mikro
besin elementlerinin bitki tarafından alınabilirliği artmaktadır. Besin ortamı bazik yapıya dönüştükçe
besinlerin bitkiler tarafından biyoyararlanım miktarları azalmaktadır. Asidik özelliği daha fazla olan torf
ortamının (pHμ 6.1), açık arazi toprağına göre (pHμ 7.7) daha yüksek çimlenme oranına sahip olması literatür
bilgileri ile örtüşmektedir. Bunun yanında toprak tuzluluk oranı, toplam organik madde miktarı ve toprak
kirecinin de çimlenme oranına etkileri olduğu düşünülebilir. Toplam organik madde miktarının çimlenme
oranına etkisi göz ardı edilemez. Ancak iki toprak türünün de zengin organik madde içeriğine sahip olması
çimlenmeye etkinin karşılaştırılması açısından açık bir fikir vermemektedir.
Torf ile açık arazi toprakları bire bir oranında karıştırıldığında çimlenme yüzdesinin sadece torf olan besi
ortamına yakın olduğu görülmektedir. Buradan da tohum çimlendirmede maliyeti düşürme adına açık arazi
toprağı ile torf karışımının daha verimli olabileceği sonucuna varılabilir.
TEŞEKKÜR
Yapılan çalışmalarda değerli fikirleri ile bizlere yön gösteren ve destek veren Yrd. Doç. Dr. Mehmet
AYTEKİN ve Yrd. Doç. Dr. Mustafa PEHLİVAN’a teşekkürlerimi borç bilirim.
KAYNAKLAR
KOCABAŞ, I., ÇITAK, S., ASRİ, F. Ö., SÖNMEZ, S., & KAPLAN, M. (β01β). Depolanan ve
Depolanmayan Karanfil Çeliklerine Yapraktan Uygulanan Fe-EDTA Gübrelemesinin Karanfil (Dianthus
caryophyllus L.) Bitkisinin Beslenmesi Üzerine Etkisi. Anadolu Tarım Bilimleri Dergisi, βγ(β), 8γ-91.
KOCABAŞ, I., & KAPLAN, M. (β007). Farklı Gübre Uygulamalarının Karanfil (Dianthus caryophyllus L.)
Fidesi’nin Beslenme ve Renk Değerleri Üzerine Etkisi. Bahçe, γ6(1).
KOCABAŞ, I., & KAPLAN, M. (β007). Köklendirme Döneminde Yapraktan Uygulanan Farklı Gübrelerin
Karanfil (Dianthus Caryophyllus L)’in Beslenme, Kardeşlenme ve Kuru Ağırlığı Üzerine Etkisi.
MEDITERRANEAN AGRICULTURAL SCIENCES, 20(2), 301-309.
POSTER PRESENTATION
386
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Çeşitli hücre hatlarında Opunti ficus-indica spp. meyve ve yaprak ekstraktının in vitro
sitotoksik etkisinin araştırılması
Ilgın ŞİRİN1, Ata TURGUT1, Serpil YANBAKAN2, Demet İZGÜ1, Maksut COŞKUN3, Özgür
ŞAHİN4, Üstün EZER2, Ahmet Emin KÜREKÇİ2
TED Ankara Vakfı Özel Lisesi, Ankara
LÖSANTE Çocuk ve Yetişkin Hastanesi, Ankara, TÜRKİYE.
3
Ankara Üniversitesi, Eczacılık Fakültesi Farmasötik Botanik ABD, Ankara, TÜRKİYE
4
Bilkent Üniversitesi, Fen Fakültesi Moleküler Biyoloji ABD, Ankara, TÜRKİYE.
*1
2
Sorumlu yazar e-mail: serpilyanbakan@gmail.com
Özet
Türkiye’de Akdeniz kıyı bölgelerinde kendiliğinden doğal olarak yetişen devedikeni, kaynanadili, Frenk
inciri yerel adları ile bilinen Opuntia ficus-indica, antioksidan aktivite varlığı, antikanserojen ve
antiinflamasyon etkileri ile bilinen Cactus ailesine mensup bir bitkidir. Bu araştırma ile farklı dozlardaki
O. ficus-indica meyve ve yaprak ekstraktlarının prostat, meme ve kolon kanseri hücre hatları üzerindeki
sitotoksik etkisi methyl thiazolyl tetrazolium (MTT) testi ile değerlendirilmiştir. Optik dansite (OD), doz
bağımlı inhibisyon (%) ve hücre canlılığını kontrol hücre grubuna kıyasla %50 oranında azaltan etkin
doz (IC50) değerleri hesaplanarak elde edilen inhibisyon oranları karşılaştırılmıştır. Ekstrakt ihtiva
etmeyen kontrol hücre grubuna kıyasla, ekstraktların kanser hücrelerinin her üçüne birden 0,001-0,08
mg/ml değişen gayet düşük etkin IC50 doz aralığı ile %1λ-74 gibi yüksek oranda bir inhibisyon yüzdesi
gösterdiği belirlenmiştir. Ekstraktlara ait IC50 etkin dozların ve inhibisyon yüzdelerinin belirlenmesi
amacıyla SPSS ve Excel programları kullanılmıştır. Bu çalışma, bitkiye ait ekstraktların yaygın görülen
kanserli hücreler üzerindeki in vitro sitotoksik etkisinin detaylı olarak ele alındığı Türkiye’deki ilk
araştırmadır. Minumum dozlar ile elde edilen yüksek inhibisyon oranları, ülkemizdeki O. ficusindica’nın dünya üzerindeki benzerlerine kıyasla daha yüksek polifenolik ve antioksidan varlığına sahip
olduğunu düşündürmektedir. Araştırma, biyolojik ve tıbbi aktivite çalışmaları ile derinleştirildiğinde,
ülkemiz ve dünyadaki tamamlayıcı ve alternatif tıp ile aromatik bitki çeşitliliğinin sürdürülmesine katkı
sağlayacaktır.
Anahtar Kelimeler: Opuntia ficus-indica, in vitro, IC50, sitotoksisite, MTT, prostat, kolon, meme
kanseri hücre hatları.
1. GİRİŞ
Çalışmada ülkemizde doğal olarak yetişen Frenk inciri, Hint inciri yerel adları ile bilinen, kaktüsgiller
(Cactaceae) familyasında sınıflanan (Karamanoğlu, 1λ76) O. ficus-indica cinsinin tipik türü olan O. ficusindica ‘nın meyve ve yaprak metanol ekstarktları hazırlanarak kullanılmıştır. Antioksidan fenolik bileşikler
acısından zengin olan meyve, yaprak ve diğer kısımlarının antikansorejen ve sitotoksik etkisinin prostat,
kolon kanseri ve kronik hastalıklar üzerinde in vitro olarak değerlendirildiği çeşitli araştırmalar (ChavezSantoscoy, 2009, Kim ve ark., 2014, María ve ark., β017) mevcuttur. Bu bildiri ile bitkiye ait meyve ve
yaprak metanol ekstraktlarının üç farklı kanserli hücre hattı üzerindeki sitotoksik aktivitelerinin
karşılaştırılması amaçlanmıştır.
2. MATERYAL VE METOD
O. ficus-indica meyve ve yaprakları Antalya yöresinden Eylül-Ekim β016 tarihleri arasında toplanarak
metanol uçurma metodu (Su ve ark β008) ile meyve ve yaprak ekstraktları hazırlanmıştır. Her bir ekstrakt
%0,1 dimetil sülfoksit (DMSO) içerisinde çözdürülerek, her bir ekstrakt türü için dört ayrı doz (0,002 mg/ml,
0,001 mg/ml, 0,0002 mg/ml, 0,0001 mg/ml) hazırlanmıştır. İn vitro hücre ortamının sağlanması amacıyla,
American Type Cell Culture (ATCC -USA), Prostat (PC-3), Kolon (HCT 116), Meme (MDA MB 231)
karsinom (Ca) insan kanser hücre hatları kullanılmıştır. Her bir hücre hattı, β5 cm2’lik flasklarda %10 fötal
dana serumu (Capricorn, Germany), %1 antibiyotik katkılı (PenStrep) RPMI 1640, (Capricorn, Germany)
ilavesi ile 370C’de %5 CO2‘li ortamda kültüre edilmiştir. λ6 gözlü pleyt (Biologix) gözlerine 100’er µl 1×10 4
hücre/göz hücre ekimi yapılarak, %5 CO2’li inkübatör içerisinde γ7°C‘de 48 saat süreyle inkübe edilmiştir.
Her bir test materyali için altışar tekrarlı göz ayrılarak ilgili ekstraktın ilgili sulandırma basamağından her bir
göze 100’er µl konularak β4 saat süreyle inkübe edilmiştir. Sitotoksisite etkinliğini değerlendirmek amacıyla,
her bir göze β0 µl γ-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) konularak 3 saat
POSTER PRESENTATION
387
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
inkübasyon sonunda mavi renkli formazan kristallerinin oluşumu gözlemlenmiştir. Süre sonunda her bir göze
100 ηL DMSO konularak ELISA okuyucusu (OD 540 nm) ile değerlendirilmiştir. inhibisyon değerleriν %
İnhibisyon=[(OD örnek-OD blank)/(OD negatif kontrol-OD blank)]×100 formülü ile hesaplanmıştır. Bu
dozlara ait % inhibisyon değerleri XY dağılımı grafiğinden yararlanarak infektif doz 50 değeri (IC50 mg/ml)
ve R2 değerleri belirlenmiştir. IC50 değerleri, dağılıma ait eğilim çizgisi eğrisinden hesaplanmıştır.
İnhibisyon yüzdeleri arasındaki farkın istatistiksel açıdan anlamlılığının tespiti amacıyla, SPSS 15.0 istatistik
programı ile bağımsız örnekler t-testi, Kruskal-Wallis ve Mann Whitney-U veri analizleri kullanılmıştır.
İstatistiksel anlamlılık için p<0.05 değeri kabul edilmiştir.
3. SONUÇ
Bitkiye ait ekstraktların kontrol grubuna kıyasla kanserli hücre proliferasyonunu azalttığı gözlemlenmiştir.
Negatif kontrol yani ekstrakt içermeyen gözlerdeki sitotoksisite değeri %0 olarak yani %100 canlılık tespit
edilmiştir. Ekstraktlara ait doz miktarları ile inhibisyon yüzdeleri arasında pozitif bir korelasyon (p=0,018)
varlığı tespit edilmiştir. Buna göreν en yüksek (0,0β mg/ml) ve en düşük (0,001 mg/ml) yaprak metanol
ekstraktı dozları ile elde edilen en yüksek ve en düşük inhibisyon yüzdeleri, Prostat ca ile %74 ve %58ν
Kolon ca ile %48 ve %ββν Meme ca ile %50 ve %50ν meyve metanol ekstraktı -Prostat ca ile %52 ve %19;
Kolon ca ile %31 ve %19; Meme ca ile %β0 ve %β0 olarak belirlenmiştir (Grafik 1). IC50 etkin dozları
(mg/ml) (Tablo 1) karşılaştırıldığında, meyve ekstraktı ile en düşük etkinin (0,08 mg/ml) Meme ca ile ve en
yüksek etkinin (0,0018 mg/ml) prostat ca ileν yaprak ekstraktı ile en düşük etkinin (0,0019 mg/ml) kolon ca
ile ve en yüksek etkinin (0,001 mg/ml) prostat ca ile olduğu görülmüştür. Ekstrakt gruplarının hücreler
üzerindeki inhibisyon etkileri arasındaki farklılığın anlamlı olduğu bağımsız örnekler t-testi, (p=0,000) ve
ANOVA testi ile (Tablo β) belirlenmiştir. Bu farklılığın prostat ve meme kanseri hücre hatlarında daha
yüksek olduğu ve yaprak ekstraktı grubu lehine gerçekleştiği belirlenmiştir (Mann Whitney-U=14: z=-3,352,
p=0,001). Ekstraktların prostat (p=0,0β0) ve meme (p=0,01λ) hücre hattı üzerindeki etkisi, kolon hücre
(p=0,386) hattına göre anlamlı bir farklılık arz etmektedir. Her iki ekstraktın prostat ca hücreleri üzerinde
yüksek düzeyde, kolon kanseri hücre hattında orta seviyede ve istatistiksel açıdan anlamlı olmayan bir
sitotoksik etki oluşturduğu tespit edilmiştir (Şekil 1, Tablo γ).
80
Yaprak ekstraktı Prostat ca
%inhibisyonu
% İnhibisyon
70
Yaprak ekstraktı Meme ca
%inhibisyonu
60
50
Yaprak ekstraktı Kolon ca
%inhibisyonu
40
Meyve ekstraktı Prostat ca
%inhibisyonu
30
20
Meyve ekstraktı Kolon ca
%inhibisyonu
10
0
NK
0,001
0,002
0,01
0,02
(mg/ml)
Meyve ekstraktı Meme ca
%inhibisyonu
Grafik 1. Meyve ve yaprak metanol ekstraktlarına ait inhibisyon yüzdeleri.
Tablo 1. Meyve ve yaprak metanol ekstraktlarına ait IC50 ve Rβ değerleri.
Kanser Hücre Hattı Türü
Prostat kanseri hücre hattı IC50 Etkin Doz
(PC-3)
R2 değeri
Meyve
ekstraktı
0,0018 mg/ml
0,9839
Kolon kanseri hücre hattı IC50 Etkin Doz
(HCT-116)
R2 değeri
0,0047mg/ml
0,5758
0,002 mg/ml
0,8228
Meme kanseri hücre hattı IC50 Etkin Doz
(MDA-MB-231)
R2 değeri
0,0810 mg/ml
0,087
0,0013 mg/ml
0,1894
POSTER PRESENTATION
metanol Yaprak
ekstraktı
0,0010 mg/ml
0,9268
metanol
388
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Tablo 2. Independent t-test ve ANOVA test tabloları
Group Statistics: %inhibisyon ortalama±ssapma
% İnhibisyon
Ekstrakt türü N
Mean
Std. Deviation Std. Error Mean
Meyve ekst
12
25,98
10,715
3,093
Yaprak ekst
12
49,33
13,963
4,031
Sum
Squares
of df
ANOVA Table
Gruplar arası
% İnhibisyon
Ekstrakt türü
*
(Combined)
Mean Square F
Sig.
,000
3509,002
1
3509,002
Grup içi
3712,503
22
168,750
Toplam
7221,505
23
20,794
Şekil 1. Bağımsız örnekler t-testi kutu grafikleri
Tablo 3. Ekstrakt türü ve hücre hattına bağlı % inhibisyon ve etkin dozların karşılaştırılması
Ekstrakt türü
Yaprak ekst
Meyve ekst
Hücre Hattı
Prostat Ca
Meme Ca
Kolon Ca
Prostat Ca
Kolon Ca
Meme Ca
%İnhibisyon
(ortalama±standart sapma)
65,50± 7,7
48,75± 5,5
γ6,β5± 1β,γ
γ1,λ5± 16,1
β7,00± 6,7
1λ,00± 1,1
IC50
Etkin
(mg/ml)
0,001010000
0,001285005
0,001907059
0,001820157
0,004761261
0,080994621
Doz
4. TARTIŞMA
Bitkiye ait farklı ekstratların hücreler üzerindeki antikansorejen etkisinin araştırıldığı birçok araştırmada
(Butera ve ark., β00β, Khatabi ve ark., β01γ, Faten ve Rehab, β014) total fenolik bileşen miktarı ile
antikansorejen özelliğinin parelel bir artış içinde olduğu bildirilmektedir. Yaprak ve meyve ekstraktlarının
çeşitli kanser hücreleri üzerinde in vitro sitotoksik aktivesinin belirlenmesi amacıyla yapılan çalışmamızda,
bitkiye ait yaprak ekstraktının tüm hücre hatlarında %4λ,γ±1γ,γ ortalama inhibisyon ve 0,001-0,002 mg/ml
IC50 etkin doz aralığı ile istatistiksel olarak anlamlı bir düzeyde (p=0,000) bir sitotoksik etki gösterdiği
POSTER PRESENTATION
389
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
belirlenmiştir. Çalışmamız, meyve ekstraktı uygulanan kolon kanseri hücrelerinin meme kanseri hücrelerine
göre daha duyarlı olduğunu bildiren araştırmalar (Kim ve ark., β015) ile uyum göstermektedir.
Çalışmamızda meyve metanol ekstraktı-prostat ca ile elde edilen en etkili dozun (0,018 mg/ml), Kannusamy
ve Rengaswamy (β016) tarafından meyve metanol ekstraktı -HeLa hücreleri üzerindeki en etkili dozdan
(0,04 mg/ml) yaklaşık olarak dört kat daha duyarlı olduğu tespit edilmiştir. Bu çalışma ile elde edilen
bulgular, ülkemizdeki Opuntia ficus-indica’ya ait polifenolik ve antioksidan madde içeriğinin diğer Akdeniz
ülkeleri ile kıyaslandığında çok daha yüksek düzeylerde olabileceğini düşündürmektedir. Sonuç olarak,
ülkemize ait zengin bitki florasından sadece biri olan Opuntia ficus-indica’nın antioksidan ve apoptotik
etkilerinin, içerdiği biyoaktif bileşikler ve polifenoller düzeyinde ele alındığı daha ayrıntılı çalışmalar ile
değerlendirilmesi gerekmektedir.
KAYNAKLAR
Butera D, Tesoriere L, di Gaudi F, Bongiorno A, Allegra M, Pintaudi AM, Kohen R, Livrea MA 2002.
Antioxidant activities of sicilian prickly pear (Opuntia ficus indica) fruit extracts and reducing properties of
its betalains: Betanin and indicaxanthin. J. Agric. Food Chem, 50: 6895–6901.
Chavez-Santoscoy RA, Gutierrez-Uribe JA, Serna-Saldívar SO β00λ. “Phenolic composition, antioxidant
capacity and in vitro cancer cell cytotoxicity of nine prickly pear (Opuntia spp.) juices,” Plant Foods for
Human Nutrition, 64(2): 146-152.
Faten MAE, Rehab FMA 2014. Antioxidant and Anticancer Activities of Different Constituents Extracted
from Egyptian Prickly Pear Cactus (Opuntia ficus-indica) Peel. Abou-Elella and Ali, Biochem Anal
Biochem, 3:2. doi: 10.4172/2161-1009.1000158.
Kannusamy G, Rengaswamy G 2016. Anticancer Activity of Methanol Fruit Extract of Opuntia ficus indica
Against Cervical Cancer Using Hela Cell Line. Int J Pharm Bio Sci, 7(3): 712–720.
Karamanoğlu K 1λ76. Türkiye Bitkileri, Ankara Üniversitesi Eczacılık Fakültesi Yayınları, Sayıμ γγ, cilt 1.
Khatabi O, Hanine H, Elothmani D, Hasib A 2016. Extraction and determination of polyphenols and betalain
pigments in the Moroccan Prickly pear fruits (Opuntia ficus indica). Arab. J. Chem. 9(1): 278281.doi:10.1016/j.arabjc.2011.04.001.
Kim J, Soh SY, Shin J, Cho CW, Choi YH, Nam SY 2015. Bioactives in cactus (O. ficus-indica ficus-indica)
stems possess potent antioxidant and pro-apoptotic activities through COX-2 involvement. J Sci Food Agric.
95(13): 2601-6. doi: 10.1002/jsfa.6968.
María SSD, Ana-Paulina BR, Cécile HT, Françoise G, Anne NS 2017. Opuntia spp.: Characterization and
Benefits in Chronic Diseases. Review Article. Oxidative Medicine and Cellular Longevity. Volume
2017(2017): 1-17. Article ID 8634249,. doi.org/10.1155/2017/8634249.
POSTER PRESENTATION
390
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The Effects Of Some Plant Extracts On The Digestive And Urinary System
Yasemen ADALI1, Özlem ÖNEN2, Gülname FINDIK GÜVENDİ3, Hatice BEŞEREN4, Hasan
Basri ŞENER5
18 Mart University, Medicine Faculty, Medical Pathology Department,Çanakkale
2
Kafkas University, Science and Art Faculty, Biology Department, Kars
3
Recep Tayyip Erdoğan Üniversity, Medicine Faculty, Medical Pathology Department,Rize
4
Kafkas University, Veterinary Medicine Faculty, Pathology Department, Kars
5
Detay Pathology and Cytology Laboratory, Ankara
Corresponding Author: e-mail: hbeseren@ymail.com
Abstract
It is a very wide market, from herbal products to slimming medicines, to blends sold in transit. Many
herbal products have been used for years and are known to be useful. However, some herbal products
can cause serious side effects on the users. Traders say that most of these herbal products are natural.
Unlike medicines, herbal products are not tested before use and therefore can not be said to be safe.
Some of these products contain toxic substances and pollen; this can lead to diseases and side effects in
some people. Some of them may contain substances such as steroids and estrogens, which are not
mentioned on the label. Some of them contain poisonous substances such as arsenic, mercury, lead and
pesticide. Apart from this, it is very important to set the dosage as well as the content. Whether it's
medicine or herbal products, it's often the dose that causes toxicity. Excessive or unnecessary use causes
diseases. In this article we will try to show the positive and negative aspects of the histopathological
results on the digestive system and the urinary system of studies on current plant extracts.
Key words: Liver, Kidney, Pancreas, Plant extract
Introduction
Recently, the use of herbal products like medicine has become widespread. It is a very
worrying and anxious situation to recommend to people and institutions that are not sufficiently
competent in terms of healthcare identity through media (WHO traditional medicine strategy 2002–
2005). For this reason, the development of an approach that draws the scientific and ethical
framework of this subject has become a matter of responsibility for the institutions and individuals
working in this field (Mosihuzzaman et al., 2012) ( Wilt et al. 1998). In this article, we aimed to
draw attention once again to the digestive system of the drugs and the histopathological effects of
the drugs on the urinary system by compiling the studies done in the world and in our country
related to the plant extracts. The authenticity of the accumulation, experience and professional
practice of each study was seen as a wealth and in this article it was aimed to protect and develop
the health of the community and to take into account the scientific data available (De smet et al.,
β005) (Dickinson et al., β00λ) (Özyazıcıoğlu et al., β01β).
What is Herbal Extract?
Each plant has one or more active substances in its essence. This is the name given to the
extract of the plant which is used as extraction material by means of extraction and to be presented
as food supplement to human health and also used as medicine raw material (Traditional Medicine)
(Hansel et al., 1996) (Tanker, 1985, 1990).
How to Plant Extraction?
It is obtained as a result of carrying out osmosis processes using special extraction methods
from dried plants (Heinrich et al., 2004).
Use Case Extraction Plant in the World and Turkey
The use of herbal products is based on thousands of years. They have been in use since the
3000's on the use of these products and are known to have been used for 60,000 years
(Mosihuzzaman et al., 2012). According to a report by the World Health Organization, 70-80% of
POSTER PRESENTATION
391
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
the world population is registered for primary health care applications (The ABC Clinical Guide to
Herbs, Blumenthal M (Ed), American Botanical Council/Thieme, New York 2003). It is also
recorded that in the United States, $ 60 billion has been spent on this area each year and $ 5 million
has been spent in Europe since 2003, while 80% of African societies are recorded. In the study of
45,748 people in the 50-75 age group in the United States, those who are older are using more
herbal extracts / herbal products than those of younger ones, those who have higher education status
than those who are younger and those with normal body mass index (Tilburt et al., 2012). In
Malaysia, 33.9% of participants used vegetable products. In Turkey, admitted to a university
hospital 4 of every 10 mothers (45.2%) was recorded these types of products it makes available to
the child (Dickinson et al., 2009) (Satia-Abouta et al., 2003).Yet among 12 cancer patients under
the age of 18 was recorded in a study conducted in Turkey have applied to at least 73.3% of such
applications (Karalı et al., β01β).
Reasons for Use of Plant Extracts
Many factors influence the frequency of use of these products. When these factors are
examined, we can begin by increasing the use of process change in the concept of health (How safe
is traditional medicine) (WHO Traditional medicine strategy 2002–2005). In other words, reduced
trust, inequalities, expensive treatment options, and inability to reach everybody, hinders access to
modern medical options cause individuals to have a tendency to produce individual solutions to
health problems (Stasio et al., 2008).
The responsibility of not having a societal point of view and maintaining the good state is
left to the preference and application of the individual, but it also leads to the use of these
medicines. These drugs are also used for reasons such as believing that these drugs are natural,
increasing the progressive diseases due to age progression(Ruparel et al.,2011). We have also
mentioned above that the scientific researches on the use of these drugs, which are produced by
means of supporting rules. For example, according to a study done in the united States, the reasons
for using joints as pain relief, prevention of memory loss, decreased fatigue state(Şen et al., β010).
Women use more than men. Apart from that, shelf stands as an obstacle to effective and reliable
applications with product sales application. These products are easily accessible(Mesina et al.,
2006). And they have increased the use of their discourse that they are naturally harmless in
exaggerated media programs (İzzo et al., β00λ) (Hsieh et al.,β01β)(Kaefer et al., β01β).
Health Risks of Using Plant Extracts
Pharmacognosy of plant extracts needs to be assessed from the point of collection of the
correct part of the plant, detection of the active ingredients, heavy metal and microbial
contamination. If assessment has not been made and the effects / risks have been put on the market
without proof, it can lead to many health problems.
There are many studies on this subject. These products have been shown to contain many toxic
substances, poisons, heavy metals, chemical poisons. In addition, due to its pharmacokinetic
properties it can cause toxicity when consumed with other medicines and even lead to death. The
liver toxicity caused by these products also leads to liver failure. Hypertension is also the result of
the phytochemical properties of the prolongation of bleeding time.
The Effect of Plant Extracts on the Digestive System
Unconscious use of plant extracts can cause some discomfort in our digestive system. For
example, unconscious aloe vera and extracts from Sweetgum tree plant can cause abdominal pain,
diarrhea, Chappenal plant extract liver damage, John's wort extract digestive system complaints,
Senna extract abdominal pain, liver damage. Also after the unconscious use of the GI bleeding, the
event is dramatizing until the liver failure.
Effect of Plant Extracts on Urinary System
As in the digestive system, unconscious consumption of the extract in the urinary system
causes disturbances. Particularly when the kidneys are not dosed, they are damaged, kidney stones
are formed and further progression to renal failure. For example, unconscious consumption of
Chappenal and Flavonoid plant extracts causes renal damage.
POSTER PRESENTATION
392
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Histopathological Effects of Digestive System and Urinary System on Plant Extracts
Histopathological effects of many plant extracts were investigated by various doses of oral,
intravenous, intraperitoneal, intramuscular and various routes on mice. For example, Modaresi and
colleagues administered ginger extract intraperitoneally to male rats at doses of 10 mg, 20 mg and 40 mg for
48 days at intervals of 20 days. This application has looked at the effects of liver, kidney. The results are as
follows; 10 mg and 20 mg administration: histopathological findings in the liver are normal. Very few
harmful effects have been observed in the kidneys. In 40 mg administration; Renal tubular degeneration,
glomerulosclerosis and germerul hyperatrophy were seen in the kidneys, increased toxicity, increased
interstitial inflammation, hyalin and basement membrane thickening. In this application, no abnormal
findings were found in the liver, especially kidney damage (Modaresi et al., 2011). In another study, Land
and colleagues administered male Rhaphidophora decursive plant extract to male rats for orally in the form
of 140 mg, 210 mg, 2100 mg, 3500 mg for 28 days. They eventually looked at the histopathological effects
of kidney and liver. Given the histopathological effects of renal, 2100 mg and 3500 mg doses were noticed in
granular cell formation and 3500 mg dosing, especially acute toxicity and protein increase. Acute toxicity
and granular cell formation were also observed in the 210 mg dose application (Figure-1, Figure-2). In liver
histopathological examination; At doses of 2100 mg and 3500 mg, active kupffer cells, sinicoidal dilation,
cytoplasmic vacuolization were observed. Chronic toxicity and cytoplasmic vacuolization were observed in
140 mg and 210 mg dose applications (Figure-3) (Arsad et al., 2014).
Figure 1: Pathological changes in kidney tissue. GC: Granular cast, CC: Cytoplasmic cast (HE, X400)
(Arsad et al., 2014).
Figure 2: Pathologic changes in kidney tissue. PC: Protein cast (HE, X400) (Arsad et al., 2014).
POSTER PRESENTATION
393
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 3: Pathological changes in the liver. CPV = Cytoplasmic vacuolation, CV = Central vein, KC
Kupffer cell, SD = Sinusodial dilatation (HE, X400) (Arsad et al., 2014).
Nottidge and colleagues in Nigeria have been able to extract Garcinia Coke with ethenol to feed on
three dogs, 500 mg, 1000 mg daily for three meals a day for 6 weeks. Histopathological evaluation of various
organs of otopside made at the end of 6 weeks. Necrosis, mononuclear aggregates, and mild portal fibrosis
were seen in 1000 mg administered group as well as vacuolar degeneration in hepatocytes in the liver of 500
mg IUggulana groups. In addition, neutrophils, lymphocytes, macrophage formation and mild periportal
fibrosis and kupffer cell proliferation were observed (Figure 4). When the kidney sections are examined;
multiple focal glomerular degeneration areas, and coagulative necrosis of focal mononuclear cell aggregation
of proximal tubules (Figure 5). In addition, the cortex and medulla have pink tubules casting (Figure 5).
When the small intestine sections were examined, mild villous atrophy, goblet cell hyperplasia, lamina
propria and submucosa showed diffuse neutrophil and lymphocyte infiltration (Figure 6). These appearances
were more severe in 1000 mg applications. In the testis sections, 500 mg doses of the animals were also
irregularly found in about 70% of the seminiferous tubules, and the epithelial cells were hypoplasic. At 1000
mg doses, semen tubules were found to be severely fibrotic (Figure 7) (Notidge et al., 2008).
Figure 4: A dog liver examination given 1000 mg / kg G. coke extract for 6 weeks. Severe vacuolar
degeneration and necrosis of hepatocytes, mononuclear cell aggregations in the liver and mild portal fibrosis
(H & E; x450) (Notidge et al., 2008).
POSTER PRESENTATION
394
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 5: A dog kidney examination with 500 mg / kg G. coke extract for 6 weeks. In kidneys, a large
number of focal glomerular degeneration sites, coagulative necrosis of proximal tubules and focal
mononuclear cell aggregates. Also pinkish tubular casts in the cortex and medullary (H & E; x450) (Notidge
et al., 2008).
Figure 6: A small intestine examination of a dog given 500 mg / kg G. coke extract for 6 weeks.
Moderate villous collapse and mild goblet cell hyperplasia (H & E; x600) (Notidge et al., 2008).
Figure 7: A dog testis given 500 mg / kg G. Coke extract for 6 weeks review. Severe testicular
hypoplasia, absence of live spermatids and spermatozoa in seminiferous tubules (H & E; x600)
(Notidge et al., 2008).
Abalaka and his colleagues conducted a 96-hour application of Clarias grariepinus named
Adenium obesum root shell with ethanol at different doses and finally dissected and liver sections
were examined by hematoxylin eosin staining. According to the results of the study, 6.25 mg
POSTER PRESENTATION
395
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
administration showed clogging in hepatocyte vessels (Figure 8). In 7.50 mgL administration, liver
cell defense mechanism was introduced and mononuclear infiltration increased and hepatocyte
vacuole formation was observed in liver asinus cells (Figure 9). 8.20 mgL administration also
increased hepatocyte vacuoles (Figure 10). In the 8.80 mgL application, severe clogging of the data
structures and deterioration of the liver structure were observed (Figure 11). In the 9.30 mgL
application, degeneration and haemorrhagic foci were increased in hepatocytes (Figure 12)
(Abalaka et al., 2015).
Figure 8: You will see the first cross-sectional liver cross-section. The area marked with a black
arrow is the center ven and the area marked with a red arrow is the hepatocyte vocalis cells. Central
venous occlusion was observed at the end of the 6.25 mgL application of the second section (H & E
x 64) (Abalaka et al., 2015).
Figure 9: The mononuclear infiltration cells and the red arrows of the structures marked with the
black arrow on the liver of the 7.50 mgL application showed hepatocyte vacuole cells in the liver
asinus cells (H & E x 64.) (Abalaka et al., 2015).
POSTER PRESENTATION
396
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 10: Figure 10: Hepatocyte vacuole cells in areas marked with a red arrow on the hepatic
liver examination with 8.20 mgL (H & E x 64.) (Abalaka et al., 2015).
Figure 11: The area marked by the black arrow shows ven cocktail in the liver study with 8.80
mgL, while the area marked with red arrow shows the deterioration of the liver structure (H & E x
64.) (Abalaka et al., 2015).
Figure 12: Areas showing green arrows on liver examination with 9.30 mgL applied degenerated
hepatocyte and hepatocyte necrosis, area marked with blue arrow Hepatocyte vacuums and areas
marked with red arrow Lobular haemorrhagic foci (H & E x 64. )(Abalaka et al., 2015).
Uboh et al. Have looked at how psidium guajava plant extract acts on mouse liver enzymes, as
well as hematological and histopathological effects. Blood and liver tissues were examined at the
end of the application by 200 mg / kg oral route for 30 days. Kanda AST, ALT and ALP values
were examined. Blood values were found to increase slightly above normal. Histopathologic
POSTER PRESENTATION
397
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
examination revealed an increase in hepatocytes and a more prominent appearance of sinusoids.
And the liver is considered relatively normal (Uboh et al., 2010).
In 2010, Mohammadi and his colleagues applied the plant extract named Morus alba to the
diabetic rats in India and examined their pancreas. Were injected intraperitoneally with a 400 mg /
kg and 600 mg / kg intraperitoneal injection over 72 hours for 35 days. When the type-1 diabetic
pancreas was examined, damaged nerve cells and ί-cells and langerhans islets showed increased
necrosis. Necrosis was reduced at the end of the application of 400 mg / kg, and ί cells appeared to
have a better appearance. No necrosis was observed after 600 mg / kg administration. As a result,
the therapeutic effect of this plant extract has been elucidated and it has been noted that it
regenerates damaged cells and corrects ί cells (Mohammadı et al., β010).
Figure 13: Pancreatic cross section of diabetic mice in control group. EX: Exocrine pancreas, beta
cell: beta cells, RBCs: red blood cells (CHP staining, 400x) (Mohammadı et al., 2010).
Figure 14: Pancreatic cross section of diabetic mice in control group. Increased necrosis has been
demonstrated with beta cells and langerhans islets damaged in the exocrine region in the Type-1
diabetic pancreas. EXμ Exocrine pancreas, ί cell: beta cells, RBCs: red blood cells (CHP staining,
400x) (Mohammadı et al., β010).
POSTER PRESENTATION
398
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 15: Rat pancreas screening with type-1 diabetes at 400 mg / kg. Regularly distributed ί
cells.
EXμ Exocrine pancreas, ί cellμ beta cells, RBCsμ red blood cells (CHP staining, 400x) (Mohammadı
et
al., 2010).
Figure 16: Rat pancreas screening with type-1 diabetes at 400 mg / kg. Regularly distributed ί
cells.
EXμ Exocrine pancreas, ί cellμ beta cells, RBCsμ red blood cells (CHP staining, 400x) (Mohammadı
et
al., 2010).
In another diabetes study, plant extracts of S. Xantocarpum and P. Kurroa were applied to
diabetic
rats and positive changes were noted in the kidney, anchorose and liver at the end of the
administration
(Malar and Bai 2009).
In the study of the alferaha, Lawsonia inermis named plant extract was given to the animals
peritoneally in the form of 200 mg and 1000 mg for 42 days. At the end of the study, the liver,
spleen
and kidney structures were examined. Animals treated with 200 mg / kg showed moderate
degenerative changes in renal sections and renal tubular damage. When the kidney section of
animals
POSTER PRESENTATION
399
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
was examined at 1000 mg / kg dose, cell death increased. When liver sections of 200 mg / kg
animals
were examined, degeneration and lymphocytic infiltration of hepatocytes were observed. Bile duct
epithelium hyperplasia in liver lecithins, hyalinization in portal area hepatic arterioles, and highly
lymphocytic infiltration were observed in 1000 mg / kg animals. No abnormal findings were
observed
in the splenic sections of animals in both doses (Alferah, 2012).
Figure 17: Examination of the kidney section. 1a showed normal glomerulus and kidney
tubules with arrow marks. Administration of 200 mg / kg at 1b showed mild degeneration of
the kidney epithelium and priming of the kidney tubules. 1000 mg at 1C showed cell death at
the end of administration. Apoptosis is shown with arrows (HE 400X)(Alferah, 2012).
Figure 18: Cross section of the liver. In 2a, normal liver section was shown. Arrows showed
normal hepatocytes. At 2b, 200 mg / kg dose resulted in moderate degeneration in the liver.
Hepatocyte degeneration with arrows, stellate lymphocytic infiltration was demonstrated. At 2c
doses of 1000 mg / kg doses resulted in severe grade degeneration. Lymphocytic infiltrates on the
portal area with arrows, bile duct epithelial hyperplasia and hyalinization findings present in arterial
walls have been shown (HE X) (Alferah, 2012).
POSTER PRESENTATION
400
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 19: Spleen cross section examination. Normal findings were observed in all 3 sections
including normal sections (W, white pulp, R, red pulp, C, central arteriole) (HE X) (Alferah, 2012).
RESULT
The studies on herbal medicines, which have been practiced in traditional custody since
centuries, have been reviewed and summarized concretely. According to the evaluation made, the
importance of these plant extracts is very important. While it may be beneficial to certain doses,
doses above a certain limit may create a risk factor for health. It was recorded in studies that
particularly harm liver and kidney structures. It has also been noted that not only in high vertebrate
living organisms, but also in water-borne living organisms, severe over-dose application has also
severely damaged the liver. In addition, some plant extracts have been administered with controlled
doses for diseases that are particularly difficult to treat, such as diabetes, and have been shown to be
partially healed.
As a result; In studies performed, single plant extracts are used and doses are adjusted
according to kg. For herbal extracts that are put on the market to prevent disease and not become ill,
we can say that; These medicines, which you do not know about their content and dose, can cause
serious health problems and lead to liver and kidney failure in particular.
REFERENCES:
Mehrdad Modaresi, Mozhgan Ghobadi Pour, Sayed Ali Tabeidian , Alireza Jalalizand 2011. Study
of Histopathologic changes of the effect of Zingiber extract on mice kidneys 2011 International
Conference on Food Engineering and Biotechnology vol.9.
Nottidge H. O.Omobowale T. O., Taiwo V. O., Omotoso M. A. 2008. Histopathological Studies on
the Effects of the Ethanolic Extract of the fruits of Garcinia kola on Selected Organs of the Dog. Int.
J. Morphol., 26(4):1067-1072.
Ablaka, S. E., Fatıhu, M. Y., Ibrahım, N. D. G. and Ambalı, S. F.β015. Liver histopathological changes in
Clarias gariepinus exposed to ethanol extract of Adenium obesum stem bark. J. Morphol. Sci. , vol. 32, no.
1, p. 22-28.
Friday E. Uboh, Iniobong E. Okon, Moses B. Ekong 2010. Effect of Aqueous Extract of Psidium
Guajava Leaves on Liver Enzymes, Histological Integrity and Hematological Indices in Rats.
Gastroenterology Researc;3(1):32-38.
POSTER PRESENTATION
401
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Jamshid MOHAMMADI , Prakash R. NAIK 2012. The histopathologic eff ects of Morus alba leaf
extract on the pancreas of diabetic rats. Turk J Biol 36;211-216 TUBİTAK doiμ10.γλ06/biy-100851.
Malar and Bai.2009. Histopathological Studies of Plant Extract Treated and Control Diabetic Rats.
Mosaid A. Z. Alferah 2012. Toxicity Induced Histological Changes in Selected Organs of Male
(Wistar) Rats by Lawsonia inermis Leaf Extract. European Journal of Medicinal Plants, 2(2): 151158.
Willcox ML, Bodeker G.2004. Traditional herbal medicines for malaria. BMJ;329:11569.
WHO traditional medicine strategy 2002–2005.
Geneva: WHO; 2002.
Tilburt JC, Kaptchuk TJ. 2012. Herbal medicine research and global health: an ethical analysis.
http:// www.who.int/bulletin/volumes/86/8/07-042820/en/. 26.8.
De Smet PA. 2005. Herbal medicine in Europe--relaxing regulatory standards. N Engl J Med;
352:1176.
Dickinson A, Boyonand N, Shao A.2009. Physicians and nurses use and recommend dietary
supplements: Report of a survey/ Nutr J. 1;8:29.
Haensel R, Hölzl J. 1λλ6. Lehrbuch der pharmazetischen Biologie, Springer Verlag ,BerlinHeidelberg New York.
Türkiye’ye Özgü Beslenme Rehberi β004, Sağlık Bakanlığı Yayınları, Ankara.
Traditional Medicine 2012. http://www.who.int/topics/traditional_medicine/en/
Mosihuzzaman M. 2012 Herbal medicine in healthcare--an overview. Nat Prod Commun; 7(6):80712.
Ozdemir B, Sahin I, Kapucu H, Celbis O, Karakoc Y, Erdogan S, Onal Y. 2012 Feb 21. How safe is
the use of herbal weight-loss products sold over the Internet/ Hum Exp Toxicol.
Traditional Medicine. http://www.who.int/mediacentre/factsheets/fs134/en/index.html. 2.9.2012.
Chan K. 2003. Some aspects of toxic contaminants in herbal medicines. Chemosphere ;52(9):136171.
Tanker N, Tanker M. 1985 ve 1990. Farmakognozi Cilt 1 ve 2, Ankara Üniversitesi Eczacılık
Fakültesi Yayınları No 58 ve 65, Ankara Üniversitesi Basımevi Ankara.
Bruneton J. 1995. Pharmacognosy, Phytochemistry, Medicinal Plants, Lavoisier Publishing, Paris.
Haensel R, Sticher O, Steinegger E.1999. Pharmacognosie-Phytopharmazie, Springer
Verlag,Berlin, New York, Tokio.
Heinrich M, Barnes J, Gibbons S, Willamson E. 2004. Fundamentals of Pharmacognosyand
Phytotherapy, Churchill Livingstone,Edinburgh.
Wilt TJ, Ishani A, Stark G, 1998. Saw palmetto extracts for treatment of benign prostatic
hyperplasia: a systematic review. JAMA; 280:1604.
The ABC Clinical Guide to Herbs, Blumenthal M (Ed) 2003, American Botanical Council/Thieme,
New York.
Chan K.2003. Some aspects of toxic contaminants in herbal medicines. Chemosphere;52(9):136171.
Ohnishi N, Yokoyama T. 2004. Interactions between medicines and functional foods or dietary
supplements. Keio J Med.; 53: 137-150.
Sparreboom A, Cox MC, Acharya MR, Figg WD. 2004. Herbal remedies in the United States:
Potential adverse interactions with anticancer agents. J Clin Oncol.; 22: 2489-2503.
Satia-Abouta J, Kristal AR, Patterson RE, Littman AJ, Stratton KL. 2003. White E. Dietary
Supplement and Medical Conditions the VITAL study Am J Prev Med; 24(1):43-51.
Honda K, Jacobson JS. 2005. Use of complemantary and alternative medicine among United States
adults: the influences of personality, coping strategies, and social support. Preventive Medicine,
40:46-53.
POSTER PRESENTATION
402
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Kayaalp O. 1λλ8. Klinik Farmakolojinin Esasları.β. baskı, Hacettepe Taş Ankara,2001. 48 Winslow
LC, Kroll DJ. Herbs as medicines. Arch Intern Med;158:2192-2199.
Linde K, Mulrow CD.β00γ. St John’s wort for depression (Cochrane Review). Inμ The Cochrane
Library, Issue 3,. Oxford: Update Software.
Aziz Z, Tey NP. 2009. Herbal medicines:prevalance and predictors of use among Malaysian adults
Complement Ther Med;17(1):44-50.
Özyazicioğlu N, Ogur P, Tanriverdi G, Vural P.β01β. Use of complementary and alternative
medicine and the anxiety levels of mothers of children with chronic diseases. Jpn J Nurs
Sci;9(1):19-2
Karalı Y, Demirkaya M, Sevinir B. β01β.Use of complementary and alternative medicine in
children with cancer: effect on survival. Pediatr Hematol Oncol.;29(4):335-44.
Şen B, Meriçli F. β010. Boswelia serrata ve Bosvelik Asit Türevlerinin Artrozlarda Etkisi, Fitomed
Bilimsel Fitoterapi Dergisi,14 : 36- 40.
Stjernberg L, Berglund J, Halling A. 2006. Age and gender effect on the use of herbal medicine
products and foodsupplements among the elderly Scand J Prim Health Care.;24(1):50- 5.
Bateman J, Chapman RD, Simpson D.1998. Possible toxicity of herbal remedies. Scott Med
J.;43(1):7-15.
Izzo AA. 1998. Interactions between Herbs and Conventional Drugs: Overview of the Clinical
Data. Med Princ Pract. ;21(5):404-28.
Hsieh CF, Huang SL, Chen CL, Chen WT, Chang HC, Wu ML, Yang CC.2012. Increased risk of
chronic kidney disease among users of non-prescribed Chinese herbal medicine in Taiwan. Prev
Med. 2012 Aug;55(2):155-9. Epub.
Kaefer CM, Milner JA. 2011. Herbs and Spices in Cancer Prevention and Treatment. In: Benzie
IFF, Wachtel-Galor S, editors.
Faydaoğlu E, Sürücüoğlu MS.β011. Geçmisten Günümüze Tıbbi Ve Aromatik Bitkilerin
Kullanılması ve Ekonomik Önemi. Kastamonu Üni., Orman Fakültesi Dergisiν11 (1)μ 5β-67.
Sinmez CC, Yaşar A.β011. Animal-Based Drugs Employed At Folkloric Veterinary Medicine in
Bozlak Culture of Central Anatolia. Lokman Hekim; Supplement, 12.
Canooğlu E, Atatuş Y, Bekyürek T. β010. Organik Hayvancılıkta Veteriner Homeopati, Türkiye I.
Organik Hayvancılık Kongresi Kelkit.
Chan TY. 2009. Potential risks associated with the use of herbal anti-obesity products. Drug Saf.
;32(6):453-6.
Yarsan E. β007. Veteriner Sağlık Ürünleri ve Sebest Veteriner Hekimil Sempozyumunun ardından.
Türk Veteriner Hekimleri Birliği Dergisiν7(1-2):34-41.
Dokuzuncu Kalkınma Planı (β007-β01γ), Veteriner İlaç Sanayii Çalışma Grubu Raporu, β01- 237.
Bischoff K, Guale F. 1998. Australian tea tree Oil Poisoning in three purebred cats, Journal of
Veterinary Diagnostic Investigation;10:208.
Villar D, Knight MJ, Hansen SR, Buck WB.1994. Toxicity of melaleuca oil and related essential
oils applied topically on dogs and cats. Vet Hum Toxicol;36(2),139-42.
Levy B. The Complete Herbal Book For The Dog, Faber and Faber Limited, 1950, 24 Russel
Square, London.
Birinci S. β008. Doğu Karadeniz bölgesinde doğal olarak bulunan faydalı bitkiler ve kullanım
alanlarının araştırılması. Çukurova Üniversitesi, Fen Bilimleri Enstitüsü, Yüksek Lisans Tezi.
Şarışen Ö, Çalışkan D.β005. Fitoterapiμ Bitkilerle Tedaviye Dikkat.STED;14(8):182-187.
POSTER PRESENTATION
403
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
The Effects of Arsenic on the Digestive System Histology
Özlem ÖNEN1, Yasemen ADALI2 , Gülname FINDIK GÜVENDİ3, Hatice BEŞEREN4, Hasan Basri
ŞENER5
1
Kafkas University, Science and Art Faculty, Biology Department, Kars
8 Mart University, Medicine Faculty, Medical Pathology Department,Çanakkale
3
Recep Tayyip Erdoğan Üniversity, Medicine Faculty, Medical Pathology Department,Rize
4
Kafkas University, Veterinary Medicine Faculty, Pathology Department, Kars
5
Detay Pathology and Cytology Laboratory, Ankara
2
Corresponding Author: e-mail: hbeseren@ymail.com
Abstract
Arsenic is a natural element and is present in trace amounts in all living materials that live in water, on
rocks, in plants, in animals. Worldwide chronic arsenic poisoning has become a threat to human health.
Arsenic exposure is most often transmitted from contaminated water and food. It is the most harmful
substance in drinking water and it is mixed with minerals. In some regions, volcanic movements, forest
fires and erosion of rocks increase the amount of arsenic in groundwater.Arsenic, which is used as an
agricultural or industrial pollutant, food preservative or agrochemical, can also be mixed with drinking
water. Arsenic is not transmitted by direct contact and it needs to be taken orally to cause disease.
However, some research shows that arsenic also causes increase in skin pigmentation and makes crust by
contact. Apart from this, arsenic is also used in dentistry and can also give damage to teeth, palate and
tongue. It is aimed to summarize the histopathologic changes that occurred in digestive system after the
ingress of arcenic to the body in the light of previous studies.
Keywords: Arsenic, Liver, Bowel, Stomach, Digestive system.
1. Introduction
It is classified as most gray-yellow crystals, organic and inorganic, nonmetallic, meta-looid (metal to
ametal) most common in the earth's crust (Yağmur ve ark., β00β, Başkan ve ark. β00λ). Underground water
passes through the soil and rock and dissolves certain compounds such as arsenic to allow it to mix with the
water, which ensures it is in the most water. Most of the inorganic arsenic species found in water are arsenite
(As (III)) and arsenate (As (V)). The pH of the water, redox potential and the presence of complex ions such
as sulfur, iron and calcium determine the species and distribution of Arsenic.Although it is used as raw
material in agriculture, pharmacy and most common industries, it is a toxic and carcinogenic substance
(Başkan ve ark. β00λ) .
2.Arsenic Resources
2.a. Natural Resources: Soil is found naturally in some rocks, including lead and copper ores. The dust that
the wind carries can pass into the air and the water, which is infiltrated into the ground (Chou and Rosa,
2003).Natural resources of Arsenic include springs, volcanic rocks, sedimentary rocks (organic / inorganic
clay), metamorphic rocks, seawater and mineral deposits (EPA, 2003). In addition, volcanic movements,
rock erosion and forest fires are among the natural resources of the arsenal (EPA, 2003).
2.b. Anthropogenic Sources: The anthropogenic sources of Arsenic are quite diverse. Industrial products
containing arsenic include wood, timber protection, cosmetics, paint operations, pharmaceutical industry,
herbicide industry, semiconductor material production, leather production, glass production, medical use,
paper and paper clay production and cement businesses. In addition, copper, nickel, gold mining and ore
disposal operations, agricultural applications, use of fossil fuels, and landfill leachate are among the
anthropogenic sources of arsenic (EPA, 2002). Among the most important human activities that cause
arsenic formation are the use of agrochemicals and mining activities that destroy harmful plants and insects
POSTER PRESENTATION
404
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
(Mandal et al., 2002; Moore, 2005).The use of arsenic-containing pesticides is one of the non-point
anthropogenic sources of arsenic (President et al., 2009).
3. Effects Of Arsenic On The Body
There are arsenic in many organic and inorganic materials. Inorganic arsenic is absorbing very quickly in
the living body. It has been documented in many studies that have chronic toxicity in vivo. In the whole
world but especially in southeastern Asia, it is transmitted from drinking water (WHO 2001; IARC 2004).
According to the researches carried out again, arsenic is the most contaminated with water and causes the
skin lesions first in the living organisms. In particular, melanosis (increased pigmentation of the skin),
keratosis (papillary skin lesions in rough, dry appearance) (WHO 2001). After the skin, it affects our
reproductive, neurological, cardiovascular, respiratory, hepatic, hematological systems.Extreme exposure
leads to end-stage diabetes and cancer (Morton ve ark. 1994; Naqvi ve ark. 1994; Mandal ve ark. 2002; Ng
ve ark., 2003; Yoshida ve ark. 2004; Kapaj Et al. 2006; Wang ve ark. 2007; Chen ve ark. 2007). In addition,
during pregnancy can enter the placenta and fetal growth factors, DNA repair may be disturbed, may cause
immunosuppression. When taken orally, people have nausea, vomiting and diarrhea. Also on the lips are
burning, swallowing difficulty, constant thirst and various abdominal colic. In addition, the epithelium in the
gastrointestinal tract damages the cells causing irritation. İn more advanced stages, the bleeding diabetic
cause is associated with varicose veins and gastrointestinal bleeding due to portal hipertension.
Splenomegaly (hypersplerism) is seen in many cases in the western study (NRC 1999, Mazumder et al.,
1997).
4. Research Sıgnıfıcance
Arsenic is one of the substances found in nature. In our everyday life, our life mixes with the most water.
It is also used as an additive in fields such as agriculture and health. It enters the body of living things orally
and creates deformation. Leading to death when taken in advanced doses. When taken orally, it affects the
digestive system first. The purpose of this compilation is to show the structural and functional effects of the
arsenic on the digestive system.
5.Results
Studies are usually done on rats and monkeys and liver, bowel and stomach hematoxylin-eosin is
evaluated. It has been shown that structural changes in the arsenic given at low doses lead to pathological
changes in high doses.In addition, the most important target in gastrointestinal toxicity in organs is the liver,
the most pathologic findings being seen here.
Arsenic intake at doses of 00.1 to 0.1 mg per day leads to liver damage (Liu et al., 2002).Histologically,
protal fibrosis and necrosis are seen and cirrhosis occurs later (Mazumder et al.,1997).The critical target for
arsenic is the gastrointestinal system, causing hemorrhage in the organs of this region and forming lesions
(Uede et al., 2003, Vantroyen et al., 2004). In humans, reports of diffuse inflammation and hepatocellular
degeneration have been noted in the gastrointestinal tract (Jaghabir et al., 1989).
Nausea, vomiting, abdominal pain, hyperactive bowel and diarrhea are seen in clinical findings when 67
mg dose is taken daily (Lee et al., 1995). When a dose of 72.4 mg per day is taken, edema, hemorrhage,
necrosis, ulcerated or perforated intestinal mucosa are seen in the thick intestinal mucosa. Histopathological
examination revealed epithelial columnar squamous metaplasia in the large intestine mucosa (Arnold et al.,
2003, Gur et al., 1991). Hepatic findings: In the studies performed, hepatic lobules were not impaired in the
control tissues and hepatic and vacuolary degeneration marked hepatic necrosis in hepatocyte and vacuol
degeneration in the liver of the rats exposed to arsenic (Figure 1, Figure 2) (Noman et al., 2015).
Mazumder and his colleagues gave monkeys a dose of 80 mg arsenic for 28 days, liver injury,
portal travma fibrosis, central venous occlusion, increase in hepatocytes, moderate degeneration and
necrosis, There is a mild to moderate increase in fat in the parenchyma. (Figure 2, Figure 3, Figure
4) (Mazumder et al., 2005).Al- Furkan et al. 20 rats were orally administered with 10 ppm, 30 ppm,
50 ppm sodium arsenic distilled water for 90 days, edema, picnosis, occlusion sinusoidal dilatation,
focal hemorrhage, portal and sinusoidal mononuclear inflammatory cell infiltration were observed
POSTER PRESENTATION
405
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
in euthanasia- 6) (Al-Furkan et al., 2016). In another study, Nain et al. Showed degeneration and
necrosis of liver tissues after euthanasia with 18 weeks oral administration of arsenic at 40 ppm.
Periodic acid schiff staining showed vacuole cells, glycogen deposits and hepatocytic fat infiltration
with oil red stain (Figure 6) Nain et al., 2010).
Bowel-stomach Disorders: Heywood and colleagues reported that acute inflammation and bleeding in the
small intestine were seen in autopsy intestines after euthanasia with 6 mg orally administered arsenic to
monkeys (Heywood and Sortwell, 1979). In a further study, arsenic exposure to orally in the digestive tract
was accompanied by villous rupture with mononuclear cell proliferation and degenerative changes (Figure 7)
(Hemalatha et al., 2013).
In this study, enlargement of the pyloric part of the stomach, combined villus structures, vacuolation and
degeneration areas were observed (Hemalatha et al., 2013).
6. Result
Arsenic is a substance commonly found in nature and most commonly enters the living body by oral
route, mostly from live waters and pesticides.The first goal of the arthritis toxicity is gastrointestinal system,
and when taken orally for a long time or over a long time, the first nausea, vomiting, abdominal pain and
diarrhea are confronted.Patients who are not fortunate as long as they are taken for a long time at low
doses.It makes functional disorders.Degeneration, portal fibrosis, enlargement of the venules and further
cirrhosis are seen especially in the liver. The stomach, on the other hand, causes the pylorus to enlarge by
breaking the muscle structure. Histopathologically, we see the union and degeneration areas of the villi
structures.In the pubs, acute inflammation is caused, and at later doses, degenerative changes parallel to the
increase of villus rupture and mononuclear cell are seen.
Arsenic is also used as an anthropogenic source in dentistry. When applied to the teeth and veins, the
striated muscles in the veins create paralysis, causing destruction of the walls of the endothelium and vessels.
Necrosis induces degeneration and causes plazmolysis and caryolysis in pulp cells, resulting in necrosis
(Şen, β010).
As a result, arsenic compounds are accepted as potent carcinogenic agents in addition to local
complications.Development of water treatment plants to prevent oral transmission, retrospective review of
the contents of pesticides, Other fields such as dentistry should be used instead of arsenic. As long as this is
not under control, the gastrointestinal system will be structurally impaired and the carcinoma cases will
increase and it will become more difficult to control it in the future.
Figure 1: A- Intact hepatic lobules in the control group. B- Necrotic area in the liver of animals in the group
exposed to arsenic(H &E 200X) (Noman et al., 2015).
POSTER PRESENTATION
406
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 2: Areas of light liver fat and necrosis (H & E X200) (Hemalatha et al., 2013).
Figure 3: Mild degenerative changes in the liver (H & E X200) (Hemalatha et al., 2013).
Figure 4: Fat accumulation in liver hepatocytes and veins (H & E X200)(Hemalatha et al., 2013).
POSTER PRESENTATION
407
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 5: Increased inflammatory cells in the liver, edema and necrotic cells (H & E X400) (AlFurkan et al., 2016).
Figure 6: Untreated control liver tissue (a) exposed to 40 ppm arsenic remaining rat liver section , areas
shown with white arrows hepatocyte vacuolization fields (b). Periodic acid - areas marked with white arrows
with schiff staining hepatocyte vacuolization, black arrows indicate the presence of glycogen in
hepatocytes warehouses. In the final image, the cells indicated by white arrows with Oil Red
staining hepatocyte structure infiltration sites have been demonstrated (H & E X200) (Nain S. et al., 2010).
POSTER PRESENTATION
408
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Figure 7: Villous rupture in the pubes (H & E X100) (Hemalatha et al., 2013).
Figure
8: Pyloric structure enlargement, degeneration in vacuole cells (H & E X200) (Hemalatha et al.,
2013).
Figure
9: Degenerative changes in the stomach structure (H & E X200) (Hemalatha et al., 2013).
Resources
Yağmur F., Hancı İ.H., (β00β). Arsenic. Vol. 11 No. 7-250.
WHO (2001), World Health Organization Publication Report.
IARC (2004), Monographs of Carcinogenic Risk Assessment to Humans.
POSTER PRESENTATION
409
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Morton, W. E., & Dunnette, D.A. (1994). Health effects of environmental arsenic. J. O. Nriagu (Ed.),
Arsenic in the environment. Part II: Human health and ecosystem effects (pp. 17-34). New York: Wiley.
Naqvi, S. M., Vaishnavi, C., & Singh, H. (1994). Toxicity and metabolism of arsenic in vertebrates. In J. O.
Nriagu (Ed.), Arsenic in the environment. Part II: Human health and ecosystem effects (pp. 55-92). New
York: Wiley.
Mandal, B. K., & Suzuki, K. T. (2002). Arsenic round the world: A review. Talanta, 58, 201-235.
Yoshida, T., Yamauchi, H., & Sun, G. F. (2004). Chronic health effects in people exposed to arsenic via
drinking water: Dose-response relationships in review. Toxicology and Applied Pharmacology, 198, 243252.
Yoshida, T., Yamauchi, H., & Sun, G. F. (2004). Chronic health effects in people exposed to arsenic via
drinking water: Dose-response relationships in review. Toxicology and Applied Pharmacology, 198, 243252.
Kapaj, S., Peterson, H., Liber, K., et al. (2006). Human health effects from chronic arsenic poisoning-a
review. Journal of Environmental Science and Health, 41, 2399-2428.
Wang, J. P., Wang, S. L., Lin, Q., et al. (2008). Association of arsenic and kidney dysfunction in diabetes
and validation of its effects in rats. Environmental International. doi: 10.1016 .
Chen, C.J., Wang, S.L., Chiou, J.M., et al. (2007). Arsenic and diabetes and hypertension in human
populations: A review. Toxicology and Applied Pharmacology, 222, 298- 304.
National Research Council (NRC). (2001). Arsenic in drinking water-2001 update. Washington, DC:
National Academy Press.
Heywood R, Sortwell RJ. (1979). Arsenic intoxication in the Rhesus monkey. Toxicol. Lett. 3: 137-144.
Uede K, Furukawa F. (2003). Skin manifestations in acute arsenic poisoning from the Wakayama
curry-poisoning incident. Br. J. Dermatol. 149: 757-762.
Lee DC, Roberts JR, Kelly JJ, Fishman SM. (1995). Whole-bowel irrigation as an adjunct in the
treatment of radiopaque arsenic. Am. J. Emerg. Med. 13: 244-245.
Arnold LL, Eldan M, van Gemert M, Capen CC, Cohen SM. (2003). Chronic studies evaluating the
carcinogenicity of monomethylarsonic acid in rats and mice. Toxicology 190: 197-219.
Gur E, Pirak M, Waner T. (1991). Methanearsonic acid oncogenicity study in the mouse.
Luxembourg Industries (Pamol) Ltd. Submitted to the US Environmental Protection Agency.
Liu J, Zheng B, Aposhian HV, Zhou Y, Chen ML, Zhang A, Waalkes MP. (2002). Chronic arsenic
poisoning from burning high-arsenic-containing coal in Guizhou, China. Environ. Health Perspect.
110: 119-122.
Mazumder DN, Steinmaus C, Bhattacharya P, von Ehrenstein OS, Ghosh N, Gotway M, Sile,
Balmes JR, Haque R, Hira-Smith MM, Smith AH. (2005). Bronchiectasis in persons with skin
lesions resulting from arsenic in drinking water. Epidemiology 16: 760-765.
Jaghabir MTW, Abdelghani AA, Anderson AC. (1989). Histopathological effects of monosodium
methanearsonate (MSMA) on New Zealand white rabbits (Oryctalagus cuniculus). Bull. Environ.
Gasket. Toxicol. 42: 289-293.
POSTER PRESENTATION
410
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Noman ASM, Dilruba S., Mohanto NC, Rahman L., Khantun Z., Riad W., Mamun AA, Alam S.,
Aktar S., Chowdhuryl S., Saud ZA, Rahman Z., Hossain K., Haquee . (2015). Arsenic-induced
Histological Alterations in Various Organs of Mice. Cytol Hysteresis 2015, 6: 3
Jomova K., Jenisova Z., Feszterova M., Baros S., Liska J., Hudecova D., Rhodes D. C. J., Valkoc M. (2011).
Arsenic: toxicity, oxidative stress and human disease. J. Appl. Toxicol. , 31: 95-107.
Hemalathal P., Reddyl A. G., Ranil M. U., Anandkumar A., Shivakumar P. (2013). ARSENIC-INDUCED
HISTOLOGICAL ALTERATIONS IN VARIOUS ORGANS IN RATS. Int. J. LifeSc. Bt & amp; Pharm.
Res. 15-10.
Sahal J. C., Dikshit A. K., Bandyopadhyay M. (2011). A REVIEW OF ARSENIC POISONING AND ITS
EFFECTS ON HUMAN HEALTH. School of Tropical Medicine, Calcutta, India.
Al-Forkan M., Islam S., Akter R., Shameen AS, Khaleda L., Rahman Z., Salma CD 2016. A Sub- Chronic
Exposure Study of Arsenic on Hematological Parameters, Liver Enzyme Activities, Histological Studies and
Accumulation Pattern of Arsenic in Organs of Wistar Albino Rats. J Cytol Hyster, S5: 1.
Nain S., Smits J.E.G., (2010). Pathological, Immunological and Biochemical Markers of Subchronic Arsenic
Toxicity in Rats. Received 26 April 2010; Revised 14 June 2010; Accepted 15 June.
President B. M. and Pala A. (2009). Arsenic pollution in drinking waters: an assessment from the perspective
of our country. Journal of engineering sciences, p. 69-79.
POSTER PRESENTATION
411
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Study of MAR-pyocin from Pseudomonas aeruginosa isolated from Clinical Specimen and
Pomegranate seed oil as Antifungal agents
Mais E.Ahmed 1 , Israa A. Ali Al-Temimay2
* Ph.D. in Biology Depart./ Collage of Science/ University of Baghdad.
1
mais.e.mahmood@gmail.com,2 israaahmed51@yahoo.com
Abstract
This research was designed to study the inhibitory effect of crud bacteriocin (MAR-Pyocin) production from
resistance Pseudomonas aeruginosa which has been isolated from Baghdad, Iraq samples of different
sources (ear and eye) swab according to biochemical test and vitek 2 system. In vitro assay with the
antagonists and their Crude and Purified bacteriocin by precipitation 75% ammonium sulfate and
conventional size exclusion using Ion-exchge column DEAE -cellulos gel equilibrated and with 50 mM
sodium phosphate buffer pH 7.0 eluted. From resistance Pseudomonas aeruginosa strains on agar plates
and Pomegranate peel extraction showed that the effectively inhibited growth of the following fungi
(Trichophyton mentagrophyes, Microsporum audouinii , Trichophyton tonsurans, Candida kefyer,
Aspergillus fumigatus, Hortaea werneckii, Rhizoctinoa spp). The results showed that the Minimum
Fungicidal Concentrations were (γβ.5 and 1βγ) µg/ml bacterocin and Pomegranate peel respectively, also the
inhibition zone of reached Bacterocin (12 to 18 ) mm in solid medium .while Pomegranate peel reached (3-5)
mm inhibition zone.
Key words: MAR-Pyocin, Candida , Pseudomonas aeruginosa, antifungal agents, Pomegranate seeds oil.
1- Introduction:
A common global problem Fungal infection of the suffers from skin mycosis currently, 21–β5% of the world’s
population, making most frequent forms of infection (Havlickova, et al., 2008) has emerged from Mexico and the
Caribbean Trichophyton tonsurans and is now the most prevalent cause of tinea capitis in North America and the UK,
frequently resistant to traditional fungicides Trichophyton tonsurans (Shroba. etal. 2009). Identify antifungal lactic acid
bacteria (LAB) and characterize their activity against the dermatophyte Trichophyton tonsurans (Guo.etal., 2011)
.,A.fumigatus conceders a main cause of morbidity and mortality in immunocompromised patients. This patients group
are distributing due to the increasing use of transplantation for end organ disease, the development of
immunosuppressive and myeloablative therapies for autoimmune and neoplasticdisease and the human
immunodeficiency virus/AIDS pan-demic. So the A. fumigatus is the most common mold infection invasive these
patients and the mortality rates overrun 50% in high-risk groups, like leukemic patients and hematopoietic stem cell
transplant receivers (Hohl and Feldmesser 2007) and(Denning,1998) Hortaea werneckii caused the superficial mycosis
Tinea nigra. It is an uncommon asymptomatic infection that infects human palms and soles, and is mostly seen in
tropical area (Bonifaz etal., 2008). Rhizoctonia sp. is one of the important soil borne pathogen all over the world. Very
serious diseases, it causes of wide varieties of plants ranging from damping-off till stem canker led to dramatic effects
on plant physiology and its nutrition (Mohamed etal.,2014). Protein substances Bacteriocins are which exhibit activity
against antibacterial related closely species. Bacteriocins can inhibit very restricted of bacteria spectrum, mostly Gram
positive bacteria limited. Bacteriocins Different from each other by chemical structure and antagonistic activity( Fujita.
etal.,2007). Has assumed Pseudomonas aeruginosa an increasingly etiological agent prominent serious infections in
hospitalized patients. Three distinct types of bacteriocins Pseudomonas aeruginosa strains produce. Classified
according to their morpology Bacteriocins functions into pore forming pyocin and DNase activity–pyocins.of P.
aerugonosa strains (Al-Shammary etal., 2013). Requires a period Pyocin typing of 24 h to achieve a result but provides
adequate discrimination on which to base more confident epidemiological judgment (Waite and Curtis,2009). An
alternative source of new active molecules Natural products have proven to be. Basic health treatment plants have been
used as the primar (Dell’Agli etal., β00λ). The pomegranate (PUNİCA GRANATUM ) composed the fruit is of a
yellow to red peel the seeds that covers, In folk medicine PUNİCA GRANATUM is application a plant with
worldwide. An antimicrobial effect there are references to of pomegranate products against many pathogenic fungal
species, formation of biofilms including inhibition (Bakkiyaraj etal., 2013). Effect of pomegranate there are references
to an antimicrobial products against many pathogenic microbiology species, including inhibition of formation of
biofilms(Al-Zoreky,2009) Pomegranate fruit rind extracted Polyphenols from were active against phytopathogenic
fungi ( Osorio etal.,2010) Showed good results the extract of P. GRANATUM as antifungal a topical agent for
candidosis associated with denture stomatitis of the treatment (Vasconcelos etal.,2003) .Isolated not only this substance
was from PUNİCA GRANATUM, but also was described from TERMİNALLİA BRACHYSTEMMA and
TERMİNALLİA MOLLİS , as having antifungal activity against CANDİDA ALBİCANS, C. KRUSEİ, and C.
POSTER PRESENTATION
412
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
PARAPSİLOSİS ( Liu etal.,2009). This research was designed to study the inhibitory effect R- pyocin and
Pomegranate peel extraction which isolated from resistance Pseudomonas aeruginosa in reduction fungal growth in
vitro
2- Materials and Methods
2-1 Isolation and identification of resistance Pseudomonas aeruginosa :
Sample Collection A total of 12 clinical specimens of resistance Pseudomonas aeruginosa were collected from
different were collected from the pathology Hospital in Iraq (ear and eye) Swab on MacConkey agar plates and Kligler
Iron agar that we used, were purchased from Sigma Company.For the isolation and identification each specimen was
identified, depending on the morphology, cultural characteristics and biochemical reaction (Baron and Finegold,1990)
.Finegold. Additional chemicals; Indole, Simmen Citrate and Urea test and identifaction by vitek 2 system. The strain of
Candida kefyer, Trichophyton tonsurans., Trichophyton mentagrophytes, T. rubrum, Aspergillus fumigatus, Hortaea
werneckii, Rhizoctinoa spp.) Were obtaining, Isolation and identification from (College of Science for Women and
Biology Department/ College of Science/University of Baghdad).
2-2 Antibacterial resistance:
The isolates pattern of was by Kirby-Bauer disc diffusion technique studied Susceptibility of the isolates were done
and interpreted according to (NCCLS) National Committee for Clinical Laboratory Standards recommendations. The
antibiotic concentration per disk was as following. Ceftriaxone (30), Ampicillin (10 Mg), Amikacin (30 Mg),
Gentamicin (10 Mg) and Cephalexin (30 Mg)
2-3 Production crud MAR- pyocin:
Resistance Pseudomonas aeruginosa after growing in a Brain-Heart infusion broth and diluting appropriately to a 0.5
McFarland standard (1.5×107 CFU/ml), incubated at γ7°C for 18 hrs. after centrifuged at 5000 × g for 10 min
supernatant fluid of the isolates, the cells were discarded and the cell free extract was filtered using a syringe with
0.βµm filter. The diameter of the inhibition zone around the wells, the antimicrobial activity was determined by
measuring., The cell free extract was gently filtered into sterilized test tubes with 0.βµm acetate cellulose filter
(Majeed.2004).
2-4 Protein precipitation by ammonium sulphate: Broth culture an overnight of Sample cell free supernatant obtain
was centrifuged at 6000 rpm for 10 minutes at 4°C. the ammonium sulphate was added to achieve 75% saturation. It
was stirred well and incubated at 4°C overnight. The following day, the precipitates were collected by centrifugation at
6000rpm for β5 minutes at 4°C. The dissolved precipitates were in 500 ml of sterile distilled water (McCaughey.,β016)
Antibacterial activity of both the supernatant and the precipitate were tested using agar well diffusion assay and the
results were recorded, protine assay according (Lowry etal.,1951).
2-5 Purification of MAR-pyocin:
After the supernatnat was thoroughly with Ammonium sulphat at a ratio 70% than Chromatography (DEAE-Cellulose)
gel was used as a first step for MAR-pyocin purification . This gel was prepared according to Pharmacia catalogue
(Pharmacia Fine Chemical/ Sweden). was loaded slowly over the DEAE-Cellulose.The MAR-pyocin was eluted from
the column(β × 40) cm dimensions) by β0mM sodium citrate buffer (pH 7)and flow rate was adjusted to give 40 ml per
hour. 5 ml for each fraction was collected. Activity and absorbance at 280nm of each fraction were determined,the
active fractions were mixed .Activity and protein concentration were determined, then loaded again on the same column
at the same conditions above.
2-6 Determining inhibitory effect of MAR- pyocin and Pomegranate seed oil on Fungal:
Was determined using the well diffusion method the antifungal spectrum of the bacteriocin (MAR-pyocin) from P.
aeruginosa. The supernatant from a 24-h culture of P. aeruginosa filter sterilized by passage through a 0.45 mm pore
size membrane filter. of the sterile supernatant were placed in 6-mm-diameter wells that had been cut in Sabourad agar
plate previously seeded with the indicator fungal ,After 12-β4 h of incubation, the diameters of the zones of growth
inhibition were measured. Antifungal activity was expressed in arbitrary units (AU/ml). One AU was defined as the
reciprocal of the highest level of dilution resulting in a clear zone of growth inhibition (Mélanie etal.,2016).
2-7 Pomegranate seeds oil preparation
The seeds were collected from local Pomegranate. This seeds was dried at 45 Cº in oven overnight. Methanol was used
as a polar solvent. It used to extract Pomegranate seeds oil. The extraction was done by Soxhlet device, 200ml of
solvent was added and still for 8 hr. at 70Cº and the extract was dried by oven for two days to obtain oil extract. This oil
stored at 4Cº until use, the concentration was prepared it taken from this formula.
C1 V1 = C2 V2 According to this formula the Pomegranate seeds oil concentration was 4%.
2-8 Culture Media:In this study Sabouraud’s Dextrose Agar (SDA) (Himedia/ India) was used as fungal medium. This medium was
prepare depending to the manufactory by dissolved 39g powder from PDA in one liter of D.W. and sterilized by
autoclave at 15 psi pressure and 1β1 ºC for 15 minute. This medium (with antibiotic penicillin and Streptomycin) was
used for culture purposes Koneman etal.,1978).
2-9 The agar well diffusion method:
POSTER PRESENTATION
413
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
This method use for determined antifungal activity of R- pyocin and Pomegranate seeds oil extract. The solution
are added in wells by using cork porer to make three wells in each one plates after the fungi (Trichophyton tonsurans.,
Trichophyton mentagrophytes, T. rubrum, Candida kefyer, Tricoderma, Aspergillus fumigatus, Hortaea werneckii,
Rhizoctinoa spp.) were cultured on this meidium, then the extract of MAR- pyocin and Pomegranate seeds oil were
incubated into the groove after 2-4 days at γ7Cº and β8 Cº. The D.W. was used as control (Sheyin etal.,β015).
3- Result and Discussion:
Antibiotic resistance of Pseudomonas aeruginosa showed Table (1) shows the categorization of cases. The results
of the present study showed that (60%) were wound infaction (15%) from urine (25%) frome ear and eye infaction .
Table (1): Categorization of Pseudomonas aeruginosa cases.
Category
Ear
Numbers of neonates
No. & %
(45)%
Eye
(55)%
` Antibiogram Profile P. aeruginosa Isolated Clinical Samples The results showed all isolates of P. aeruginosa, which
were Resistace antibiotc, constituted 45% from the ratio in the ear and while the (55%) isolates were from eye samples.
Highly significant differences (P˂0.01) recorded in both isolates among clinical samples. R-pyocin production from
Only five isolates (P3,P4, P7, P9 ,P11) in the study identified by wells diffusion method, depending on the widest
inhibition zone and the highest sensitive number of the basic indicator isolates P9 isolation from eye specimen .
Table (2) Antibiotic sensitivity test of P. aeruginosa
Antibiotic
Amikacin
Ampicillin
Cephalexin
Ceftriaxone
Gentamicin
P1
R100
S0
R66
S0
R100
S 20
R100
S 0
R75
S 0
P2
R 86
S 12
R 73
S 0
R 83
S 9
R 75
S 11
R 44
S 26
P3
R 72
S 28
R 75
S 25
R80
S 20
R82
S 18
R52
S 48
P4
R 66
S 34
R 74
S24
R80
S20
R80
S 20
R50
S 50
P5
R 66
S 34
R 70
S30
R 76
S 17
R 70
S 32
R 43
S 62
P6
R 66
S 44
R 55
S 45
R62
S 40
R55
S 44
R 88
S 18
P7
R 62
S 40
R 65
S 34
R 77
S 26
R 87
S 14
R 80
S19
P8
R 55
S 42
R 60
S 44
R 73
S 23
R 85
S 20
R 78
S 28
P9
R 72
S32
R63
S34
R 66
S 34
R 74
S 26
R 80
23 S
P10
R 83
S 13
R 45
S 55
R 60
S 43
R 55
S 46
R 69
S 35
P11
R 84
S 13
R 74
S 23
R 84
S 14
R 78
S 24
R 84
S 14
P12
R60
S 33
R 72
S 22
R 55
S 43
R 43
S 53
R 14
S 86
S: Sensitive , R: Resistant
POSTER PRESENTATION
414
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3-1 Vitek 2 system:
Gave confirmation of positive results for P. aeruginosa and as a selected organism with a probability 98-99%
(Cartwright etal.,2013) showed that out of P. aeruginosa isolates had resistant profile with a sensitivity of 88.7%
and a specificity of 99.5% for the identification of P. aeruginosa isolates.
3-2 Screening for crude MAR-pyocin :
" The P. aeruginosa isolate P9 was chosen among five bacterial isolates as a good crude R-pyocin producer according
to their widest inhibition zone that reached 15 mm on the basic indicator isolates. Figure (1) and Figure (2)
P3
P4
P1
1
P9
P7
Figure (1): Screening of crude R-pyocin from resistance P. aeruginosa against Candida kefyer on Sabourad agar plate at 30°C
for 24-48 hrs.
1,9
1,5
washi
0.25M NaCl
160
MRSAcin
Elute
140
120
Diameter of inhibition
Absorbance(280
1,7
0.5M NaCl
100
1,3
0.15M NaCl
1,1
80
0.75M NaCl
60
0,9
40
0,7
20
0,5
0
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45
Fraction number
Figure (2): Ion exchange chromatography for Bacteriocin column (2×40cm) equilibrated with Tris-HCl buffer (10 mM , pH 7
), eluted with Tris –HCl buffer with NaCl (0.15 -0.75 M) in flow rate 0.8 ml /min., 5ml for each fraction
Ion exchange (DEAE-Cellulose) features used in this step due to high resolution power , easily prepared , high capacity ,
possibility of reactivate and uses many times as well as the simplicity of the principle of separation, which mainly depends on net
charges of protein ( Kateete etal., 2010). Figure (3)
MAR-pyocin
Figure (3): Screening of Purified MAR-pyocin against Candida kefyer on Sabourad agar plate at 30°C for 24-48 hrs.
POSTER PRESENTATION
415
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
3-3 Determination of Molecular Weight:
The protein slandered was compared used as to detection molecular weight of MAR-pyocin,. as shown in Figure (4) the high
molecular weight was found to be (38) KDa, particularly for MAR-pyocin .The current results agree with molecular weight of both
pyocin and bacillin extracellular bacteriocin were approximately 40 kDa according to reference protein ladder band , while the
molecular weight of LB were estimated to be in the range of (10 to 25 ) kDa Ogunshe etal.,2012).
2 kDa
5 kDa
10 kDa
20 kDa
30 kDa
MAR-pyocin
40 kDa
Figure (4): SDS-PAGE Tricine-SDS-PAGE of MAR-pyocin (A): Molecular weight marker. (B): Purified MAR-pyocin.
3-4 Well plate assay
In this study Purified MAR-pyocin and Pomegranate seeds oil were tested among many fungi some of them pathogen for human
such as Trichophyton tonsurans., Trichophyton mentagrophytes, T. rubrum, Candida kefyer Aspergillus fumigatus and Hortaea
werneckii. Another them was plant pathogen such as Rhizoctinoa spp. All these fungi were sensitive to Bactericin and resistant’s to
Pomegranate seeds oil. The Purified MAR-pyocin give high inhibition zone radius when it tested on Hortaea werneckii 38 mm
followed by Aspergillus fumigatus 35mm and give the lower inhibition zone radius in Rhizoctinoa spp.
27mm only. While Pomegranate seeds oil don’t give any inhibition zone in all fungi were tested.Figure (5 and 6) showed the activity
of MAR-pyocin and Pomegranate seeds oil on this fungi.
A
B
C
Figure (5): A: Hortaea werneckii. B: Aspergillus fumigatus. C: Rhizoctinoa spp. Antifungal
activity of purified MAR-pyocin (concentration γβ.5 µg/ml) in the same experiment
conditions.
POSTER PRESENTATION
416
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
B
A
C
Figure (6): A: Trichophyton mentagrophyes. B: Microsporum audouinii C: Trichophyton
tonsurans: Antifungal activity of purified MAR-pyocin (concentration γβ.5 µg/ml) in the same
experiment conditions.
4. Discussions
Four lactobacilli Identified as having strong inhibitory activity against the human pathogenic fungi Microsporum canis,
Microsporum gypseum and Epidermophyton floccosum. One of the, namely Lb. reuteri ee1p exhibited the most
inhibition against dermatophytes (Guo etal.,2012). Lactic acid bacteria were isolated from yogurt samples. Four species
of lactic acid bacteria L. acidophilus, L. plantarum, L. delbrueckii and L. bulgaricus were isolated and their bacteriocins
were extracted against Aspergillus niger, Mucor and Penicillium.at zone inhabation 7mm (Yasmin,2015).
The study of McCaughey et al., 2016 was show the ability of pyocin SD2 to treat a lethal P. aeruginosa lung infection
in a murine model indicates that pyocin SD2 has excellent antimicrobial activity in vivo. So the research of( Scholl and
Martin, 2008) were elucidated the R-type pyocins share many features with bacteriophages. Phages have recently been
used to treat murine peritonitis and bacteremia. Exhibited antimicrobial activity of Lactobacillus sp against
dermatomycotic fungi and foodborne pathogen bacteria. The highest antimicrobial activity was recorded against
Trichophyton mentagrophytes and T. rubrum with minimal lethal concentration of 32 mg/ml (Koutb etal.,2016).
Lactobacillus reuteri Rβ and Pyocin was identified as having strong inhibitory activity against the dermatophyte T.
tonsurans The use of these and⁄or their products may well provide alternative safe approaches for the inhibition of
dermatophytic fungi (Guo etal., 2011) .Although all previous research has had a significant effect on bacteria
dermatophytic fungi inhibition, but in this study, Pyocin has shown clear results in inhibiting harmful fungi for humans
and plants such as Hortaea werneckii, Aspergillus fumigatus and Rhizoctinoa spp was a good step to finding alternative
solutions to eliminate this type of fungus.
Conclusion :
Nowadays use of commercially available antimicrobial drugs such Bacterocin caused drug resistance in many human
pathogenic microorganisms. The resistance adaptation properties of fungal many species is a major health concerns and
it force scientist to discover new effective antifungal agents. Bacterocin have been a key source for the discovery of
new drugs and can provide a potential antifungal lead against the resistance strains pathogen.
References:
Havlickova, B., V.A. Czaika , V.A. and M. Friedrich, M. (2008) Epidemiological trends in skin mycoses worldwide. Mycoses
51: 2–15.
Shroba, J., C .Olson-Burgess, B .Preuett,. and S.M .Abdel-Rahman(2009),. A large outbreak of T. tonsurans among health care
workers in a pediatric hospital. Am J Infect Control 37, 43–48. Guo, A. and P .Galle, Inhibition of growth of Trichophyton
tonsurans by Lactobacillus reuteri Journal of Applied Microbiology 111, 474–483.
Hohl, T.M and M . (2007) Feldmesser,. Aspergillus fumigatus: Principles of Pathogenesis and Host Defense. Eukaryotic Cell,
Vol. 6, No. 11. p. 1953–1963. doi:10.1128/EC.00274-07. Denning, D. W. Invasive Aspergillosis. Clin. Infect. Dis. 26:781–803.
Bonifaz, A., H. Badali,. G.S.de Hoog, M. Cruz, J. Araiza, M.A. Cruz, and R.M. Ponce, (2008). Tinea nigra by Hortaea
werneckii, a report of 22 cases from Mexico. Studies in Mycology 61: 77–82.
Mohamed, M.H. E. A .Gado,. S. H. El-Deeb and M. H. Mostafa (2014) .Behavior of fungus Rhizoctonia solani under faba bean
cotyledons when away from host and the effect of its starvation on aggressiveness. Journal of Yeast and Fungal Research. Vol.
5(1), pp. 1-8.
Fujita, K., S. Ichimasa, T. Zendo, S. Koga and F. Yoneyama, (2007) Structural analysis and characterization of lacticin
Q, a novel bacteriocin belonging to a new family unmodified bacteriocins of gram-positive bacteria. Applied Environ.
Microbiol., 73: 2871-2877..
Al-Shammary, A.H. I.G .Auda and I.H. Aziz (2013). Pyocin-Based Molecular Typing of Local Isolates of Pseudomonas
Aeruginosa Isolated from Blood Samples, Al-Nahrain College of Medicine, 1681-6579.
Waite, R.D and M.A. Curtis. (2009). Pseudomonas aeruginosa PAO1 pyocin production affects population dynamics within
mixed-culture biofilms. J Bacteriol.; 191: 1349-54.
Dell’Agli M, GV .Galli, Y .Corbett, D .Taramelli, L .Lucantoni, A .Habluetzel, O .Maschi, S .Romeo, D. Bhattacharia and E
.Bosisio. (2009).Antiplasmodial activity of Punica granatum L. fruit rind. J Ethnopharmacol. 125:279–285.
Bakkiyaraj D, JR.Nandhini, B.Malathy and SK .Pandian. (2013) The antibiofilm potential of pomegranate (Punica granatum L.)
extract against human bacterial and fungal pathogens. Biofouling. 29:929–937.
Al-Zoreky NS. (2009) Antimicrobial activity of pomegranate (Punica granatum L.) fruit. Int J Food Microbiol. 134:244–248.
POSTER PRESENTATION
417
International Eurasian Conference on Biological and Chemical Sciences (EurasianBioChem 2018), April 26-27, 2018 Ankara, Turkey
www.EurasianBioChem.org
Osorio E, M .Flores, D .Hernández, J. Ventura, R. Rodríguez and C.N.Aguilar. (β010) Biological Efficiency of polyphenolic
extracts from pecan nuts Shell (Carya illionensis), pomegranate husk (Punica granatum) and creosote bush leaves (Iarrea
tridentate Cov.) against plant pathogenic fungi. Ind Crops Prod. 31:153–157.
Vasconcelos LCS, MCC. Sampaio, FC .Sampaio and JS .Higino. .( 2003) Use of Punica granatum as an antifungal agent
against candidosis associated with denture stomatitis. Mycoses. 46: 192–196.
Liu M, DR.Katerere , AI .Gray and V .Seidel , (2009). Phytochemical and antifungal studies on Terminalia
mollis and Terminalia brachystemma . Fitoterapia . 80:369–373.
Baron EJ and SM .Finegold. Bailey & Scott’s (1λλ0).μ Diagnostic Microbiology. 8th ed. Mocby Company. U.S.A.
Majeed, H. A. L. (2004) Identification and immunological study of Candida spp. Causin gvaginitis. M.Sc. thesis ,College of
Science for Women, University of Baghdad.
McCaughey, L.C., I.Josts, , R.Grinter, P.White , O.Byron, N.Tucker, Kleanthous J.M , and D.Walker,. (2016). Discovery,
characterization and in vivo activity of pyocin SD2, a protein antibiotic from Pseudomonas aeruginosa. Biochem. J.; 473, 2345–
2358.
Lowry, O. H., N. J.Rosebrough, A. L .Farr and Randall, R. J. (1951) Protein measurement with folin phenol reagent. J. Biol.
Chem., 193(1): 265-275.
Mélanie,T. D.Khanh, M.Mathieu, D.Claude, and L.Monique. (β016). Influence of Environmental Factors on Bacteriocin
Production by Human Isolates of Lactococcus lactis MM19 and Pediococcus acidilactici MM33. Probiotics & Antimicro. Prot.
8: 53.
Koneman, E.W, G.D. Roberts and S.E.Wright. (1978) Practical laboratory mycology, 2nd ed. Williams and Wilkins Company.
Baltimor USA. pp: 139-140..
Sheyin, Z., J.Maimako, J.Shindang, C.Essien, , E.Bigwan and F.Ede. (2015). Antimicrobial Activity of Albizia lebbeck leafe
extract on some Medically Important Bacteria. Int. J. Curr. Microbiol. App. Sci. 4(9): 473-477.
Cartwright E., G.Paterson , K .Raven and E. Torok(2013). .Use of Vitek 2 Antimicrobial Susceptibility Profile To Identify
mecC in Methicillin-Resistant Staphylococcus aureus. in J.clin. micro. ,51:(8).
Kateete, D. C.Kimani, F.Katabazi, A.Okeng, M.Okee, A.Nanteza, and F.Najjuka. (2010). Identification of Staphylococcus
aureus: DNase and Mannitol salt agar improve the efficiency of the tube coagulase test. Ann Clin Microbiol. Antimicrob. 9:2330.
Ogunshe, A. O.Johnny and A. O. Arinze (2012). Effects of Food Spices on Gram-Negative Food Indicator Bacteria from Some
Nigerian Ethnic Fermented Plant Food Condiments,” Afric.J. Plant Scie, (6)μ 18-14.
Guo J, B .Brosnan, A .Furey and E .Arendt. (2012). Antifungal activity of Lactobacillus against Microsporum canis,
Microsporum gypseum and Epidermophyton floccosum. Bioengineered Bugs 3:2, 104–113.
Yasmin A, M.Ashraf, M. Arshad and G. Muhammad.(2015). Determination of biopreservative effects of bacteriocins isolated
from lactic acid producing bacteria against food spoiling fungi . Int.J.Curr.Microbiol.App.Sci . 4(2): 88-96.
Scholl, D. and D.W Martin. (2008). Antibacterial Efficacy of R-Type Pyocins towards Pseudomonas aeruginosa in a Murine
Peritonitis Model. Antimicrobial Agents And Chemotherapy. Vol. 52, No. 5; P. 1647–1652. Doi:10.1128/Aac.01479-07.
Koutb M, M. Khider, E .Ali and N .Hussein . (2016).Antimicrobial Activity of Donkey Milk against Dermatomycotic Fungi and
Foodborne Bacteria, International Journal of Biomedical Materials Research . 4(3): 11-17.
Guo . J, .A Mauch, and S Galle, P. Murphy . (2011). Inhibition of growth of Trichophyton tonsurans by Lactobacillus reuteri.
Journal of Applied Microbiology 111, 474–483.
POSTER PRESENTATION
418
EJBCS