sdu faculty of forestry journal special edition 2009 - Orman Fakültesi

SDU 

FACULTY 

OF 

FORESTRY 

JOURNAL 

SPECIAL EDITION 

2009 

PROCEEDINGS OF 

THE CONFERENCE OF 

IUFRO WORKING 

PARTY 7.02.02 

EĞİRDİR, TURKEY 

11-16 MAY 2009 

Guest Editor 

H. Tuğba 

DOĞMUŞ-LEHTIJÄRVI

SDU Faculty of Forestry Journal

SDU 

FACULTY OF FORESTRY JOURNAL 

Serial: A, Number: Special Edition, Year: 2009, ISSN: 1302-7085 

Indexed in 

CAB 

TÜBİTAK 

PUBLICATION COMMITTEE 

Editor 

Asst. Prof. Dr. Nevzat GÜRLEVİK 

Associate Editors 

Asst. Prof. Dr. H. Oğuz ÇOBAN 

Asst. Prof. Dr. Mehmet TOPAY 

Asst. Prof. Dr. Abdullah SÜTÇÜ 

Res. Asst. Alper BABALIK 

Res. Asst. Yılmaz ÇATAL 

Expert Süleyman UYSAL 

Guest Editor 

H. Tuğba DOĞMUŞ-LEHTIJÄRVI 

COVER DESIGN 

SDU Press and Public Relations 

PRESS 

Fakülte Kitabevi-ISPARTA 

SDU Faculty of Forestry Journal is a refereed journal and published twice a year. 

Responsibility for the published papers concern to the Authors 

2009 – SDU FFJ 

CORRESPONDENCE 

SDÜ Orman Fakültesi, 32260, ISPARTA 

Phone: + 90 246 2113198 Fax: +90 246 2371810 

e-mail: dergi@orman.sdu.edu.tr 

http://ormanweb.sdu.edu.tr/dergi

SDU Faculty of Forestry Journal

SDU FACULTY OF FORESTRY JOURNAL 

SERIAL: A, NUMBER: SPECIAL ISSUE, YEAR: 2009, ISSN: 1302-7085 

Asko T. LEHTIJÄRVI 

Ayşe Gülden ADAY 

Organization Committee 

V 

SDU Faculty of Forestry 


Canpolat KAYA SDU Faculty of Forestry 

Denizhan ULUSAN SDU Faculty of Forestry 

Funda OSKAY 

H. Tuğba DOĞMUŞ-LEHTIJÄRVI 

Mertcan KARADENIZ 

Musa GENÇ 

Mustafa AVCI 






Süleyman UYSAL SDU Faculty of Forestry 

Special edition of the journal is financially supported by 

The Scientific and Technological Research Council of Turkey (TÜBİTAK) 

& Süleyman Demirel University



VI

Preface 

Full papers 



Foliage diseasas of conifers 

Needle diseases 

CONTENTS 

DOTHRISTROMA AND LECANOSTICTA NEEDLE BLIGHT IN THE CR 

Libor JANSKOVSKY, Miroslava BEDNAROVA, Milon DVORAK, 

Dagmar PALOVCIKOVA and Michal TOMSOVSKY..........................................................7-14 

TWO NEW SPECIES OF Lophodermium COLONISE SCOTS PINES NEEDLES IN 

SCOTLAND 

Sabrina N. A. REIGNOUX, Richard A. ENNOS, Sarah GREEN .........................................15-23 

RED BAND NEEDLE BLIGHT IN FINLAND, SYMPTOMS AND DISTRIBUTION 

Martti VUORINEN ..........................................................................................................24-26 

Scleroderris canker 

THE OCCURRENCE OF MICROCONIDIA ON Gremmeniella abietina (LAGERB.) 

MORELET 

Antti UOTILA ...................................................................................................................29-32 

CENTRAL NEWFOUNDLAND: ESCAPE FROM QUARANTINE 

Gary R. WARREN and Gaston LAFLAMME .....................................................................33-38 

Shoot blights 

CONE DAMAGES BY Diplodia pinea AND SEED BORING INSECTS ON Pinus pinea 

L. (ITALIAN STONE PINE) IN CENTRAL ITALY 

Paolo CAPRETTI, Matteo FEDUCCI, Martina CAMBI, Alessia PEPORI, 

Daniele BENASSAI ...........................................................................................................41-47 

SUSCEPTIBILITY OF DIFFERENT CONIFEROUS SEEDLINGS INOCULATED 

WITH Diplodia pinea 

H. Tuğba DOĞMUŞ-LEHTIJÄRVI, Asko LEHTIJÄRVI, Gürsel KARACA, 

A. Gülden ADAY and Funda OSKAY ...............................................................................48-56 

SITE AND STAND CHARACTERISTICS OF A Pinus brutia STAND INFECTED 

WITH Diplodia pinea IN TURKEY 

Nevzat GÜRLEVIK, H. Tuğba DOĞMUŞ-LEHTIJÄRVI, Asko LEHTIJÄRVI, 

A. Gülden ADAY...............................................................................................................57-64 

THE EFFECTS OF Sirococcus SHOOT BLIGHT AND VITALITY FERTILIZATION 

ON GROWTH OF MATURE NORWAY SPRUCE 

Markus HUBER, Erhard HALMSCHLAGER and Hubert STERBA....................................65-70 

INTERACTION BETWEEN Diplodia pinea, D. scrobiculata AND SEVERAL FUNGAL 

ENDOPHYTES IN RED AND JACK PINE SEEDLINGS 

Oscar SANTAMARÍA, Denise R. SMITH, Glen R. STANOSZ ..........................................71-84 

ADELGID GALLS ON SPRUCE AS A RESERVOIR INOCULUM SOURCE FOR 

THE SHOOT BLIGHT PATHOGEN Diplodia pinea 

Glen R. STANOSZ, Denise R. SMITH -, and S. ZHOU.......................................................85-92 

VII



Dieback and canker diseases 

Dieback dieases 

THE CURRENT SITUATION OF ASH DIEBACK CAUSED BY Chalara fraxinea IN 

AUSTRIA 

Thomas KIRISITS, Michaela MATLAKOVA, Susanne MOTTINGER-KROUPA, 

Thomas L. CECH, Erhard HALMSCHLAGER................................................................. 97-119 

DIEBACK ON Fraxinus ornus IN KONYA REGION 

Asko LEHTIJÄRVI, H. Tuğba DOĞMUŞ-LEHTIJÄRVI, Mertcan KARADENİZ, 

Mustafa UYGUN........................................................................................................... 120-123 

ASH DIEBACK IN THE CZECH REPUBLIC 

Petr STASTNY, Dagmar PALOVCIKOVA and Libor JANKOVSKY............................. 124-128 

Canker dieases 

HORSE CHESTNUT BLEEDING CANKER – BAGGING THE BUG! 

Sarah GREEN, Bridget LAUE, Grace MACASKILL, Heather STEELE.......................... 131-135 

AN OVERVIEW OF POTENTIAL INFECTION COURTS FOR Neonectria fuckeliana, 

THE CAUSAL AGENT OF NECTRIA FLUTE CANKER IN Pinus radiata IN NEW 

ZEALAND 

Anna J..M. HOPKINS, PATRICIA E. CRANE and Margaret A. DICK ........................... 136-140 

PRELIMINARY RESULTS OF MYCOFLORA ASSOCIATED WITH CANKERS ON 

Cupressus sempervirens var. horizontalis (Mill.) GORDON IN TURKEY 

Asko LEHTIJÄRVI, H. Tuğba DOĞMUŞ- LEHTIJÄRVI, Funda OSKAY, 

A. Gülden ADAY .......................................................................................................... 141-149 

SOME MORPHOLOGICAL ASPECTS OF EUTYPELLA CANKER OF MAPLE 

(Eutypella parasitica) 

Nikica OGRIS, Barbara PIŠKUR, and Dušan JURC........................................................ 150-161 

OCCURRENCE OF Pseudomonas syringae ON POPLAR DAMAGED BY NECROSIS 

AND CANKER 

Irmtraut ZASPEL and Volker SCHNECK....................................................................... 162-167 

Rust dieases 

SEASONAL FRUITING AND SPORULATION OF THEKOPSORA AND 

CHRYSOMYXA CONE RUSTS IN NORWAY SPRUCE CONES AND ALTERNATE 

HOSTS IN FINLAND 

Juha KAITERA, Eila TILLMAN-SUTELA and A. KAUPPI........................................... 171-176 

PRELIMINARY STUDIES ON GENETIC VARIATION IN Gymnosporangium fuscum 

IN THE LAKES DISTRICT OF TURKEY DETECTED WITH M13 MINISATELLITE 

MARKER 

Asko LEHTIJÄRVI, H. Tuğba DOĞMUŞ-LEHTIJÄRVI, A. Gülden ADAY, 

Funda OSKAY .............................................................................................................. 177-181 

FACTORS FAVOURING BROOM RUST INFECTION IN ADVANCE PLANTINGS 

OF Abies alba IN SW-GERMANY 

Tilo PODNER, Berthold METZLER .............................................................................. 182-186 

VIII



Foliage diseases of hardwood 

NON-NATIVE HOSTS AND CONTROL OF Rhytisma acerinum CAUSING TAR SPOT 

OF MAPLE 

Tom HSIANG, Tian LYNN, Coralie SOPHER............................................................... 189-193 

BIOLOGICAL CONTROL TRIALS OF BEECH BARK DISEASE UNDER 

LABORATORY CONDITIONS 

Gaston LAFLAMME, Simon BOUDREAULT, Robert LAVALLÉE, Martine BLAIS, 

Jean Yves BLANCHETTE ............................................................................................. 194-199 

PATHOGENICITY OF Fusarium circinatum NIREMBERG & O’DONNELL ON 

SEEDS AND SEEDLINGS OF RADIATA PINE 

Pablo MARTÍNEZ-ÁLVAREZ, Juan BLANCO, Milagros DE VALLEJO, 

Fernando M. ALVES-SANTOS, Julio Javier DIEZ ........................................................ 200-205 

POWDERY MILDEW ON WOODY PLANTS IN THE CZECH REPUBLIC 

Dagmar PALOVČÍKOVÁ, Hana DANČÁKOVÁ, Hana MATOUŠKOVÁ, 

Jindřiška JUNÁŠKOVÁ and Libor JANKOVSKÝ.......................................................... 206-215 

Abiotic diseases and other diseases 

URBAN TREE HEALTH OF 49 GREEN SPACES IN MADRID (SPAIN) 

Eva ALFONSO CORZO, María Jesús GARCIA and J. A SAIZ DE OMEÑACA............. 219-232 

CHARACTERISATION OF CZECH Ophiostoma novo-ulmi ISOLATES 

Milon DVORAK, Libor JANKOVSKY, J .KRAJNAKOVA ........................................... 233-237 

HAIL DAMAGE OF FOREST TREES IN WESTERN CANADA 

Yasuyuki HIRATSUKA................................................................................................. 238-240 

Extended abstracts 

THREATENING TREE DISEASE IN EAST AFRICA 

Pia BARKLUND, Jane NJUGUNA, Abdella GURE, Philip NYEKO, Katarina IHRMARK 

and Jan STENLID . ........................................................................................................ 243-244 

PREMATURE DEFOLIATION OF Cedrus libani IN SOUTH- WESTERN TURKEY 

Asko LEHTIJARVI, H. Tuğba DOĞMUŞ-LEHTIJÄRVI....................................................... 245 

CONTRIBUTIONS TO THE PHYLOGENY OF EUROPEAN Porodaedalea species 

(BASIDIOMYCETES, HYMENOCHAETALES) 

Michal TOMSOVSKY, Libor JANKOVSKY.................................................................. 246-251 

Abstracts 

EXAMINING THE GEOGRAPHIC DISTRIBUTION OF Diplodia pinea AND D. 

scrobiculata: A CASE STUDY FROM MINNESOTA, USA 

J. S. ALBERS, Denise R. SMITH, Glen R. STANOSZ........................................................... 255 

FOREST INVASIVE ALIEN FUNGAL SPECIES PRESENT IN LIVE PLANT 

MATERIAL 

Jean A. BERUBE.................................................................................................................. 256 

NEW ADVANCES IN THE STUDY OF THE TAXONOMY OF THE EUROPEAN 

RACE OF Gremmeniella abietina 

Leticia BOTELLA, Julio Javier DIEZ and Jarkko HANTULA................................................ 257 

IX



STUDIES ON THE SIGNIFICANCE, CAUSAL AGENTS AND CONTROL 

METHODS OF DAMPING- OFF DISEASE IN FOREST NURSERIES OF AEGEAN 

AND LAKES DISTRICT 

H. Tuğba DOĞMUŞ LEHTIJÄRVI and Gülay TURHAN..................................................... 258 

A FOLIAR DISEASE OF Celtis glabrata IN THE LAKES REGION 

Gürsel KARACA, H. Tuğba DOĞMUŞ LEHTIJÄRVI –, Hüseyin FAKIR ............................. 259 

DETERMINATION OF MACROMYCETES IN THE REGION OF KOCAELI 

Ayhan KARAKAYA ............................................................................................................ 260 

ARE SUBPOPULATIONS OF Heterobasidion parviporum DIFFERENTIATED BY 

LOCAL CLIMATE? 

Michael M. MÜLLER, Nicola LA PORTA, Jaana EKOJÄRVI, Jarkko HANTULA and Kari 

KORHONEN........................................................................................................................ 261 

ATTEMPTS TO NATURALLY REGENRATE RED PINE CAN BE THREATENED 

BY DIPLODIA SHOOT BLIGHT DAMAGE TO UNDERSTORY SEEDLINGS 

B.W. OBLINGER, Denise R. SMITH and Glen R. STANOSZ............................................... 262 

SOME FUNGAL SPECIES ON Pinus pinaster Ait. AND Pinus radiata D. Don 

PLANTATIONS IN MARMARA REGION OF TURKEY 

Fazıl SELEK......................................................................................................................... 263 

RESPONSE OF Alnus tenuifolia TO INOCULATION WITH Valsa melanodiscus. 

Glen R. STANOSZ, L. M. TRUMMER, J. K. ROHRS-RICHEY, - G.C. ADAMS and 

J. T. WORRALL................................................................................................................... 264 

GREMMENIELLA INFECTIONS ON SEEDLINGS AFTER REPLANTING 

SEVERELY INFECTED PINE FOREST 

Elna.STENSTRÖM........................................................................................................ 265-266 

List of participants 

X

Preface 

The meeting of IUFRO Working Party (WP) 7.02.02 “Foliage, Shoot 

and Stem Diseases of Forest Trees” was held in Eğirdir, Isparta, 

Turkey. Local organizers were Dr. H. Tuğba Doğmuş-Lehtijärvi and 

her colleagues from the Faculty of Forestry, Süleyman Demirel 

University. In the opening ceremony, vice rectors of the university, 

Dr. Vecihi Kırdemir and Dr. Mehmet Ali Koyuncu and also dean of 

the Forestry Faculty, Dr. Musa Genç and the Coordinator of the 

IUFRO Forest Health Division, Dr. Gaston Laflamme welcomed the 

participants of the WP. We thank the attendees who presented oral 

and poster presentations, local organisers for their great effort, 

Süleyman Demirel University for their kind support and The 

Scientific and Technological Research Council of Turkey (TUBİTAK) 

for financial support. 

Forest pathology has developed a lot during the past 40 years. The 

most remarkable progress is the possibility to use DNA methods in 

studying genetics of pathogens and host plants. DNA methods are 

helping us also when we try to find out the origin of new diseases, 

alien or original? What is the next step? Also the development of 

information technology has affected a lot of our daily working 

compared to time before computers and internet. The first step in 

forest pathology is to describe the pathogen and disease symptoms. 

The pathogenicity should be tested according to Koch’s postulates. 

Then the ecology of the disease should be examined experimentally 

including the interactions between the pathogen, host, other 

microbes and environment. DNA methods can be used in studying 

the variation of pathogens, taxonomy, endophytes and 

pathogenesis. 

The first meeting of the IUFRO Working party 7.02.02 was 

arranged in 1973 in Minneapolis, USA. Now Turkey was the 10th 

country to host the meeting so far. In the first meetings one of the 

main subjects was Scleroderris canker which was an important 

disease in Europe, Northern America and Japan. Surprisingly, the 

subjects of the presentations in this meeting were scattered, 

including some other important biotic and abiotic diseases of forest 

trees. 

XI

SDÜ Faculty of Forestry Journal 

When new disease appears we should start from the beginning. 

Thanks to new methods or tools we can get the same knowledge 

much faster than in the 1900´s. It seems that new diseases appear 

continuously, f. ex. Phytophthora alni and Chalara fraxinea in 

Europe. The human interest to grow exotic tree species and even the 

commercial international seedling trade keeps the forest 

pathologists in work in future too. 

The climate change means also challenges to forest pathologists. 

The warming climate is a fact based on the laws of physics. The 

concentration of carbon dioxide and other greenhouse gases are 

rising fast in atmosphere. Near the arid areas the warming means 

the drought problems and in the north it means the new pathogens 

from milder climates together with faster forest growth. The climate 

change can disturb the evolutionary balance between the plants 

and the pathogens. But the climate change highlights also the 

importance of forests. At the same time, forests produce renewable 

materials and energy and bind the carbon dioxide from the air. A 

healthy forest is important in controlling the warming. This is a 

fact which is very important to get to a common knowledge of people 

and this is our task. 

Nowadays we can exchange information quickly by internet. Why 

to fly to another side of the earth to meet colleagues? I think the 

human being needs human contacts and conversation. This is an 

excellent opportunity to discuss and to start co-operation. The 

internet has not yet changed human genes. We had once more a 

very successful meeting in Eğirdir with very sincerely and relaxed 

atmosphere and found the opportunity to share the experiences and 

create the new ideas coming from basically all age groups, from 

very young to seniors, and we had close to 50 participants from 15 

countries with 29 oral presentations and 15 posters. This proceeding 

includes full papers as well as extended and short abstracts and we 

would like to mention that the responsibility for the published 

papers lies with the authors. 

Finally, we would like to see you in the next meeting to be held in 

Spain, 2011 organised by new deputy Julio Javier Diez Casero! 

Antti Uotila H. Tuğba Doğmuş-Lehtijärvi 

Coordinator Local organizer & Deputy 

IUFRO WP 7.02.02 

XII

Full Papers 

1

Foliage Diseases of Conifers 

3

Needle Diseases 

5

SDU Faculty of Forestry Journal 

Serial: A, Number: Special Issue, Year: 2009, ISSN: 1302-7085, Page: 7-14 

DOTHISTROMA AND LECANOSTICTA NEEDLE BLIGHT IN THE CR 

Libor JANKOVSKÝ 1* , Miroslava BEDNÁŘOVÁ 1 , Miloň DVOŘÁK 1 , 

Dagmar PALOVČÍKOVÁ 1 , Michal TOMŠOVSKÝ 1 

1 Dpt. of Forest Protection and Wildlife Management, Faculty of Forestry and Wood Technology, 

Mendel University of Agriculture and Forestry, Zemědělská 3, 613 00 Brno, Czech Republic 

ABSTRACT 

*jankov@mendelu.cz 

Dothistroma needle blight is widespread in the Czech Republic now, although 

the first finding was noted in 2000. To date, it has been identified on 21 species of 

Pines, 4 species of Spruces and also on Douglas fir in the CR. Records on Scots 

pine were exceptionally rare in the CR and also in Europe up to spring 2008. 

Brown spot needle blight caused by Lecanosticta acicola was for the first time 

reported in the Czech Republic on June 2007, actually is known from 2 localities 

on Pinus rotundata. Lecanosticta acicola coincides in observed localities with 

Dothistroma needle blight on Scots pine Pinus sylvestris, bog pine Pinus rotundata 

and their hybrid P. digenea, however no finding of both diseases on the same tree 

was observed. 

Key words: Dothistroma septosporum, Lecanosticta acicola, needlecast, alien 

species 

1. INTRODUCTION 

Dothistroma needle blight Mycosphaerella pini E. Rostrup, resp. its anamorph 

Dothistroma septosporum is known from most of European countries, eg. France, 

Italy, Portugal, Spain, Georgia (Ivory, 1994), UK (Murray and Batko, 1962), 

Croatia (Novak-Agbaba et al., 1997; EPPO, 2005), Montenegro and Serbia 

(Karadzic, 1989, 2004), Romania (Gremmen, 1968) etc. From Central Europe it 

was reported from Austria (Petrak, 1961), Slovenia (Macek, 1975), Germany 

(Butin, 1983; Richter, 1983) and Poland (Kowalski and Jankowiak, 1998) where it 

7


was found in May 1990, Slovakia (Kunca and Foffová, 2000), Hungary (Koltay, 

1997) and Czech Republic (Jankovský et al., 2000, 2004). Recent findings are from 

Netherlands (EPPO, 2007) and Belgium (EPPO, 2008a). Up to 2008 there was no 

report on Dothistroma from Scandinavia, actually there are reports from Estonia 

(Hanso and Drenkhan 2008), Finland (EPPO, 2008b), Sweden (Stenlid, oral 

communication; DNA isolated from needle, no symptoms); it is also reported from 

Lithuania (Fig 1). European strains belong mostly to Dothistroma septosporum, 

however Barnes et al. (2004, 2007) recorded also D. pini from samples from 

Ukraine. 

Fig. 1 Distribution of Dothistroma needle blight in Europe. Years mean first published 

report, in parentheses are years of findings, if differ from year of publishing. 

Brown spot needle blight Mycosphaerella dearnessii M. E. Barr, resp. 

anamorphic stage Lecanosticta acicola (Thüm.) Syd. is in Europe reported (Fig. 2) 

from Austria (Petrak, 1961; Brandstetter and Cech, 1999, 2003; Kirisits and Cech, 

2006), France (Chandalier et al., 1993), Italy (Porta and Capretti, 2000), Germany 

(Butin and Richter, 1983; Pehl, 1995), Switzerland (Holdenrieder and Sieber, 

1995), Bulgaria and formerly Yugoslavia (Holdenrieder and Sieber, 1995), Serbia 

(Milanovic and Karadzic, oral communication), in 1979 it was reported from 

Croatia (Novak-Agbaba and Halambek, 1997; EPPO, 2007). Some new records 

origin from Estonia (Cech, 2008, oral communication) and Slovenia (Jurc, 2008). 

8

SDÜ ORMAN FAKÜLTESİ DERGİSİ 

Fig. 2. Distribution of Lecanosticta acicola in Europe. Years mean first report, in 

parentheses are years of findings, if differ from year of publishing. 

2. MATERIAL AND METHODS 

Records from the Czech Republic are based on monitoring carried out in 2000 – 

2008. Pine and also Spruce and Douglas fir needle samples were examined, mainly 

from regions of Southern and Central Moravia, Silesia, Eastern and Central 

Bohemia. 

The presence of the pathogen was always investigated according to 

characteristic symptoms such as red bands, dying tips of needles or the occurrence 

of subepidermal sporocarps, acervuli. Exact identification was proved on the basis 

of microscopic analyses of conidia. 

Isolation of culture was made on 3% MEA containing malt extract 30 g/l, 

pepton 5 g/l, agar 15 g/l, without addition of any antibiotics. Pieces of needles with 

acervuli 3 - 5 mm long were on surface sterilized by sodium hypochlorite 7%, 

subsequently by ethanol 96% and washed by sterilized water and put on malt 

extract agar. After 3 weeks of incubation, when new conidia occurred on fruiting 

bodies, conidia were inoculated into new medium. 

Herbarium specimens are deposited at Herbarium of Faculty of Forestry and 

Wood Technology (BRNL). 

9

3. RESULTS AND DISCUSSION 


Dothistroma needle blight is widespread across the CR now, although the first 

finding was noted in 2000 (eg. Jankovský et al., 2000, 2004; Bednářová et al., 

2007). More than 80 host species of Dothistroma needle blight are mentioned from 

all continents (Bednářová et al., 2006). To date, it has been identified on 21 species 

of pine, 4 species of spruce and also on Douglas fir in the CR: Pinus aristata 

Engelm., P. attenuata Lemon, Pinus banksiana Lamb., Pinus cembra L. var. 

sibirica (Du Tour) G. Don, Pinus contorta Douglas ex Loudon, Pinus x digenea 

Beck (=P. rotundata x P. sylvestris), Pinus heldreichii H. Christ, Pinus heldreichii 

H. Christ var. leucodermis (Antoine) Markgraf ex Fitschen, syn. Pinus leucodermis 

Ant., Pinus jeffreyi Grev. et Balf, Pinus mugo Turra, Pinus nigra Arnold, Pinus 

ponderosa Douglas ex Lawson, Pinus pungens Lambert, Pinus rigida Miller, Pinus 

rotundata Link = Pinus mugo nothosubsp. rotundata (Link) Janchen & Neumayer, 

Pinus strobus L. var. sibirica, Pinus sylvestris L., Pinus tabuliformis Hort. ex 

Carrière, Pinus taeda L., Pinus thunbergii Parlatore, syn. Pinus thunbergiana 

Franco, Pinus wallichiana A. B. Jackson, Picea abies L. Karst., Picea pungens 

Engelm., Picea omorika (Pančić) Purkyně, Picea schrenkiana Fisch. & C. A. Mey, 

Pseudotsuga menziesii. Austrian pine Pinus nigra Arnold, mountain pine Pinus 

mugo Turra, Pinus ponderosa Douglas ex Lawson, Pinus jeffreyi Grev. are the 

most frequent and most susceptible hosts. As for species of other genera Picea 

pungens Engelm., Picea abies L. Karst., Picea omorika Purkyně and Picea 

schrenkiana Fisch. & C. A. Mey were noted as hosts. Dothistroma septosporum 

was also isolated from needles of Pseudotsuga menziesii. Symptoms on needles of 

Douglas fir were not so clear, acervuli were observed exceptionally. 

Records on Scots pine were exceptionally rare in the CR and also in Europe up 

to spring 2008. Risk of Dothistroma needle blight for Scots pine in Europe is noted 

eg. by Lang and Karadzic (1987). According to Gadgil (1984), Pinus sylvestris is 

highly susceptible. Contrary, according to data from Great Britain, Peterson (1982), 

mentions that the attack occurs very rarely. However several hectares of Scots pine 

plantations, infested by Dothistroma septosporum, about 10 years old, were 

registered in Southern Bohemia, in Forest district Nové Hrady, Třeboň area, in 

March, 2008. In 2009 progress of infection in the same plot contrary precedent 

year. Large infestations were registered also on Scots pine in peat bog nature 

reserve Soběslavská blata in Southern Bohemia. Infected trees were origin from 

natural regeneration. Surrounding commercial forest was not affected. Dothistroma 

septosporum outbreak on Scots pines was observed simultaneously in large areas 

across the Central Finland in spring 2008 (EPPO, 2008). Dothistroma seems to be 

threat for Scots pine, including natural stands in Europe, although it was mostly 

reported from plantations of introduced species eg. Pinus nigra, P. ponderosa, P. 

contorta etc. 

Brown spot needle blight caused by Lecanosticta acicola was for the first time 

reported in the Czech Republic on June 10, 2007 (Jankovský et al. 2008). The first 

record is from the peat bog National Nature Reserve Červená Blata in South 

10


Bohemia, close to town Třeboň; coord. N 48°51'37.06", E 14°48'44.09". The 

disease was observed on 10 – 40 years old trees of Pinus rotundata, (Jankovský et 

al., 2008). The new record in the CR is from the same host species, 10-60 years old 

in National Nature Reserve Borkovická blata, near town Soběslav (coord. N 

49°14'16.3" E 14°37'54.2") on August 7, 2008 (Jankovský et al., in press). Both 

places are very strictly protected areas. Typical symptoms (according to EPPO, 

2005) were observed in current year needles declined from tips in middle of July 

and in August. Brown spots with apparent yellow separation were present on green 

needles as well. Visible yellow belts were present between dead tissues of killed 

tips and green tissues. Studied conidia were subhyalinne, even dark olive green, 

surface of conidia echinulate to verrucose or tuberculate, straight to curved, with 

one to five septae, fusiform to cylindrical, size 3 - 5 μm × 21 - 44 μm. On 3% MEA 

medium, the fungus produced grayish green olive to olive black stromatic colonies, 

producing slime with conidias 

Lecanosticta acicola coincides in localities with causal agent of Dothistroma 

needle blight Dothistroma septosporum on Scots pine Pinus sylvestris, bog pine 

Pinus rotundata and their hybrid P.×digenea. Nevertheless, the threat of the 

disease spreading to Scots pines frequently planted in the region remains unclear 

yet. While bog pines inside the nature reserves display remarkable needle 

defoliation, Scots pines in surrounding managed stands are without visible 

symptoms of infection by Lecanosticta acicola. 

4. CONCLUSIONS 

With respect to actual epidemic situation in some countries, it is necessary to 

discuss the role of climatic factors in Europe and trade with plant material as main 

risk factors for spreading of both diseases. Dothistroma needle blight and brown 

spot needle blight are relatively quickly spreading needle casts in Central and also 

in Northern Europe. Within past 15 years, Dothistroma was reported from many 

new areas. Spreading of these diseases should be considered as result of climatic 

extremes and also one of exhibitions of climatic changes (eg. Woods et al., 2005). 

However reasons of spreading are still not sure. We cannot exclude also some other 

factors as trade with plant material. Reasons of occurrence of disease of strictly 

protected areas without any human interventions for many decades are not sure. 

Control of these needle casts is problematic due distribution in large infested areas. 

Dothistroma needle blight is established in most areas across Europe now and 

seems to be problem in Central and North Europe now due to very quick spreading 

and adaptation for climatic and natural conditions in new areas. 

5. ACKNOWLEDGEMENTS 

The results presented here were obtained from projects supported by NAZV 

QH81039. 

11

6. REFERENCES 


Barnes, I., Wingfield, M.J., Groenewald, M., Kirisits, T., Crous, P.W., Wingfield, B.D., 2007. 

Exposing the Enigma of Dothistroma Needle Blight Using Molecular Markers – a 

Progress Report. Acta Silv. Lign. Hung., Spec. Edition: 239-240. 

Barnes, I., Crous, P.W., Wingfield, M.J., Wingfield, B.D., 2004. Multigene phylogenies reveal that 

red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. 

septosporum and D. pini. Stud. Mycol. 50, 551-565. 

Bednářová, M., Palovčíková, D., Jankovský, L., 2006. The host spektrum of Dothistroma needle 

blight Mycosphaerella pini E. Rostrup – new hosts of Dothistroma needle blight observed 

in the Czech Republic. Journal of Forest Science 52(1), 30–36. 

Bednářová, M., Bodejčková, I., Palovčíková, D., Jankovský, L., 2007. 

The contemporary situation of Dothistroma needle blight outbreak in the Czech Republic. 

Acta Silv. Lign. Hung. Spec. Edition, 17-22. 

Brandstetter M., Cech T. 2003. Lecanosticta - Kiefernnadelbäume (Mycosphaerella dearnessii Barr) 

in Niederösterreich = Brown Spot Needle Blight of Pines (Mycosphaerella dearnessii 

Barr) in Lower Austria. Centralblatt für das gesamte Forstwesen, Wien, 120 (3/4), 163- 

175. 

Brandstetter, M., Cech, T., 1999. Neue Nadelkrankheiten Kiefer. Osterreichishe Forstzeitung, 99 (3): 

p. 35 - 36. 

Butin H., Richter J., 1983 Dothistroma - Nadelbräune: Eine neue Kiefernkrankheit in der 

Bundesepublik Deutschland. Nachrichtenblatt Deutscher Pflanzenschutzdienst 

(Braunschweig), 35: p. 129 - 131. 

Doroguine, G., 1911. Une maladie cryptogamique du Pin. Bulletin Trimestriel de la Société 

Mycologique de France 27 (1): 105 – 106. 

EPPO, 1997. Fungal diseases of forest trees in the coastal region of Croatia. EPPO Reporting Service. 

1997/149. 

EPPO, 2005a. EPPO Standards. Diagnostic PM 7/46. OEPP/EPPO, EPPO Bulletin, 35: p. 271 – 273. 

EPPO, 2005b. New data on quarantine pests and pests of the EPPO Alert List. EPPO Reporting 

Service. 2005/33. 

EPPO, 2007. First report of Mycosphaerella pini in the Netherlands. EPPO Reporting Service. 

2008/55. 

EPPO, 2008a. First report of Mycosphaerella pini in Belgium. EPPO Reporting Service. 2007/211. 

EPPO, 2008b. First report of Mycosphaerella pini in Finland. EPPO Reporting Service. 2008/185. 

Gadgil, P.D., 1984. Dothistroma needle blight. Forest Pathology in New Zealand, No. 5. New 

Zealand Forest Service, Roturua, New Zealand. 

Gremmen, J., 1968. The presence of Scirrhia pini Funk et Parker in Romania (Conidial stage: 

Dothistroma pini Hulb.). Bulletin Trimestiel de la Société Mycologique de France, 84: 

489–492. 

Hanso, M., Drenkhan, R., 2008. First observations of Mycosphaerella pini in Estonia. New disease 

reports 17. 

Holdenrieder, O., Sieber, T.N., 1995. First report of Mycosphaerella dearnessii in Switzerland. Forest 

Pathology, 25(5), 293 – 295. 

Hulbary, R.L., 1941. A needle blight of Austrian pines: III. of the Illinois Natural History Survey 

Bulletin 21, 231 – 236. 

12


Chandelier, P., Lafaurie, C., Maugard, F., 1994. Découverte en France de Mycosphaerella dearnessii 

sur Pinus attenuata x radiata. C.R. Acad. Agric. Fr., 80, 103 - 108. 

Ivory, M.H., 1994. Records of foliage pathogens of Pinus species in tropical countries. Plant 

Pathology 43, 511–518. 

Jankovský, L., Šindelková, M., Palovčíková, D., 2000. Karanténní sypavky Mycosphaerella pini a M. 

dearnessii. [The quarantine needlecasts Mycosphaerella pini and M. dearnessii] Lesnická 

práce 79, 370 – 372. 

Jankovský, L., Bednářová, M., Palovčíková, D., 2004. Dothistroma needle blight Mycosphaerella pini 

E. Rostrup, a new quarantine pathogen of pines in the CR. Journal of Forest Science 50, 

319-326. 

Jankovský, L., Palovčíková, D., Tomšovský, M., 2008. Brown spot needle blight associated with 

Mycosphaerella dearnessii occurs on Pinus rotundata in the Czech Republic. New 

Disease Reports, 18. . 

http://www.bspp.org.uk/ndr/volume18.asp. 

Karadzic, D.M., 1989. Scirrhia pini Funk et Parker. Life cycle of the fungus in plantations of Pinus 

nigra Arn. in Serbia. Eur. J. For. Path. 19 (4), 231-236. 

Karadzic, D. M., 2004. The distribution, hosts, epidemiology, impact and control of fungus 

Mycosphaerella pini E. Rostrup apud Munk. in Serbia. Glasnik Šumarskog fakulteta, 

Beograd 90, 7 – 35. 

Kirisits, T., Cech, T., 2006. Entwickelt sich die Dothistroma-Nadelbräune zu einem 

Forstschutzproblem in Österreich? Forstschutz aktuell, 36, 20 – 26. 

Kowalski, T., Jankowiak, R., 2008. First record of Dothistroma septospora (Dorog.) Morelet in 

Poland: a contribution to the symptomology and epidemiology. Phytopatologia Polonica 

16, 16-29. 

Koltay, A., 1997. New pathogens in Hungarian black pine stands. Novenyvedelem 33 (7), 339 – 341. 

Kunca, A., Foffova, E., 2000. Ohrozenie porastov borovice čiernej fytokaranténnym patogénom 

Dothistroma septospora (Dorog.) Morelet [Threat of stands of Austrian Pines by 

Dothistroma septospora (Dorog.) Morelet]. In: Varinsky J. (ed.): Aktuálne problémy v 

ochrane lesa 2000. Proceeding Zvolen, Slovak National Forest Centrum Zvolen, 136– 

139. 

La Porta, N., Capretti, P., 2000. Mycosphaerella dearnessii, a needle-cast pathogen on mountain pine 

(Pinus mugo) in Italy. Plant Disease, 84(8): 922. 

Lang, K. J., Karadzic, D., 1987. Dothistroma pini - eine Gefahr für Pinus sylvestris?- 

Forstwissenschaftliches - Zentralblatt 106 (1), 45-50. 

Macek, J., 1975. Scirrhia pini, the pathogen of a new disease of Pine in Slovenia. Gozdarski Vestnik, 

33, 9 – 11. 

Morelet, M., 1968. De Aliquibus in Mycologia Novitatibus (3 e note). Bull. Soc. Sci. Nat. Archeo. 

Toulon Var. 177, 9. 

Murray, J. S., Batko, S., 1962. Dothistroma pini Hulbary: A new disease on pine in Britain. Forestry 

3, 57–65. 

Novak-Agbaba, S., Halambek, M., 1997. The most important plant diseases on forest trees in the 

coastal region of Croatia. In: Proceedings of the 10th Congress of the Mediterranean 

Phytopathological Union, 1997-06-01/05, Montpellier (FR), 67-73. 

Pehl, L., 1995. Lecanosticta-Nadelbräune. Eine neue Kiefernkrankheit in der Bundesrepublik 

Deutschland. Nachrichtenbl. Deut. Pflanzenschutzd., 47, 305 - 309. 

13


Peterson, G.W., 1982. Dothistroma needle blight of pines. Forest Insect and Disease Leaflet 143. 

U.S. Department of Agriculture Forest Services, Washington DC. 

Petrak, F., 1961. Die Lecanosticta Krankheit der Föhren in Osterreich [The 

Lecanosticta disease of. pines in Austria]. Sydowia 15, 252–256. 

Saccardo, P. A., 1920. Mycetes Boreali-Americani. Nuovo Giornale Botanico Italiano 27, 75–88. 

Woods, A., Coates, D. and Hamann, A., 2005. Is an Unprecedented Dothistroma Needle Blight 

Epidemic Related to Climate Change? BioScience 55, 761-769. 

14



TWO NEW SPECIES OF Lophodermium COLONISE SCOTS PINES 

NEEDLES IN SCOTLAND 

ABSTRACT 

Sabrina. N. A. REIGNOUX 1 *, Elizabeth A.E. AITKEN, Sarah GREEN, 

Richard A. ENNOS 

1 Forest Research, Northern Research Station, Roslin, Midlothian, Scotland EH25 9SY 

*s.n.a.reignoux@sms.ed.ac.uk 

Previous work has indicated that Scots pine needles are colonized by three species of 

Lophodermium, of which two are the endophytes L. pinastri and L. conigenum and the third 

is the pathogen L. seditiosum. Recent work on a DNA based Lophodermium phylogeny 

found huge variation among L. pinastri isolates which was interpreted as the presence of 

two subspecies within this taxon. In this study we use a combination of sequence data, 

molecular markers and culture morphology to demonstrate the existence of three distinct 

taxa within the entity that was previously classified as L. pinastri. These three taxa co-occur 

within the native pine woods of Scotland 

Keywords: Ascomycete, Lophodermium pinastri, Pinus sylvestris, Phylogeny 


There is increasing evidence that the diverse endophytic communities within the 

leaves and needles of trees confer protection against pathogens (Petrini, 1991; 

Arnold et al., 2003). A situation in which protection by endophytes could be 

commercially important is found in the ascomycete genus Lophodermium Chev 

which is ubiquitous in pines and is distributed worldwide. Many Lophodermium 

species live asymptomatically as endophytes inside the needles of pines for at least 

part of their life cycle (Minter, 1981a; Diwani & Millar, 1987; Wilson, 1995) and 

could potentially help to protect against needle cast diseases (Minter, 1981b). 

However in order to determine the importance of endophytic Lophodermium 

species in protecting pines from needle diseases, it is essential to clarify their 

taxonomy so that they can be readily identified and their ecology and behaviour 

can be studied. 

Lophodermium Chev. includes 145 species, mostly from pine hosts, and there is 

some degree of host specificity (Kirk et al., 2008; Ortiz-Garcia et al., 2003). 

Morphological characteristics of this genus include a single longitudinal slit 

opening of the apothecia, and the fusiform shape of the ascospores (Darker 1967). 

As it is known today, the Lophodermium species complex on P. sylvestris in 

Scotland includes two endophytes and one pathogen. The two endophytes differ in 

15


their ecology. L. pinastri ascocarps are found on naturally shed needles, while L. 

conigenum fruits on prematurely killed needles (Minter and Millar, 1980). The 

pathogen L. seditiosum causes needlecast disease which is particularly a problem 

on young P. sylvestris (Diwani and Millar, 1987). 

Preliminary studies of Lophodermium isolates made from naturally shed needles in 

Scottish native pinewoods showed striking variation among cultures grown on malt 

agar. PCR-RFLP and sequence analysis of the ITS region in these isolates also 

showed greater variability than had hitherto been reported for L. pinastri (Johnston 

et al., 2003). In this manuscript we explore the hypothesis that the current taxon L. 

pinastri includes more than one species. The hypothesis is tested using data from a 

DNA based phylogeny and analysis of DNA markers and cultural morphology. 


2.1. Fungal Isolates and DNA extraction 

L. pinastri was isolated onto malt agar from naturally shed, surface sterilized 

needles collected in the Scottish native pine woods at Glen Affric (NH278278) and 

Amat (phylogenetic and population genetic analysis) and in Glen Affric, Abernethy 

(NJ015155) and Loch Maree (NG995654) for the analysis of culture morphology 

(Table 1). DNA was extracted from pure cultures grown in liquid Malt Extract 

medium using the Plant DNAeasy Qiagen kit. 

Table 1: Numbers of isolates of each clade and population included in the culture 

morphology test 

Population Clade Ia Clade Ib CladeII 

Loch Maree 10 20 3 

Glen Affric 15 20 18 

Abernethy 20 20 2 

Total 45 60 23 

2.2. Sequencing and Sequencing Analysis 

ITS regions of the Ribosomal DNA and partial ACTIN was amplified using 

primers ITS1 / ITS4 (White et al., 1990) and ACT-512F / ACT-783R (Carbone and 

Kohn 1999) respectively. Sequencing of both strands was conducted using the 

BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem, Foster city, 

USA). Sequences were aligned with Clustal X2 (Thompson et al., 1997; Larkin et 

al., 2007). 

2.3. Phylogenetic Analysis 

Phylogenetic analysis was conducted using parsimony in PAUP* 4.0 (Swofford, 

2003) and Baysian inference in MrBayes-3.1.2 (Huelsenbeck and Ronquist, 2001; 

16


Ronquist and Huelsenbeck, 2003). Additional ITS sequences derived from 

Genbank were included in a broader ITS phylogeny to look at the relationship 

between L. pinastri isolates from Scotland and from other parts of the globe. 

2.4. Amplified Fragment Length Polymorphism and Corresponding Analysis 

AFLP (Amplified Fragment Length Polymorphism) markers were obtained using 

the protocol of Vos et al. (1995). Eight primer combinations were chosen which 

gave 549 markers across all L. pinastri isolates (Table 2). Bands were scored as 

present or absent, a distance matrix was calculated using the Jaccard coefficient, 

and this was used to conduct a principal coordinate analysis in PAST. 

Table 2: Numbers of AFLP markers found in each putative Lophodermium species 

Primer Combination Total Clade Ia Clade Ib Clade II 

AAC/CAA 74 27 23 24 

AAC/CG 86 31 33 33 

AAC/CT 98 24 39 48 

AAC/CC 91 26 33 46 

AAC/CAGA 53 26 7 28 

AAC/CTA 58 18 10 34 

AAC/CCG 60 20 13 32 

AAC/CAG 29 12 5 12 

2.5. Culture Morphology 

Isolates collected as described above from Glen Affric, Loch Maree and Abernethy 

(Table 1) were identified to clade on the basis of their ITS sequence. Isolates were 

then chosen at random within clades and populations. Inoculum measuring 5mm 

diameter was cut from cultures and transferred onto a 2% malt agar Petri dish. 

Radial growth was measured once a week. The experiment followed a randomised 

block design with four blocks and included two replicates of each isolate. Results 

were analysed using R 2.8.0 (R Development Core Team, 2008) 

3. RESULTS 

3.1. Phylogenetic and Genetic Marker Analysis 

Phylogentic analysis showed a total of five monophyletic clades with strong bootstrap 

or prior probability support within the Lophodermium complex on Pinus sylvestris. 

Isolates derived from shed needles in Scottish pinewoods, and previously classified as 

L. pinastri, fell into three of these clades named Ia, Ib and II. These clades are 

consistent when using both Parsimony and Baysian inference of phylogeny on 

combined data from the ITS and Actin loci (Fig. 1 and 2). Isolates from these three 

clades also form three distinct groupings in the Principal Coordinate analysis based on 

genetic distances obtained by scoring AFLP markers. 

17


Figure 1: Phylogeny of Lophodermium species isolated from Pinus sylvestris needles from 

Scotland by Parsimony criterion phylogeny of the ITS. Bootstrap values are annotated on 

the branch located before the corresponding node 

18


Figure 2: Phylogeny of Lophodermium species isolated from Pinus sylvestris needles from 

Scotland by Baysian inference of phylogeny of combined ITS and Actin 

3.2. Culture Morphology 

Growth rate differs significantly among the three clades identified in the 

phylogenetic and genetic marker analyses (P< 0.001 ANOVA, Fig. 3). Clade Ib 

shows the slowest and clade Ia the fastest growth. 

19


Figure 3: Box plot representing growth rate difference between each phylogenetic clades 

Figure 4: Eight weeks old colonies of two individuals per clade. From left to right: Clade 

Ia, Clade II and clade Ib. 

20


3.3. Relationships among Lophodermium Species 

Clade Ia includes Genbank sequences of L. pinastri from Europe on Pinus 

sylvestris and from Canada on P. strobus (Fig. 5). There are no Genbank 

sequences of clade Ib except for those derived from the native pinewood at Glen 

Affric (Scotland). Clade II includes Genbank sequences of L. pinastri from P. 

ponderosa in North America and from P. pinaster in New-Zealand. It also 

includes a different species of Lophodermium, L. kumaunicum, described from 

the Himalayas. 

Figure 5: Phylogenetic relationship between species of Lophdermium Chev. 

21

4. DISCUSSION 


Multigene genealogy and genetic marker analysis coupled with culture morphology 

data demonstrate that Pinus sylvestris in Scotland is colonized by five species of 

Lophodermium, four of which are endophytes. Isolates previously classified in a 

single taxon, L. pinastri, fall into three distinct species. At least one of these 

species, corresponding to clade II, is distributed worldwide. This clade includes 

Genebank entries given the name L. pinastri and more recently L. kumaunicum. 

Clade II of L. pinastri was previously classified as a subspecies in the phylogeny of 

Lophodermium published by Ortiz-Garcia et al. (2003). 

The present study has uncovered a greater diversity of endophytes than was 

previously known. Clarification of their taxonomy, and the ability to recognize the 

Lophodermium taxa on Scots pine in Scotland will allow us to compare the genetic 

diversity, gene flow and mating system of each species. Ultimately this will help us 

to understand the differences that exist and the interactions that occur between 

closely related pathogens and endophytes within Lophodermium. 

5. ACKNOWLEDGMENT 

We would like to thank BBSRC and Forest Research for funding this project, 

Professor Mark Blaxter, Dr Graham Stone and Dr Martin Jones for their 

contribution in the phylogenetic analysis. 

6. REFERENCES 

Arnold, A. E., Mejia, L. C., Kyllo, D., Rojas, E. I., Maynard, Z., Robbins, N., et al., 2003. Fungal 

endophytes limit pathogen damage in a tropical tree. Proceedings of the National 

Academy of Science of the United States of America, 100, 15649-15654. 

Carbone, I., Kohn, L.M., 1999. A Method for Designing Primer Sets for Speciation Studies in 

Filamentous Ascomycetes. Mycologia, 91, 553-556. 

Darker, G. D., 1967. A revision of the genera of the hypodermataceae, 45, 1399-1444. 

Diwani, S.A., & Millar, C.S., 1987. Pathogenicity of three Lophodermium species on Pinus sylvestris 

L. European Journal of Forest Pathology, 17, 53-58. 

Huelsenbeck, J.P., & Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. 

Bioinformatics, 17, 754-755. 

Johnston, P.R., Park, D., Dick, M.A., Ortiz-Garcia, S., & Gernandt, D.S., 2003. Identifying pineinhabiting 

Lophodermium species using PCR-RFLP. New Zealand Journal of Forestry 

Science, 33, 10-24. 

Kirk, P.M., Cannon, F.P., Minter, W.D., & Stalpers, A.J., 2008. Dictionary of the Fungi 10th Edition 

(10th ed.). CABI Publishing. 

Larkin, M.A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., et al., 

2007. Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947. 

Minter, D.W., 1981a. Lophodermium on pines. Commonwealth Mycological Institute. 

22


Minter, D.W., 1981b. Possible biological control of Lophodermium seditiosum. In C. S. Millar (Ed.), 

Current Research on Conifer Needle Diseases, pp. 67-74. Aberdeen University Press, 

Aberdeen. 

Minter, D.W. & Millar, C.S., 1980. Ecology and biology of three Lophodermium species on 

secondary needles of Pinus sylvestris. European Journal of Forest Pathology, 10, 169- 

181. 

Ortiz-Garcia, S., Gernandt, D.S., Stone, J.K., Johnston, P.R., Chapela, I.H., Salas-Lizana, R., et al., 

2003. Phylogenetics of Lophodermium from pine. Mycologia, 95 846-859. 

Petrini, O., 1991. Fungal endophytes of tree leaves. Microbial ecology of leaves, 179–197. 

R Development Core Team., 2008. R: A language and environment for statistical computing. R 

Foundation for Statistical Computing Vienna, Austria. Retrieved from http://www.Rproject.org. 

Ronquist, F., & Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed 

models. Bioinformatics, 19, 1572–1574. 

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., & Higgins, D.G., 1997. The Clustal X 

windows interface: flexible strategies for multiple sequence alignment aided by quality 

analysis tools. Nucleic Acids Research, 24, 4876-4882. 

Swofford, D.L., 2003. PAUP–Phylogenetic Analysis Using Parsimony. Ver. 4.0 [Computer Software 

and Manual]. Sinauer Associates, Massachusetts, Sunderland. 

Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van De Lee, T., Hornes, M., et al., 1995. AFLP: a new 

technique for DNA fingerprinting. Nucleic acids research, 23, 4407-4414. 

White, T.J., Bruns, T., Lee, S., & Taylor, J., 1990. Amplification and Direct Sequencing of Fungal 

Ribosomal RNA Genes for Phylogenetics. In M. A. Innis, D. H. Gelfand, & J. J. Sninsky 

(Eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, San 

Diego, pp. 315-325. 

Wilson, D., 1995. Endophyte: The Evolution of a Term, and Clarification of Its Use and Definition. 

Oikos, 73, 274-276. 

23



RED BAND NEEDLE BLIGHT IN FINLAND, SYMPTOMS AND 

DISTRIBUTION 

Martti VUORINEN 1* 

1 Finnish Forest Research Institute, Suonenjok Research Unit FI-91500, Juntintie, Finland 

ABSTRACT 

*Martti.vuorinen@metla.fi 

Red band needle blight is cused by Mycosphaerella pini Rostrup (1957) also 

known as Scirrhia pini A. Funk & A.K. Parker and conidial state is Dothistroma 

septosporum (Dorog.) M Morelet. First time it has described as Cytosporina 

septospora Dorog. 1911 and later the asexual state has called Septoria septospora 

(Dorog.) Arx, Dothistroma pini Hulbary 1941, Dothistroma pini var. keniense 

M.H. Ivory 1967, Dothistroma pini var. lineare Thyr & C.G. Shaw 1964, 

Dothistroma septospora, Dothistroma septosporum (G. Doroguine) M. Morelet, 

Dothistroma septosporum var. keniense (M.H. Ivory) B. Sutton 1980, Dothistroma 

septosporum var. lineare (Thyr & D.E. Shaw) B. Sutton 1980, Dothistroma 

septosporum var. septosporum (Dorog.) M. Morelet 1968, Eruptio pini (Rostr.) 

M.E.Barr 1996. The disease is called red band needle cast or dothistroma needle 

cast or dothistroma needle blight or pine needle blight. In Finnish it is called 

punavyökariste. Reproduction happens mostly asexual through conidia during the 

growing season in moist conditions, in Finland from May to October. Needles of 

all ages are infected by D. septospora. If infection is strong, needles can fall down 

during the same growing season, but more often they can stay on branches to the 

next season. 

First symptoms of red band needle cast are yellow spots on needles which turn 

later on brown. Red-brown coloration, commonly associated to the disease is 

caused by dothistromin which is a potent and broad–spectrum toxin and is 

responsible for the characteristic necrotic lesions and red bands on needles. 

Mycosphaerella pini is believed to be native to the cloud forest of Central America, 

but the first description has made in Russia (Dorogin, 1911). Red band needle 

blight has now a days world wide distribution and is most serious disease in Pinus 

radiata plantations in Southern Hemisphere, East Africa, New Zealand and Chile 

and Pinus contorta in Northern Hemisphere in British Columbia, in Canada is 

particularly susceptible. 

There are altogether 80 host species: 60 Pinus species and t.e. Picea and 

Pseudotsuga. 

24


Occurrence in Finland 


Red band needle blight is most common in dense 5-15 years stands and infects 

needles in branches mostly in 0.5m-2 m high. It can also find in the same young 

pine stands, where is or has been Pine needle cast epidemic caused by 

Lophodermium seditiosum. Jankowsky (2008) has also observed infections in 60- 

80 years stands. In Pinus sylvestris records has made in Hungary, Poland, Zhech 

Republic and Estonia, but records were rare until spring 2008 (Jankowsky, 2008) 

when has happened rapid outbreak throughout Europe. 

Limiting factors to occurrence? 

In Finland red band needle blight is recorded first time in autumn 2007 and in 

spring 2008 pycnidias and germinated conidia was found and first tree isolates 

have done from Hartola, Kangasniemi and Suonenjoki and ITS sequenced. The 

sequences are identical with each others to a number of M. pini sequences of the 

GenBank database. 

Cold tolerance test has been made in test chambers to the needles, where was 

able to find fresh pycnidias: one day interval +5 o C/-5 o C, continuous -10 o C, one 

day interval +5 o C /-20 o C, continuous -70 o C in one week testing time and control 

samples were stored in cold room in +4 o C. No clear differences could be 

observed in the germination of conidia between temperatures, which mean that 

winter temperature is not a limiting factor. Humid climate favors the outbreak of 

red band needle cast, but dry periods in growing season are a stress to pathogen and 

the developing of the disease can discontinue. 

25


Observations of the distribution of Red band needle blight in Finland 2008 by 

occasionally selected areas. Observations were not made systematically in whole 

country, e.g. south western Finland was outside observation area. 

These observations show areas where red band needle cast was noticed in dense 

pine stand. Most of the observations in 2008 have made in southern and central 

Finland, but some observations have made in northern Finland, too. That means, 

that red band needle cast has spread out to some extend in whole country. 

CONCLUSIONS OF THE DISEASE OUTBREAK ACCORDING TO 

OBSERVATIONS 2008 

Red band needle blight has been prevalent since 1960s in pines planted as 

exotics in plantation forests, particularly in Southern hemisphere, but caused 

normally not serious damage to native pine stands. During the last few years the 

incidence of red band needle blight has increased dramatically in the Northern 

Hemisphere and the epidemic in British Columbia, Canada, has caused extensive 

mortality of pines in their native ranges and the disease has been correlated with 

climate change ( Woods et. al., 2005). Climate change could have a positive 

impact to the occurrence of Dothistroma pini if weather is humid and rainy during 

growing season. Drought during growing season is a stress to host and to pathogen 

too and the outbreak can stop. 

REFERENCES 

Jankovský, L., Tomešová, V., Palovčíková, D., Dvořák, M., Bednářová, M., 2008. Dothistroma 

needle blight -- Dothistroma septospora epidemic on Scots pine?. In Methodology of 

Forest Insect and Disease Survey in Central Europe. Abstrakt book. IUFRO Working 

Party 7. 03. 10. 1. vyd. Tatranské lomnica: IUFRO Working Party 7.03.10, 2008. 

Müller, M.M., Hantula, J. and Vuorinen M., 2009. First Observations of Mycosphaerella pini on 

Scots Pine in Finland. Plant Disease ,March 2009, Volume 93, Number 3 

Page 322 

Woods, A.K., Coates, D. and Hamann, A., 2005. Is an Unprecedented Dothistroma Needle Blight 

Epidemic Related to Climate Change? BioScience, Vol. 55, No. 9, pp. 761-769, 09/2005 

26

Scleroderris Canker 

27


28



THE OCCURRENCE OF MICROCONIDIA ON Gremmeniella abietina 

(LAGERB.) MORELET 

ABSTRACT 

Antti UOTILA 1* 

1 Hyytiälä Forestry Field Station, University of Helsinki, Finland 

*antti.uotila@helsinki.fi 

The Gremmeniella abietina microconidia were observed during 1981-2002 in 

numerous finnish specimen and pure cultures of the fungus. Microconidia existed in 

type A and B on Gremmeniella abietina. Microconidia were found in pycnidia and 

apothecia. Grey microconidial mass was produced also in pure cultures. Size of 

microconidium was 3-6 µm X 1 µm. The germination was not observed. The attempts 

to produce apothecia with the help of microconidia in lab failed. 


Finn and Helka Roll-Hansen first reported microconidia in 1973. They found 

microconidia in pycnidia in Norwegian samples of G. abietina. The colour of 

microconidial mass was grey instead of pink as conidial mass. Bergdahl and 

Tsajkowski (1982) reported microconidia in North America. According to them 

microconidia rarely germinate. Microconidia are also described in taxonomical 

work of Petrini et al., 1989, when microconidia were found on different races or 

types of G. abietina. My purpose was to check the occurrence of microconidia 

in two types of G. abietina existing in Finland. In addition apothecia were tried 

to produce by transferring microconidia. 


These results based on notes which I have done on different experiments and 

cultures of numerous G. abietina isolates during 1981-2002. Hundreds of 

microscope slides were examined. They were done from natural pycnidia or 

apothecia and also from pure cultures in laboratory. The types of G. abietina 

were determined by conidial septa and disease symptoms. Later the types were 

confirmed with fatty acid (Müller & Uotila, 1997) or RAMS method (Hantula 

&Müller, 1997; Uotila et al., 2000). After determining mating alleles of G. 

abietina (Uotila, 1992) the pairing experiment with microconidia was done. G. 

abietina has two mating alleles, mat 1 and mat 2. The microconidia from the 

monospore culture were transferred to culture having different mating allele. 

The cultures were grown in erlenmeyer bottles on barley groats +pine needles 

medium. 

29



The size of microconidia is 3-6 µm X 1 µm (Fig. 1 and 2). Microconidium 

contain one nucleus. Microconidia were found regularly in types A and B of 

Gremmeniella. Microconidia are produced also in pure cultures of 

monoascospore isolates. The color of microconidial mass in pure culture or in 

pycnidia is grey instead of pink color of macroconidial mass. I have not seen 

germinating microconidia. The microconidia were not germinating in 

monospore cultures. 

Figure 1. Microconidia formation in pure culture of Gremmeniella abietina. 

Stained with anilin blue. 

The microconidia are formed from mycelia (Fig. 1 and 3.), conidia (Fig. 2.) 

or ascospores. When the contents of pycnidium with microconidia and 

macroconidia is spread on the agar the microconidia adhered close to 

macroconidia (Fig. 2.). The change of nuclei is possible in these conditions. The 

role of microconidia is propably to transfer the nuclei before meiosis. This 

sounds reasonable, but why there are microconidia also in apothecia? I tried to 

produce apothecia in lab with help of microconidia. G. abietina is heterothallic 

with two mating alleles. So the microconidia were added in cultures with 

different mating allele, but apothecia did not appear in these cultures. In nature 

we can produce apothecia by inoculating compatible mycelia close to each other 

in the same seedling. 

30


Figure 2. The macroconidium seems to produce microconidia. 

Figure 3. Germinated macroconidia and the mycelia forming microconidia. 

31


It is still needed more research to describe the exact process of pairing and so 

to understand the role of microconidia for the fungus. This knowledge do not 

offer direct possibilities to control the disease, but it is important to understand 

the enemy. 

4. REFERENCES 

Hantula, J. & Müller, M., 1997. Variation within Gremmeniella abietina in Finland and other 

countries as determined by Random Amplified Microsatellites (RAMS). Mycol. Res. 

101: 169-175. 

Müller, M. & Uotila,A., 1997. The diversity of Gremmeniella abietina var. abietina FAST 

profiles. Mycological Research 101 (5): 557-564. 

Petrini, O., Petrini, L. E., Laflamme, G., Ouellette, G. B., 1989. Taxonomic position of 

Gremmeniella abietina and related species: a reappraisal. Can. J. Bot. 67:2805-2814. 

Roll-Hansen, F. & Roll-Hansen, H., 1973. Microconidia formed by Scleroderris lagerbergii. 2nd 

International congress of Plant Pathology. University of Minneapolis, MN. 

Uotila, A., 1983. Physiological and morphological variation among finnish Gremmeniella 

abietina isolates. Commun. Inst. For. Fenn. 119, 12 p. 

Uotila, A., 1992. Mating system and apothecia production in Gremmeniella abietina. Eur. J. For. 

Path. 22: 410-417. 

Uotila, A., Hantula, J., Väätänen, A-K. & Hamelin, R., 2000. Hybridization between two biotypes 

of Gremmeniella abietina var. abietina in artificial pairings. Eur. J. For. Path. 30:211- 

219. 

Zajkowski, S. J. & Bergdahl, D. R., 1982. Observations on a microconidiospore stage associated 

with Gremmeniella abietina. Phytopathology 72: 267. 

32



CENTRAL NEWFOUNDLAND: ESCAPE from QUARANTINE 

Gary R. WARREN 1* and Gaston LAFLAMME 2 . 

1 Natural Resources Canada, C.F.S. - Canadian Wood Fibre Centre, Corner Brook, NL Canada 

A2H 6J3 

2 Natural Resources Canada, C.F.S. - Laurentian Forestry Centre, Quebec, QC. Canada G1V 4C7 

ABSTRACT 

* Gary.Warren@NRCan-RNCan.gc.ca 

Scleroderris canker, European race, was first detected on Austrian pine in St. John’s, 

Newfoundland in 1979. To prevent spread of this exotic disease, a quarantine zone was 

established in 1980 to all areas north of the Witless Bay Line. Later, red pine mortality near 

Torbay (1981), Upper Island Cove and along Salmonier Line (1996) resulted in extending 

the quarantine zone in 1998 to all areas east of Route #202 at the isthmus of the Avalon 

Peninsula. Infection on these pines was tracked back to planting stock produced at the Back 

River Nursery on Salmonier Line. These seedlings were planted on the Avalon and 

Bonavista Peninsulas from1937 to1952. Until 2007, the slow rate of spread and natural 

quarantine boundary limited this disease for over 60 years to the Avalon Peninsula. In 

2007, the European race of Scleroderris canker was detected in an isolated red pine 

plantation in central Newfoundland at Berry Hill Pond, 400km outside of the quarantine 

zone. Field observations showed that conducive conditions for the pathogen were always 

present in the area, explaining rapid development of the epidemic compared to slow 

progression in plantations on the Avalon Peninsula. Failure to publicize and enforce the 

quarantine and apply preventative control measures has now resulted in threats to native red 

pine stands and plantations established throughout central Nfld. Pruning red pines in that 

region will prevent any new outbreak. We cannot rely on quarantine measures alone to 

prevent spread of this disease. 

Keywords: Scleroderris canker, Gremmeniella abietina, Pinus resinosa, outbreak, 

quarantine. 


Scleroderris canker cause by Gremmeniella abietina (Lagerb.) Morelet is a serious 

disease of hard pines, causing shoot blight, branch dieback, stem cankers and tree 

mortality. Two races of the disease affect pines in North America, the native North 

American (NA) race and the introduced European (EU) race (Dorworth et al., 1977)). 

The NA race causes infection on lower branches in the snow, inducing dieback and 

mortality in pine seedlings or pines less than 2 m in height. The NA race has never 

been found in Newfoundland. The EU race, introduced in North America, is a very 

serious disease; it is not restricted at the snow level; the whole crown of large trees can 

be affected. Red pine (Pinus resinosa Ait.) is very susceptible to this disease (Skilling, 

1975); Scots (Pinus sylvestris L.) and Austrian pines (Pinus nigra Arnold) are 

moderately affected (Bernhold et al., 2009) while jack pine (P. banksiana Lamb.) is the 

most resistant (Laflamme and Blais, 2000). 

33


2. FIRST REPORTS OF THE DISEASE IN NEWFOUNDLAND 

Scleroderris canker, EU race, was first detected on Austrian pine in St. John’s, 

Newfoundland, in 1979 (Singh et al., 1980). To prevent spread of this exotic disease, a 

quarantine zone was established in 1980 to all areas north of the Witless Bay Line 

(Figure 1). No movement of conifer stock from the area north of Witless Bay Line was 

allowed out of this zone. An information pamphlet was produced and distributed. It 

showed photos of symptoms to help identification of the disease as well as a map of the 

hazard and quarantine zone for Scleroderris canker. Within this quarantine zone, severe 

infection followed by tree mortality of red pine was detected in 1981; it was found in 

the Torbay plantation located 15 km north of St. John's (Figure 1). 

3. BACK RIVER NURSERY 

In mid 1980's, Scots pine dieback and mortality caused by Scleroderris canker 

EU race was observed along Salmonier Line and at a site called the old “Back 

River Nursery”. This tree nursery has an important role in understanding the 

introduction of the disease on the Island, as we will see later. Back River Nursery 

was outside the quarantine zone (Figure 2). 

In early 1990's Scleroderris canker infection and limited mortality was observed 

in a number of mixed pine plantations along the southern shore of Conception Bay, 

again outside the quarantine zone. Planting stock for all affected plantations came 

from the Back River Nursery. 

In 1996, Scleroderris canker was observed in a red pine plantation at Upper 

Island Cove and the whole plantation was completely destroyed by the disease. 

Figure 1: Quarantine zone north of Witless Bay Line established in 1980 to prevent 

spread of Scleroderris canker outside this area. 

34


Figure 2: In1998, the quarantine zone for Scleroderris canker, European race, was 

extended to all areas east of Route #202, a natural barrier for the Avalon Peninsula. 

Following this extension of the disease, the quarantine zone was extended in 

1998 to all areas east of Route #202, a natural barrier for the Avalon Peninsula 

(Figure 2). Unfortunately, no public information or pamphlet was given or 

produced 

After these new findings, the senior author did a search of historical data on the 

Back River Nursery, to have information on the provenance of seed or seedlings in 

this nursery and the location of plantations established with seedlings produced in 

this nursery. A report on Reforestation in Newfoundland, from 1937 to 1952, 

summarized the establishment and activities of the Back River Nursery (Doyle, 

1967). It gives details of planting stocks produced, and identified 16 plantations 

established on the Avalon, Burin and Bonavista Peninsulas between 1938 and 

1951. This report indicated also that all stocks at the Back River Nursery were 

produced from seeds: white spruce (Picea glauca (Moench) Voss), white pine 

(Pinus strobus L.) and balsam fir (Abies balsamea (L.) P.Mill.) were of local origin 

while Norway spruce (Picea abies (L.) Karst.), red pine, Scots pine and jack pine 

came from Ontario, Canada. It is important to note that Scleroderris canker cannot 

be transmitted by seed. Another report provided a detailed historical account of the 

Back River Nursery (Baker and Miller-Pitt, 1998). In 1939 the Newfoundland 

Forestry Division received a gift of 30,000 seedlings of red, white, jack and Scots 

pines from the Province of Ontario, Canada. 

With this information on hand, a survey of localized plantations was done in 1998. 

The 16 plantations established with Back River Nursery stock, revealed that most 

plantations were in very poor condition, but Scleroderris canker EU race was present in 

a number of them. The majority of red pine had died but the disease was still present 

and viable in the surviving Scots and jack pines which show resistance to the disease 

35


(Bernhold et al., 2009; Laflamme and Blais, 2000). Even if these pines are surviving 

with the disease for several years, the host persists as an endemic carrier of the 

pathogen. Infected plantations outside the Avalon Peninsula, at Sunnyside and on the 

Bonavista Peninsula, were sanitized with expectations of limiting the disease to the 

Avalon Peninsula, and keeping the 1998 quarantine zone in place. The quarantine and 

natural barrier at the isthmus of the Avalon Peninsula was successful in limiting the 

spread of Scleroderris canker EU race for over 60 years (Figure 2). 

4. OUTBREAK IN SOUTH-CENTRAL NEWFOUNDLAND 

In 2007, severe red pine mortality was reported in an 18-year-old red pine 

plantation at Berry Hill Pond, 90 km down the Bay D'Espoir highway from the 

Trans Canada Highway, approximately 400 km outside the quarantine zone. 

(Figure 3). G. abietina was isolated and molecular tests have proven the disease to 

be Scleroderris canker EU race. Damage assessment done in 

Figure 3: Outbreak in Central Newfoundland, 400 km from the quarantine zone for 

Scleroderris canker, European race on the Avalon Peninsula. 

2007 and 2008 revealed the disease had been present for 7-8 yr, building up 

inoculum by infecting lower branches in a center of infection. Then, optimum 

conditions conducive for spore release, dispersal and infection occurred 2-3 years prior 

to 2007 resulting in killing pines in the center of infection by shoot infection of the 

whole crown. This high spore load in the top of crown exposed to wind, rain and snow 

helped the disease to spread on top of surrounded healthy pines. Spores from these tops 

36


were rain splashed and disseminated on lower shoots, killing the residual trees the 

following year. 

Planting stock for this plantation was produced in the Wooddale provincial tree 

nursery in central Newfoundland. This plantation and several others in the forest 

management district were established in 1989 using the same red pine planting 

stock. An inspection in the fall of 2007 of the other plantations showed no other 

signs of infection, ruling out infected planting stock as the source of the disease. 

Geographic isolation of this plantation, surrounded primarily by bog and scrub 

forest with no pine content, has all but ruled out natural spread of the disease from 

the Avalon Peninsula. Forestry personnel from the Bay D'Espoir office commented 

that locations along the road through the plantation were common camp sites for 

moose hunters from the Avalon Peninsula in the late 1980's early 1990's. Two tall 

communication towers along the road to the plantation were easy landmarks for 

hunters to locate the campsites. It is suspected that hunting groups from the Avalon 

Peninsula brought their own kindling and firewood with them, which would have 

been readily available from recently killed red pine in the infected Conception Bay 

plantations. 

5. DISCUSSION 

After 15 years of observations on the development of a Scleroderris canker 

epidemic, EU race, in 50 red pine plantations located in Quebec, we can sum up the 

results into three steps: 

1- There is a build up of inoculum in a centre of infection. 

2- Followed by a spread of infection on lower branches in the snow over a large 

area. 

3- Finally, under conducive climatic conditions, conidia of G. abietina produced 

on lower branches will spread the disease higher in the crown of trees. 

In south-central Newfoundland, we observed a different pattern. The epidemic 

started in a centre of infection and killed the trees in that centre relatively rapidly. 

The large number of infected shoots in the crown of dead and dying trees produced 

a large amount of inoculum in the upper part of trees. The strong wind prevailing in 

that region, with rain and snow had spread the disease to the top of surrounding 

trees, causing their death in less than 2 to 3 years. The disease became so 

widespread that nothing could be done to save the plantation. Because of the 

climatic conditions favourable to the disease in that region, the other red pine 

plantations should be pruned to prevent any build up of inoculum in the eventuality 

of an introduction of G. abietina. 

From the historical reports, seedlings of pine were imported into the Island of 

Newfoundland from Ontario, Canada. It is difficult to conclude that the 

introduction of the disease came with this nursery stock: the European race was not 

37


found in Ontario until 1985 and the disease had been present in Back River 

Nursery several years before. So the origin of the introduction of the disease on the 

island is still unknown. Based on preliminary molecular study, the Newfoundland 

introduction would be different than the one on continental North America; 

moreover, the pathogen population in Nfld. shows more relationship with the 

pathogen population from Europe (Hamelin et al., 1998). The introduction could 

have come from Austrian pine seedlings imported from Europe; this pine species 

has been planted in St. John’s area for many years. This tree species was never 

imported for reforestation; it was imported as ornamental probably not too long 

after the establishment of the Back River Nursery, but this hypothesis remains to be 

proven. 

The breach of the quarantine zone now places the natural red pine stands and 

numerous plantations in central Newfoundland region at a serious risk of 

extinction. A communication plan to the public should be undertaken through 

information, pamphlets, display notices, roadside signs and kiosk.. It is necessary 

to maintain the Scleroderris canker quarantine on the Avalon Peninsula. The 

isthmus of the Avalon Peninsula is a natural barrier with limited alternate access, 

where quarantine notices, signage and material deposition depots can be setup. 

6. LITERATURE CITED 

Baker, M., Miller-Pitt. J., 1998. By wise and prudent measures: The development of forestry on 

Salmonier Line. Newfoundland & Labrador, Department Forest Resources & Lands 

Publication. 65 p. 

Bernhold, A., Hansson, P., Rioux, D., Simard, M., Laflamme, G., 2009. Resistance to Gremmeniella 

abietina (EU race, large tree type) in introduced Pinus contorta and native Pinus 

sylvestris in Sweden. Canadian Journal of Forest Research 39, 89-96. 

Doyle, J.A., 1967. Report of reforestation in Newfoundland 1937-1952. Nfld. Dept. Forestry, File 

Report. 18 p. (Nfld. Dept. For. Library File #002509), Corner Brook, Newfoundland. 

Dorworth, C.E., Krywienczyk, J., Skilling, D.D., 1977. New York isolates of Gremmeniella abietina 

(Scleroderris lagerbergii) identical to immunogenic reaction to European isolates. Plant 

Disease Reporter 61, 887-890. 

Hamelin, C.R., Lecours, N., Laflamme, G., 1998. Molecular evidence of distinct introduction of the 

European race of Gremmeniella abietina into North America. Phytopathology 88, 582- 

588. 

Laflamme, G., Blais, R., 2000. Resistance of Pinus banksiana to the European race of Gremmeniella 

abietina. Phytoprotection 81, 49-55. 

Myren, D.T., Davis, C.D., 1986. European race of Scleroderris canker found in Ontario. Plant 

Disease 70, 475. 

Singh, P., Dorworth, C.E., Skilling, D.D., 1980. Gremmeniella abietina in Newfoundland. Plant 

Disease 64, 1117-1118. 

Skilling, D.D., 1975. The development of a more virulent strain of Scleroderris lagerbergii in New 

York State. European Journal Forest Pathology 7, 297-302. 

38

Shoot Blights 

39


40



CONE DAMAGES BY Diplodia pinea AND SEED BORING INSECTS ON 

Pinus pinea L. (ITALIAN STONE PINE) IN CENTRAL ITALY 

Matteo FEDUCCI 1 , Alessia PEPORI 1 , Daniele BENASSAI 2 , Martina CAMBI 1 , 

Paolo CAPRETTI 1* 

1 DiBA – Department of Agricultural Biotechnology Sect. of Plant Pathology. Piazzale delle 

Cascine, 28 – 50144 – FIRENZE - ITALY 

2 DiBA – Department of Agricultural Biotechnology, Sect. of Entomology Via Maragliano, 77 – 

50144 – FIRENZE - ITALY (at the time of research) 

ABSTRACT 

* paolo.capretti@unifi.it 

In Italy Pinus pinea L. (Italian Stone Pine) is cultivated for several purposes but mainly 

for dune protection, landscape conservation, tourism, and seeds production. This economic 

activity is annually negatively affected by the occurrence of fungi, insects, and abiotic 

agents but also by a new alien pest (Leptoglossus occidentalis Heidemann) recently 

introduced from North America. In order to clarify the main reasons of seed losses, 

monitoring investigation have been organized in different pinewood located along the 

Tyrrhenian cost in Tuscany. During the period 2006 – 2008 cones, having different ages 

(from 1 to 3 years old) were analyzed. The main agents responsible of biotic damage were 

identified and their incidence on losses was ranked. 

The study showed that: - about 64% of 1-yr old and 36% of 2-yrs old cones were 

affected by D. pinea; - more than 80% of old cones collected on the ground in pinewoods 

were colonized by the fungus; - up to 57% of old infected cones produced available 

inoculum, able to germinate in 6h at 25°C. The most consistent damages on the harvested 

mature cones were caused by D. pinea, followed by small mammals and insects including 

L. occidentalis, although differences among forest occurred. In infected cones by the fungus 

seed losses were up to 64%. 

Keywords: Pinus, edible seeds, insects, diseases, fungi 


Pinus pinea L., the Italian Stone Pine with its umbrella-shape crown is one of 

the most characteristic and attractive Mediterranean trees. It is usually grown in 

pure pinewood plantation along the coasts, or mixed with other Mediterranean 

species in temperate forests. Often it is also cultivated as an ornamental tree, in 

gardens and public parks areas of Southern Europe (Bernetti, 1995). 

P. pinea is also well known for its edible seeds (pinoli) about two cm long that 

quite often constitute the main income for pinewoods owners (Bernetti, 1995; 

Ducci et al., 2001; Saporito, 2002). Seeds are produced by pines after a long 

process of maturation. The cones ripen after three years expanding to oval-shaped, 

300 gr. weigh. During that long period they are exposed to several biotic threats 

41


due primarily to insects Ernobius impressithorax, (Coleoptera,Anobiidae) 

(Dioryctria mendacella Stgr. (Lepidoptera, Pyralidae), Pissodes validirostris Gyll. 

(Coleoptera, curculionide), small mammals (squirrels and dormouse) 

(CanakcioglU, 1969; Roques, 1983; El Hassani and Messaoudi, 1986; Innocenti 

and Tiberi, 2002) and fungi, mainly Diplodia pinea (Petri, 1917; Petri and Adani, 

1916; Verona, 1950; Maresi et al., 2002). More recently a new alien insect, 

Leptoglossus occidentalis Heidemann (Heteroptera Coreidae), was accidentally 

introduced in Italy (Bernardinelli and Zandigiacomo, 2001) and contribute to 

enhance the amount of seed damages. 

Since the 2006-2007 the amount of seed production dropped down causing 

serious economic concern for the market and several survey activities were 

organized in order to evaluate the main causes of seed losses. 

2. MATERIALS AND METHODS 

The studies on the reduction of seed production from P. pinea trees were carried 

out in Tuscany, Central Italy during the period 2006 – 2008 in different pine 

forests. Two areas were located in the North, close to Pisa, in the Regional Park 

“Parco Migliarino S. Rossore Massaciuccoli” MSRM-1 (Migliarino) and MSRM-2 

(Tirrenia), while the third was situated in the South of region, close to Grosseto, in 

the “Parco Naturale della Maremma” PNM (Alberese). All the mentioned areas are 

particularly large pinewood forests from where every year cones are usually 

harvested and seeds are send to the market. 

The study was organized following different aspects: 

2.1. - Surveying on the Occurrence of D. pinea on cones of different age. 

Pinewood areas MSRM-1 and MSRM-2. 

a) Occurrence of D. pinea on immature 1- 2 yr-old cones. During the winter 

2006 five trees were felled and 150 green cones (n.100 1yr-old and n.50 2yr 

old samples) were randomly collected from the crown. Cones were then put 

in moist chambers up to 15 days and regularly checked to detect the 

occurrence of D. pinea (Feducci, 2007). 

b) Occurrence of D. pinea on mature and old cones lying on the ground. 

Pinewood area MSRM-1. About 600 cones were collected under the pine 

crown in order to detect the occurrence of the fungus. Cones were ranked 

according to the age (1, 2 >2 yrs) and percentage of scales cover by pycnidia 

(< 15% ; 15 – 50 ; > 50%) (Pepori, 2006). 

2.2. Detecting the inoculum availability from mature cones on the ground. 

Pinewood area MSRM-1. A sample of 135 cones was collected from 5 different 

particles under the crown of 27 pines. Cones were processed according to Munck 

and Stanosz (2009). The method was modified and adjusted to the size of cones 

(350 ml of water was used in rinsing the cones). A conidia suspension was 

42


obtained for each cone and used for germinability test on 2% Malt-agar in Petri 

dishes at 25°C for 6 hours (Cambi, 2008). 

2.3. Assessing the sanitary conditions of harvested mature cones (3 yrs-old). 

Pinewood areas MSRM-1, MSRM-2, and PNM. In order to evaluate the occurrence 

of damage on cones ready to the extraction process, about 3000 cone samples were 

collected (1000 from each previously mentioned area). Symptoms of damages, if 

present, were visually detected and classified according their main causes: insects 

(Dioryctria sp., Ernobius impressithorax, Pissodes validirostris), L. occidentalis, 

small mammals (Dormouse, Glis glis; Squirrel, Sciurus vulgaris), Diplodia pinea 

and abiotics. Total observed: 3045 cones (Migliarino 1045, Tirrenia 1000, Alberese 

1000). 

2.4. Test seed viability. Pinewood areas MSRM-1, MSRM-2, and PNM. From 

a sample of 100 cones, 80 affected by D. pinea and 20 apparently healthy as 

control (see 2.3) all seeds were extracted and than checked for their viability 

conditions, first visually and later by using the Tetrazolium Test (International 

Seed Testing Association., 2003; 2007; Feducci, 2007). 

3. RESULTS 

3.1. Occurrence of D. pinea on cones of different age. 

a) Immature 1-2 yr-old cones. D. pinea is a fungal parasite quite common in 

young pine cones. After evaluation about 64% of 1-yr old and 36% of 2-yrs old 

cones were affected by the fungus. Percentages of apparently healthy cones 

increase according to their age (Table 1). 

Table 1. Occurrence of Diplodia pinea on Pinus pinea cones of different age. 

Cone conditions Apparently 

healthy 

1 year-old cones 2 years- old cones 

Affected by 

D. pinea 

43 

Apparently 

Healthy 

Affected by 

D. pinea 

data in % 36.6±13.9 63.4±13.9 66.7±4.3 33.3±4.5 

b) Mature and old cones lying on the ground. Observations on cones on the 

ground under the crown of pines show that the number of old ones was quite 

relevant. The percentage of cones having more than 50% of scales covered by D. 

pinea was also consistent (Table 2). 

Table 2. Occurrence of pycnidia of Diplodia pinea on Pinus pinea cones. 

Cone 

Age of cones Occurrence of D. pinea on cones* 

conditions 1 yr 2 yrs >2 yrs 0 1 2 3 

Data in % 

±st 

6,7±0,8 12,1±5,6 81,2±4,0 5,9±2,1 7,4±1,1 15,0±0,2 71,3±3, 

2


* Occurrence of Diplodia pinea. 0= none or few pycnidia; 1 = pycnidia detected 

on < 15% of cone scales ; 2 = 15 – 50 % ; 3 = > 50%. 

3.2. Detecting the inoculum availability from mature cones on the ground. 

A large amount of cones colonized by D. pinea, and showing pycnidia (Table 3), 

were still actively releasing conidia. Among them 55.6% of 1-yr old cones and 

63.9% of >3-yrs cones were still producing inoculum. Percentage of conidia 

germination after 6 h at 25°C was 47.4%. 

Table 3. Inoculum availability of Diplodia pinea (pycnidia) on Pinus pinea cones. 

Ages of cones 

Percentage of cone scales showing D. pinea pycnidia 

50 

1-yr 15.6±0,8 66.7±5,6 17.8±4,0 

2-yrs 0.0 42.2±5,6 57.8±4,0 

>3-yrs 35.6±0,8 53.3±5,6 11.1±4,0 

3.3. Sanitary conditions of harvested mature cones (3 yrs-old). 

Data obtained from cones ready for seed extraction showed that damages 

ranged from 28-55% according to the different forest areas considered. The most 

consistent damages were caused by D. pinea (average 16%) followed by small 

mammals and insects (about 6%) and L. occidentalis (4%) (Table 4). Differences 

values among forests were quite pronounced particularly for the fungal parasite 

(Figure 1). 

Table 4. Main damages observed on 3-yrs old Pinus pinea cones. 

Sampling 

area Healthy 

Cone conditions Causes of damage 

(n.1900) 

Damaged 

(n.1145) 

Insects* 

44 

L. 

occid. 

Small 

mam.** 

D. 

pinea 

Other 

causes 

MSRM-1 71.1 28.9 6.3 2.5 2.5 14.5 3.1 

MSRM-2 44.8 55.2 4.5 8.0 1.3 32.0 9.4 

PNM 70.9 29.1 7.5 3.2 15.6 2.4 0.4 

Average±sd 62.4±15.1 37.6±15.1 6.1±1.5 4.5±3.0 6.4±7.9 16.3±14.9 4.3±4.6 

*Insects: Dioryctria sp., Ernobius impressithorax, Pissodes validirostris. 

** Small mammals: Dormouse (Glis glis), Squirrel (Sciurus vulgaris). 

Total cones: 3045 (Migliarino 1045, Tirrenia 1000, Alberese 1000)

35,0 

30,0 

25,0 

20,0 

15,0 

10,0 

5,0 

0,0 


Insects* L. 

occidentalis 

Small 

mammals 

45 

MSRM-1 

MSRM-2 

PNM 

D. pinea Other 

causes 

Figure 1. Main damages observed on 3-yrs old Pinus pinea cones according different 

pine forests. (MSRM-1 “Parco Migliarino S. Rossore Massaciuccoli” MSRM-2, Tirrenia; 

PNM “Parco Naturale della Maremma” 

3.4 Test seed viability. Quality of seeds resulted quite variable after visual 

assessment and TZ test. Seeds discarded were about 35% from apparently healthy 

cones and raised up to 55% and 64% from partially injured and injured cones 

respectively (Table 6). 

Table 6. Percentage of seed losses in healthy and injured cones by D. pinea. 

Percentage 

of seed losses 

after/ 

Visual 

assessment 

Seeds from 

healthy cones 

(n.503) 

Seeds from 

partially Injured cones 

(n.1056) 

Seeds from 

Injured cones 

(n.1221) 

TOT 

(n.2780) 

34,4 50,5 60,9 52,1 

TZ test 0,9 4,6 3,8 3,4 

T. losses 35,3 55,1 64,6 55,5 

4. DISCUSSION 

Due to the losses of seed production several survey activities have been 

promoted by Italian local regional governments. In this study, conduced during the 

period 2006-2008, mainly supported by the Tuscany region, the surveys showed 

that seed losses can be attributed to different causes but mainly to D. pinea, the 

fungal parasite which is able to colonize a large amount of cones since the first


year after their development (up to 64% of 1-yr losses). Later on the fungus can 

survive for long time on old cones on the ground under the canopy (up to 80% of 

old cones sampled). Large part of these cones, confirming Munck and Stanosz 

(2009), produced available inoculum, able to germinate in 6 h at 25°C and able to 

infect the new cones generation. 

Ranking the most common types of damage on the harvested mature cones, we 

found that large part of losses can be attributed to D. pinea, followed by small 

mammals and insects, including L. occidentalis. However the occurrence of the 

fungus was clearly related with site conditions and was more pronounced in humid 

areas whilst was lower in dry forests where insects and small mammals prevailed. 

On the basis of this data seed losses related to L. occidentalis were not so 

evident. Probably the role of the insect is more dangerous during the early stages of 

cone growth and also it remain difficult to be detected on mature cones. 


Authors are grateful to the Regional Agricultural Agency of Tuscany, (ARSIA) 

and its Monitoring service (META) for the financial support during the 

investigation. Prof. Riziero Tiberi, Forest Entomologists from DIBA, is also 

acknowledged for useful suggestions and help for insects identification. 

6. REFERENCES 

Bernardinelli, I., Zandigiacomo, P., 2001. Leptoglossus occidentalis Heidemann (Heteroptera, 

Coreidae): a conifer seed bug recently found in Northern Italy. - In: Knizek M., Forster 

B., Grodzki W. (eds.), Methodology of forest insect and diseases survey in Central 

Europe. Proceedings of the 4th international Workshop of the IUFRO WP 7.03.10, 

September 17-20, 2001, Praha (Czech Republic). J. For. Sci., 47, Special Issue 2, 56-58. 

Bernetti, G., 1995. Selvicoltura speciale, UTET, Torino. 

Cambi, M., 2008. Conservazione dell'inoculo di Diplodia pinea su pigne nel parco di Migliarino - S. 

Rossore - Massaciuccoli. Tesi di Laurea Scienze Forestali ed ambientali. Anno 

accademico 2006–07. Facoltà di Agraria, Università degli Studi di Firenze. 

Çanakçıoğlu, H., 1969. Insect damage on cones and seeds of forest trees in Turkey, Istanbul 

University Orman Fakultesi Dergisi. 19A(2), 82-88. 

Ducci, F., Maltoni, A., Tani, A., 2001. La raccolta del seme di specie forestali, Monti e Boschi 70, 57- 

62. 

El Hassani, A., Messaoudi, J., 1986. Italian stone pine (Pinus pinea L.): the cone and seed pest of 

conifers and their distribution in Marocco. Proceedings of the 2nd Conference of the cone 

and seed insect working party S207-01. September 3-5, 1986. Briancon, 05100, France. 

pp 5-14. 

Feducci, M., 2007. Indagini sulle cause dei danni alla fruttificazione del pino domestico in Italia. Tesi 

di Laurea Magistrale. In Gestione dei sistemi forestali. Anno accademico 2005– 06. 

Facoltà di Agraria, Università degli Studi di Firenze. 

Innocenti, M., Tiberi, R., 2002. Cone and seed pests of Pinus pinea L. in Central Italy, Redia, 85, 21- 

28. 

46


International Seed Testing Association., 2003. Working Sheet on Tetrazolium Testing. Vol 1. 1st 

Edition. CH-Switzerland. 

International Seed Testing Association., 2007. Biochemical Test for Viability : The Topography 

Tetrazolium Test International Rules for Seed Testing 2007. ISTA. CH-Switzerland. 

Maresi, G., Ambrosi, P., Battisti, A., Capretti, P., Danti, R., Feci, E., Minerbi, S., Tegli, S., 2002. Pine 

dieback by Sphaeropsis sapinea in Northern and Central Italy, Proceedings IUFRO WP 

7.02.02, 17-21 June, 2001, Hyytiälä, Finland, Finnish Forest Research Institute, Research 

Papers 829, pp. 60-67. 

Munck I.A., Smith D.R., Stanosz G.R., 2007. Quantification of conidia of Diplodia sp. Extracted 

from Red and Jack pine. Acta Silvatic. Lign. Hung., Spec. Edition, p. 280. 

Munck, I.A., Stanosz, G.R., 2009. Longevity of inoculum production by Diplodia pinea on red pine 

cones. Forest pathology, doi: 10.1111/j.1439-0329.2009.00607.x 

Pepori, A.L., 2006. Danni da Sphaeropsis sapinea alla fruttificazione del pino domestico nel litorale 

tirrenico. Tesi di Laurea Scienze Forestali ed ambientali. Anno accademico 2005– 06. 

Facoltà di Agraria, Università degli Studi di Firenze. 

Petri, L., 1917. Contributo allo studio delle condizioni di recettività del Pinus pinea per la 

Sphaeropsis necatrix, Ann. R. Ist. Sup. Forestale, II. 

Petri, L., Adani A., 1916. Ricerche sopra una Malattia dei coni del "Pinus pinea", Estratto dagli 

Annali della R. Accademia di Agricoltura di Torino, volume LIX, 1916. 

Roques, A., 1983. Les insectes ravageurs des cones et graines de conifères en France, Instutut 

National de la Recherche Agronomique, Paris. 

Salvadori, C., 2005. II cimicione americano delle conifere, Terra Trentina, Novembre: 31-33. 

Saporito, L., 2002. Produzione di pinoli in popolamenti di Pinus pinea L. della Sicilia orientale, 

Sherwood, 78, 35-39. 

Verona, O., 1950. Note sopra una malattia degli strobili di “Pinus pinea” prodotti da “Sphaeropsis 

necatrix”, Università di Pisa, Istituto di Patologia Vegetale e Microbiologia agraria, Pisa. 

47



SUSCEPTIBILITY OF DIFFERENT CONIFEROUS SEEDLINGS 

INOCULATED WITH Diplodia pinea 

H. Tuğba Doğmuş-Lehtijärvi 1* , Asko Lehtijärvi 1 , Gürsel Karaca 2 , 

A. Gülden Aday 1 , Funda Oskay 1 

1 Süleyman Demirel University, Faculty of Forestry, Dept. of Botany, Isparta-Turkey 

2 Süleyman Demirel University, Faculty of Agriculture, Dept. of Plant Protection, Isparta-Turkey 

ABSTRACT 

* tugba@orman.sdu.edu.tr 

In this study, virulence of 5 Diplodia pinea isolates on Pinus nigra, Pinus brutia, Pinus 

sylvestris, Cedrus libani, Abies nordmanniana ssp. bornmülleriana and Juniperus excelsa 

seedlings was investigated. Needle fascicles on terminal and three lateral shoots of each 

seedling were removed to create small wounds. Agar plugs with D. pinea mycelia were 

placed in the wounds and secured in position with laboratory film. Five seedlings were used 

for each species-isolate combination and a randomized complete block design was used in 

the trial. Nine weeks later dead shoots, lesion length and fungal growth were recorded. 

Dead shoots occurred in almost all isolate–host combinations: the only exceptions were two 

isolates on J. excelsa. Within host variation in dead shoot rates among the isolates was low. 

However, there was high variation in the mean dead shoot rate among the hosts, with the 

highest rate (98.0%) on C. libani, and the lowest (4.0%) on J. excelsa. On C. libani all 

isolates caused remarkable lesion, while on the other host species some of the isolates 

caused lesion. The average lengths of lesion were 15.72 mm on C. libani, 8.12 mm on P. 

nigra, 2.4 on P. sylvestris, 1.2 on P. brutia and 0.08 mm on A. nordmanniana ssp. 

bornmülleriana and J. excelsa. Similarly, average linear extension of D. pinea in the shoot 

tissues was high on C. libani and Pinus spp. and low on J. excelsa. The results indicate high 

virulence of D. pinea on C. libani and P. nigra. 

Keywords: Pathogenicity, Pinus nigra, Pinus brutia, Pinus sylvestris, Cedrus libani, 

Abies nordmanniana ssp. bornmülleriana, Juniperus excelsa 

1- INTRODUCTION 

Diplodia pinea (Desm.) Kickx. (=Sphaeropsis sapinea (Fr.) Dyko Sutton) has 

a worldwide distribution and causes the disease known by the common name of 

Diplodia tip blight of pine (Stanosz et al., 1996). The fungus can affect the trees 

from early to older ages causing shoot blight, twig blight, dead top, sap stain, root 

48


disease and cankers on stems and branches (Brookhouser and Peterson, 1971; 

Peterson, 1977) and can have devastating effects on various conifers when it is 

associated with stress-inducing factors (Sinclair et al., 1987; Swart et al., 1987; 

Chou and Mackenzie, 1988; Nicholls and Ostry 1990; Stanosz et al., 2001). 

Although diseases caused by the fungus are usually on trees under stress, 

healthy trees, especially nursery seedlings can also be infected (Palmer and 

Nichols, 1985). Pinus species are the most common hosts of the fungus, but Abies 

Mill., Chamaecyparis Spach., Cupressus L., Larix Mill., Picea A. Dietr., 

Pseudotsuga Carriere and Thuja L. species are among hosts of the pathogen 

(Punithalingam and Waterston, 1970; Swart and Wingfield, 1991). Previous studies 

reported significant interactions among host species, environmental factors and the 

virulence of the isolates (Swart and Wingfield, 1991; Blodgett and Stanosz, 1997; 

Adams et al., 2002; Blodgett and Bonello, 2003). 

Two different S. sapinea morphotypes have been described and are referred to 

as A and B (Palmer et al., 1987; Smith and Stanosz, 1995; de Wet et al., 2000; 

Burguess and Wingfield, 2001). While D. pinea is accepted name for morphotype 

A, morphotype B has been recognized as Diplodia scrobiculata J. de Wet, B. 

Slippers & M. J. Wingfield (de Wet et al., 2003). It is reported that they differ in 

morphology, cultural characteristics and aggressiveness against host plants (Smith 

and Stanosz, 1995; Blodgett and Stanosz, 1997; Blodgett and Bonello, 2003). 

Eventhough D. pinea was recorded sixteen years ago for the first time on Pinus 

pinea and Pinus pinaster (Unligil and Ertas, 1993), very little is known about the 

distribution and the damage of the disease by far in Turkey (Doğmuş- Lehtijärvi, 

et al. 2007). Studies carried out in the western part of Taurus Mountains located in 

the Mediterranean part of Turkey, in Isparta province showed that D. pinea was the 

main agent of the shoot blight of Calabrian pines (Pinus brutia Ten.) (Doğmuş- 

Lehtijärvi et al., 2007). The aim of this study was to determine the pathogenicity of 

D. pinea isolates obtained from P. brutia showing shoot blight symptoms, on 6 

conifer species, under field conditions. 

2- MATERIALS AND METHODS 

Five-year-old potted Pinus nigra Arnold, Pinus brutia Ten, Pinus sylvestris L., 

Cedrus libani A. Rich., Abies nordmanniana ssp. bornmülleriana Mattfelt 

seedlings obtained from Eskişehir and Balıkesir forest nurseries and 3- year-old 

Juniperus excelsa Bieb seedlings obtained from Eğirdir forest nursery were used as 

the plant materials. Fungal materials were the five D. pinea isolates obtained from 

the Calabrian pine (P. brutia) shoots showing blight symptoms in Aşağı-Gökdere 

location of Isparta province, Turkey. The isolates were confirmed as D. pinea by 

Glen Stanosz, (Department of Plant Pathology, University of Wisconsin-Madison, 

personal communication) using species-specific primers (Smith and Stanosz 2006). 

49


Pathogenicity trial was carried out in the campus area of Süleyman Demirel 

University, during October-November, 2007. The D. pinea isolates were grown on 

PDA (Merck) at 24ºC in the dark, for one week. Four wounds of 2 x 2 mm were 

made approximately 2 cm below the shoot apex, on one terminal and three lateral 

shoots of each seedling, removing a needle fascicle by a scalpel and agar plugs 

with D. pinea mycelia cut from the actively growing culture were placed myceliaside-down 

on the wounds (Blodget and Stanosz, 1997). Wounds were then 

wrapped with parafilm. Non-colonized agar plugs were placed on control 

seedlings. Five seedlings were used for each species-isolate combination and a 

randomized complete block design was used in the trial. Seedlings were incubated 

under field conditions for 9 weeks. Average temperature in October was 14.4°C 

(maximum up to 28.2 °C, minimum 0.8 °C) and in November 7.4 °C (maximum up 

to 22.9 °C, minimum -10°C). Average relative humidity was 58 % in October and 

76 % in November. The seedlings were regularly irrigated and controlled for 

characteristic disease symptoms. Dead shoots were recorded. 

At the end of the inoculation period, inoculated terminal and lateral shoots were 

cut 15 cm below the inoculation point and brought to the laboratory. Based on the 

color changes on the shoots and needles, lesion sizes were measured. Then the 

needles on the shoots were removed and the shoots were cut into 1 cm long 

segments, from the inoculation point to the cut end of the shoots. The segments 

were surface sterilized by keeping them 10 seconds in 96 % ethyl alcohol and 4 

minutes in 1 % NaOCl and dried between sterile paper towels. They were then 

placed on petri plates with 2.5 % bacto agar and 0.05 % tannic acid, 5 segments per 

plate, in a clockwise serial order. 

The plates were incubated at room temperature for 4 weeks and examined under 

stereomicroscope for the presence of D. pinea colonies growing from the segments. 

Dead shoot rate, lesion length and fungal growth data obtained for each tree 

species-isolate combination were statistically analyzed by using SPSS program. 

3- RESULTS 

Susceptibility of the tree species to D. pinea and the virulence of the D. pinea 

isolates among those host species were different from each other. Dead shoots were 

observed in all isolate-host combinations, except for P047 and P097 isolates on J. 

excelsa. Considering the dead shoot rates, within host variation of the isolates was 

low, while host species had high variation. The highest rate was on C. libani 

(98.0%), followed by P. nigra (51.0%) and P. brutia (31.9%). Dead shoot rates 

were low on Abies (16.0%), P. sylvestris (12.8%) and J. excelsa (4.0%) (Figure 1). 

50


Figure 1. Dead shoot rates of five tree species inoculated with five D. pinea isolates. 

On C. libani all isolates caused remarkable lesion, while on the other host 

species only 1-3 of the isolates caused lesion. The length of lesion ranged from 

12.4 to 21.4 mm on C. libani and from 9.0 to 18.6 mm on P. nigra, while on the 

other hosts the length did not exceed 6.0 mm (Figure 2). 

There was a significant correlation ( r= 0.53, p< 0.01) between length of 

lesion and linear fungal extension on all host-isolate combinations. Average 

length of the lesion was greater than average fungal extension in all host species 

including all isolates of the fungus ( Table 2, Figure 3). The average fungal 

extension was found 27.6 mm on P. nigra, 24.0mm on P. brutia, 18.4mm on C. 

libani, 16.4 mm on P. sylvestris and 8.4 mm on A. nordmanniana 

bornmülleriana. Similar to length of lesion , average fungal extension was the 

lowest on J. excelsa (1.6 mm). Control seedlings did not show any symptoms of 

disease. 

51


Figure 2. Length of lesions of five tree species inoculated with five D. pinea isolates. 

Figure 3. Average fungal extension and length of lesion caused by D. pinea. 

52


Table 1. Linear extension of D. pinea in the shoots of five tree species inoculated with 

different isolates (mm). 

Tree 

species 

53 

Isolates 

T008 T029 P047 T081 P097 Control Averages 

A.n.bor. 6.0 B ab 8.0 B a 10.0 BC a 10.0ABC a 8.0 B a 0.0 Ab 8.4AB 

C. libani 12.0 AB b 34.0 A a 14.0 B b 20.0AB ab 12.0 B b 0.0 Ac 18.4 BC 

J. excel. 2.0 B a 2.0 B a 2.0 C a 2.0 C a 0.0 C a 0.0 Aa 1.6 A 

P. brutia 20.0 A ab 38.0 A a 20.0 B ab 24.0 A b 18.0AB ab 0.0 Ac 24.0 BC 

P. nigra 22.0 A abc 22.0ABabc 54.0 A a 6.0 BC bc 34.0 A ab 0.0 Ac 27.6 C 

P.syl. 12.0AB ab 8.0 B bc 28.0 AB a 24.0 A ab 10.0 B abc 0.0 Ac 16.4 ABC 

Means in the same column followed by the same uppercase letter and means in the same row 

shown by the same lowercase letter were not significantly different from each other according to 

Duncan’s Multiple range test (P=0.05) 

4- DISCUSSION 

Inoculations with the five D. pinea isolates resulted in necrotic needles and dead 

shoot tips on the tested coniferous tree species, showing high virulence on C. libani 

and P. nigra and low on A. nordmanniana ssp. bornmülleriana and J. excelsa. 

Even though most of the coniferous tree species have been tested for their 

sensitivity to S. sapinea sensu lato (s.l.) (Chou, 1976; Brookhouser, 1971; Blodgett 

and Stanosz, 1997; Flowers, 2001; Blodgett and Bonello, 2003; Luchi et al., 2007; 

Munoz et al., 2007) this is the first study mentioning the high susceptibility of C. 

libani to D. pinea isolates. 

The time of the inoculation significantly affects the relative aggressiveness of 

the fungus. (Literatür). The results of the experiment indicate that D. pinea were 

pathogenic on tested conifer tree species, especially on C. libani and Pinus spp. 

However, inoculations with most of the fungal isolates resulted in little or no 

measurable symptoms on shoots of J. excelsa and A. nordmanniana in October and 

November when the experiment was carried out. To confirm these results it may be 

necessary to repeat the experiment during spring when the conditions are much 

more favorable for the natural spread of the fungus. 

Blodgett and Stanosz (1997) indicated that the wound inoculation technique 

provides a reproducible method for comparing the aggressiveness of the isolates 

belonging to different species of the fungus but, they did not found this method 

reliable for comparing the aggressiveness of the isolates within the species. In the 

present experiment, the same technique was used to find out the susceptibility of 

the host species to the disease, and similarly, there were no significant differences 

between the five isolates on any of the tree species. Blodgett and Stanosz (1997) 

conducted the inoculation experiments also with conidial suspensions to be able to


understand the penetration capacity of the fungus to the healthy tissue. Also in the 

present study more realistic results of the virulence of the isolates could have been 

obtained by spraying the seedlings with conidial suspensions. 

Virulence of S. sapinea s.l. isolates on pine varies depending on several factors, 

such as ecological and climatic conditions, season, species of the fungus and where 

the experiment takes place (Swart and Wingfield, 1991; Blodgett and Stanosz, 

1997). It is also known that S. sapinea s.l. is able to live without typical symptoms 

in its latent phase (Stanosz et al., 1997; Flowers et al., 2001; 2003; Stanosz et al., 

2005; Maresi et al., 2007). In that sense, it is important to have knowledge about 

the latent infections in nurseries and forest stands. D. scrobiculata was not found in 

the area where the isolates used in the present experiment were collected. As the 

isolates of D. pinea were directly obtained from pycnidia located on diseased 

shoots, instead of isolating from host tissues, only the frequently fruiting species 

could be found. Since the asymptomatic persistence of the fungal species in the 

host tissues is important for their wide distribution, a study focusing in latent 

infections is needed to shed light on the Diplodia-species composition on the local 

tree species and their infection potential. 

5-ACKNOWLEDGEMENTS 

This research was founded by Süleyman Demirel University Scientific Projects 

Unit (1325-06) and Republic of Turkey Prime Ministry State Planning 

Organisation (DPT 2003- K- 121020 /7). We are also very grateful to Glen Stanosz 

and Denise Smith for their help in molecular identification of isolates of S. sapinea 

sensu lato, Department of Plant Pathology, University of Wisconsin-Madison. 

REFERENCES 

Adams, G. C., Wu, N. –T., Eisenberg, B. E., 2002. Virulence and double-stranded RNA in 

Sphaeropsis sapinea. Forest Pathology 32 (2002) 309–329. 

Blodgett, J.T., Stanosz, G.R., 1997. Sphaeropsis sapinea morphotypes differ in aggressiveness, but 

both infect nonwounded red or jack pines. Plant Disease 81, 143-147. 

Blodgett, J.T., Bonello, P., 2003. The aggressiveness of Sphaeropsis sapinea on Austrian pine varies 

with isolate group and site of infection. Forest Pathology 33, 15-19. 

Burguess, T., Wingfield, M. J., 2001. Simple sequence repeat markers distinguish among 

morphotypes of Sphaeropsis sapinea. Applied and Environmental Microbiology 67, 354- 

362. 

Brookhouser, L. W. Peterson, G. 1971. Infection of Austrian, Scots, and panderosa pines by Diplodia 

pinea. Phytopathology 61, 409–414. 

de Wet, J., Burgess, T., Slippers, B., Preisig, O., Wingfield, B.D., Winfield, M.J., 2000. 

Characterization of Sphaeropsis sapinea isolates from South Africa, Mexico and 

Indonesia. Plant disease 84, 151-156. 

54


de Wet, J., Burgess, T., Slippers, B., Preisig, O., Wingfield, B. D., Winfield, M.J., 2003. Multiple 

gene genealogies and microsatellite markers reflect relationships between morphotypes of 

Sphaeropsis sapinea and distinguish a new species of Diplodia. Mycological Research 

107, 557-566. 

Chou, C. K. S., Mackenzie, M., 1988. Effect of prunning intensity and season on Diplodia pinea 

infection of Pinus radiata stem through prunning wounds. Eur. J: For. Path., 18, 437-444. 

Doğmuş Lehtijärvi H. T., Lehtijärvi, A., Karaca, G. and Aday, A. G., 2007. Sphaeropsis sapinea 

Dyko& Sutton associated with shoot blight on Brutian pine in soutwestern Turkey. 

IUFRO Meeting- May- 2007, Hungary. Acta Silv. Lign. Hung., Spec. Edition, 95-99. 

Flowers, J., Hartman, J., Vaillancourt, L., 2003. Detection of latent Sphaeropsis sapinea infection in 

Austrian pine tissues using Nested-Polymerase Chain Reaction. Phytopathology 93, 1471- 

1477. 

Flowers, J., Nuckles, E., Hartman, J., Vaillancourt, L., 2001. Latent infection of Austrian and Scots 

pine tissues by Sphaeropsis sapinea. Plant Disease 85, 1107-1112. 

Luchi, N., Capretti, P., Maresi, G., Feducci, M., 2007. Detection of Diplodia pinea in asymptomatic 

pine shooths. Acta Silv. Lign. Hung. Spec. Edition, 111-114. 

Nicholls, T. H., Ostry, M. E. 1990. Sphaeropsis sapinea cankers on stressed red and jack pines in 

Minnesota and Wisconsin. Plant Dis. 74 (1): 54-56. 

Maresi, G., Luchi, N., Pinzani, P., Pazzagli, M., Capretti, P., 2007. Detection of Diplodia pinea in 

asymptomatic pine shoots and its relation to the Normalized Insolation index. Forest 

Pathology 37, 272-280. 

Muñoz, Z., Moret, A., Garcés, S., 2008. The use of Verticillum dahliae and Diplodia scrobiculata to 

induce resistance in Pinus halepensis against Diplodia pinea infection. European Journal 

of Plant Pathology 120, 331-337. 

Palmer, M. A. Nicholls, T.H., 1985. Shoot blight and collar rot of Pinus resinosa caused by 

Sphaeropsis sapinea in forest tree nurseries. Plant Dis. 69, 739- 740. 

Palmer, M.A., Stewart, E.L., Wingfield, M.J., 1987. Variation among isolates of Sphaeropsis sapinea 

in the North Central United States. Phytopathology 77, 944- 948. 

Peterson, G., 1977. Infection, epidemiology, and control of Diplodia blight of Austrian, ponderosa, 

and Scots pines. Phytopathology 67: 511–514. 

Punithalingam, E., Waterston, J. M.1970. Diplodia pinea. CMI Descriptions of Plant Pathogenic 

Fungi and Bacteria. No. 273. Commonw. Mycol. Inst./Assoc. Appl. Biol.,Kew, Surrey, 

Eng. 

Smith, D.R., Stanosz, G.R., 1995. Confirmation of two distinct populations of Sphaeropsis sapinea in 

the north central United States using RAPDs. Phytopathology 85, 699-704. 

Smith, D.R., Stanosz, G.R., 2006. A species-specific PCR assay for detection of Diplodia pinea and 

D. scrobiculata in dead red and jack pines with collar rot symptoms. Plant Disease 90, 

307-313. 

Stanosz, G. R. Cummings, C.J., 1996. Association of mortality of recently planted seedlings and 

established saplings in red pine plantations with Sphaeropsis collar rot. Plant Disease 80, 

750–753. 

55


Stanosz, G.R., Smith, D.R., Albers, J.S., 2005. Surveys for asymptomatic persistence of Sphaeropsis 

sapinea on or in stems of red pine seedlings from seven Great Lakes region nurseries. 

Forest Pathology 35, 233-244. 

Stanosz, G.R., Blodgett, J.T., Smith, D.R., Kruger, E.L. 2001. Water stress and Sphaeropsis sapinea 

as a latent pathogen of red pine seedlings. New Phythologist 149: 531-538. 

Stanosz, G.R., Smith, D.R., Guthmiller, M.A., Stanosz, J.C., 1997. Persistence of Sphaeropsis 

sapinea on or in asymptomatic shoots of red and jack pines. Mycologia 89, 525-530. 

Swart, W. J., Wingfield, M. J., 1991. Biology and control of Sphaeropsis sapinea on Pinus species in 

South Africa. Plant Dis. 75 (8): 761-766. 

Swart, W. J. Wingfield, M. J., Knox, P. S., 1987. Factors associated with Sphaeropsis sapinea 

infection of pine trees in South Africa. Phytophylactica 19: 505-510. 

Unligil, H., Ertaş, A.,1993. Damage caused by Sphaeropsis sapinea to pine trees near İstanbul [ 

İstanbul yakınlarındaki çam ağaçlarında Sphaeropsis sapinea (Fr.) Dyko & Sutton mantar 

hastalığı]. İstanbul Universitesi Orman Fakültesi Dergisi Seri A 43 (1): 131-137. (in 

Turkish). 

56



SITE AND STAND CHARACTERISTICS OF A Pinus brutia STAND 

INFECTED WITH Diplodia pinea IN TURKEY 

Nevzat GÜRLEVIK 1* , H.T. Doğmuş LEHTIJÄRVI 1 , Asko LEHTIJÄRVI 1 , 

ABSTRACT 

A. Gülden ADAY 1 

SDU Faculty of Forestry, 32260 Isparta, TURKEY 

*gurlevik@orman.sdu.edu.tr 

Shoot blight can be a very costly disease for coniferous forests as it results in defoliation 

and reduced growth. In this study, some of the site and stand characteristics of a Pinus 

brutia Ten. stand infected with Diplodia pinea (Desm.) Kickx has been investigated. 

Blight occurrence was investigated for two different years, and also some soil and foliar 

nutrients were determined. Our results showed that at the first sapling time in 2006, 18 out 

of 90 shoot samples had infection, while in 2008 this number fell down to 5 out of 90 

samples. Results for soil analysis generally indicated somewhat poor site conditions. On 

average, soil had sandy clay loam texture, reaction was 7.72 and organic matter content was 

moderate with 3.84 percent. However, soil had a coarse fraction up to 62 % indicating 

relatively poor nutrition. Similarly, foliar nutrient levels also showed poor site quality. 

Overall, needle N concentration was lower than 1 %, indicating N deficiency on these sites. 

These poor site conditions and extreme droughts may have played a role in development of 

the shoot blight in these stands. 

Keywords: Diplodia pinea, Pinus brutia, drought, nutrients 


Pinus brutia Ten. is the most commonly distributed coniferous forest tree 

species in Turkey, covering approximately 5.4 million hectares. It can be found at 

elevations between sea level and 1500 m. Pinus brutia grows best at elevations of 

600-800m, below which very high temperature and demand for evapotranspiration, 

and above which cold weather restrict its distribution and growth (Boydak, 2000) 

Diplodia pinea (Desm.) Kickx is one of the most common disease agents in 

coniferous forests. It causes necrosis on needles, and therefore defoliation and 

death of shoots. In turn, it results in reduced growth and substantial economical 

losses (Stanosz et al., 2004). 

Several studies indicate higher risk of disease if plants are stressed. Especially, 

water stress seems to increase the occurrence of this disease. Paoletti et al. (2001) 

showed that water stressed Pinus halepensis Mill. seedlings had longer cankers of 

Sphaeropsis sapinea sensu lato 5 months after inoculation. Blodgett et al. (1997a) 

have also shown that 3-year-old red pine (Pinus resinosa Sol. ex Aiton) seedlings 

57


had higher S. sapinea infection when the seedlings were subjected to water stress. 

Similarly, in a 9–year–old red pine plantation in Wisconsin, trees with lower predawn 

water potentials had more severe development of disease (Blodgett et al., 1997b). Also, 

nutritional imbalances and alterations of nutrients can affect development of disease 

(Stanosz et al., 2004). Blodgett et al. (2005) showed that fertilized red pine trees had 

higher foliar N and greater lesion size. 

In 2004 and 2005, Diplodia had devastating effect on P. brutia stands on lower 

ranges of its distribution area (Lehtijärvi et al., 2007). It caused defoliation of the pines 

and reduced growth. In this study, the objectives were to determine the occurrence of 

disease on pines and also to determine the site and stand characteristics of this infected 

site. 

2. MATERIAL AND METHOD 

The study site is located in Asagi Gokdere district of Isparta, along the Isparta- 

Antalya highway (37 o 33" N, 30 o 45" E). The altitude is 350 m above sea level and the 

distance to the Mediterranean coast is 75 km. The site was planted in mid 1980’s, and 

it became somewhat dense over time with natural seeding and lack of tending 

operations. Number of trees per hectare was 2100 on average and it reached as high as 

2775 on one site. Mean annual precipitation is 1052 mm in Antalya weather station, 

and there is almost no rainfall between June and September during the growing season. 

Monthly average temperatures range from 0 o C to 23.4 o C, but maximum daily 

temperatures can be as high as 41 o C during the summer, indicating very high demand 

for evapotranspiration. 

For the study, four different treatments with three replications were applied to the 

stands to control the disease. These treatments included control, pruning, thinning and 

pruning + thinning. Each plot was 20 x 20 m in size. Remains of pruning and thinning 

operations were removed from the plots afterwards. 

We conducted some measurements to determine the disease rate and site 

parameters. These measurements included fungal survey, soil analysis, foliar analysis 

and water potential. 

2.1. Fungal survey 

10 trees were samples from each plot for fungal survey in two different years (2006 

and 2008). One dead branch from each tree was cut and the shoots were investigated 

under the stereomicroscope for the presence of fungal structures. Samples were also 

isolated to identify the fungal species based on conidial and pycnidial morphology. 

Number of shoot samples with D. pinea was recorded. 

2.2. Soil sampling 

Soil samples were taken from 5 points in each plot at 0-20 cm depth. Coarse 

material larger than approximately 3 cm in diameter was not included in soil 

58


samples. Samples were mixed for each plot, sieved to pass 2 mm after air drying, 

and physical and chemical properties were determined in laboratory. 

2.3. Needle samples 

Prior to sampling, every tree was labelled and their health condition was 

recorded. Five healthy and 5 unhealthy trees were chosen for foliar sampling in 

each plot (Figure 1). 40 fascicles were taken from each tree with a shotgun. 

Samples were dried at 70°C for 24 hours. The dry weights were measured and the 

needles ground, then chemical analysis was performed for nutrients. 

2.4. Plant water potential 

We assumed that water potential of the trees may have played a role in 

development of this fungal disease. Five trees were chosen in each plot for water 

potential measurements. From each tree, representative needle samples were taken 

from the bottom 1/3 of the canopy, and needle water potentials were measured with 

a pressure bomb. However, the data was not conclusive, so the initial results were 

not included here. 

3. RESULTS 

3.1. Fungal survey 

Figure 1. Healthy (a) and unhealthy (b) pine needles. 

Since start of the fungal disease in 2004, the rate of the disease has decreased 

over time. In 2006, the ratio of samples with Diplodia was 20 %, while in 2008 the 

ratio fell down to 5.5 %. As of today, the stand looks quite healthy. 

3.2. Soil samples 

On average, soil texture was sandy clay loam (Table 1). Soil reaction was relatively 

neutral. Organic matter and nutrient concentrations were moderate. However, soil 

59


organic matter and nutrient contents were low considering that the coarse fraction (up 

to 3 cm) was as high as 62 %, and fraction larger than 3 cm in size estimated to be 

more than 50 % in some plots. 

3.3. Needle samples 

Similarly, foliar nutrient levels also showed poor site quality (Table 2). Overall, 

needle N concentration was lower than 1 per cent. Usually, less than 1.2 % N indicates 

some deficiency and N concentration is usually between 1.4-1.6 % in first quality sites. 

There was no significant difference between healthy and unhealthy needles in terms of 

nutrient concentrations (Figure 2), however fascicle weight of health needles were 

significantly greater (Figure 3). 

Table 1. Soil characteristics of the infected stands. 

Parameters Mean Std. Error 

Sand (%) 50.11 1.958 

Silt (%) 27.32 1.297 

Clay (%) 22.57 1.570 

Coarse faction (%) 34.63 5.664 

EC 188.53 8.909 

pH 7.72 0.044 

Lime (%) 16.08 1.899 

Organic matter (%) 3.84 0.116 

N (ppm) 1360.33 71.736 

P (ppm) 16.38 1.425 

K (ppm) 256.17 14.053 

Ca (ppm) 8130.92 361.213 

Mg (ppm) 248.08 13.118 

Na (ppm) 16.47 0.925 

Table 2. Foliar characteristics of the infected stands. 

Parameters Mean Std. Error 

N (%) 0.97 0.024 

P (%) 0.13 0.003 

K (%) 0.33 0.010 

Ca (%) 0.83 0.030 

Mg (%) 0.21 0.007 

Fe (ppm) 37.24 1.069 

Cu (ppm) 3.13 0.197 

Mn (ppm) 32.60 3.640 

Zn (ppm) 15.00 0.414 

B (ppm) 19.07 1.418 

Fascicle weight (g) 6.53 0.204 

60

N (%) 

P (%) 

K (%) 

1,40 

1,20 

1,00 

0,80 

0,60 

0,18 

0,14 

0,10 

0,06 

0,60 

0,40 

0,20 

0,00 


h uh h uh h uh h uh 

K T P TP 


K T P TP 


K T P TP 

Figure 2. Nitrogen, phosphorus and potassium concentrations of healthy (h) and 

unhealthy (uh) needles in control (C), thinning (T), pruning (P) and thinning plus pruning 

(TP) treatments. 

61

100 fascicle weight (g) 

9 

8 

7 

6 

5 

4 


Figure 3. Fascicle weights of healthy (h) and unhealthy (uh) pine needles in control (C), 

thinning (T), pruning (P) and thinning plus pruning (TP) treatments. 

4. CONCLUSION 


K T P TP 

Diplodia had some very serious effects on pine stands of Asagi Gokdere region. 

The symptoms diminished over the past four years since its first occurrence in this 

site. The site characteristics indicated poor site with low nutrients and rocky soil. 

Nutrient level in the needles also showed very low levels of N, indicating nitrogen 

deficiency. In fact, N levels in needles were almost one half of the one in a healthy 

needle. In addition, these stands have received no silvicultural treatments in recent 

years and the number of stems in these stands was almost twice as much as it 

should be. 

Although the site is located in a region which receives approximately 1000 mm 

rainfall, most of it is received in winter, and summer droughts are very common. 

Temperatures reaching above 40°C during the summer months intensify the effects 

of drought, creating a very high demand for evapotranspiration. 

These poor site conditions and extreme droughts may have played a role in 

development of the shoot blight in these stands. Apparently, the site was both 

nutrient and water limited, especially during the growing season. This limitation 

was most apparent when the canopy of the stand was investigated. In most areas of 

the site, the individual trees had very thin and sparse canopy due to lack of growing 

space and site resources to develop healthy crown (Figure 4). Timely and 

appropriate silvicultural treatments may reduce the effects of poor soil conditions 

and droughts, leading to stronger and more resistant trees beforehand, and better 

recovery after an infection. 

62


Figure 4. Defoliated branches and remaining thin canopy of Pinus brutia infected by 

Diplodia pine. 


This work was supported by Süleyman Demirel University BAP Project (1325- 

M-06). 


Blodgett J. T., Kruger E. L., Stanosz G. R., 1997a. Effects of Moderate Water Stress on Disease 

Development by Sphaeropsis sapinea on Red Pine. Phytopathology, 87 (4): 422-428 

Blodgett J. T., Kruger E. L., Stanosz G. R., 1997b. Sphaeropsis sapinea and Water Stres in a Red 

Pine Plantation in Central Wisconsin. Phytopathology, 87 (4): 429-434 

Blodgett J.T., Herms D.A. Bonello P., 2005. Effects of fertilization on the red pine defense chemistry 

and resistance to Sphaeropsis sapinea. Forest Ecology and Management, 2008: 373-382. 

Boydak, M., 2006. Biology and Silviculture of Turkish Red Pine (Pinus brutia Ten.). Lazer Ofset 

press, Ankara, 19-41 s 

63


GDF, 2008. Forest atlas. General Directorate of Forestry, Ankara 

Lehtijärvi H.T.D., Lehtijärvi A., Karaca G., Aday, A.G., 2007. Sphaeropsis sapinea Dyko & Sutton 

Associated with Shoot Blight on Pinus brutia Ten. in Southwestern Turkey. Acta Silv. 

Lign. Hung., Spec. Edition (2007) 95-99. 

Paoletti, E., Danti R., Strati S., 2001. Pre- and post-inoculation water stress affects Sphaeropsis 

sapinea canker length in Pinus halepensis seedlings. For. Path. 31: 209-218 

Stanosz, G. R., Trobaugh, J., Guthmiller, M. A., Stanosz, J. C., 2004. Sphaeropsis shoot blight and 

altered nutrition in red pine plantations treated with paper mill waste sludge. For. Path. 

34: 245–253 

64



THE EFFECTS OF SIROCOCCUS SHOOT BLIGHT AND VITALITY 

FERTILIZATION ON GROWTH OF MATURE NORWAY SPRUCE 

Markus HUBER 1 , Erhard HALMSCHLAGER 2* , Hubert STERBA 1 

Department of Forest and Soil Science, University of Natural Resources and Applied Life Sciences, 

Vienna (BOKU), 

1 Institute of Forest Growth and Yield Research, Peter Jordanstraße 82, 

A-1190 Vienna, Austria, 2 Institute of Forest Entomology, Forest Pathology and Forest Protection 

(IFFF), Hasenauerstraße 38, A-1190 Vienna, Austria 

ABSTRACT 

* erhard.halmschlager@boku.ac.at 

The impact of Sirococcus shoot blight and vitality fertilization on the growth of mature 

Norway spruce (Picea abies (L.) Karst.) was studied in a single tree fertilization 

experiment, established in autumn 2000. A total of 144 sample trees were selected among 

the dominant and co-dominant trees of the 90-year-old Norway spruce stand. Half of the 

trees exhibited severe symptoms of Sirococcus shoot blight whereas the other half were 

apparently healthy and vigorous. A randomised block design with the factors “slope 

section” (lower slope versus upper slope) and “Sirococcus shoot blight” (severely affected 

versus healthy trees) was used. Within these blocks sample trees were randomly assigned to 

one of the three treatments (dolomitic liming, application of gypsum and kieserite, 

unfertilized control). Due to tree mortality caused by bark beetle infestation the 

experimental design became unbalanced and therefore final analyses were performed with 

the volume growth data of 125 sample trees only. The effects of Sirococcus shoot blight 

and fertilization treatments on current annual volume increment were investigated by 

analysis of covariance, using the average volume increment of the period 1977–1980 as a 

covariate attribute (assuming that tree growth was not yet affected by Sirococcus shoot 

blight during this period). Indeed results indicated that Sirococcus shoot blight started in 

1981 in the experimental stand and trees with shoot blight symptoms had a significantly 

lower increment over the whole period 1981–2006. Sirococcus induced increment reduction 

of the nonfertilized trees continuously increased from 7,5 ± 2,9% in 1981 to 37 ± 3,8% by 

the year 2000. A significant positive effect of vitality fertilization was only achieved with 

the gypsum and kieserite variant from 2002 to 2006. The highest surplus increment was 

found in 2004 with 31,6 ± 15,2%, calculated as average over the diseased and healthy 

group. However, a mitigation of increment loss caused by Sirococcus shoot blight was 

statistically significant only for the year 2003. 

Keywords: Sirococcus conigenus, Norway spruce, increment reduction, vitality 

fertilization 

65



Since the early 1980s shoot blight by Sirococcus conigenus (DC.) P. Cannon & 

Minter has caused severe damage on Norway spruce (Picea abies [L.] Karst.) in 

some parts of Austria (Fig. 1). Previous studies revealed insufficient Mg and Ca 

supply, enhanced N/Mg and N/Ca-ratios in the needles of severely diseased trees 

(Anglberger et al., 2003) and demonstrated that application of appropriate 

fertilizers mitigated disease severity and promoted tree recovery (Halmschlager et 

al., 2007). The present study was carried out in the same individual-treefertilization 

experiment and aimed to investigate the effect of Sirococcus shoot 

blight on growth of mature Norway spruce (for further details see: Huber et al., 

2009). 

Figure 1. Severely affected mature Norway spruce. 

66

2. MATERIAL & METHODS 


The experiment was established in a mature Norway spruce stand in Upper 

Austria. Two fertilizer treatments and an unfertilized control variant were applied 

on a total of 144 dominant or co-dominant trees in a randomized block design 

(Fig. 2) in April 2001. Half of the trees exhibited symptoms of Sirococcus shoot 

blight (“diseased”), whereas the other trees were “healthy”. The average basal area 

increment of the two groups diverged after the year 1980, therefore analysis of 

covariance was applied for testing the effects of fertilization and Sirococcus 

symptoms on volume increment, using the average of the current annual increment 

in the period 1977 to 1980 as the covariate. 

Figure 2. Position of the sample trees within the experimental stand. The tree position is 

marked with different symbols for the variants. Trees from the slope position “upper slope” 

are found northern to the dotted line. (Figure reprinted from Huber et al. 2009 with 

permission from Elsevier.) 

67

3. RESULTS & DISCUSSION 


Tree ring analyses indicated that Sirococcus shoot blight started in 1981 in the 

experimental stand and trees with shoot blight symptoms had a significantly lower 

increment over the whole period 1981–2006 (data not shown). Sirococcus induced 

increment reduction of the nonfertilized trees continuously increased from 7,5 ± 

2,9% in 1981 to 37 ± 3,8% by the year 2000 (Fig. 3). Results therefore clearly 

revealed a volume-growth decreasing effect of Sirococcus shoot blight in mature 

Norway spruce, which has been been observed only on young Norway spruce trees 

yet (Halmschlager et al., 2000). 

Figure 3. Current annual increment of the unfertilized “diseased” and “healthy” sample 

trees, adjusted for the same average current annual increment of 21.0 dm 3 in the period 

1977 to 1980, and the difference between the current annual increment of “diseased” and 

“healthy” trees in percent of the current annual increment of “healthy” trees. The error bars 

indicate the standard error of the adjusted means. (Figure reprinted from Huber et al. 2009 

with permission from Elsevier.) 

68


69 

Figure 4. The development of the adjusted average increment per tree by fertilization treatment for the “diseased” and “healthy” trees. 

The error bars indicate the standard errors of the means. The means in the subfigure on the right were calculated as average over the 

“diseased” and “healthy” group. (Figure reprinted from Huber et al. 2009 with permission from Elsevier.)


The effect of fertilization on tree volume growth was negative in the first year 

after fertilization in both treatments. A positive effect of vitality fertilization was 

achieved for the first time 2 years after fertilization with the gypsum and kieserite 

variant (Fig. 4). This significant surplus in increment was found from 2002 to 2005 

and culminated in 2004 with 32 ± 15%, calculated as average over the diseased and 

healthy group. The rapid response of the fertilized trees in this treatment can be 

explained by the quick plant availability of Ca and Mg from these water soluble 

fertilizers. In the dolomitic lime variant a positive effect occurred at first in 2004 

on the healthy trees and in 2006 also on the diseased trees. 

A significant interaction between Sirococcus symptoms and fertilization with 

kieserite + gypsum was found in 2003, where the increment increasing effect by 

fertilization was higher for the “diseased” trees. Therefore a possible mitigation of 

Sirococcus-induced increment losses by fertilization can be suggested. 

4. REFERENCES 

Anglberger, H., Sieghardt, M., Katzensteiner, K., Halmschlager, E., 2003. Needle nutrient status of 

Sirococcus shoot blight-diseased and healthy Norway spruces. Forest Pathology 33, 21- 

29. 

Halmschlager, E., Anglberger, H., Katzensteiner, K., Sterba, H., 2007. The effect of fertilisation on 

the severity of Sirococcus shoot blight in a mature Norway spruce (Picea abies [L.] 

Karst.) stand. Acta Silvatica & Lignaria Hungarica, Special Edition 2007,101-11. 

Halmschlager, E., Gabler, A., Andrae, F., 2000. The impact of Sirococcus shoot blight on radial and 

height growth of Norway spruce (P. abies) in young plantations. Forest Pathology 30, 

127–33. 

Huber, M., Halmschlager, E., Sterba, H., 2009. The impact of forest fertilization on growth of mature 

Norway spruce affected by Sirococcus shoot blight. Forest Ecology and Management 

257, 1489-95. 

Acknowledgements: We gratefully acknowledge the support of the Austrian 

Federal Forests (Österreichische Bundesforste AG), district management Traun- & 

Innviertel in supplying financial support, the plot and local resources for this 

investigation. 

70



INTERACTION BETWEEN Diplodia pinea, D. scrobiculata AND 

SEVERAL FUNGAL ENDOPHYTES IN RED AND JACK PINE 

SEEDLINGS 

Oscar SANTAMARÍA 1 *; Denise R. SMITH 2 and Glen R. STANOSZ 2 

1 Dpt. Ingeniería del Medio Agronómico y Forestal, Universidad de Extremadura. Ctra. de Cáceres 

s/n, 06071 Badajoz, SPAIN. 

2 Dpt. of Plant Pathology, University of Wisconsin-Madison, 1630 Linden Dr., Madison 53706, WI, 

USA. 

ABSTRACT 

* osantama@unex.es 

Sphaeropsis sapinea sensu lato is a conifer fungal pathogen that causes mainly shoot 

blight and stem cankers. Recently, the former S. sapinea has been divided in two new 

species, D. pinea and D. scrobiculata. The aim of the study was to evaluate the interaction 

between those two fungal pathogens and among them and several fungal endophytes 

isolated from healthy shoots of Pinus resinosa and P. banksiana adult trees. Interaction was 

evaluated by means of co-inoculations in Red and Jack pine seedling under greenhouse 

conditions. Symptom severity (distance below the inoculation site at which necrotic needles 

were observed) was recorded after four weeks of incubation and used as response variable. 

The results showed D. pinea to be much more aggressive on both hosts than D. 

scrobiculata. When both pathogens where inoculated in a single plant, the symptom 

development was mainly due to D. pinea. Furthermore, D. scrobiculata showed antagonism 

with D. pinea, since when both pathogens co-occurred in a single seedling, symptom 

severity caused by D. pinea was lower than that caused when D. pinea acted alone. The 

results also suggested that two of the endophytes, Trichoderma atroviride and Rosellinia 

subiculata, were able to inhibit the pathogen spreading and therefore they could be 

considered biocontrol agents against D. pinea. Further studies would be needed to confirm 

biocontrol. 

Keywords: Sphaeropsis sapinea, biocontrol, Pinus sp, inoculation. 


Sphaeropsis sapinea sensu lato is a conifer fungal pathogen of worldwide 

distribution which has caused significant economic damage in nurseries, 

plantations, and natural stands (Gibson, 1979; Nicholls and Ostry, 1990; Davison et 

al., 1991). The parasite can infect most parts of host plants, causing a broad range 

of disease symptoms: shoot blight, stem cankers, branch dieback, dead tops, death, 

and blue staining of cut wood (Nicholls and Ostry, 1990; Stanosz and Cummings- 

Carlson, 1996). 

71


Two groups, A and B, were distinguished within S. sapinea sensu lato (Palmer 

et al., 1987) based on several characteristics such as morphology, growth, virulence 

and molecular markers (Palmer et al., 1987; Smith and Stanosz, 1995; de Wet et 

al., 2000; Burguess and Wingfield, 2001). Recently, the B group has been 

recognized as a distinct species and assigned the name Diplodia scrobiculata J. de 

Wet, B. Slippers & M. J. Wingfield (de Wet et al., 2003). At the same time, the A 

group was named as Diplodia pinea (Desmaz.) J. Kickx fil. (syn. Sphaeropsis 

sapinea (Fr.:Fr.) Dyko & Sutton in Sutton) (de Wet et al., 2003). In terms of 

pathogenicity, D. pinea has been shown to be more aggressive than D. scrobiculata 

(Blodgett and Stanosz, 1997; Blodgett and Bonello, 2003). 

The reported geographic and host ranges of D. pinea and D. scrobiculata are 

broad and overlapping. Not only do distributions and hosts overlap, but D. pinea 

and D. scrobiculata also are known to occur together. In this sense, both species 

have been isolated from individual red pine (Pinus resinosa Aiton.) plantations 

(Palmer, 1991; Stanosz et al., 2005) or even from a single tree (Morelet and 

Chandelier, 1993) or a single sample (Smith and Stanosz, 2006). Those 

experiments stated the potential for intimate association between D. pinea and D. 

scrobiculata within host tissues, but relatively little is known about their local cooccurrence 

and the implications of this fact for the disease development, and 

subsequent survival. 

Complete eradication of the pathogen is difficult due to latent infection of 

symptomless tissues of apparently healthy trees (Flowers et al., 2001; Stanosz et 

al., 2005; Maresi et al., 2007; Stanosz et al., 2007); however, proper control 

measures could reduce the spread and virulence of the disease. Among those 

measures, the use of biological control is of increasing interest since it provides an 

effective and environmentally safer alternative to chemical application. Several 

microorganisms, mainly fungi, have been observed to cause ‘systemic induced 

resistance’ in the host after their inoculation into the plant, which may prompt a 

lower host susceptibility to later infections with D. pinea (Luchi et al., 2005; 

Blodgett et al., 2007; Muñoz et al., 2008). On the other hand, several endophytes, 

which have been shown to produce secondary metabolites, some of them with 

antifungal properties (Tan and Zou, 2001; Schulz et al., 2002), have shown 

antagonism with several pathogens and they have been assessed as biological 

control agents (Mehrotra et al., 1988; Holdenrieder and Greig, 1998; Roy et al., 

2001). However in the literature, few studies dealing with the use of endophytes as 

biological control agents against D. pinea can be found. 

Therefore, the main aim of the study was to analyse the effect of D. 

scrobiculata and several fungal endophytes, isolated from healthy shoots of Pinus 

resinosa and P. banksiana Lamb. (jack pine) adult trees, on the symptom severity 

72


caused by D. pinea by means of co-inoculations on P. resinosa and P. banksiana 

seedlings, with the goal of evaluating their potential role as biological control 

agents of Diplodia pinea. 


2.1. Plant material 

Dormant, 1-year-old jack pine and 2-year-old red pine nursery seedlings were 

lifted at the beginning of winter and transplanted into Deepot cones (conical tubes, 

6.4 cm wide x 25.4 cm deep; Stuewe & Sons Inc., Corvallis, OR) in a soil mix (1:1 

vol/vol) of Plainfield sand (containing 89% sand and 7% silt) from a 24-year-old 

red pine plantation in central Wisconsin and Fafard growing mix no. 2 (Conrad 

Fafard Inc., Inkerman, New Brunswick, Canada). Red pine seedlings had a mean 

stem height of 16.9 cm 0.3 standard error (SE) and jack pine had a mean stem 

height of 26.8 cm 0.6 SE at the time transplanted. Seedlings were placed in a 

greenhouse supplemented with artificial light (maximum recorded ambient 

greenhouse photon flux density was 1,560 µmol·s -1 ·m -2 ; supplemental photon flux 

density averaged 132 µmol·s -1 ·m -2 ) to provide a 16-h photoperiod. The seedlings 

were watered to field capacity every 2 to 3 days. The climatic conditions during the 

experiments in the greenhouse were: average temperature (T) 30.6º C 0.7 SE, 

average relative humidity (RH) 30.0% 1.5 SE. 

2.2. Fungal material 

Diplodia mycelia inoculum was produced for two monoconidial isolates of each 

species, D. pinea and D. scrobiculata, collected from various pine species and 

locations in the north central United States (Table 1). Thirty four endophytes were 

isolated from vigorous external twigs located at 1.5 m above ground in the canopy 

of 20–30 year old dominant red and jack pine trees. For isolations, needle-free 

shoots were surface sterilized by immersion for 30 s in 95% ethanol, and then two 

immersions for 2 min each in 1.05% NaClO plus two drops Tween-80 per litre. 

This procedure is similar to those routinely used for detection of endophytic fungi 

(Bills, 1996). Then, for each shoot, four 5-mm long plant segments including bark 

were cut and plated into a Petri dish containing PDA (Potato Dextrose Agar, 39 g·l - 

1 , Difco Laboratories, Detroit, MI) medium and incubated at room temperature for 

1 week before examination. Outgrowing colonies were transferred to PDA and 

incubated at 24º C. Four endophytes (Table 1) among the total were selected to 

perform the experiments based on a preliminary study (data not shown) where the 

antagonism between all of them and the 

73


Table 1: Origin of Sphaeropsis sapinea sensu lato and endophyte isolates used in the 

experiments. 

Isolate Isolate no. a Species Pine host Geographic origin 

P1 411 D. pinea b Pinus resinosa Clearwater Co., MN 

P2 04-126 D. pinea b Pinus banksiana Wood Co., WI 

S1 124 D. scrobiculata b Pinus banksiana Jackson Co., WI 

S2 462 D. scrobiculta b Pinus resinosa Clearwater Co., MN 

E1 08-08 Not determined Pinus banksiana Jackson Co., WI 

E2 08-09 Not determined Pinus resinosa Jackson Co., WI 

E3 08-10 

Trichoderma atroviride 

Karst. c 

E4 08-13 Rosellinia subiculata 

(Schwein.) Sacc. c 

74 

Pinus resinosa Jackson Co., WI 

Pinus banksiana Jackson Co., WI 

a 

Culture collection numbers of M. A. PALMER (3-digit number) or G. R. STANOSZ 

(04-xxx). 

b 

The isolates were previously characterized according to the specific primers given by 

SMITH and STANOSZ (2006). 

c 

The most homologous species given in the GeneBank after introducing the ITS 

sequence. 

Diplodia isolates was evaluated in vitro. Identifications of these four endophytes 

were carried out by obtaining the ITS region sequence and later comparison with 

the GeneBank. The fungal DNA was extracted directly from mycelia previously 

grown in PDB (Potato Dextrose Broth, 39 g·l -1 , Difco Laboratories, Detroit, MI) by 

using the slightly modified method of Gilbertson et al. (1991) outlined in Smith 

and Stanosz (1995). The extracted DNA was amplified using ITS1 and ITS4 

primers, and the entire region containing both internal transcribed spacers (ITS) 

was sequenced by the University of Wisconsin Biotechnology Center on an 

Applied Biosystems 3730XL DNA sequencer. 

2.3. Interaction between D. pinea and D. scrobiculta experiment 

The elongating, asymptomatic terminal shoot of each seedling was inoculated in 

the greenhouse approximately 11 weeks after transplanting in the case of red pine, 

and 6 weeks in jack pine. On each shoot, two wounds (in the opposite sides of the 

shoot) were made by removing a needle fascicle per side (by a sterile scalpel cut 

flush to the stem) approximately 2 cm below the shoot apex. Inoculations were 

made by placing fungus-side-down a 4-mm-diameter plug, cut from the margin of 

an actively growing culture on PDA (Potato Dextrose Agar, 39 g·l -1 , Difco 

Laboratories, Detroit, MI), on each of the two wounds. In the controls, seedlings 

were inoculated with sterile PDA in both wounds. Another five nonwounded 

seedlings for each host were incorporated in the experiments as additional controls 

but those were not included in the statistical analyses. Parafilm (American National 

Can Co., Chicago, IL) was wrapped around the shoots for 7 days. Five seedlings 

per treatment combination (isolate and fungal species; Table 1) were used in each 

of two trials separated by two weeks. Thus, for each tree species were inoculated


five seedlings per each one of the following treatments: 1) P1+S1, 2) P1+S2, 3) 

P2+S1, 4) P2+S2, 5) P1+P1, 6) P2+P2, 7) S1+S1, 8) S2+S2, and 9) Agar A+A. 

Then, a total of 45 seedlings per trial and tree species were inoculated. All 

treatments were assigned randomly. Four weeks after inoculation, the distances 

below the inoculation site at which necrotic needles and cankers were present were 

measured (symptom severity). Most of the seedlings were carried to the lab and, by 

means of a molecular analysis with specific primers (Smith and Stanosz, 2006), the 

presence of D. pinea or/and D. scrobiculata was verified in order to assure they 

were the causal agents of the necroses. 

2.4. Interaction between D. pinea and several endophytes experiment 

This experiment was carried out on 1-year-old jack pine seedlings. Shoots were 

inoculated as explained above, although D. pinea was inoculated 2 cm below the shoot 

apex and the endophyte 5 cm below the shoot apex. The endophytes were inoculated 

one week before the Diplodia inoculation. Two types of controls were used: seedlings 

inoculated with sterile PDA instead of the endophyte into the lowest wound (D+PDA) 

and seedlings nonwounded in the lower part (D). Other nonwounded seedlings were 

incorporated in the experiments as additional controls but those were not included in 

the statistical analyses. Five seedlings per treatment combination (D. pinea isolate and 

endophyte species) were used in each of two trials separated by two weeks. Thus, a 

total of 60 seedlings were double-inoculated per trial and considered in the analysis. 

All treatments were assigned randomly. 

Two and four weeks after inoculation, the distances below the site inoculated with 

D. pinea isolates at which necrotic needles and cankers were present (symptom 

severity) were measured. At the end of the experiment, 40% of the seedlings were cut 

and carried to the lab where, after needles were removed, cross sections, 1 cm long, 

centered at 0, 1.5, and 3 cm from the site inoculated with Diplodia, were aseptically cut 

and surface disinfected as described above. Each of the three cross sections was 

transferred to a PDA plate and incubated for 1 week at 25ºC and light. The presence of 

Diplodia isolates and endophyte species in the plates was recorded. 

2.5. Statistical analysis 

Symptom severity was analyzed by two-factor analysis of variance with 

interaction. Factors used as main effects were treatment and trial. Fisher´s least 

significant difference (LSD) test was used for multiple comparison among 

treatments by means of the General Linear Model Procedure of SAS (Statistical 

Analysis Software v. 9.1.3, SAS Institute Inc., Cary, NC) when significant 

differences were found in the ANOVA table. The ln (x+1) transformation of the 

response variable was used to stabilize the residual variance, although backtransformed 

values are presented in tables and figures for clarification. 

Assumptions of normality and homoscedasticity were assured by Kolmogorov- 

Smirnov and Levene´s tests respectively. In the endophyte experiment, since 

symptom severity was recorded at two and four weeks after inoculation, a repeated 

measurements analysis was also applied by means of Repeated Procedure of SAS, 

to test the effect of time on the symptom severity. 

75

3. RESULTS 


3.1. Interaction between D. pinea and D. scrobiculta experiment 

Inoculated seedlings of both tree species produced symptoms similar to those 

reported for seedlings in field and nursery studies, including necrotic needles, stem 

cankers, and crooked and dead shoot tips. Symptoms were observed in 100% of the 

seedlings inoculated with D. pinea, in 60% of the seedlings inoculated with D. 

scrobiculata and in 95% of the seedlings inoculated with both pathogens. No 

symptoms developed on wounded or nonwounded controls of any of the two hosts. 

In jack pine, the two-factor analyses of variance of the symptom severity (distance 

below the inoculation site at which necrotic needles were present) indicated a 

significant effect of the treatment (F = 50.75, p < 0.01), but not of the trial (F = 

1.92, p = 0.170). Thus, the multiple comparison of the treatments was performed 

with the pooled data of the two trials. 

In jack pine, symptom severity was greater on seedlings inoculated with isolates 

of D. pinea than on seedlings inoculated with isolates of D. scrobiculata (Figure 1). 

Symptom severity on seedlings inoculated with the isolate S2 of D. scrobiculata 

was not significantly different from that on control seedlings. It was observed that 

symptom severity also differed between the two isolates of D. pinea. On seedlings 

inoculated with the most aggressive isolate (P1), there were not statistical 

differences in the symptom severity between seedlings inoculated only with P1 and 

those inoculated with P1 in combination with either isolate of D. scrobiculata 

(Figure 1). However, on seedlings inoculated with the less aggressive isolate of D. 

pinea (P2), the co-occurrence of both fungal species in the seedling significantly 

reduced symptom severity in comparison to that caused by P2 when it was 

inoculated alone (Figure 1). 

Figure 1: Mean symptom severity (distance below the inoculation site at which necrotic 

needles were present) for each treatment on jack pine seedlings. Averages with the same 

letter are not significantly different according to Fisher´s least significant difference (LSD) 

test at a significant level of 0.05. Vertical bars indicate Standard Error. 

76


In the case of red pine seedlings, two-way ANOVA of the symptom severity 

showed a significant effect of the treatment (F = 15.89, p < 0.01), the trial (F = 

16.29, p < 0.01), but not of their interaction (F = 0.34, p = 0.88). Therefore, 

multiple comparison was performed separately for each trial (Figure 2). As in the 

case of jack pine, isolates ranked in the same order in relation to their 

aggressiveness, although in general terms, symptom severity was lower in red pine 

than in jack pine. In red pine, it was also observed that the presence of either isolate 

of D. scrobiculata in the seedling reduced the symptom severity caused by either 

isolate of D. pinea (except in trial 1 for P2 isolate), although in red pine, the 

differences between treatments were not so evident (Figure 2). Molecular analyses 

indicated that symptom severity was caused mainly by D. pinea. D. scrobiculata 

was only detected in the proximities of the inoculation site. 

Figure 2: Mean symptom severity (distance below the inoculation each trial on red 

pine seedlings. Averages with the same letter are not significantly different according to 

Fisher´s least significant difference (LSD) test at a significant level of 0.05. Vertical 

bars indicate Standard Error. 

3.2. Interaction between D. pinea and several endophytes experiment 

Jack pine seedlings inoculated with D. pinea isolates also produced symptoms 

similar to those reported above. No symptoms developed on nonwounded controls. 

After 2 weeks, the two-factor analyses of variance of the ‘necrosis length’ (distance 

below the inoculation site at which necrotic needles were present) indicated a 

significant effect of the ‘treatment’ (F = 4.24, p < 0.01), the trial (F = 6.53, p = 

0.012), but not of the interaction (F = 1.41, p = 0.18). The two-factor ANOVA of 

the ‘necrosis length’ caused by Diplodia isolates after 4 weeks showed that only 

the ‘treatment’ effect was significant (F = 2.91, p < 0.01). Only the ‘Time’ effect 

77


influenced the ‘treatment’ effect (interaction time*treatment: F = 3.94, p < 0.01). 

LSD test showed the inoculation with endophytes 08-10 and 08-13 to produce a 

significantly lower symptom severity caused by the second isolate (p2) of D. pinea 

after 2- and 4-weeks of incubation but only when compared with the control 

seedlings non-wounded in the lower part (Fig. 3). However, those fungi did not 

cause reduced symptom severity when compared with those caused by Diplodia on 

the controls wounded in the lower part and inoculated with PDA instead of 

endophyte mycelia (Controls PDA). For the most aggressive isolate of D. pinea 

(the p1 isolate), no endophyte was able to reduce significantly the symptom 

severity caused by Diplodia (Fig. 3). Re-isolation percentages of each fungus can 

be observed in Table 2. 

Figure 3: Mean necrosis length caused by the D. pinea for each endophyte treatment 

after 2 (figure a) and 4 weeks (figure b) of incubation. Averages with the same letter are 

not significantly different according to Fisher´s least significant difference (LSD) test at 

a significant level of 0.05. Vertical bars indicate Standard Error. ‘Control’ was not 

wounded 5 cm below the apex; and ‘Agar’ was a control wounded and inoculated with 

agar 5 cm below the shoot apex. 

78


Table 2: Re-isolation percentage of each fungal species from the seedlings where they had 

been inoculated. 

Isolate 

79 

Cross section a 

Initial Mid Final 

P1 100% 85% 55% 

P2 100% 60% 40% 

08-08 0% 0% 0% 

08-09 0% 0% 0% 

08-10 0% 25% 81.3% 

08-13 0% 0% 6.3% 

a .- Initial: 1-cm cross section including the Diplodia inoculation site; 

Mid: 1-cm cross section between both inoculation sites; Final: 1-cm cross 

section including the endophyte inoculation site. 

4. DISCUSSION 

Inoculations with D. pinea isolates resulted in greater severity of symptoms 

than inoculations with D. scrobiculata isolates on seedlings of red and jack pine. 

This result agrees well with those stated in previous studies (Blodgett and Stanosz, 

1997; 1999) which used a similar inoculation technique on the same or different 

host seedlings. However, in Blodgett and Stanosz (1997) D. scrobiculata was more 

aggressive in jack pine and D. pinea in red pine. In our study, although results are 

not statistically comparable since they were obtained in separated experiments, 

jack pine appeared to be the most susceptible host for both fungal species. 

The molecular analysis confirmed that, when both pathogens were inoculated in 

the same seedling, D. pinea was mainly responsible for the necrosis length 

observed in the seedlings. This fact was consistent with the greater aggressiveness 

shown by D. pinea. In general terms, when both species were inoculated in the 

same seedling, symptom severity observed was lower than that recorded when D. 

pinea was inoculated alone. This fact suggests a potential antagonism between both 

pathogens when they co-occurred in the same plant tissue. This may have very 

important implications, because it is already known D. pinea and D. scrobiculata 

occur together in nature. In this sense, both species have been isolated from 

individual red pine plantations (Palmer, 1991; Stanosz et al., 2005) or even from a 

single tree (Morelet and Chandelier, 1993) or a single sample (Smith and Stanosz, 

2006). Therefore it would be very interesting to develop further studies to 

investigate whether where both pathogens co-occur in those plantations, the disease 

incidence caused by Diplodia is lower than in plantations where just one pathogen 

is present.


However, this result should be taken cautiously because the reduction of the 

symptom severity caused by D. pinea when D. scrobiculata was also present, was 

not always statistically significant. One possible explanation for this lack of 

significance could be related to the great variability recorded between the 

repetitions. This great variation could be a consequence of the natural presence of 

both pathogens, in a latent state, in the plant material used in the experiments. 

Latency has already been described in previous studies as a very common state for 

Sphaeropsis sapinea sensu lato (Stanosz et al., 1997; Flowers et al., 2001; 2003; 

Stanosz et al., 2005; Maresi et al., 2007), which was isolated from asymptomatic 

plant tissues in a percentage range of 20-85%. Even in the present study, D. pinea 

and D. scrobiculata occurred asymptomatically in several of the non inoculated 

seedlings (data not shown). Despite this natural presence of the pathogen in the 

seedlings of our experiments, control seedlings did not become diseased and did not 

show any symptom of the disease. This result was predictable since it has been 

proposed by several authors that activation from this latency to a pathogenic state may 

take place under different conditions of stress (Stanosz et al., 1997; Smith et al., 2002); 

and seedlings used in the present study were grown in optimal conditions. However in 

the case of inoculated seedlings, the fungal spreading and colonization may cause 

stress to the plant that could activate the latent infections of the pathogen, if present. In 

such cases, the symptom severity recorded could be overestimated. 

In general terms, when two of the endophytes, 08-10 and 08-13, were also 

inoculated in the seedling, symptom severity casused by the D. pinea isolates was 

lower than that recorded when D. pinea was inoculated alone. This fact suggests a 

potential antagonism between those two endophytes and D. pinea when they cooccurred 

in the same plant tissue. However, that reduction of the symptom severity 

caused by D. pinea was only statistically significant on the less aggressive isolate 

of D. pinea (p2). Endophytes have been demonstrated to be suitable candidates as 

biological control agents, as they seem to be part of the defence system of trees 

(Barklund and Unestam, 1988; Ranta et al., 1995) and have already been shown to 

be antagonistic to many fungal pathogens, including Diplodia spp. (Holdenrieder 

and Greig, 1998; Roy et al., 2001; Campanile et al., 2007). 

Among the endophytes used in the present study, isolate 08-10 was identified as 

Trichoderma atroviride Karst. Since the potential of this genus as a biocontrol 

agent of plant pathogens was first recognized in the early 1930s (Weindling, 1932), 

continuous studies have demonstrated the effectiveness of this species in the 

biological control against a number of plant pathogenic fungi, including Diplodia 

spp., on several forest hosts (Knudsen et al., 1991; Mousseaux et al., 1998; 

Campanile et al., 2007; Schubert et al. 2008). T. atroviride is a mycoparasite 

which, once it recognizes and attacks the fungal host, uses it’s nutrients killing the 

host before or just after invasion (Chet et al., 1998). The endophyte 08-13, which 

was also able to reduce the symptom severity caused by Diplodia on pine 

seedlings, was identified as Rosellinia subiculata (Schwein.) Sacc. This fungal 

endophyte has been shown to produce sordarin, which is an antibiotic with 

antifungal properties against a number of plant pathogenic fungi (Bills et al., 2002). 

80


This fact is in agreement with a preliminary assay carried out in the present study 

for the endophyte selection, where R. subiculata was observed to produce a reddish 

compound on PDA culture media that inhibited strongly Diplodia growth on 

contact with mycelium. 

Among the three types of interaction between antagonistic organisms proposed 

by Adams (1990), competition, antibiosis and hyperparasitism, the former could be 

the most important mechanism acting for D. scrobiculata, although antibiosis could 

be also acting since S. sapinea sensu lato has been shown to produce metabolites 

with antifungal activity (Cabras et al., 2006). For T. atroviride hyperparasitism 

may be the main process involved in the reduction of symptom severity caused by 

D. pinea in most of the cases. This is corroborated with the fact that in the 92.8% 

of the seedlings where T. atroviride was re-isolated, D. pinea isolates were not able 

to cause necroses farther than the site inoculated with the endophyte. In the case of 

R. subiculata it seems clear that the type of interaction involved in the antagonism 

would be antibiosis as expressed above. 

Systemic induced resistance (SIR) is a host defense mechanism which has also 

been proposed by several authors (Blodgett et al., 2007; Muñoz et al., 2008) to 

explain why inoculations with D. scrobiculata and other fungal endophytes 

reduced the symptom severity on seedlings inoculated later with D. pinea. In such 

studies, those fungi were inoculated several weeks before inoculating with D. 

pinea, because plants need some time to produce the defensive action. Therefore, 

the reduction of symptom severity caused by D. pinea when D. scrobiculata is also 

inoculated into the same seedling at the same time, as it is our case, could not be 

explained by this mechanism of SIR. In the case of the endophytes, however, those 

were inoculated one week before the D. pinea inoculation. Therefore, SIR could be 

implicated in the reduction of the symptom severity caused by D. pinea when 

endophytes had been previously inoculated into the plant. This is consistent with 

the fact that in the present study the reduction in the symptom severity caused by 

D. pinea when endophytes were also inoculated into the seedlings, was only 

significant when compared with the controls non-wounded in the lower part, but it 

was not with those wounded and inoculated with PDA plugs. This fact may 

indicate that wounding could activate that defensive mechanism. This mechanism 

has been already shown to occur after wounding without any later fungal 

inoculation in several important components in pine resistance such as resin flow 

(Luchi et al., 2005). Nevertheless, this is in disagreement with the results obtained 

by other authors who indicated that wounding alone does not induce SIR in the 

case of Pinus nigra Arn. (Blodgett et al., 2007) or in P. radiata D. Don. (Bonello et 

al., 2001). 

In conclusion, the results presented here suggested that, when both D. pinea and 

D. scrobiculata co-occurred in a single plant, the symptom development was 

mainly due to D. pinea. Furthermore, D. scrobiculata and two of the endophytes 

tested (the isolate 08-10 of Trichoderma atroviride and the isolate 08-13 of 

Rosellinia subiculata) showed some antagonism to D. pinea, since, when both 

81


fungi co-occurred in a single seedling, symptom severity caused by D. pinea was 

lower than that caused when D. pinea was acting alone (at least this happened with 

the less aggressive isolates of D. pinea). 

Acknowledgements 

This research was partially supported by a grant provided by the Ministry of 

Culture and Science of Spain (Program: José Castillejo) and by the Department of 

Plant Pathology of the University of Wisconsin-Madison. We are also very grateful 

to the Wisconsin Department of Natural Resources for seedlings, and JoAnne 

Stanosz and Lea Gardiner for technical assistance. The attendance of Oscar 

Santamaría to the meeting was co-funded by the regional government of 

Extremadura (Consejería de Economía, Comercio e Innovación de la Junta de 

Extremadura) and by the European Regional Development Fund (ERDF). 

5. REFERENCES 

Adams, P.B., 1990. The potential of mycoparasites for biological control of plant diseases. Annual 

Review of Phytopathology 28, 59-72. 

Barklund, P., Unestam, T., 1988. Infection experiments with Gremmeniella abietina on seedlings of 

Norway spruce and Scots pine. European Journal of Forest Pathology 18, 409-420. 

Bills, G.F., 1996. Isolation and analysis of endophytic fungal communities from woody plants. In: 

Redlin, S.C., Carris, L.M. (Eds.) Endophytic fungi in grasses and woody plants: 

systematics, ecology and evolution. APS Press, Saint Paul, Minnesota. pp. 31-65. 

Bills, G.F., Dombrowski, A.W., Horn, W.S., Jansson, R.K., Rattray, M., Schmatz, D., Schwartz, R.E., 

2002. Rosellinia subiculata ATCC 74386 and fungus ATCC 74387 for producing sordarin 

compounds for fungi control. Merck & Co., Inc. Rahway, NJ (USA). Patent no 6436395. 

http://www.freepatentsonline.com/6436395.html 

Blodgett, J.T., Bonello, P., 2003. The aggressiveness of Sphaeropsis sapinea on Austrian pine varies 

with isolate group and site of infection. Forest Pathology 33, 15-19. 

Blodgett, J.T., Stanosz, G.R., 1997. Sphaeropsis sapinea morphotypes differ in aggressiveness, but 

both infect nonwounded red or jack pines. Plant Disease 81, 143-147. 

Blodgett, J.T., Stanosz, G. R, 1999. Differences in aggressiveness of Sphaeropsis sapinea RAPD 

marker group isolates on several conifers. Plant Disease 83, 853-856. 

Blodgett, J.T., Eyles, A., Bonello, P., 2007. Organ-dependent induction of systemic resistance and 

systemic susceptibility in Pinus nigra inoculated with Sphaeropsis sapinea and Diplodia 

scrobiculata. Tree Physiology 27, 511-517. 

Bonello, P., Gordon, T.R., Storer, A.J., 2001. Systemic induced resistance in Monterey pine. Forest 

Pathology 31, 99-106. 

Burguess, T., Wingfield, M. J., 2001. Simple sequence repeat markers distinguish among 

morphotypes of Sphaeropsis sapinea. Applied and Environmental Microbiology 67, 354- 

362. 

Cabras, A., Mannoni, M.A., Serra, S., Andolfi, A., Fiore, M., Evidente. A., 2006. Occurence, 

isolation and biological activity of phytotoxic metabolites produced in vitro by 

Sphaeropsis sapinea, pathogenic fungus of Pinus radiata. European Journal of Plant 

Pathology 115, 187-193. 

82


Campanile, G., Ruscelli, A., Luisi, N., 2007. Antagonistic activity of endophytic fungi towards 

Diplodia corticola assessed by in vitro and in planta tests. European Journal of Plant 

Pathology 117, 237-246. 

Chet, I., Benhamou, N., Haran, S., 1998. Mycoparasitism and lytic enzymes. In: Harman, G.E., 

Kubicek, C.P. (Eds.). Trichoderma and Gliocladium, vol. 2. Taylor & Francis, London, 

pp. 153–171. 

Davison, E.M., Tay, F.C.S., Peroni, D., 1991. Sphaeropsis sapinea on pines in Western Australia. 

Australasian Plant Pathology 20, 31. 

de Wet, J., Burgess, T., Slippers, B., Preisig, O., Wingfield, B.D., Winfield, M.J., et al., 2000. 

Characterization of Sphaeropsis sapinea isolates from South Africa, Mexico and 

Indonesia. Plant disease 84, 151-156. 

de Wet, J., Burgess, T., Slippers, B., Preisig, O., Wingfield, B. D., Winfield, M.J., et al., 2003. 

Multiple gene genealogies and microsatellite markers reflect relationships between 

morphotypes of Sphaeropsis sapinea and distinguish a new species of Diplodia. 

Mycological Research 107, 557-566. 

Flowers, J., Hartman, J., Vaillancourt, L., 2003. Detection of latent Sphaeropsis sapinea infection in 

Austrian pine tissues using Nested-Polymerase Chain Reaction. Phytopathology 93, 1471- 

1477. 

Flowers, J., Nuckles, E., Hartman, J., Vaillancourt, L., 2001. Latent infection of Austrian and Scots 

pine tissues by Sphaeropsis sapinea. Plant Disease 85, 1107-1112. 

Gibson, I.A.S., 1979. Diseases of Forest Trees Widely Planted as Exotics in the Tropic and Southern 

Hemisphere. Part II. The Genus Pinus. Commonwealth Mycological Institute, Kew, Eng. 

Gilbertson, R.L., Rojas, M.R., Russell, D.R., Maxwell, D.P., 1991. Use of the asymmetric polymerase 

chain reaction and DNA sequencing to determine genetic variability of bean golden 

mosaic geminivirus in the Dominican Republic. Journal of General Virology 72, 2843- 

2848. 

Holdenrieder, O., Greig, B.J., 1998. Biological methods of control. In: Woodward, S., Stenlid, J., 

KarjalaineN, R., Hüttermann, A.; Heterobasidium annosum: Biology, Ecology, Impact 

and Control. Oxon, UK. CAB International, pp. 235-258. 

Knudsen, G.R., Eschen, D.J., Dandurand, L.M., Bin, L., 1991. Potential for biocontrol of Sclerotinia 

sclerotiorum through colonization of sclerotia by Trichoderma harzianum. Plant Disease 

75, 466-470. 

Luchi, N., Ma, R., Capretti, P., Bonello, P., 2005. Systemic induction of traumatic resin ducts and 

resin flow in Austrian pine by wounding and inoculation with Sphaeropsis sapinea and 

Diplodia scrobiculata. Planta 221, 75-84. 

Maresi, G., Luchi, N., Pinzani, P., Pazzagli, M., Capretti, P., 2007. Detection of Diplodia pinea in 

asymptomatic pine shoots and its relation to the Normalized Insolation index. Forest 

Pathology 37, 272-280. 

Mehrotra, R., Aneja, K., Gupta, A., Aggerwal, A., 1988. Fungi-agents of biological control. In: 

Mukerji, K. G.; Garg, K. L. Biocontrol of plant diseases. Vol. 1. CRC Press, Boca Raton, 

Fla., pp. 37-52. 

Morelet, P.M., Chandelier, P., 1993. Sur un cas de variabilité chez Sphaeropsis sapinea. European 

Journal of Forest Pathology 23, 317-320. 

Mousseaux, M.R., Dumroese, R.K., James, R.L., Wenny, D.L., Knudsen, G.R., 1998: Efficacy of 

Trichoderma harzianum as a biological control of Fusarium oxysporum in containergrown 

Douglas-fir seedlings. New Forests 15, 11-21. 

83


Muñoz, Z., Moret, A., Garcés, S., 2008. The use of Verticillum dahliae and Diplodia scrobiculata to 

induce resistance in Pinus halepensis against Diplodia pinea infection. European Journal 

of Plant Pathology 120, 331-337. 

Nicholls, T.H., Ostry, M.E., 1990. Sphaeropsis sapinea cankers on stressed red and jack pines in 

Minnesota and Wisconsin. Plant Dis. 74, 54-56. 

Palmer, M.A., 1991. Isolate types of Sphaeropsis sapinea associated with main stem cankers and topkill 

of Pinus resinosa in Minnesota and Wisconsin. Plant Disease 75, 507-510. 

Palmer, M.A., Stewart, E.L., Wingfield, M.J., 1987. Variation among isolates of Sphaeropsis sapinea 

in the North Central United States. Phytopathology 77, 944-948. 

Ranta, H., Neuvonen, S., Ylimartimo, A., 1995. Interactions of Gremmeniella abietina and 

endophytic fungi in shoots of Scots pine trees treated with simulated acid rain. Journal of 

Applied Ecology 32, 67-75. 

Roy, G., Bussières, G., Laflamme, G., Dessureault, M., 2001. In vitro inhibition of Heterobasidion 

annosum by Phaeotheca dimorphospora. Forest Pathology 31, 395-404. 

Schubert, M., Fink, S., Schwarze, F.W.M.R., 2008. Evaluation of Trichoderma spp. as a biocontrol 

agent against wood decay fungi in urban trees. Biological Control 45, 111–123. 

Schulz, B., Boyle, C., Draeger, S., Römmert, A. –K.; Krohn, K., 2002. Endophytic fungi: a source of 

novel biologically active secondary metabolites. Mycological Research 106, 996-1004. 

Smith, D.R.; Stanosz, G.R., 1995. Confirmation of two distinct populations of Sphaeropsis sapinea in 

the north central United States using RAPDs. Phytopathology 85, 699-704. 

Smith, D.R., Stanosz, G.R., 2006. A species-specific PCR assay for detection of Diplodia pinea and 


307-313. 

Smith, H., Wingfield, M.J., Coutinho, T.A., 2002. The role of latent Sphaeropsis sapinea infections in 

post-hail associated dieback of Pinus patula. Forest Ecology and Management 164, 177- 

184. 

Stanosz, G.R., Cummings-Carlson, J., 1996. Association of mortality of recently planted seedlings 

and established saplings in red pine plantations with Sphaeropsis collar rot. Plant Dis. 80, 

750-753. 

Stanosz, G.R., Smith, D.R., Albers, J.S., 2005. Surveys for asymptomatic persistence of Sphaeropsis 

sapinea on or in stems of red pine seedlings from seven Great Lakes region nurseries. 

Forest Pathology 35, 233-244. 

Stanosz, G.R., Smith, D.R., Leisso, R., 2007. Diplodia shoot blight and asymptomatic persistence of 

Diplodia pinea on or in stems of jack pine nursery seedlings. Forest Pathology 37, 145- 

154. 

Stanosz, G.R., Smith, D.R., Guthmiller, M.A., Stanosz, J.C., 1997. Persistence of Sphaeropsis 

sapinea on or in asymptomatic shoots of red and jack pines. Mycologia 89, 525-530. 

Tan, R.X., Zou, W.X., 2001. Endophytes: a rich source of functional metabolitos. Natural Products 

Rep. 18, 448-459. 

Weindling, R., 1932. Trichoderma lignorum as a parasite of other soil fungi. Phytopathology 22, 837– 

845. 

84



ADELGID GALLS ON SPRUCE AS A RESERVOIR INOCULUM 

SOURCE FOR THE SHOOT BLIGHT PATHOGEN Diplodia pinea 

Glen R. STANOSZ 1*, Denise R. SMITH 1 , S. ZHOU 2 

1 Department of Plant Pathology and 2 Genomics Center of Wisconsin, University of Wisconsin- 

Madison, WI, 53706, USA 

ABSTRACT 

* grs@plantpath.wisc.edu 

Diplodia pinea is a shoot blight and canker pathogen of many conifers and sporulates 

on killed needles, stems, and mature, opened seed cones. Although Colorado blue spruce 

(Picea pungens) is an atypical host, pycnidia of this fungus were observed on galls induced 

by the Cooley spruce gall adelgid (Adelges cooleyi). The elongate, cone-like galls that 

form on ends of shoots as a result of feeding by nymphs of this insect normally do not 

seriously impact tree health, but they can be considered unsightly. A survey was conducted 

to determine the incidence and abundance of inoculum of D. pinea that could be obtained 

from these galls on an otherwise healthy, ornamental Colorado blue spruce in Madison, WI, 

USA. Ten arbitrarily selected galls were collected from one branch at each of four 

directions in the top, middle, and bottom thirds of the tree crown (120 galls total). A 

washing and filtration technique was used to determine presence and estimate the numbers 

of conidia extracted from these galls, and species-specific PCR primers were used to 

confirm the identity of the pathogen. Conidia were obtained from each gall, but the number 

of spores varied greatly from gall to gall. Some galls yielded few spores, a result that 

suggests these conidia may have been produced elsewhere. In contrast, many thousands of 

spores were obtained from galls on which pycnidia were abundant. Thus, in the absence of 

usual host trees, insect-altered organs of an atypical host can be an alternative substrate for 

this pathogen and a reservoir inoculum source of D. pinea. 

Keywords: spruce, Picea, gall, Adelges, Diplodia, inoculum 


Elongate, cone-like galls form on ends of shoots of several Picea A. Dietr. 

species as a result of feeding by nymphs of the Cooley spruce gall adelgid (Adelges 

cooleyi Gillette) (Cumming, 1959; USDA Forest Service, 1985). This insect is 

native to North America and transcontinental in distribution. Primary hosts include 

Colorado blue spruce (P. pungens Engelm.), Englemann spruce (P. englemannii 

Parry ex Englem.), Sitka spruce (P. sitchensis (Bong.) Carrière), and white spruce 

(P. glauca (Moench) Voss. Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) is 

an alternate host. Similar galls are induced by the eastern spruce gall adelgid 

(Adelges abietis L.), which was introduced from Europe and is now found in 

85


eastern North America on native spruce species and on Norway spruce (Picea 

abies (L.) H. Karst). Although sometimes numerous, these galls normally do not 

seriously impact spruce health. They are, however, considered unsightly on trees 

grown as ornamentals or as Christmas trees. 

Although a single host species can support multiple generations of the Cooley 

spruce gall adelgid, its complex life cycle normally involves alternation between 

spruce and Douglas-fir hosts. The life history of this insect has been described in 

detail by Cumming (1959) and summarized by the USDA Forest Service (1985). 

Immature females overwinter as nymphs on the most recent year’s twigs of spruce. 

After emergence and maturation in spring, the “stem-mother” deposits up to 350 

eggs covered by a mass of white, waxy secretion. Eggs hatch in 1 to 2 weeks, and 

nymphs feed at bases of new needles on the elongating shoots. Young, green to 

purple, fleshy galls develop rapidly, elongating (up to 75 mm) and expanding in 

girth (up to 18 mm) to enclose the feeding nymphs. By late summer galls open to 

allow nymphs to move to needles where they molt into winged adults that fly to 

Douglas-fir. On Douglas-fir the adelgid is able to reproduce parthenogenically and 

sexually, overwinter as nymphs, and develop a winged stage that returns to spruce. 

Although feeding occurs on Douglas-fir, galls similar to those on spruce are not 

produced on this host. 

Diplodia pinea (Desmaz.) J. Kickx fil. (syn. Sphaeropsis sapinea) is a widely 

distributed, asexual fungal pathogen of conifers in native forests and where 

planted as exotics (Punithalingam and Waterston, 1970). Reports of severe 

damage caused by D. pinea most frequently involve pines (Pinus species), 

especially two- and three-needled pines of the subgenus Diploxylon. However, the 

fungus occasionally has been reported from spruce hosts or substrates (Farr et al., 

1989; Punithalingham and Waterston, 1970). Rain-splashed conidia of D. pinea 

can be dispersed throughout the growing season (Palmer et al., 1988) and 

germinate quickly followed by penetration directly (Brookhouser and Peterson, 

1971; Chou, 1978) or through wounds. Disease may develop rapidly, or D. pinea 

may persist on or in asymptomatic hosts (Stanosz et al., 2005) with subsequent 

proliferation to cause disease under conditions that induce host stress (Stanosz et 

al., 2001). Damage includes seed rot and seedling collar rot, shoot blight, branch 

and bole cankers, crown wilt, and blue stain of sapwood (Chou, 1976; Chou, 1987; 

Palmer, 1991; Rees and Webber, 1988; Stanosz and Cummings Carlson, 1996). 

Diplodia pinea is frequently found sporulating on needles and stems it has killed, 

and also on mature, opened seed cones (Waterman, 1943; Peterson, 1977). 

Close examination of galls of the Cooley spruce gall adelgid from an 

ornamental Colorado blue spruce revealed presence of pycnidia on the galls (and 

attached needles) (Figure 1) that yielded D. pinea conidia. The objective of this 

study was to examine the frequency of occurrence and amount of potential 

inoculum of this pathogen from galls induced by the Cooley spruce gall adelgid. 

Procedures used were modified from those developed by Munck and Stanosz 

(2009) for water extraction of conidia from seed cones of pines. 

86


Figure 1: Abundant pycnidia of Diplodia pinea on a gall induced by the Cooley spruce 

gall adelgid. 


Galls were collected in summer from a single mature Colorado blue spruce tree 

(approximately 12 m tall) growing as an ornamental on the University of 

Wisconsin-Madison campus (43.07 N, 89.40 W). Shoots on this tree did not 

exhibit symptoms attributable to D. pinea. Two ornamental Austrian pines (Pinus 

nigra Arnold) that were damaged by shoot blight and bore D. pinea pycnidia on 

shoots and cones were located within approximately 20 m. The galls that were 

collected had matured to release nymphs the previous year and were dead. Ten 

arbitrarily selected galls were collected from one branch at each of the four 

cardinal directions in the top, middle, and bottom thirds of the tree crown (120 

galls total). Galls were bagged separately and frozen until extraction of conidia. 

Galls were processed individually using procedures similar to those described 

for pine cones by Munck and Stanosz (2009). Each gall was placed in a 100 ml 

plastic beaker containing 50 ml of distilled water with 2 drops of Tween 80 l -1 

(Fisher Scientific Company, Fair Lawn, NJ) and washed for 3 h on a rotary shaker 

at 110 rpm. The resulting suspension was then filtered through 0.8 µm pore size 

filters printed with a grid to delineate 3 mm x 3 mm squares (Cat. No.: 

AAWG047SP, Millipore Corporation, Billerica, MA). The cup with the gall then 

was rinsed with an additional 50 ml of distilled water with Tween and this liquid 

87


also was filtered. The filter for each gall was examined with the aid of a microscope 

for presence or absence of conidia recognized as those of D. pinea based on 

morphological characteristics. For three randomly selected galls from each branch, 

conidia were counted in five compound microscope fields randomly located within the 

filtered area at magnifications of 40 to 200x. Lower magnification was used for filters 

with relatively few conidia and higher magnification (i.e., smaller fields) was used for 

filters with many conidia. The number of conidia in five fields was multiplied by 

respective factors to adjust for total filtered area. Galls were then oven dried and 

weighed to also allow expression of conidial numbers on the basis of oven dry weight 

(odw). 

To confirm pathogen identity, 12 filters (corresponding to four galls from each third 

of the tree crown) on which numerous conidia had been deposited were selected. A 

piece of the filter approximately 5 mm x 5 mm was excised and placed in a 

microcentrifuge tube. This was ground and then DNA was directly extracted using 

methods described by Smith and Stanosz (1995). DNA was amplified using speciesspecific 

primers developed by Smith and Stanosz (2006) that allow differentiation of 

D. pinea from the similar conifer pathogen D. scrobiculata. 


Every gall yielded conidia morphologically consistent with those of D. pinea, 

although the estimated numbers of conidia obtained varied widely. The range per gall 

was from 176 to 1,099,695 (mean = 249,599, standard error = 57,756). The range per 

gram odw was from 169 to 3,447,320 (mean = 462,691, standard error = 120,975). 

The numbers of galls categorized according to the estimated numbers of conidia 

extracted from each (for the 36 for which conidia were quantified) are displayed in 

Figure 2. For the majority of galls, this number was >10 4 conidia on both per gall and 

per gram odw bases. 

Figure 2: Numbers of Cooley spruce gall adelgid galls categorized by the 

estimated number of conidia extracted per gall. 

88


The identity of the pathogen was confirmed as D. pinea. Eleven of the 12 filters 

that were tested were positive for this fungus. The test of one filter produced no 

result. No filters tested positive for D. scrobiculata. 

The estimated numbers of conidia extracted from galls (when expressed on the 

per gram odw basis) often were within the range or even greater than numbers 

reported by Munck and Stanosz (2009) for pine cones. In that study, cones from 

which D. pinea (or less frequently D. scrobiculata) were cultured were collected 

from the crowns of red pines (P. resinosa Aiton) and jack pines (P. banksiana 

Lamb.) in which typical shoot blight symptoms were not apparent. The greatest 

mean number of conidia extracted per gram odw for any of these locations was 

23,181, for cones from red pine crowns. The large numbers of conidia obtained 

from Cooley spruce gall adelgid galls indicate that, at least in this case, inoculum 

production by D. pinea is not limited by its exploitation of an atypical host as 

substrate. 

Previous researchers have noted a diversity of relationships between D. pinea 

and insects or host material altered by insects. Epidemics characterized by severe 

damage to Scots pine (P. sylvestris L.) in Ontario was associated with injuries 

resulting from feeding of the pine spittle-bug (Aphrophora parallela Say) (Haddow 

and Newman, 1942). In contrast, Feci et al. (2003) found D. pinea only 

infrequently on red pine shoots damaged by insects, primarily the red pine shoot 

moth Dioryctria resinosella Mutuura. Other studies provide evidence that the cone 

bug Gastrodes grossipes De Geer has a role in movement of this fungus to cones of 

Austrian pine (Feci et al., 2002) and support the conclusion that the bark beetle Ips 

pini (Say) may vector D. pinea (Whitehill et al., 2007). 

Researchers also have noted a previous relationship between an apparent 

disease and adelgid galls on spruce. Audley and Skelly (1994) noted the 

occurrence of necrotic twigs of red spruce (Picea rubens Sargent) that bore galls of 

the eastern spruce gall adelgid. A Phomopis Harter species was isolated from 14 of 

33 dying, adelgid-galled twigs. This fungus was used to inoculate seedlings, and 

produced cankers in 29% of the attempts. 

Documentaton of the sporulation of D. pinea on insect altered, necrotic spruce 

tissues does not clarify the potential confusion about the ability of this fungus to 

infect and kill normal spruce shoots under natural conditions. Although spruces 

are included on lists of trees on which D. pinea has been reported (Farr et al., 1989; 

Punithalingam and Waterston, 1970) such sources do not provide details necessary 

to know if the fungus was causing disease or merely was present saprophytically. 

Interpretation of reports of D. pinea from spruces is further complicated by current 

knowledge that past references to D. pinea sensu lato may have referred to either of 

two species (i.e., D. pinea or the similar fungus D. scrobiculata that was described 

by deWet et al., 2003). For example, Myren (1991) attributed killing of stems and 

branches of stressed black spruce (P. mariana (Mill.) B. S. P.) in an Ontario seed 

orchard to D. pinea (as S. sapinea). However, isolates later collected from black 

spruces at that seed orchard and each of four other Ontario seed orchards all were 

89


proven to be D. scrobiculata (Hausner et al., 1999). Blodgett and Stanosz (1999) 

did demonstrate the ability of well-characterized isolates of D. pinea and D. 

scrobiculata to kill shoots of small, potted Colorado blue spruce seedlings 

following wounding and inoculation in a greenhouse experiment. But the relative 

lack of reports of damage to spruces, even when grown in the same locations where 

more susceptible species are attacked (e.g., red pine in the Great Lakes region of 

the USA) suggests that spruce species are infrequent hosts, or perhaps not often 

severely damaged by D. pinea. Unambiguous identification of the Diplodia 

species associated with disease symptoms of spruces should allow a better 

understanding of the relationships between these fungi and Picea species. 

Regardless of possible ambiguity in the status of D. pinea as a potential 

pathogen of spruce, galls of the Cooley spruce gall adelgid serve as a substrate. 

The production of a very large number of conidia on any individual gall is 

magnified by the potential for a single spruce crown to bear many hundreds of 

galls. This utilization of galls by D. pinea to produce very large numbers of 

conidia confirms that, in the absence of normal disease development, altered 

tissues on an atypical host tree species can be a potentially significant reservoir 

inoculum source for this pathogen. 

4. ACKNOWLEDGMENTS 

The authors thank Erin Brooks for collecting the galls used in this study, and 

with Mary Lynn Stanosz, for assistance examining galls in the laboratory. 

5. REFERENCES 

Audley, D. E., Skelly, J. M., 1994. A Phomopsis species associated with nonlethal adelgid galls on 

upper crown branchlets of red spruce in West Virginia. Plant Disease 78, 569-571. 

Blodgett, J. T., Stanosz, G. R., 1999. Differences in aggressiveness of Sphaeropsis sapinea RAPD 

marker group isolates on several conifers. Plant Disease 83, 853-856. 

Brookhouser, L. W., Peterson, G. W., 1971. Infection of Austrian, Scots, and ponderosa pines by 

Diplodia pinea. Phytopathology 61, 409-414. 

Chou, C. K. S., 1976. A shoot dieback in Pinus radiata caused by Diplodia pinea. I. Symptoms, 

disease development, and isolation of the pathogen. New Zealand Journal of Forest 

Science 6, 72-79. 

Chou, C. K. S., 1978. Penetration of young stems of Pinus radiata by Diplodia pinea. Physiological 

Plant Pathology 12, 189-192. 

Chou, C. K. S., 1987. Crown wilt of Pinus radiata associated with Diplodia pinea infection of 

woody stems. European Journal of Forest Pathology 17, 398-411. 

Cumming, M. E. P., 1959. The biology of Adelges cooleyi (Gill.) (Homoptera: Phylloxeridae). 

Canadian Entomologist 91, 601-617. 

90


de Wet, J. T., Burgess, T., Slippers, B., Preisig, O., Wingfield, B. D., Wingfield, M. J., 2003. 

Multiple gene genealogies and microsatellite markers reflect relationships between 

morphotypes of Sphaeropsis sapinea and distinguish a new species of Diplodia. 

Mycological Research 107, 557-566. 

Farr, D., Bills, G., Chamuris, G., Rossman, A., 1989. Fungi on Plants and Plant Products in the 

United States. APS Press, St. Paul. 1252 pp. 

Feci, E., Battisti, A., Capretti, P., Tegli, S., 2002. An association between the fungus Sphaeropsis 

sapinea and the cone bug Gastrodes grossipes in cones of Pinus nigra in Italy. Forest 

Pathology 32, 241-247. 

Feci, E., Smith, D., Stanosz, G. R., 2003. Association of Sphaeropsis sapinea with insect-damaged 

red pine shoots and cones. Forest Pathology 33, 7-13. 

Haddow, W. R., and Newman, F. S., 1942. A disease of the Scots pine (Pinus sylvestris L.) caused 

by the fungus Diplodia pinea Kickx associated with the pine spittle-bug (Aphrophora 

parallela Say.). Transactions of the Royal Canadian Institute 24 (Part 1), 1-18. 

Hausner, G., Hopkin, A. A., Davis, C. N., Reid, J., 1999. Variation in culture and rDNA among 

isolates of Sphaeropsis sapinea from Ontario and Manitoba. Canadian Journal of Plant 

Pathology 21, 256-264. 

Munck, I., and Stanosz, G., 2009. Quantification of conidia of Diplodia spp. extracted from red and 

jack pine cones. Plant Disease 93, 81-86. 

Myren, D. T., 1991. Sphaeropsis sapinea on black spruce in Ontario. Plant Disease 75, 664. 

Palmer, M. A., McRoberts, R. E., Nicholls, T. H., 1988. Sources of inoculum of Sphaeropsis sapinea 

in forest tree nurseries. Phytopathology 78, 831-835. 

Palmer, M. A., 1991. Isolate types of Sphaeropsis sapinea associated with main stem cankers and 

top-kill of Pinus resinosa in Minnesota and Wisconsin. Plant Disease 75, 507-510. 

Peterson, G. W., 1977. Infection, epidemiology, and control of Diplodia blight of Austrian, 

ponderosa, and Scots pines. Phytopathology 67, 511-514. 

Punithalingam, E., Waterston, J. M., 1970: Diplodia pinea. No. 273 in: Descriptions of Pathogenic 

Fungi and Bacteria, Commonwealth Mycological Institute, Kew, Surrey, England. 

Rees, A. A., Webber, J. F., 1988. Pathogenicity of Sphaeropsis sapinea to seed, seedlings, and 

saplings of some central American pines. Transactions of the British Mycological Society 

91, 273-277. 

Smith, D. R., Stanosz, G. R., 1995. Confirmation of two distinct populations of Sphaeropsis sapinea 

in the north central United States using RAPDs. Phytopathology 85, 699-704. 

Smith, D. R., Stanosz, G. R., 2006. A species-specific PCR assay for detection of Diplodia pinea and 


307-313. 

Stanosz, G. R., Cummings Carlson, J., 1996. Association of mortality of recently planted seedlings 

and established saplings in red pine plantations with Sphaeropsis collar rot. Plant Disease 

80, 750-753. 

Stanosz, G. R., Blodgett , J. T., Smith, D. R., Kruger, E. L., 2001. Water stress and Sphaeropsis 

sapinea as a latent pathogen of red pine seedlings. New Phytologist 149, 531-538. 

Stanosz, G. R., Smith, D. R., Albers, J. S., 2005. Surveys for asymptomatic persistence of 

Sphaeropsis sapinea on or in stems of red pine seedlings from seven Great Lakes region 

nurseries. Forest Pathology 35, 233-244. 

91


USDA Forest Service, 1985. Insects of Eastern Forests. Misc. Publ. 1426. Washington, D.C. 608 

pp. 

Waterman, A. M., 1943. Diplodia pinea, the cause of a disease of hard pines. Phytopathology 33, 

1018-1031. 

Whitehill, J. G. A., Lehman, J. S., and Bonello, P., 2007. Ips pini (Curculionidae: Scolytinae) is a 

vector of the fungal pathogen, Sphaeropsis sapinea (Coelomycetes), to Austrian pines, 

Pinus nigra (Pinaceae). Environmental Entomology 36, 114-120. 

92

Dieback And Canker Diseases 

93


94

Dieback Diseases 

95


96



THE CURRENT SITUATION OF ASH DIEBACK CAUSED BY 

Chalara fraxinea IN AUSTRIA 

Thomas Kirisits 1* , Michaela Matlakova 1 , Susanne Mottinger-Kroupa 1 , 

Thomas L. Cech 2 , Erhard Halmschlager 1 

1* Institute of Forest Entomology, Forest Pathology and Forest Protection (IFFF), Department of 

Forest and Soil Science, University of Natural Resources and Applied Life Sciences, Vienna 

(BOKU)Hasenauerstraße 38, A-1190 Vienna, Austria; 2 Federal Research and Training Centre for 

Forests, Natural Hazards and Landscape (BFW), Department of Forest Protection, Seckendorff- 

Gudent-Weg 8, A-1131 Vienna, Austria 

ABSTRACT 

*thomas.kirisits@boku.ac.at 

In many parts of Europe common ash, Fraxinus excelsior, is presently affected by a 

serious dieback of shoots, twigs and branches, causing decline and mortality of trees of all 

age classes. Initially thought to be primarily incited by abiotic damaging factors, 

accumulating evidence suggests that ash dieback is a new infectious disease caused by the 

hyphomycete Chalara fraxinea and its teleomorphic state, Hymenoscyphus albidus. In 

Austria, ash dieback was first observed in 2005 and in 2008 it occurred in all Austrian 

provinces. In heavily affected forests mortality is common amongst saplings and young 

trees. Moreover, in some areas dying of mature trees has started to occur. Chalara fraxinea 

was for the first time recorded in Austria in June 2007. Subsequent surveys have shown that 

the pathogen is widespread in the country. Until June 2009 it was isolated from 

symptomatic ash trees at 82 localities in eigth out of the nine Austrian provinces. Apart 

from F. excelsior, C. fraxinea was isolated from narrow-leaved ash, F. angustifolia subsp. 

danubialisand from weeping ash, F. excelsior ‘Pendula’. Chalara fraxinea was consistently 

isolated at high frequencies from ash shoots, twigs and stems showing early symptoms of 

disease. In inoculation experiments using potted F excelsior and F. angustifolia seedlings, 

Kochs postulates were fulfilled for C. fraxinea, clearly suggesting that this fungus is the 

primary causal agent of ash dieback. It also displayed pathogenicity to Fraxinus ornus 

seedlings. Besides reviewing the situation of ash dieback in Austria and summarizing the 

results of some of our research since 2007, we generally review the knowledge on this 

emerging disease in Europe, describe its symptoms, present a hypothetic disease cycle for 

ash dieback and discuss options for disease management. 

Keywords: Hymenoscyphus albidus, Fraxinus excelsior, Fraxinus angustifolia subsp. 

danubialis, emerging disease, fungal disease, new forest health problem 

97



Since the early 1990s common ash, Fraxinus excelsior, has been affected by an 

unprecedented, serious dieback of shoots, twigs and branches, causing decline and 

mortality of trees of all age classes. Ash dieback was first noticed around 1992 in 

Poland (Kowalski and Holdenrieder, 2008), where it has been causing serious 

damage (Przybył, 2002; Kowalski, 2006; Kowalski and Holdenrieder, 2008). It was 

subsequently recorded in many other European countries and threatens common 

ash in large parts of its distribution range. By 2009 ash dieback has been reported 

to occur in Lithuania (Lygis et al., 2005), Latvia (T. Gaitnieks, personal 

communication), Estonia (M. Hanso and R. Drenkhan, personal communication), 

area Kaliningrad (Russia, R. Vasaitis, personal communication), Danmark 

(Thomsen et al., 2007; Skovsgaard et al., 2009), Sweden (Bakys et al., 2009a; 

2009b), Norway (Talgø et al., 2009), Finland (J. Hantula, personal 

communication), Germany (Schumacher et al., 2007), Slovakia (A. Kunca, 

personal communication), Czech Republic (Jankovský et al., 2008), Austria (Cech, 

2006b; Halmschlager and Kirisits, 2008; Kirisits et al., 2008a; 2008b; 2009), 

Hungary (Szabó, 2008), Slovenia (Ogris et al., 2009), Rumania (D. Chira, personal 

communication), Switzerland (Engesser et al., 2009) and eastern France 

(Chandelier et al., 2009; Ioos et al., 2009) It can be expected that this emerging 

forest health problem will in the future also occur in other parts of Europe, where it 

has thus-far not been found. 

Initially, ash dieback was suspected to be primarily incited by abiotic damaging 

factors (frost, drought and abrupt changes of periods with warm and cold weather 

conditions), with secondary, weakly virulent fungal pathogens and endophytes 

contributing to the syndrome (Przybył, 2002; Pukacki and Przybyl, 2005; Cech, 

2006b; Cech et al., 2007). This view changed with the discovery and description of 

the anamorphic fungus Chalara fraxinea that was in Poland frequently isolated 

from shoots in the early phase of the pathological process (Kowalski, 2006). In the 

meanwhile, C. fraxinea has been detected in many of the above mentioned 

countries and accumulating evidence suggests that it is the cause of ash dieback 

(Schumacher et al., 2007; Halmschlager and Kirisits, 2008; Szabó, 2008; Kowalski 

and Holdenrieder, 2009a; Talgø et al., 2009; Bakys et al., 2009a; 2009b; Engesser 

et al., 2009; Ogris et al., 2009; Kirisits et al. 2009; Chandelier et al., 2009; Ioos et 

al., 2009). 

Because of the sudden appearance, the rapid spread and the high intensity of ash 

dieback, C. fraxinea was thought by some forest pathologists to be an alien 

invasive organism (Halmschlager and Kirisits, 2008; Kirisits and Halmschlager, 

2008; Kowalski and Holdenrieder, 2008; Ogris et al., 2009). However, 

Hymenoscyphus albidus, a discomycete native to Europe has recently been 

identified as the teleomorph of C. fraxinea (Kowalski and Holdenrieder, 2009b). 

This ascomycete fungus has been known since 1850 as harmless decomposer of 

leaf rachises (referred to as leaf petioles by Kowalski and Holdenrieder [2009b] but 

we think that ‘leaf rachis’ is the more appropriate botanical term) of common ash 

98


and it is unknown, why this fungus suddenly causes a serious, emerging disease on 

F. excelsior (Kowalski and Holdenrieder, 2009b). Kowalski and Holdenrieder 

(2009b) proposed that the fungus they assigned to the morphospecies H. albidus 

may have undergone genetic change by mutation or hybridization with an unknown 

introduced species. Another possibility is that the teleomorph of C. fraxinea is not 

the ‘original’ H. albidus, but an exotic invasive species, that is morphologically 

virtually identical to H. albidus. Finally, the fungus may show unprecedented 

aggressiveness towards ash because of environmental factors or/and weather 

extremes, that could either have predisposed the host trees to fungal attack or 

provided ideal conditions for fungal infections (Kowalski and Holdenrieder, 

2009b). These three theories are the conceptual basis for future research regarding 

the question what triggered the epidemic of H. albidus and its anamorphic state C. 

fraxinea. 

Ash dieback is presently amongst the most important forest health problems in 

Austria. Here we review the situation of this emerging disease in this Central 

European country. We also summarize some research that has been conducted 

since 2007, present a hypotheticAL disease cycle for ash dieback and discuss 

options for disease management. 

2. ASH SPECIES IN AUSTRIA 

Three ash species are native in Austria including common ash, Fraxinus 

excelsior, also known as European ash, narrow-leaved ash, F. angustifolia subsp. 

danubialis and flowering ash, F. ornus (Adler et al., 1994). While European ash is 

widespread on appropriate sites in many parts of the country (Schadauer, 1994), the 

two other species are at the edge of their distribution ranges in Austria and are thus 

rare (Adler et al., 1994; Zukrigl, 1997). 

With a share of 2.5% (based on the number of trees) and 1.8% (based on the 

growing stock) ash species are the third most frequent group of hardwood species 

in managed forests in Austria (Table 1). All three species are included in the 

relative proportions reported in Table 1, but the vast majority of the share of 

Fraxinus spp. refers to F. excelsior. Based on the growing stock only European 

beech (Fagus sylvatica) and oak species (mainly Quercus petraea and Quercus 

robur) occur more frequently than Fraxinus spp. and based on the number of trees 

F. sylvatica dominates amongst hardwood species, while European hornbeam 

(Carpinus betulus) is slightly more frequent than ash. The share of ash in the nine 

Austrian provinces is shown in Table 1. Ash is particularly abundant in the 

provinces Upper Austria, Lower Austria, Vorarlberg and Vienna and occurs least 

frequently in the province Tyrol that is to a large extent located in areas of the Alps 

that are inappropriate for the growth of F. excelsior. 

99


Table 1: Share (%) of ash, based on number of trees and based on growing stock in 

managed forests in the nine Austrian provinces and in entire Austria. The data include all 

three ash species native in Austria, but the vast majority is F. excelsior, while the 

proportions of F. angustifolia and F. ornus are negligible. Source: Austrian Forest 

Inventory 2000-2002, Federal Research and Training Centre for Forests, Natural Hazards 

and Landscape (BFW), Department of Forest Inventory 

(http://bfw.ac.at/rz/bfwcms.web?dok=35). 

Austrian province Based on number of trees Based on growing stock 

Burgenland 2.1 1.2 

Carinthia 1.7 1.0 

Lower Austria 3.4 2.9 

Salzburg 2.0 1.1 

Styria 1.6 1.2 

Tyrol 0.4 0.1 

Upper Austria 5.2 3.7 

Vienna 9.4 7.5 

Vorarlberg 4.6 2.2 

Austria total 2.5 1.8 

Common ash has its optimum on moist, nutrient-rich sites, but in areas with 

limestone as geological bedrock it can also occur on drier sites (Mayer, 1984). It is 

mainly found from the lowlands up to elevations of 900 m asl. (Schadauer, 1994; 

Nationalpark Kalkalpen, 2007) In the Alps it rarely occurs at elevations higher than 

1200 m asl. (Mayer, 1984; Schadauer, 1994; Nationalpark Kalkalpen, 2007). 

Fraxinus excelsior occurs in a large number of forest types. It is a characteristic 

component of floodplain forests along big rivers, forests along streams and in 

glens, but also occurs in other hardwood-dominated forests on moist and 

sometimes drier sites (Jelem, 1974; Mayer, 1974; 1984; Nationalpark Kalkalpen, 

2007). For forest owners managing riparian forests, along the Danube for example, 

common ash is usually the most economically important timber species (Jelem, 

1974). In many areas, especially on sites at lower elevations it has received much 

attention for the production of valuable timber and as an alternative to Norway 

spruce (Picea abies) (Wolf and Jasser, 2003). It is also important for various 

ecosystem services, for example stabilization of riverbanks and slopes (Mayer, 

1984). Moreover, F. excelsior is an attractive and appreciated landscape tree in the 

countryside and shade tree in urban areas. Due to its nutrient-rich foliage it was the 

most preferred tree species for lopping in the Alps, providing fresh or dry fodder 

for cattle, sheep and other domestic animals. 

Narrow-leaved ash, Fraxinus angustifolia subsp. danubialis (hereafter referred 

to just as ‘F. angustifolia’), is mainly distributed in lowland areas of south-eastern 

Europe. In eastern Austria it reaches one of its distribution limits and is therefore 

rare (Jelem, 1974; 1975; Adler et al., 1994; Zukrigl, 1997). It forms part of riparian 

forest ecosystems along the lower reaches of the rivers March, Danube, Fischa 

100


(province Lower Austria) and Leitha (provinces Lower Austria and Burgenland) 

(Jelem, 1974; 1975; Adler et al., 1994; Zukrigl, 1997). Hybrids between 

F. angustifolia and F. excelsior have been reported to occur in areas in Austria, 

where the distribution ranges of the two species overlap (Jelem, 1974; 1975). 

While it is mainly a botanical curiosity and of interest for nature conservation, this 

ash species is an economical important timber species in floodplain forests along 

the March (Jelem 1975; Damm, 1997). 

Flowering ash mainly occurs in southern and south-eastern Europe, but its 

natural distribution range just reaches southern Austria (Mayer, 1974; Adler et al., 

1994; Zukrigl, 1997). It is mainly found in southern and eastern Carinthia (Adler et 

al., 1994), where it usually occurs on steep, rocky, warm and dry sites on limestone 

(Zukrigl, 1997). Together with European hop-hornbeam, Ostrya carpinifolia, 

F ornus often forms dense bush forests on such sites (Mayer et al., 1974; Zukrigl, 

1997). Apart from Carinthia, flowering ash also occurs in other Austrian provinces 

(Eastern and Northern Tyrol, Styria, Lower Austria and Burgenland), where it is 

generally rare (Adler et al., 1994; Zukrigl, 1997). Most of the occurrences in these 

provinces are likely not native, but F. ornus has become naturalized in some areas 

(Zukrigl, 1997). This ash species has no importance for forestry in Austria, but is 

of interest for nature conservation, as it forms part of rare and ecologically valuable 

forest types. It is occasionally used as shade and ornamental tree and planted in 

shelterbelts (Zukrigl, 1974). 

Green ash (F. pennsylvanica) and white ash (F. americana), two introduced 

species from North America are occasionally planted as ornamentals (Adler et al., 

1994). Some decades ago they also received some interest as plantation trees in 

floodplain forests, but as their growth potential and timber quality did not fulfill the 

expectations of foresters they are presently no longer planted. Fraxinus 

pennsylvanica has become naturalized in some riparian areas, especially in those 

along the lower reach of the Danube and the March (Essl and Rabitsch, 2002). It is 

therefore considered as alien invasive species in Austria (Essl and Rabitsch, 2002; 

Essl et al., 2006). 

3. SYMPTOMS OF ASH DIEBACK 

The symptoms of ash dieback share characteristics of a bark disease, a vascular 

wilt disease and a leaf disease (Figure 1 and 2; Thomsen et al., 2007; Halmschlager 

and Kirisits, 2008; Kirisits et al., 2008a; 2008b; Kowalski and Holdenrieder, 2008; 

Szabó, 2008; Bakys et al., 2009b; Engesser et al, 2009; Kirisits and Cech, 2009; 

Kirisits et al., 2009; Ogris et al., 2009). Typical symptoms occur in the bark, 

phloem and wood of shoots, twigs, branches and stems as well as on leaves of ash 

trees. Necrotic lesions and wood discoloration can also extend into the roots, from 

where the fungus infects coppice sprouts, but the disease clearly starts at aboveground 

parts of the tree (Kowalski and Holdenrieder, 2008). 

101


Figure 1. A stand of common ash severely affected by shoot, twig and branch dieback 

(Laussa, Upper Austria, July 2007). 

The most obvious symptom is dieback of shoots, twigs and branches (Fig. 1). 

Shoot dieback is caused by localized necrotic lesions that initially are small, but as 

they expand they girdle the phloem and sapwood occlusion occurs, too. When 

phloem girdling and sapwood occlusion take place in winter time, shoots do not 

flush in spring, however, when they happen during the vegetation period, 

simultaneous wilting of leaves above the lesions occurs (Fig. 2A). Leaves then dry, 

turn brown to black and remain attached to the shoots for a long time. Elongated, 

often elliptical necrotic lesions and cankers in the bark are characteristic symptoms 

of ash dieback (Fig. 2B and 2C). These lesions either form around a dead side twig 

(Fig. 2B) or occur around a leaf scar (Fig. 2C). On larger shoots, twigs, branches as 

well as on younger stems, the tree often defends itself against the pathogen attack, 

at least for some time, leading to perennial cankers. 

102


Necrotic lesions and cankers are usually accompanied by brownish to grayish 

discoloration of the wood (Fig. 2D) that frequently extends longitudinally beyond 

necrotic areas in the bark. Diseased trees react with prolific formation of epicormic 

shoots and the silhouettes of heavily affected trees look tousled and distorted 

(Fig. 1). Chalara fraxinea also causes symptoms on leaves, resulting from direct 

leaf infections (Kirisits et al., 2008b; Ogris et al., 2009; Bakys et al., 2009b). These 

symptoms include brown to blackish necrotic lesions on leaf rachises and leaflet 

veins, followed by wilting of parts of the leaves distal to the necrotic lesions. Early 

leaf shedding is often a consequence of these leaf symptoms. 

4. ASH DIEBACK IN AUSTRIA 

In Austria, first unambiguous observations of ash dieback were made in 2005, 

mainly on young trees (Cech, 2006a; 2006b). From 2006 to 2007 damage levels 

increased dramatically, particularly in the provinces Lower and Upper Austria as 

well as Styria (Cech and Hoyer-Tomiczek, 2007; Hagen, 2007; Fachabteilung 

Forstwesen-Forstdirektion, 2009). In 2008 the phenomenon was widespread and 

symptoms were observed in all Austrian provinces (Kirisits et al., 2008a; Kirisits 

and Cech, 2009). 

Prior to the widespread occurrence of dieback of shoots, twigs and branches, 

early leaf shedding on ash trees, occurring already in late August and early 

September, was observed in parts of the provinces Lower and Upper Austria in 

2005 and Styria in 2006 (Cech, 2005; Hagen, 2005; Fachabteilung Forstwesen- 

Forstdirektion, 2009). In the following year, thus in 2006 in Lower and Upper 

Austria and in 2007 in Styria, ash dieback was for the first time recorded at high 

intensity (Cech, 2006b; Hagen, 2007; Fachabteilung Forstwesen-Forstdirektion, 

2009). Originally, this early shedding of F. excelsior leaves was thought to be 

caused by powdery mildews (Phyllactinia fraxini) and other microfungi (Cech, 

2005). However, as C. faxinea is now known to cause also symptoms on ash leaves 

(Thomsen et al., 2007; Bakys et al., 2009b; Kirisits and Cech, 2009; Ogris et al., 

2009), it is likely that the episodes of early leaf shedding in 2005 and 2006 were 

the first obvious indications of ash dieback. In 2008 leaf symptoms and early leaf 

shedding occurred again, for example in parts of Styria (Fachabteilung Forstwesen- 

Forstdirektion, 2009). 

Incidence and severity of ash dieback varies considerably in different parts of 

the country. It appears to be most serious in the Northern Limestone Alps in the 

provinces Lower and Upper Austria, Styria and Salzburg. Likely, there are still 

areas, where the disease does not occur, especially in parts of the Alps, where 

common ash is present at a low density (Kirisits and Cech, 2009). Apart from 

F. excelsior, dieback also occurs on narrow-leaved ash and weeping ash (Fraxinus 

excelsior ‘Pendula’), an ornamental variety of common ash (Kirisits et al., 2008a; 

2009; Kirisits and Cech, 2009). No symptoms have thus-far been observed on 

103


F. ornus as well as the exotic F. pennsylvanica and F. americana (Kirisits, 2008; 

Kirisits et al., 2008a; Kirisits and Cech, 2009). 

The disease occurs on ash trees of all ages, both on natural regeneration and 

planted trees and on the entire spectrum of sites and forest types, where ash is 

found (Cech, 2008). Ash dieback is damaging on both forest and shade trees and it 

also causes serious problems in nurseries, where rearing of healthy ash seedlings 

has become difficult, if not impossible. In heavily affected forests mortality is 

common amongst saplings and young trees. Moreover, in some areas dying of 

mature trees has started to occur. It is expected that the future use of F. excelsior as 

economically and ecologically valuable noble hardwood species will be 

substantially impaired by this emerging disease. 

Figure 2. Symptoms of ash dieback: (A) Wilting of leaves due to girdling of the phloem 

and sapwood occlusion, (B) A necrotic lesion in the bark with a small dead twig in the 

centre, (C) A necrotic lesionr in the bark with a leaf scar (arrow) in the centre, (D) 

Discoloration of the wood. 

104


A number of surveys are presently underway to obtain more precise information 

on the geographical distribution, incidence, severity and temporal development of 

ash dieback in Austria. In 2007 and 2008 monitoring plots have been established in 

Lower Austria (Cech, 2008) and additional plots in other provinces will be 

installed in 2009. On these plots, disease intensity will be monitored on 

permanently marked ash trees over the next years. From 2009 onwards the disease 

is also included in the ‘Documentation of forest damage factors’ (German: 

‘Dokumentation der Waldschädigungsfaktoren – DWF’), a monitoring system that 

is based on expert opinions and appraisals of staff of the district forest authorities 

(Steyrer et al., 2008). Finally, assessments on the geographical distribution and 

incidence of ash dieback will be carried out as part of the field work of the Austrian 

Forest Inventory. 

5. Chalara fraxinea ASSOCIATED WITH ASH DIEBACK IN AUSTRIA 

Starting in June 2007, we aimed to examine the role of C. fraxinea in ash 

dieback in Austria. Shoots, twigs, branches, stems and leaves of young F. excelsior 

trees showing symptoms of the disease were collected in many different parts of 

the country. From January 2008 onwards special attention was given to collect only 

samples from trees showing early symptoms of ash dieback, particularly shoots 

with small, localized necrotic phloem lesions. About 4 to 6 cm long segments, 

containing the transition between necrotic and healthy phloem tissues and/or 

discolored and healthy xylem were cut from symptomatic ash organs. These 

segments were surface sterilized as described by Kowalski (2006). Thereafter, the 

outer bark was carefully peeled off and 3 to 10 mm small discs containing wood 

and phloem tissues were cut under aseptic conditions and put onto malt extract agar 

(MEA; 20 g malt extract, 16g agar, 1000 ml tap water supplemented after 

autoclaving with 100 mg streptomycin sulphate). In the earlier isolation series until 

January 2008, the outer bark was not peeled off and not discs, but small pieces of 

phloem or wood were removed and placed on MEA plates. 

Initially the isolation plates were incubated at room temperature (23-25°C), but 

from August 2008 onwards they were immediately stored at low temperatures 

(approximately +4°C) in refrigerators. At cool temperatures, the growth of many 

fungi competing with C. fraxinea is more inhibited than that of C. fraxinea itself. 

In addition, phialophore formation of C. fraxinea is greatly enhanced by low 

temperatures (Halmschlager and Kirisits, 2008; Kirisits et al., 2008a). Both factors 

increase the likelihood to detect the fungus. Chalara fraxinea was identified based 

on morphological characteristics (colony morphology, phialophores and conidia; 

Kowalski, 2006; Halmschlager and Kirisits, 2008; Kowalski and Holdenrieder, 

2008; Kirisits et al., 2008a). 

Chalara fraxinea was for the first time isolated in Austria in June 2007, at one 

locality in Upper Austria (Edt bei Lambach, 48°06'51'' N, 13°53'29'' E) and another 

one in Styria (Altaussee, 47°38'34'' N, 13°45'36'' E) (Halmschlager and Kirisits, 

105


2008; Kirisits and Halmschlager, 2008). Subsequent surveys have shown that the 

pathogen is widespread in the country and apparently occurs everywhere, where 

ash dieback is present. Until June 2009 the fungus was obtained from symptomatic 

ash trees at 82 localities in eight out of the nine Austrian provinces (Table 1). The 

differences in the number of records of C. fraxinea in the various provinces 

(Table 1) do not allow inferring about the intensity of ash dieback in various parts 

of Austria, but just reflect differences in the intensity of sampling. In the future it is 

planned to examine more samples and sites in those provinces, where extensive 

collections have thus-far not been conducted, especially in Tyrol, Vorarlberg, 

Burgenland and Carinthia 

In the early isolation series carried out in 2007 C. fraxinea was rarely isolated, 

because samples were mainly collected from ash trees showing relatively late 

symptoms of disease. We suppose that on such plant material the slow growing 

C. fraxinea is in most cases already outcompeted by fast-growing endophytic and 

saprotrophic fungi (Kowalski and Holdenrieder, 2008). However, when isolations 

were made from shoots, twigs and stems showing early symptoms of disease, 

C. fraxinea was the most consistently and most frequently isolated fungus and in 

most cases the only one that was recovered. For example, isolation frequencies of 

C. fraxinea at ten localities in six Austrian provinces ranged from 81% to 100% of 

the examined shoots and necrotic lesions (Table 2). Overall, the fungus was 

obtained from 94% of the samples, from which isolations were made. Isolation of 

C. fraxinea was successful throughout the year, given that samples were collected 

from ash trees showing early disease symptoms (Table 2). 

Apart from F. excelsior, C. fraxinea was isolated from young, planted 

F. angustifolia trees in floodplain areas along the river Morava near 

Hohenau/March and from symptomatic seedlings of this species in a nursery in 

Lower Austria (Kirisits et al., 2009; Table 2). In addition, it was obtained at a few 

localities from F. excelsior ‘Pendula’ (Table 2). To our knowledge, these are the 

first and thus-far only European records of the fungus from hosts other than 

F. excelsior. The fungal isolations from Fraxinus ssp. have shown that C. fraxinea 

is associated with early symptoms of ash dieback, as it is typical for the primary 

causal agent of a plant disease. These results agree well with other studies in 

Europe, in which this fungus was consistently isolated or detected with molecular 

markers from diseased ash trees (Kowalski, 2006; Bakys et al., 2009b; Ioos et al., 

2009; Chandelier et al., 2009). 

In May 2008 potted, one-year-old common ash seedlings were woundinoculated 

with five C. fraxinea isolates and in June 2008 with five other strains. 

Similarly, potted, two-year-old narrow-leaved ash seedlings were inoculated with 

one C. fraxinea isolate in May 2008 (Kirisits et al., 2009) and with two other 

isolates in June 2008. Inoculum consisted of small pieces of autoclaved F. 

excelsior phloem (approximately 10 x 4 x 2-3 mm) that had been placed for 15 to 

30 days on the various C. fraxinea cultures on MEA. 

106


107


108


Inoculation of seedling stems was done by cutting an approximately 2 cm-long 

slit into the bark, to the level of the cambium, pulling the bark slightly away, 

inserting inoculum and wrapping parafilm around the wound to seal the bark flap 

back to the stem, to minimize contamination and to prevent rapid drying of the 

phloem and wood. Each isolate was inoculated onto 20 seedlings and twenty other 

seedlings of each ash species were inoculated with sterile pieces of ash phloem to 

serve as control. In each experiment, seedlings were observed for external 

symptoms during a period of approximately three months. Thereafter, they were 

dissected and lengths of necrotic lesions and longitudinal extension of wood 

discoloration were recorded. 

On both ash species all isolates tested caused symptoms virtually identical to 

those occurring on naturally infected trees: wilting of leaves and dieback (Fig. 3A) 

due to girdling of the phloem and sapwood occlusion around the inoculation site, 

necrotic lesions in bark (Fig. 3B), phloem (Fig. 3C) and cambium as well as 

brown-greyish discoloration in the wood (Fig. 3D) (Kirisits et al. 2008a; 2009). On 

the control seedlings the inoculation wounds were partly or entirely closed and no 

necrotic lesions or wood discoloration occurred. The three isolates that were tested 

on both ash species caused more intensive symptoms (longer necrotic lesions, more 

plants displaying wilt and dieback) on F. angustifolia than on F. excelsior, which 

may indicate that the former species is more susceptible to C. fraxinea than the 

latter species. Chalara fraxinea was consistently re-isolated from the inoculated 

seedlings, while it was not recovered from any of the control plants. On 

F. excelsior the re-isolation rates of the various C. fraxinea isolates ranged from 25 

to 73 %. On F. excelsior and F. angustifolia Kochs postulates were thus fulfilled 

for C. fraxinea, clearly suggesting that this fungus is the primary causal agent of 

ash dieback. This is in agreement with studies in Poland (Kowalski, 2006; 

Kowalski and Holdenrieder, 2008; 2009a), Sweden (Bakys et al., 2009b), Hungary 

(Szabó, 2008), Slovenia (Ogris et al., 2009) and Norway (Talgø et al., 2009). 

Flowering ash was also included in the inoculation experiments. Two C. 

fraxinea isolates, one in May 2008 and the other one in June 2008, were woundinoculated 

onto one-year-old seedlings of this ash species as described above. In 

both experiments C. fraxinea displayed pathogenicity to F. ornus. While in the first 

experiment some plants showed wilting of leaves and dieback, and necrotic lesions 

of similar size as those on F. excelsior developed, no dieback occurred in the 

second experiment and necrotic lesions were rather small. Flowering ash may be 

less susceptible to C. fraxinea than the other two European ash species which is 

supported by the fact that natural infections have thus-far not been observed. 

Further disease surveys and inoculation trials are, however, required to definitely 

appraise the susceptibility of F. ornus to the ash dieback pathogen. 

109


Figure 3. Symptoms on potted Fraxinus angustifolia seedlings following woundinoculation 

with Chalara fraxinea: (A) Wilting of leaves, (B) Superficially visible necrotic 

lesion in the bark, (C) Necrotic lesion in the phloem, (D) Discoloration of the wood (Bar 

for B, C and D [each showing the same inoculation point] = 1 cm). See Kirisits et al. (2009) 

for colored versions of the photographs. 

6. INFECTION BIOLOGY OF Chalara fraxinea AND HYPOTHETIC AL 

DISEASE CYCLE OF ASH DIEBACK 

Until recently, the infection biology of C. fraxinea was totally enigmatic. There 

were no published reports of the fungus sporulating on dead shoots, necrotic 

lesions or cankers and its mode of dispersal was unknown. The conidia of 

C. fraxinea are sticky, accumulate in droplets on the top of phialophores and do not 

appear to be adapted to wind-dispersal (Kowalski, 2006; Kowalski and 

Holdenrieder, 2008). It was therefore speculated that the fungus is transmitted by 

animal vectors such as the ash bark beetle Leperesinus varius (Kowalski and 

Holdenrieder, 2008). No clear evidence was found, however, that vectors are 

involved and circumstantial evidence, for example the occurrence of the disease on 

trees of all age classes and the low degree or lack of association between insect 

infestations and ash dieback, made vector-dispersal of the fungus unlikely. 

110


Figure 4. Apothecia of Hymenoscyphus albidus on leaf rachises of Fraxinus excelsior 

from the previous year (Neuwaldegg-Dornbach, Vienna, 14 and 16 June 2009). 

The enigma, how the ash dieback pathogen is transmitted was solved, at least 

partly, by Kowalski and Holdenrieder (2009b) who discovered the teleophorph of 

C. fraxinea and linked it to Hymenoscyphus albidus. Similar as in other 

ascomycetes, the ascospores of H. albidus are likely to be wind-dispersed 

(Kowalski and Holdenrieder, 2009) and appear to play the key role in inciting 

infections of ash trees. Ascospore dispersal by wind would also explain the rapid 

spread of the ash dieback pathogen in Europe, if it had changed genetically or were 

an invasive alien organism (Kowalski and Holdenrieder, 2009b). In contrast, we 

suppose that the spores of C. fraxinea are unable to cause infections and they may 

play a different, if any role in the biology of H. albidus. In May 2008 we 

inoculated ash shoots and leaves with suspensions of C. fraxinea spores, but no 

symptoms developed on any of the test seedlings. In addition, we repeatedly aimed 

to test the germination of spores of C. faxinea, but without any success. They did 

not germinate on MEA, V8 agar or an agar medium containing an extract from ash 

leaves that stimulated mycelial growth of C. fraxinea, but not conidial germination. 

The spores also did not germinate after in vitro inoculation of detached ash leaflets. 

We thus speculate that the spores of C. fraxinea are not conidia, but probably 

111


spermatia that play a role in exchanging nuclei and in fertilization of the fungus, if 

they are of any biological significance. 

Independent from the discovery of H. albidus by Kowalski and Holdenrieder 

(2009b), from September 2008 onwards we started to comprehend the importance 

of leaf rachises for the infection biology and epidemiology of the ash dieback 

pathogen. Fungal isolation from necrotic lesions on leaf rachises in September and 

October 2008 has shown that C. fraxinea is clearly associated with these leaf 

symptoms, as it was the most frequently isolated fungus and was often obtained in 

pure culture. Repeated isolations from shed leaf rachises collected from the forest 

floor in autumn, winter and spring confirmed that C. fraxinea persists and 

overwinters in these parts of ash trees. Given that isolation of C. fraxinea from 

dead shoots and necrotic lesions can be difficult (e. g. Bakys et al., 2009a), it was 

surprising to isolate it as the most frequent fungus from decaying leaf remnants 

collected on the ground. Occasionally, also phialophores of C. fraxinea were 

found, sometimes abundantly. Furthermore, from late November 2008 onwards, 

most leaf rachises were covered by black, pseudosclerotial plates, resembling the 

structures often occurring in cultures of C. fraxinea, and now, with hindsight, 

known to be associated with H. albidus (Kowalski, 2006; Kowalski and 

Holdenrieder, 2008; 2009b; Halmschlager and Kirisits, 2008; Kirisits et al., 2008a). 

While the discovery of H. albidus as teleomorph of C. fraxinea (Kowalski and 

Holdenrieder, 2009b) came surprising for us, we were not so surprised that the 

apothecia of this fungus are predominantly formed on leaf rachises from the 

previous year. In spring 2009 we repeatedly inspected leaf rachises for the 

occurrence of H. albidus. At one site in Vienna, developing apothecia with unripe 

ascospores were first seen at the end of May, while in mid-June the first fully 

developed fruiting bodies with ripe, germinating ascospores occurred abundantly 

(Fig. 4). Since then, apothecia of H. albidus have been recorded at several sites in 

various parts of Austria, indicating that they occur widespread and in high 

numbers. Intriguingly, apothecia were observed much earlier in the year (June) 

than previously reported in the literature (Kowalsi and Holdenrieder, 2009a and 

references therein). 

Based on the discovery of H. albidus as the teleomorph of C. fraxinea, 

published information on the disease as well as own observations and studies, we 

propose a hypothetical disease cycle for ash dieback (Fig. 5). This scheme (Fig. 5) 

shall also emphasize knowledge gaps and form the conceptual basis for future 

investigations on the infection biology and epidemiology of H. albidus/C. fraxinea. 

Infection of ash trees is thought to occur by wind-dispersed ascospores of H. albius 

which form mainly on leaf rachises from the previous year, lying on the forest floor 

(Kowalski and Holdenrieder, 2009b; Fig. 5). Occasionally they also occur on dead 

shoots (Kowalski and Holdenrieder, 2009b). Ascospores are likely released from 

June to early October (Fig. 5). The length of the infectious period will depend on 

the local climate and will likely vary from year to year according to the weather 

conditions. 

112


How infection by ascospores exactly takes place is unknown, but careful 

observations of symptoms suggest that leaves are an important target for infections 

(Fig. 5). In 2008 we observed leaf symptoms occasionally already in June and July, 

but they were most conspicuous from August onwards. In our opinion they can 

lead to early leaf shedding in late August and in September, as it has been 

repeatedly observed in Austria since 2005 (Cech, 2005; Hagen, 2005; 

Fachabteilung Forstwesen-Forstdirektion, 2009). We suppose that H. albidus is 

able to grow from the leaves into the shoots of ash trees (Fig. 5), where it causes 

necrotic lesions and wood discoloration. When examining numerous young ash 

trees showing early stages of disease, necrotic lesions occurred either around leaf 

scars (Fig. 2B) or around dead side twigs (Fig. 2C), but lesions were never seen in 

other positions. Dead side twigs are for sure entrance points of the pathogen into 

main shoots, bigger branches and stems of ash trees and the location of lesions 

around leaf scars may support the suspicion that the pathogen can enter the phloem 

and xylem via leaves. Direct infections of shoots possibly also occur (Fig. 5). 

Whatever organ is concerned, we assume that wounding is not required for 

infection. Environmental factors, particularly high amounts of precipitation and 

high levels of air humidity are likely conducive for ascospore release and for 

infections to be successful. 

In 2008 small, localized necrotic lesions on shoots, often located around leaf scars 

(Fig. 5), where leaves had already been shed, were first observed in early August, but 

more commonly in September and October. These symptoms must have originated 

from current-years infections. Observations from 2007 to 2009 suggest, however, that 

many infections may remain latent for a while and that most of the host colonization 

and symptom progression takes place outside the vegetation period (Fig. 5). This view 

is supported by wound-inoculation of F. angustifolia with C. fraxinea in early 

December, resulting in dieback of many test seedlings in early spring. Because 

symptom development occurs to a large extent in autumn and winter, high damage 

levels become obvious in spring, when shoots do not flush and die, wilting of leaves 

occurs and trees show extensive dieback (Fig. 5). On bark tissues killed a while ago, 

saprotrophic or endophytic fungi sporulate (Fig. 5) and outcompete C. fraxinea, 

making isolation of the primary pathogen difficult or impossible. With the occurrence 

of H. albidus apothecia on leaf rachises on the forest floor (Fig. 5), the disease cycle 

starts again. 

7. RECOMMENDATIONS FOR DISEASE MANAGEMENT 

Ash dieback is another example of a serious disease damaging a valuable 

hardwood tree species in Europe, thereby causing problems for forestry, nature 

conservation and shade tree management. Common ash is not amongst the main 

timber species in Austria, but on many sites and forest types it is an economically 

and ecologically important species. On some sites there are hardly any or no 

attractive alternatives to ash for the selection of tree species. If ash dieback in 

Austria develops similar as in other countries, so that also old trees are seriously 

113


affected, considerable losses will occur and ash may lose much of its importance in 

silviculture. 

Figure 5. Hypothetical disease cycle of ash dieback caused by Hymenoscyphus albidus/ 

Chalara fraxinea. See text for explanations 

Although many aspects are still unknown, much progress has recently been 

made to better understand ash dieback and, based on this knowledge, to 

recommend measures for disease management. However, this new phenomenon 

reminds us, how little can in most cases be done against emerging forest health 

problems. As a consequence of ash dieback the silvicultural characteristics of ash 

need to be re-appraised. While it used to be a ‘stable’ tree species that was little 

affected by diseases, insect pests and abiotic damaging factors, it is presently 

threatened by this new phenomenon. It is therefore recommended to plant common 

ash less extensively as before and mix it with other site-adapted tree species. Plants 

for planting should be carefully inspected for the occurrence of symptoms by 

nursery managers, forest owners and foresters. Likewise, it should be avoided to 

bring diseased seedlings into areas, where ash dieback has thus-far not been 

recorded. Wherever it is possible, leaves shed in autumn and leaf rachises on the 

114


ground prior to the occurrence of apothecia of H. albidus should be removed, 

ploughed into the soil or covered with soil. Such sanitation measures are probably 

possible and economic feasible in nurseries and urban areas. However, the 

dispersal distances of ascospores of H. albidus are presently unknown and it will 

depend on these distances, whether infections can be effectively prevented by local 

removal of leafs and leaf rachises. In nurseries fungicide application to protect 

plants from infections by ascospores may be another measure, but thus-far there is 

no experience regarding the fungicides to be effectively used as well as the precise 

timing of the applications. It is likely that infections can occur over a long period of 

time, from June to early October (Fig. 5), which would make many applications 

necessary. While fungicide treatments may be a useful method to raise healthy ash 

seedlings, their general importance for disease management will be limited, as 

seedlings will become infected after having been planted in the field. 

Thus-far there are no reliable recommendations for the silvicultural treatment of 

stands affected by ash dieback. It is, however, recommended not to abandon ash 

too early, and, if there are no other reasons, to harvest only dead and severely 

damaged trees. It has been observed that C. fraxinea can grow from epicormic 

shoots into the wood of ash stems and causes discoloration there (Kowalski and 

Holdenrieder, 2008; Thomsen et al., 2009), thereby lowering the timber quality and 

value. To avoid such losses as well as damage caused by wood-decay fungi, timely 

felling of severely diseased trees is recommended. Ash dieback will likely weaken 

the populations of ash trees and secondary pathogens such as Armillaria spp. and 

ash bark beetles may become more important and need to be considered (Kowalski 

and Holdenrieder, 2008; Thomsen et al., 2009). When intensive care is possible, 

individual trees can be rescued by cutting infected shoots, twigs and branches. 

Likewise, young trees can be cut to rescue the stump and root system, from where 

suckers will develop. However, in both cases, new infections of 

H. albidus/C. fraxinea are likely to occur and thus, trees need to be inspected and 

treated repeatedly. 

The most promising potential option for disease management may be the 

existence of considerable levels of resistance or tolerance within the populations of 

common ash. In heavily affected areas it is not rare to see severely diseased ash 

trees growing aside of still healthy or little affected trees. Likewise, investigations 

in seed plantations in Denmark strongly suggest that there are considerable 

differences in the resistance levels of ash clones towards ash dieback, with some 

clones hardly being affected (Olrik et al., 2007; Kjær et al., 2009). Preliminary 

assessments in clonal seed orchards in Austria support this view (C. Freinschlag, 

C. Jasser, A. Gaisbauer and T. Kirisits, unpublished data). It is therefore 

recommended that forest owners and foresters record, mark and promote healthy 

and slightly diseased ash trees growing in severely affected stands and promote 

natural regeneration of these potentially resistant or tolerant trees. Thereby they 

may facilitate that resistance levels in the ash populations are maintained, get 

115


stabilized or even increase. Breeding for resistance may be another, more intensive 

option for disease management in the future. 

7. REFERENCES 

Adler, W., Oswald, K., Fischer, R., 1994. Exkursionsflora von Österreich [Excursion flora of 

Austria]. Eugen Ulmer Verlag, Stuttgart, Wien, 1180 pp. 

Bakys, R., Vasaitis, R., Barklund, P., Thomsen, I.M., Stenlid, J., 2009a. Occurrence and pathogenicity 

of fungi in necrotic and non-symptomatic shoots of declining common ash (Fraxinus 

excelsior) in Sweden. European Journal of Forest Research 128, 51-60. 

Bakys, R., Vasaitis, R., Barklund, P., Ihrmark, K., Stenlid, J, 2009b. Investigations concerning the 

role of Chalara fraxinea in declining Fraxinus excelsior. Plant Pathology 58, 284-292. 

Cech, T.L., 2005. Blattkrankheiten und vorzeitiger Laubfall – eine Folge des kühlfeuchten Sommers 

2005 [Fungal diseases of leaves – a consequence of the cool and wet summer 2005]. 

Forstschutz Aktuell 34, 11-12. http://bfw.ac.at/400/pdf/fsaktuell_34.pdf 

Cech, T.L., 2006a. Auffallende Schadfaktoren an Waldbäumen im Jahr 2005 [Striking damaging 

agents on forest trees in 2005]. Forstschutz Aktuell 35, 6-7. 

http://bfw.ac.at/400/pdf/fsaktuell_35.pdf 

Cech, T.L., 2006b. Eschenschäden in Österreich [Ash dieback and premature leaf shedding in 

Austria]. Forstschutz Aktuell 37, 18-20. http://bfw.ac.at/400/pdf/fsaktuell_37_8.pdf 

Cech, T.L., 2008. Eschenkrankheit in Niederösterreich – neue Untersuchungsergebnisse [Dieback of 

ash in Lower Austria – new results]. Forstschutz Aktuell 43, 24-28. 

http://bfw.ac.at/400/pdf/fsaktuell_43_9.pdf 

Cech, T.L., Hoyer-Tomiczek, U., 2007. Aktuelle Situation des Zurücksterbens der Esche in 

Österreich [Actual situation of dieback of ash in Austria]. Forstschutz Aktuell 40, 8-10. 


Chandelier, A., André, F., Laurent, F., 2009. Detection of Chalara fraxinea in common ash (Fraxinus 

excelsior) using real time PCR. Forest Pathology, in press. DOI: 10.1111/j.1439- 

0329.2009.00610.x 

Damm, H.J., 1997. Seltene Eschen II – Fraxinus angustifolia im Auwald Hohenau [Rare ash species 

II – Fraxinus angustifolia in the floodplain forest Hohenau]. In: WWF Austria (Ed.), 

Proceedings of the symposium ‘Zukunft für gefährdete Baumarten? Rückbringung und 

Förderung seltener und gefährdeter Baum- und Straucharten’ [‘The Future for Endangered 

Tree Species. Preservation and Promotion of Rare and Endangered Tree and Shrub 

Species’], 1 October 1997, Vienna, Austria, pp. 11-17. 

Engesser, R., Queloz, V., Meier, F., Kowalski, T., Holdenrieder, O., 2009: Das Triebsterben der 

Esche in der Schweiz [Ash dieback in Switzerland]. Wald und Holz 6/2009, 24-27. 

Essl, F., Rabitsch, W., 2002. Neobiota in Österreich [Neobiota in Austria]. Federal Environment 

Agency - Austria, 432 pp. 

Essl, F., Rabitsch, W., Obermayr, G. (general co-ordination), Freud, M. (translation), 2006: Austrian 

Action Plan on Invasive Alien Species. Austrian Federal Ministry of Agriculture, 

Forestry, Environment and Water Management (‘Lebensministerium’), 26 pp. 

http://www.umweltbundesamt.at/fileadmin/site/umweltthemen/naturschutz/Neobiota_Eng 

l.pdf 

116


Fachabteilung Forstwesen-Forstdirektion, 2009. Fortschutzbericht Steiermark 2008 [Report on Forest 

Health in Styria in 2008]. 22 pp. 

Hagen, R., 2005. NÖ Forstschutzsituation 2005. [Report on the Forest Health Situation in Lower 

Austria in 2008]. 3 pp. 

Hagen R, 2007. NÖ Forstschutzsituation 2006/2007 [Report on the Forest Health Situation in Lower 

Austria in 2006/2007]. 5 pp. 

Halmschlager, E., Kirisits, T., 2008. First report of the ash dieback pathogen Chalara fraxinea on 

Fraxinus excelsior in Austria. Plant Pathology 57, 1177 and New Disease Reports 

[http://www.bspp.org.uk/ndr/july2008/2008-25.asp], Volume 17 . 

Ioos, R., Kowalski, T., Husson, C., Holdenrieder, O., 2009. Rapid in planta detection of Chalara 

fraxinea by a real-time PCR assay using a dual-labelled probe. European Journal of Plant 

Pathology, in press. DOI: 10.1007/s10658-009-9471-x. 

Jankovský, L., Palovčíková, Dvořák, M., 2008. Alien diseases of woody plants in the Czech 

Republic. In: Steyrer G, Tomiczek C, Lackner C (Eds.), Proceedings of the Second 

Meeting of Forest Protection and Forest Phytosanitary Specialists, 27-28 November 2007, 

Vienna, Austria. Forstschutz Aktuell 44, 32-34. . 


Jelem, H., 1974. Die Auwälder der Donau in Österreich [The floodplain forests along the Danube in 

Austria]. Mitteilungen der Forstlichen Bundesversuchsanstalt Wien 109, 1-287. 

Jelem, H., 1975. Marchauen in Niederösterreich [Floodplain forests along the March in Lower 

Austria]. Mitteilungen der Forstlichen Bundesversuchsanstalt Wien 113, 1-93. 

Kirisits, T., 2008. Eschenpathogen Chalara fraxinea nun auch in Kärnten nachgewiesen [First report 

of the ash dieback pathogen Chalara fraxinea from Carinthia]. Forstschutz Aktuell 45, 

28-30. http://bfw.ac.at/400/pdf/fsaktuell_45_12.pdf 

Kirisits, T., Halmschlager, E., 2008. Eschenpilz nachgewiesen [Ash fungus detected]. Forstzeitung 

119 (02-2008), 32-33. . 

https://www.dafne.at/prod/dafne_plus_common/attachment_download/efd9e0d1ee75f887 

d883b3c6e597ba03/Kirisits%20and%20Halmschlager_Chalara%20fraxinea_FZ_119_02- 

2008.pdf 

Kirisits, T., Cech, T.L., 2009. Eschentriebsterben: Ursache, Symptome, Empfehlungen [Ash dieback: 

cause, symptoms, recommendations]. Kärntner Forstverein Information 59/Juni 2009, 17- 

19. http://www.verwaltung.ktn.gv.at/161547_DE- 

Kirisits, T., Matlakova, M., Mottinger-Kroupa, S., Halmschlager, E., 2008a. Verursacht Chalara 

fraxinea das Zurücksterben der Esche in Österreich? [Is Chalara fraxinea the causal agent 

of ash dieback in Austria?]. Forstschutz Aktuell 43, 29-34. 


Kirisits, T., Matlakova, M., Mottinger-Kroupa, S., Halmschlager, E., 2008b. Involvement of Chalara 

fraxinea in ash dieback in Austria. In: Steyrer G, Tomiczek C, Lackner C (Eds.), 

Proceedings of the Second Meeting of Forest Protection and Forest Phytosanitary 

Specialists, 27-28 November 2007, Vienna, Austria. Forstschutz Aktuell 44, 16-18. 


Kirisits, T., Matlakova, M., Mottinger-Kroupa, S., Halmschlager, E., Lakatos, F., 2009. Chalara 

fraxinea associated with dieback of narrow-leafed ash (Fraxinus angustifolia). Plant 

Pathology 58, in press and New Disease Reports . 

(http://www.bspp.org.uk/publications/new-disease-reports/ndr.php?id=019043), Volume 

19. 

117


Kjær, E.D., Nielsen, L.R., Thomsen, I.M., Skovsgaard, J.P., 2009. Forskning om asketoptørre 

[Research on ash dieback]. Skoven 02/2009, 92-94. 

Kowalski, T., 2006. Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in 

Poland. Forest Pathology 36, 254-270. 

Kowalski, T., Holdenrieder, O., 2008. Eine neue Pilzkrankheit an Esche in Europa [A new fungal 

disease of ash in Europe]. Schweizerische Zeitschrift für Forstwesen 159, 45-50. 

Kowalski, T., Holdenrieder, O., 2009a. Pathogenicity of Chalara fraxinea. Forest Pathology 39, 1-7. 

Kowalski, T., Holdenrieder, O., 2009b. The teleomorph of Chalara fraxinea, the causal agent of ash 

dieback. Forest Pathology, in press. Doi: 10.111/j.1439-0329.2008.00589.x. 

Olrik, D.C., Kjær, E.D., Ditlevsen, B., 2007. Klonforskelle i angreb af asketoptørre [Clones differ in 

the infestation by ash dieback]. Skoven 11/2007, 522-525. 

Mayer, H., 1974. Wälder des Ostalpenraumes [Forests of the Eastern Alps]. Gustav Fischer Verlag, 

Stuttgart, 344 pp. 

Mayer, H., 1984. Waldbau auf soziologisch-ökologischer Grundlage. [Silviculture on Plant 

Sociological and Ecological Basis]. Gustav Fischer Verlag, Stuttgart, New York, 514 pp. 

Ogris, N., Hauptmann, T., Jurc, D., 2009. Chalara fraxinea causing common ash dieback newly 

reported in Slovenia. Plant Pathology 58, in press and New Disease Reports 

(http://www.bspp.org.uk/publications/new-disease-reports/ndr.php?id=019015 ), Volume 

19. 

Lygis, V., Vasiliauskas, R., Larsson, K.H., Stenlid, J., 2005. Wood-inhabiting fungi in stems of 

Fraxinus excelsior in declining ash stands of northern Lithuania, with particular reference 

to Armillaria cepistipes. Scandinavian Journal of Forest Research 20, 337-346. 

Nationalpark Kalkalpen, 2007. Schutzgüter im Nationalpark O.ö. Kalkalpen. Auswahl 

schützenswerter Tiere, Pflanzen und Lebensräume [Objects worth to be protected in the 

national park Upper Austrian Northern Limestone Alps. Selection of animals, plants and 

habitats worth to be protected], Schriftenreihe des Nationalparks Kalkalpen, Band 6, 127 

pp. 

Przybył, K., 2002. Fungi associated with necrotic apical parts of Fraxinus excelsior shoots. Forest 

Pathology 32, 387-392. 

Pukacki, P.M., Przybył, K., 2005. Frost injury as a possible inciting factor in bud and shoot necroses 

of Fraxinus excelsior L. Journal of Phytopathology 153, 512-516. 

Schadauer, K., 1994. Baumartenatlas für Österreich. Die Verbreitung der Baumarten nach Daten der 

Österreichischen Waldinventur. [Atlas of tree species in Austria. The distribution of tree 

species based on data of the Austrian Forest Inventory]. FBVA-Berichte 76, 1-157. 

Schumacher, J., Wulf, A., Leonhard, S., 2007. Erster Nachweis von Chalara fraxinea T. Kowalski sp. 

nov. in Deutschland – ein Verursacher neuartiger Schäden an Eschen [First record of 

Chalara fraxinea T. Kowalski sp. nov. in Germany – a new agent of ash decline]. 

Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 59, 121-123. 

Skovsgaard, J.P., Thomsen, I.M., Skovgaard, I.M., Martinussen, T., 2009. Associations among 

symptoms of dieback in even-aged stands of ash (Fraxinus excelsior L.). Forest 

Pathology, in press. DOI: 10.1111/j.1439-0329.2009.00599.x 

Steyrer, G., Krenmayer, W., Schaffer, H., 2008. Dokumentation der Waldschädigungsfaktoren 

(DWF) 2007 [Documentation of forest damage factors 2007]. Forstschutz Aktuell 42, 17- 

82. http://bfw.ac.at/400/pdf/fsaktuell_42_5.pdf 

118


Szabó, I., 2008. First report of Chalara fraxinea affecting common ash in Hungary. Plant Pathology 

58, in press and New Disease Reports (http://www.bspp.org.uk/publications/new-diseasereports/ndr.php?id=018030), 

Volume 18. 

Talgø, V., Sletten, A., Brurberg, M.B., Solheim, H., Stensvand, A., 2009. Chalara fraxinea isolated 

from diseased ash in Norway. Plant Disease 93, 548. 

Thomsen, I.M., Skovsgaard, J.P., Barklund, P., Vasaitis, R., 2007. Svampesygdom er årsag til 

toptørre i ask [A fungal disease is the cause of ash dieback]. Skoven 05/2007, 234-236. 

Thomsen, I.M., Skovsgaard, J.P., Kjær, E.D., Nielsen, L.R., 2009. Status for asketopptørre i Danmark 

og Europa [The status of ash dieback in Denmark and Europe]. Skoven 02/2009, 87-91. 

Wolf, W., Jasser, C., 2003. Laubholz – Der richtige Weg zum Erfolg [Hardwood trees – the right way 

to success]. Forest Authority of the province Upper Austria, 3rd edition, 30 pp. 

Zukrigl, K., 1997. Seltene Eschen I [Rare ash species I]. In: WWF Austria (Ed.), Proceedings of the 

symposium ‘Zukunft für gefährdete Baumarten? Rückbringung und Förderung seltener 

und gefährdeter Baum- und Straucharten’ [‘The Future for Endangered Tree Species. 

Preservation and Promotion of Rare and Endangered Tree and Shrub Species’], 1 October 

1997, Vienna, Austria, pp. 7-10. 

Acknowledgements: The financial support by the Austrian Federal Ministry of 

Agriculture, Forestry, Environment and Water Management (BMLFUW research 

project no. 100343, BMLFUW-LE.3.2.3/0001-IV/2/2008), the provincial 

governments of Lower Austria, Carinthia, Salzburg, Burgenland, Upper Austria 

and Styria as well as the Austrian Federal Forests (ÖBf AG) is gratefully 

acknowledged. We thank the Forest Authorities of all Austrian provinces as well as 

numerous District Forest Authorities and forest owners for the support of our 

research on ash dieback. The information on the occurrence of ash dieback in 

various European countries was collected as part of the Coordination Action 

‘European Network on emerging diseases and threats through invasive alien 

species in forest ecosystems (FORTHEATS)’, contract no. 044436, within the 6 th 

Framework Programme of the European Union. 

119



DIEBACK ON Fraxinus ornus IN KONYA REGION 

Asko Lehtijärvi 1* , H.Tuğba Doğmuş-Lehtijärvi 1 , Mertcan Karadeniz 1 , 

Mustafa Uygun 1 

ABSTRACT 

1 Süleyman Demirel University, Faculty of Forestry, 32260 Isparta, Turkey 

*asko@orman.sdu.edu.tr 

In many European countries, intensive dieback of ash has been observed in all age 

classes, independent of forest type and geographic position during the last 10 years. There 

are 3 species of Fraxinus in Turkey: Fraxinus excelsior L., F. angustifolia Vahl.. and F. 

ornus L.. They are fast growing trees and have valuable wood which is widely used in 

furniture industry. In addition, the trees are used in landscape architecture. 

In this study, existence and causal agents of dieback was investigated in F. ornus 

plantations located in Dutlukır (7.2 ha) and Altınapa Dam (6.4 ha) in Konya. Condition of 

the shoots, characteristics of the cankers and lesions, height and diameter (at root collar) of 

the trees, and signs of insect attacks were recorded. Almost all, 98.2%, of the sampled trees 

were bearing cankers, 4.1% had signs of insect attacks, and 24.7% of the trees had dry 

shoots. 

Keywords: Dieback, Fraxinus excelsior, Fraxinus angustifolia, Fraxinus ornus 

INTRODUCTION 

Dieback of ash has been one of the most important diseases on ash in European 

countries during the last 10 years. Recently the casual agent of the dieback was 

reported to be Chalara fraxinea T. Kowalski (Kowalski, 2006; Cech and Hoyer- 

Tomiczek, 2007; Kirisits et al., 2008; Halmschlager and Kirisits, 2008). Symptoms 

are necrosis of leaf rachises and leaflet veins, shoot, twig and branch dieback as 

well as necrotic lesions and cankers in the bark. Bark necrosis is often 

accompanied with brownish discolouration of the wood. Wilting of leaves can 

sometimes be seen on recently girdled shoots and twigs (Bakys et al., 2008; 

Kowalski, 2006; Kowalski and Holdenrieder, 2008; Halmschlager and Kirisits, 

2008; Krisits et al., 2008). 

There are three species and seven subspecies of Fraxinus distributed in 

Marmara, Black sea, Aegian and Mediterranean Region of Turkey (Yaltırık, 

1978). Fraxinus ornus (Manna ash) is a native species to southern Europe and 

south western Asia. Manna ash is an important tree species widely used in 

furniture industry and music instrument manufacturing. In addition, it is used in 

landscape architecture. 

120


The aim of the present study was to investigate the frequency of dieback in 

Manna ash plantations located in Dutlukır and near Altınapa Dam in Konya 

province. 

MATERIALS AND METHODS 

Manna ash plantations located in Dutlukır and near Atınapa Dam in Konya 

province were investigated in April 2009. The origin of the trees in the study areas 

is not known. 

The plantation site near Altınapa Dam, approximately 16.5 km west of the city 

of Konya, covers 6.4 ha on a minor slope facing the dam at an altitude of 1280 m 

a.s.l. The 7.2–hectare plantation in Dutlukır is located on flat terrain, 1075 m a.s.l., 

approximately 9 km southwest of Konya. In Konya region, winters are cold and 

snowy and summers are hot and dry. In the study area, annual precipitation ranges 

from 300 to 400 mm (Fig. 1). The average number of days with precipitation per 

month is 9-11 from December to May, and 2-7 from June to November. Between 

July and September there are only 2-3 rainy days per month. During these three 

summer months the total precipitation is below 30 mm. The average annual 

temperature is +11.4˚C (Anonymous, 2009). 

Average precipitation 

(mm) 

45 

40 

35 

30 

25 

20 

15 

10 

5 

0 

1 2 3 4 5 6 7 8 9 10 11 12 

121 

Months 

Average precipitation (mm) Average Temperature (°C) 

Figure 1: Monthly means for precipitation and temperature in Konya 1975-2007. 

The plantations were investigated using a systematic sampling strategy. 

Condition of the shoots, characteristics of the cankers and lesions, tree height and 

stem diameter at root collar, and signs of insect attacks were recorded for every 4 th 

tree in Dutlukır and for every 6 th tree in Altınapa plantation. Shoot and bark 

25 

20 

15 

10 

5 

0 

-5 

Average temperature (°C)


samples were collected from trees bearing cankers and lesions; totally 340 samples 

were collected for fungal isolation. The samples were kept in paper bags at +4˚C 

until isolation. 

The isolations were made from cankers and lesions on the shoots and the stem 

(Fig. 2). 

Figure 2: Cankers and lesions on the stem and the shoot of F. ornus. 

After surface sterilization with 70% ethanol and removing the surface bark, 

pieces of shoots were removed and placed in petri dishes containing 2% malt 

extract agar. The cultures were incubated at room temperature in dark conditions. 

RESULTS & DISCUSSION 

The average diameter of the sampled trees was 3.2 cm in Dutlukır and 2.6 cm in 

Altınapa and the average height of the sampled trees was 235 cm in Dutlukır and 

233 cm in Altınapa. 

Almost all, 98.2% of the sampled trees were bearing cankers, 4.1% had signs of 

insect attacks and 24.7% of the shoots had dried. In addition, wood discolouration 

and necrosis on the shoots were observed. The study is still going on and 

identification of the fungi is under progress. 

The high proportion of the trees bearing cankers and dry shoots indicates that 

the trees are either growing at an unsuitable site or that the trees are frequently 

attacked by a biotic agent. As the origin of the trees is not known, the possibility 

that they are poorly adapted to the local climate in the study area can not be 

excluded. The fact that the plantation sites are located outside of the natural 

distribution of F. ornus in Turkey (cf. Yaltırık, 1978) supports a hypothesis of 

weather related damage. 

122


Periods of low rainfall can be one of the abiotic factors correlated with the 

initiation of the disease (Hibben and Silverborg, 1978). However, there has not 

been any unusually dry periods, that could explain the high frequency of dead 

shoots, in Konya during the last 3 years. On the other hand, insufficient adaptation 

to the local climate could result in e.g. delayed winter hardening of the current– 

year shoots increasing susceptibility to frost damage or winter drought. The shoots 

had dried after bud formation indicating that the shoots had died between late 

summer and early spring. The frequency of dry shoots was similar in both sites. 

Therefore differences in microclimate between the sites, caused by the dam in 

Altınapa, seemed not to have had any effect on the occurrence of the damage. 

REFERENCES 

Anonymous, 2009. Turkish State Meteorological Service (www.dmi.gov.tr). 

Bakys, R., Vasaitis, R., Barklund, P., Ihrmark, K. and Stenlid, J., 2008. Investigations concerning the 

role of Chalara fraxinea in declining Fraxinus excelsior. Plant Pathology (2008). 

Cech, T. L. and Hoyer-Tomiczek, U., 2007. Aktuelle Situation des Zurücksterbens der Esche in 

Österreich. Forstschutz Aktuell 40, 8-10. 

Halmschlager, E. and Kirisits, T., 2008. First report of the ash dieback pathogen Chalara fraxinea on 

Fraxinus excelsior in Austria. Plant Pathology (2008) 57, 1177. 

Hibben, C. R. and Silverborg, S. B., 1978. Severity and causes of ash dieback. Journal of 

Arboriculture 4(12), 274-279. 

Kirisits, T., Matlakova, M. Mottinger-Kroupa, S., Harmschlager, E., 2008. Verursacht Chalara 

fraxinea das Zürücksterben der Esche in Österreich. Forstschuzt Aktuell 43-2008. 

Kowalski, T., 2006.Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in 

Poland. Forest Pathology, 36 (2006) 264–270, Blackwell Verlag, Berlin. 

Kowalski, T. and Holdenrieder, O., 2008. Pathogenicity of Chalara fraxinea. Forest Pathology 2008, 

Blackwell Verlag, Berlin. 

Yaltırık, F., 1978. Türkiye’deki Doğal Oleaceae Taksonlarının Sistematik Revizyonu. İstanbul 

Üniversitesi Orman Fakültesi Yayınları, I. U. Yayın No.: 2404, O. F. Yayın No.: 250. 

123



ASH DIEBACK IN THE CZECH REPUBLIC 

Petr ŠŤASTNÝ 1 , Dagmar PALOVČÍKOVÁ 1 , Libor JANKOVSKÝ 1* 

1 Mendel University of Agriculture and Forestry, Faculty of Forestry and Wood Technology, 

Department of Forest Protection and Wildlife Management, Zemědělská 3, 613 00 Brno, Czech 

Republic 

ABSTRACT 

*jankov@mendelu.cz 

Ash dieback was observed in Baltic states since middle of 90`s, however the progress 

of disease was observed within last years. The new fungus Chalara fraxinea was described 

as a causal agent of ash dieback in 2006. The ash dieback was observed in some local 

areas in the Czech republic since middle of 90`s and it was connected mostly with extreme 

climatic conditions. Progress of disease was observed since 2003. Ash decline was 

observed practically in all regions of the CR, C. fraxinea were confirmed in the CR in 

September 2007. Occurrence of Chalara fraxinea was confirmed in Fraxinus excelsior 

and F. angustifolia. Perfect stage of C. fraxinea Hymenscyphus albidus is known as 

common saprophytes on leaf-stalks. In areas with esh dieback was observed aphid 

Prociphilus bumeliae, however the role of this insect is actually discus. 

Key words: ash decline, Chalara fraxinea, ash, ash dieback 


Common ash (Fraxinus excelsior) is threatened in large parts of Europe by ash 

dieback (eg. Cech, 2006; Lygis et al., 2005). Chalara fraxinea has been recently 

determined to be the causal agent of this disease (Kowalski, 2006; Kowalski & 

Holdenrieder, 2009a; Bakys et al., 2009). 

Chalara fraxinea was reported in Poland (Kowalski, 2006), Denmark (Thomsen 

et al., 2007), Germany (Schumacher et al., 2007), Austria (Halmschlager and 

Kirisits, 2008), Hungary (Szabo, 2008a; 2008b), Finland (EPPO, 2008a), Lithuania 

(R. Vasaitis, personal communication), Norway (EPPO, 2008b; H. Solheim, 

personal communication), Sweden (Bakys et al., 2009), Switzerland (Engesser and 

Holdenrieder, unpublished) and France (Ioos, personal communication). Symptoms 

of ash dieback were also reported from Slovakia in 2008 (Kunca, personal 

communication); the disease was noted also in Slovenia (Ogris et al., 2009) and 

Croatia (own observation) in 2008. From the Czech republic is pathogen reported 

from 2007 (Jankovský and Holdenrieder, 2009). The ascomycete Hymenoscyphus 

albidus (Roberge ex Desm.) W. Phillips was identified as the teleomorph of C. 

fraxinea by Kowalski and Holdenrieder (2009b). 

124



Ash twigs (4-8 mm diameter) with dieback (comprising a necrotic distal portion and 

a proximal living portion) were collected and transferred to the laboratory. The surface 

were disinfected by spraying with concentrated ethanol and superficially dried on a 

clean bench. The tissue samples (diameter 2-5 mm, about 2-3 mm long), were 

dissected from the sapwood below necrotic lesions, after bark removal. Samples were 

then surface sterilized by immersion in sodium hypochlorite (7 - 10 %) for 60 - 90 sec, 

then immersed in 96% ethanol for 60 - 90 sec, washed in sterilized water and placed on 

the medium. Tissue samples were aseptically transferred on malt extract agar (MEA 3; 

30 g/L, peptone 5 g/L, agar 15 g/L) and, according to Kowalski (2006), streptomycin 

(100 mg/L) added after autoclaving. Identification was made on the bases of colony 

morphology and microscopic features. 


Ash dieback associated with bark necroses and withering of young shoots was 

recorded in several areas in the CR during 2004 – 2008. The locations affected 

include mostly all area of the CR, eg. Beskydy Mts., Jeseniky Mts., Giant Mts., 

Bayerischer Wald Mts., Central Bohemia, Prague, Eastern Bohemia, Czech 

Moravian Highland, the area at the junction of the Thaya and Morava Rivers, and 

along the Czech, Austrian and Slovak borders. Ash dieback has extended across the 

entire country since 2004. The symptoms were also noted in nurseries, especially 

on saplings in South Moravia. However wooly aphids from genus Prociphilus spp. 

were observed in this areas abundantly as a important harmful factor in early 

spring. 

The first record of Chalara fraxinea in the CR originated from samples 

collected at Drahany Highland, Arboretum Krtiny, from Fraxinus excelsior and in 

some other locations (Jankovský and Holdenrieder 2009). Ash diaback were 

observed on Fraxinus excelsior and its cultivars, especially sensible is F. excelsior 

cv. „Pendula“, and F. angustifolia. 

On the area of South Moravia samples has been taken especially from the 

district of Židlochovice forest enterprise, close to Austrian and Slovak borders. 

Health condition of young forest stands is serious on some locations and there is a 

danger of large damages of these young plantations. The culture of C. fraxinea 

origin from flood-plain forest by the village Tvrdonice in this area. It is located 

near of the boarder with Slovakia. The other samples were collected in the Ivaň 

area (adjacent to the Nove mlyny reservoir) and Soutok game preserve (National 

nature reserve Cahnov). 

The occurrence of ash decline is continually monitored, especially in the area of 

south Moravia. 

According to the experience with symptoms of ash wilting we can assume that 

C. fraxinea is spread through the whole area of the CR. 

125


Table 1. Occurrence of Ash dieback on some monitored plots. 

LOCALITY DATE OF COLLECT. CONCLUSION NOTICE POSITION 

1 Arboretum of Křtiny 26.09.2007 

2 Ochoz u Brna 29.09.2008 Pozitive 

126 

Pozitive Fraxinus excelsior 

"Pendula" 

3 Hradčany u Brna 06.10.2008 Pozitive 

Symptom of disease 

4 Brno Lesná - Soběšice 08.10.2008 

5 Lomnice u Tišnova (Sýkoř hill) 12.10.2008 Pozitive Shoots along the way 


Regeneration under the 

6 LZ Židlochovice - NPR Cahnov 13.10.2008 


cover of older stand 

7 District Lednice-Valtice area - Rendez vous 30.10.2008 

8 LZ Židlochovice - Ivaň 04.02.2009 

9 Kroměříž - zámeček 07.02.2009 



10 LZ Židlochovice – forest district Tvrdonice 18.02.2009 Pozitive Compartment 909 

11 LZ Židlochovice – forest district Tvrdonice 18.02.2009 Symptom of disease Compartment 904 

12 

Forest nursery Hadovna - region 

Kroměříž 30.05.2009 Symptom of disease 

13 Arboeko co. - Smržice 30.04.2009 Symptom of disease 

49°19'7"N/ 

16°44'35"E 

49°15'24"N, 

16°43'56"E 

49°19'36"N, 

16°25'58"E 

49°14'37.5"N, 

16°37'5.728"E 

49°24'34.51"N, 

16°24'46.765"E 

48°39'17.223"N, 

16°56'32.378"E 

48°44'54.48"N, 

16°47'39.299"E 

48°55'18.304"N, 

16°34'56.446"E 

49°16'55.536"N, 

17°27'50.746"E 

48°47'29.587"N, 

17°4'21.828"E 

48°47'23.761"N, 

17°4'21.588"E 

49°18'24.285"N, 

17°39'4.909"E 

49°23'56.145"N, 

17°11'26.528"E 

Dry lesions show circular shape at first, they gradually change into elliptical 

oblong, depressed necrosis, which gradually extends on the surface; it was 

observed in most places. Below the bark, the dieback of the cambium is evident. 

The necrosis extends both into transpiration flow and assimilation flow. The 

infection gets from necrosis also into the wood part, which is discolored by grey 

brown. One year shoots die above the necrosis especially in autumn months (from 

end of August till October). Necrosis on 2 years old and perennial shoots can be 

occluded and there can be superficial cankers with callus on the edge created. Dark 

brown necrosis is formed on petioles and trees shed premature, from end of August 

till October, their still green leaves. One year old, rarely also older shoots die on 

older trees. Typical of this is a creation of compressed crown and disturbance of 

parallel trunk. 

Hymenoscyphus albidus is noted by Kowalski and Holdenrieder (2009) as the 

teleomorph of Chalara fraxinea. The species is widespread in Europe. According 

to the literature, H. albidus occurs exclusively on ash petioles from ash litter 

(Breitenbach and Kranzlin, 1984; Ellis and Ellis, 1985). In the CR, it is well known 

as a saprophyte on leaf-stalks in the litter, it is considered to be a common species 

in mycofloristic research.


Transfer of infection nor vector has not been clarified till now. One can assume 

that infection occurs via ascospores of H. albidus which are formed on leaf fall of 

ash during summer months. It corresponds to time period of development of newly 

attacking infection. Rapid and especially sudden dissemination of this disease 

throughout Europe is not typical for tree disease, is it more typical for non biotic 

diseases or for insect outbreaks. Especially an area, which is being occupied during 

relatively short period of time, is enormous. For pathogens, it is difficult to 

penetrate structural suberin barrier which is represented by unharmed bark. The 

influence of sucking insect can be discussed. Remarkable is the fact that lesions 

occur practically at the same place like the colony of woolly aphids Prociphilus 

spp. Aphid`s colonies are located on shoots and petioles of leaves. In nurseries, 

where chemical control against sucking insect was applied, symptoms of ash 

dieback disappeared. Woolly aphids are not reported to occur in all areas where ash 

decline was observed. Sucking insect can play a role of agent which creates a 

defect in the bark. In sucking locations, tissues suffer from necrosis and fungi like 

C. fraxinea penetrate through the tissues. There is an apparent separation of reason 

– sucking of aphids during spring time and formation of necrosis during summer 

time when the connection to sucking insect needs not to be evident. 

4. CONCLUSION 

The bionomy of the fungus, infection cycle, pathology, resp. pathogenicity of 

the fungus and genetic structure are main topics of contemporary research. 

Although pathogenicity of the C. fraxinea has been proved, the mechanism of 

penetration of fungus into host is not known yet. The role of sucking insect, mainly 

woolly aphids, should be crucial due to production of lesion around sucking points 

at the position of previous aphid colonies. The relationship of sucking insects and 

C.fraxinea in ash dieback pathology requires further investigations. 


This project was supported by MSM 6215648902 and Grant foundation of 

FFWT MUAF. 

6. REFERENCES 

Bakys, R., Vasaitis, R., Barklund, P., Ihrmark, K., Stenlid, J., 2009. Investigations concerning the role 

of Chalara fraxinea in declining Fraxinus excelsior. Plant Pathology 58, 284 - 292. 

Cech, T., 2006. Eschenschäden in Österreich. Forstschutz Aktuell (Wien), 37, 18 - 20. (in German) 

Cech, T., Hoyer-Tomiczek, U., 2007. Aktuelle Situation des Zurücksterbens der Esche in Österreich. 

Forstschutz Aktuell (Wien) 40, 8 - 10. 

EPPO, 2007. Ash dieback in Europe and possible implication of Chalara fraxinea: addition to the 

EPPO Alert List. EPPO Reporting service 2007/179. 

EPPO, 2008a. First report of Chalara fraxinea in Norway. EPPO Reporting service 2008/181. 

127


Halmschlager, E., Kirisits, T., 2008. First report of the ash dieback pathogen Chalara fraxinea on 

Fraxinus excelsior in Austria. Plant Pathology 57, 1177. 

Jankovský, L., Holdenrieder O., 2009. Chalara fraxinea - ash dieback in the Czech Republic. Plant 

protection Science. (in press). 

Kirisits, T., Matlakova, M., Mottinger-Kroupa, S., Halmschlager, E., 2008. Verursacht Chalara 

fraxinea das Zurucksterben der Eshe in Osterreich. Forstschutz Aktuell (Wien) 43. 29 – 

34. 

Kowalski, T., 2006. Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in 

Poland. Forest Pathology, 36(4). 264 - 270. 

Kowalski, T., Holdenrieder, O., 2009a. Pathogenicity of Chalara fraxinea. Forest Pathology 38. 1 - 7. 

Kowalski, T., Holdenrieder, O., 2009. The teleomorph of Chalara fraxinea, the causal agent of ash 

dieback. Forest Pathology online publication doi: 10.1111/j.1439-0329.2008.00589.x. 

Lygis, V., Vasiliauskas, R., Larsson, K.H. & Stenlid J., 2005. Wood-inhabiting fungi in stems of 

Fraxinus excelsior in declining ash stands of northern Lithuania, with particular reference 

to Armillaria cepistipes. Scandinavian Journal of Forest Research 20. 337-346. 

Ogris, N., Hauptman T., and Jurc D., 2009. Chalara fraxinea causing common ash dieback newly 

reported in Slovenia. New Disease Reports 19, Feb 2009 to Aug 2009. 

http://www.bspp.org.uk/publications/new-disease-reports/ndr.php?id=019015. 

Schumacher, J., Wulf A., Leonhard, S., 2007. Erster Nachweis von Chalara fraxinea T. Kowalski sp. 

nov. Deutschland - ein Verursacher neuartiger Schäden an Eschen. Nachrichtenblatt des 

Deutschen Pflanzenchutzdienstes (Braunschweig), 59(6). 121 - 123. 

Szabó, I., 2008b. First report of Chalara fraxinea affecting common ash in Hungary. New Disease 

Reports, 18. Aug 2008 to Jan 2009. http://www.bspp.org.uk/publications/new-diseasereports/ndr.php?id=018030. 

Thomsen, I.M., Skovsgaard, J.P., Barklund, P., Vasaitis, R., 2007. Svampesygdom er arsag til 

toptorre i ask. Skoven (Skov & Landskab; Kobenhavns Universitet; Copenhagen, DK), 5: 

234 -236. 

128

Canker Diseases 

129


130



HORSE CHESTNUT BLEEDING CANKER – BAGGING THE BUG ! 

Sarah GREEN 1* , Bridget LAUE 1 , Grace MACASKILL 1 , Heather STEELE 1 

1 Forest Research, Northern Research Station, Roslin, Midlothian, Scotland EH25 9SY 

ABSTRACT 

*sarah.green@forestry.gsi.gov.uk 

Bleeding canker of horse chestnut, caused by the bacterial pathogen, Pseudomonas 

syringae pv. aesculi, has rapidly established and become widespread throughout parts of 

northern Europe, including Great Britain, over the last five years. Despite the fact that this 

disease is having a devastating effect on an important amenity tree species, very little is 

known about the infection processes of this pathogen, or the genetic and physiological 

factors which cause it to be so highly damaging. One difficulty associated with studying 

this pathogen is the lengthy procedure required to confirm its presence on the host. Realtime 

PCR primers were developed based on gyrase B gene sequence data for the specific 

detection of P. syringae pv. aesculi in infected horse chestnut. This quantitative real-time 

PCR assay provides the facility to study several important aspects of the biology of P. 

syringae pv. aesculi on horse chestnut including its potential for epiphytic survival on 

healthy trees, as well as its dissemination in different environmental substrates, such as soil, 

water and infected tree debris. As part of ongoing work, the complete genome of P. 

syringae pv. aesculi is currently being sequenced to determine its complement of virulence 

and fitness genes. Molecular tools are also being used to determine the origin of P. syringae 

pv. aesculi, the location/s and time of its introduction and geographical routes of spread 

within Great Britain and Europe. 

Keywords: Pseudomonas syringae pv. aesculi, bleeding canker, Aesculus 

hippocastanum, real-time PCR. 


In the last 10-15 years, there has been an unprecedented increase in the numbers 

of hitherto unrecognised diseases attacking trees throughout the world. Many of the 

causal organisms have been inadvertently introduced into new ecosystems through 

the increase in global commerce, via pathways such as trade in live plants 

(including soils), poorly treated timber products and international trade in bonsai 

(Brasier, 2008). European horse chestnut (Aesculus hippocastanum), an important 

amenity tree species throughout much of Great Britain and northern Europe, is 

suffering from two major problems of recent introduction into the continent: 

bacterial bleeding canker and the horse chestnut leaf miner. Native to northern 

Greece and Albania (Phillips, 1978), horse chestnut was introduced into the UK in 

the late 16 th Century and was planted widely in parks and gardens in both urban 

and rural areas, often in avenues bordering roads. Horse chestnut is highly regarded 

for its qualities as a shade tree, for its showy white flowers in spring and the 

production of its fruits or ‘conkers’. 

131


Since 2003, an epidemic of a bleeding canker disease of horse chestnut has 

become widespread across Great Britain as well as a number of other European 

countries, including the Netherlands, Belgium, France and Germany. The disease 

has been attracting a great deal of media attention in Great Britain over the last 

couple of years due to the severity of damage on affected trees. Symptoms of the 

disease include bleeding cankers located on the stem and branches, with rustcoloured 

liquid oozing from cracks in the bark, necrotic phloem, foliar 

discolouration, and crown dieback often leading to tree death. A Great Britain-wide 

survey of 2629 horse chestnut trees conducted in 2007 found that over 70% of trees 

surveyed in parts of England exhibited symptoms typical of bleeding canker, with 

36% and 42% of surveyed trees showing these symptoms in Wales and Scotland, 

respectively (Forestry Commission, 2008). The reason that bleeding canker disease 

of horse chestnut is currently of such high profile is due to its dramatic impact on 

an important amenity tree species. The disease is now a key tree health issue in 

Great Britain, particularly in the context of ‘urban greening’ and with climate 

change in mind there is increasing recognition of the need to maintain healthy 

populations of shade trees within urban areas. 

The causal agent responsible for this new epidemic of bleeding canker disease 

of horse chestnut has only very recently been identified as a gram-negative 

fluorescent Pseudomonas syringae bacterium, which has an identical partial gyrase 

B gene sequence to a strain isolated from leaf lesions on Indian horse chestnut 

(Aesculus indica) in India in 1980 (Schmidt et al., 2008; Webber et al., 2008). 

There are at least 50 closely related pathovars of the species Pseudomonas syringae 

which can be distinguished by host range, and which infect a wide range of 

herbaceous and woody plants. It is thought that P. syringae pv. aesculi may have 

originated from India, being native on Indian horse chestnut, and has been recently 

introduced to Great Britain and Europe, possibly via imported, infected nursery 

stock (Brasier, 2008). If it is a new introduction to Europe, P. syringae pv. aesculi 

has found a new host, European horse chestnut, on which it is considerably more 

aggressive than its native host on which it only causes leaf lesions. Britain’s forests 

are under continuous risk from new, exotic diseases as a result of the increased 

movement of plant stock between countries over ever greater distances. Bacterial 

diseases of trees present a particular risk to Britain’s forests and woodlands since 

their activity in northern Europe may be favoured by the milder, wetter winters 

predicted under future climate change scenarios and because so little is currently 

known about the routes of invasion, spread and survival of these pathogens on 

woody hosts. 

One of the obstacles to studying P. syringae pv. aesculi is the difficulty of 

confirming its presence in host tissues. To date, this bacterium is detected on 

symptomatic trees by isolation and culturing, PCR amplification and sequencing of 

the gyrase B gene using universal primers, and comparing sequence homology with 

a type strain of P. syringae pv. aesculi published in the US National Center for 

Biotechnology Information (NCBI) GenBank sequence database. However, this is 

132


time consuming, through the need to obtain pure bacterial cultures from diseased 

horse chestnut tissues which may be colonised by a range of bacterial genera 

(Green et al., 2009). Recently, real-time PCR has proven to be a very useful tool 

for the detection of plant pathogenic fungi and bacteria, being highly sensitive, 

specific and rapid, with the added capacity for quantification of the pathogen in 

host tissues (Schaad and Frederick, 2002; Vandroemme et al., 2008). The first aim 

of this study was to develop and test a robust, reliable, quantitative real-time PCR 

assay which is specific to P. syringae pv. aesculi, and to demonstrate its use for 

detecting the bacterium in inoculated and naturally infected horse chestnut trees 

(Green et al., 2009). Also, briefly discussed are ongoing projects aimed at i) 

characterising the key genetic and physiological factors determining virulence and 

epiphytic fitness of P. syringae pv. aesculi on European horse chestnut and ii) 

tracing the epidemiological origins of this devastating bacterium. 


For the development of the real-time PCR assay, a total of 65 bacterial isolates 

were collected from various parts of diseased or healthy horse chestnut in Britain, 

the DNA extracted and the partial gyrase B gene region amplified using universal, 

degenerate primers. The amplified fragments were sequenced and aligned with 

other bacterial gyrase B gene sequences available in GenBank to design real-time 

PCR primers specific to P. syringae pv. aesculi. The specificity and sensitivity of 

the real-time PCR primers was tested using nine strains of P. syringae pv. aesculi, 

17 other strains of P. syringae, 11 other non-pathogenic Pseudomonas spp. and 14 

other species of bacteria isolated from horse chestnut trees. The ability of the realtime 

primers to amplify and quantify DNA of P. syringae pv. aesculi in diseased 

horse chestnut tissues was also demonstrated. 

3. RESULTS 

The real-time primer pair and reaction conditions developed to detect P. 

syringae pv. aesculi amplified all isolates of P. syringae pv. aesculi, but did not 

amplify the DNA extracted from the included reference bacteria or horse chestnut 

when 1 ng of DNA was used as the template. The real-time primers reliably 

amplified P. syringae pv. aesculi down to 1 pg of extracted DNA, with and without 

the presence of host DNA, and also amplified unextracted DNA in whole cells of 

the bacterium down to at least 160 colony forming units. The real-time PCR assay 

detected and quantified DNA of P. syringae pv. aesculi in sixteen out of seventeen 

tissue samples collected from naturally infected or artificially inoculated horse 

chestnut, with generally good consistency between the two PCR runs in terms of Ct 

values and quantity of pathogen DNA detected. 

133

4. DISCUSSION 


A novel, quantitative real-time PCR assay has now been developed to detect the 

pathogenic bacterium, P. syringae pv. aesculi, which is currently causing a severe 

bleeding canker disease of horse chestnut trees in several European countries 

(Green et al., 2009). The real-time PCR primers were shown to be both highly 

specific, giving exponential amplification only with the target pathogen, and highly 

sensitive, allowing detection of P. syringae pv. aesculi down to 1 pg DNA in 

diseased horse chestnut tissues with the optimised reaction conditions used (Green 

et al., 2009). This advance in methodology now provides a tool for the accurate and 

sensitive quantitative detection of P. syringae pv. aesculi in host tissues, as well as 

in different environmental substrates. This assay will be used to examine the ability 

of P. syringae pv. aesculi to survive epiphytically in host material, and its potential 

to contaminate rainwater and soil. The aim of this is to determine the routes for 

transmission of the pathogen, and to explain the reason for its high mobility. 

Research into P. syringae plant pathogens is currently of high profile 

internationally due to their detrimental impact in the horticultural, agricultural and 

forestry sectors (Kennelly et al., 2007; Perez-Martinez et al., 2008). Ongoing 

research into the dentification of the key virulence and fitness genes of P. syringae 

pv. aesculi through genome sequencing, combined with in vivo studies on 

pathogenicity, will provide novel insights into the factors determining the 

pathogenicity and fitness of an important and newly damaging P. syringae 

pathovar on a woody host; this being an area for which information is currently 

scarce. 

The effectiveness of import and quarantine regulations and disease management 

strategies designed to protect the agricultural, horticultural and forest industries 

against exotic pathogens relies on a thorough understanding, based on sound 

scientific data, of the routes of introduction and spread of exotic pathogens in new 

locations. This is reflected in the current high priority given to these types of 

studies within the European Union (EU), particularly given the recent, rapid 

expansion of the international plant trade and an appreciation of the threat that this 

presents. Current research on P. syringae pv. aesculi will identify the most suitable 

genetic markers, based on genome sequence data, for studying the recent 

evolutionary history of P. syringae pv. aesculi. These markers will then be used for 

phylogenetic analyses to elucidate whether this pathogen is a new introduction to 

Europe, and if so, when and from where it was introduced and routes of subsequent 

spread within regions. The research briefly described here will be essential for the 

development of more effective phytosanitary measures and disease management 

strategies to guard against future threats posed by exotic bacterial pathogens. The 

project will ultimately inform and guide management and mitigation strategies for 

an important bacterial disease of an amenity tree species through increased 

understanding of the causal agent. 

134

5. REFERENCES 


Brasier, C.M., 2008. The biosecurity threat to the UK and global environment from international trade 

in plants. Plant Pathology 57, 792-808. 

Forestry Commission, 2008. Report on the national survey to assess the presence of bleeding canker 

of horse chestnut trees in Great Britain. Forestry Commission, Edinburgh, UK. 

Green, S., Laue, B., Fossdal, C.G., A’Hara, S., Cottrell, J., 2009. Infection of horse chestnut (Aesculus 

hippocastanum) by Pseudomonas syringae pv. aesculi and its detection by quantitative 

real-time PCR. Plant Pathology, In Press. 

Kennelly, M.M., Cazorla, F.M., de Vicente, A., Ramos, C., Sundin, G.W., 2007. Pseudomonas 

syringae diseases of fruit rees; Progress towards understanding and control. Plant Disease 

91, 4-16. 

Perez-Martinez, I., Zhao, Y., Murillo, J., Sundin, G.W., Ramos, C., 2008. Global genomic analysis of 

Pseudomonas savastanoi plasmids. Journal of Bacteriology 190, 625-635. 

Philips, R., 1978. Trees in Britain, Europe and North America. Macmillan Reference. 

Schaad, N.W., Frederick, R.D., 2002. Real-time PCR and its application for rapid plant disease 

diagnostics. Canadian Journal of Plant Pathology 24, 250-8. 

Schmidt, O., Dujesiefken, D., Stobbe, H., Moreth, U., Kehr, R., Schröder, T., 2008. Pseudomonas 

syringae pv. aesculi associated with horse chestnut bleeding canker in Germany. Forest 

Pathology 38, 124-8 

Vandroemme, J., Baeyen, S., Van Vaerenbergh, J., De Vos, P., Maes, M., 2008. Senstitive real-time 

PCR detection of Xanthomonas fragariae in strawberry plants. Plant Pathology 57, 438- 

44 

Webber, J.F., Parkinson, N.M., Rose, J., Stanford, H., Cook, R.T.A., Elphinstone, J.G., 2008. 

Isolation and identification of Pseudomonas syringae pv. aesculi causing bleeding canker 

of horse chestnut in the UK. Plant Pathology 57, 368. 

135



AN OVERVIEW OF POTENTIAL INFECTION COURTS FOR Neonectria 

fuckeliana, THE CAUSAL AGENT OF NECTRIA FLUTE CANKER IN 

Pinus radiata IN NEW ZEALAND 

ABSTRACT 

Anna J.M HOPKINS 1* , Patricia E. CRANE 1 , Margaret A. DICK 1 

1 Forest Protection, Scion, Private Bag 3020, Rotorua 3010, New Zealand 

* Anna.Hopkins@scionresearch.com 

Nectria flute canker is a disease of Pinus radiata stems in the southern parts of New 

Zealand caused by the pathogen Neonectria fuckeliana. Although tree crowns generally 

remain healthy, stem cankers and associated defect reduce the commercial value of the 

timber. In Northern Hemisphere countries where N. fuckeliana is endemic, open wounds, 

dead attached branches and branch stubs have been identified as the primary infection 

courts for N. fuckeliana. In New Zealand the development of the Nectria flute canker 

disease is primarily associated with pruned branch stubs however recent studies suggest 

that this is not the only possible infection court as the fungus has been found in trees prior 

to pruning. Three separate field trials were established to examine potential infection courts 

for N. fuckeliana in P. radiata in New Zealand. These infection courts included stem 

wounds, pruned stubs, branch crotches and branch collars. Stem depressions, the usual 

precursor to flute cankers, were created following inoculation of deep and shallow stem 

wounds and of some branch collars. Inoculation directly into pruned stubs resulted in only a 

few, small stem depressions and the fungus was largely contained within the branch trace. 

Infection through branch crotches was not successful. Both inoculation types tested 

(ascospores and conidia) resulted in similar canker development and fungal spread within 

the tree. The trials described in this paper are ongoing. 

Keywords: Neonectria fuckeliana, stem cankers, Pinus radiata. 


Pinus radiata D. Don is the most important plantation tree species grown in New 

Zealand, comprising more than 89% of the plantation estate (NZFOA, 2009). Many of 

the plantations are managed to produce clear, knot-free wood by pruning from one to 

three times during the rotation (NZFOA, 2009). Stem cankers, often associated with 

pruned stubs, have become increasingly noticeable in some Pinus radiata plantations 

in the lower South Island of New Zealand over the last 15 years (Dick and Crane, 

2009; Gadgil et al., 2003). The long, narrow cankers, commonly referred to as “flute 

cankers” for their elongated appearance, can extend for several metres above and for a 

shorter distance below a pruned branch stub. Formation of cankers associated with 

natural injuries on the stem internodes has rarely been observed (Dick and Crane, 

2009). Although tree crowns generally remain healthy, affected trees are susceptible to 

decay, to wind breakage at infected whorls, and wood quality can be affected. 

136


Neonectria fuckeliana (C. Booth) Castl. & Rossman (Nectria fuckeliana C. 

Booth) (Ascomycota: Nectriaceae) is the fungus most commonly found in 

association with the flute cankers (Dick and Crane, 2009). This pathogen is thought 

to be endemic to Northern Europe, Scandinavia and North America where it has 

been recorded principally as a common wound invader or weak pathogen of 

species of Picea and Abies (e.g. Roll-Hansen and Roll-Hansen, 1979; Schultz and 

Parmeter, 1990; Vasiliauskas and Stenlid, 1998). Pathogenicity of the fungus has 

been reported infrequently in Pinus spp., and this has been primarily as the result of 

artifical inoculations (Smerlis, 1969). The pathogen has three spore states. In 

addition its teleomorph, in which ascospores are produced in perithecia (the 

Neonectria phase), two anamorphs are formed under certain conditions: an 

Acremonium state with unicellular spores and a Cylindrocarpon state 

(Cylindrocarpon cylindroides var. tenue Wollenweber) with multicellular spores. 

Vasiliauskas and Stenlid (1997) demonstrated that, in Europe, the N. fuckeliana 

ascospores are probably the major dispersal propagules. The importance of the 

anamorphs in the pathogen life cycle and in disease development is not fully 

understood. 

In the Northern Hemisphere, open wounds, dead attached branches and branch 

stubs have been identified as the primary infection courts for N. fuckeliana (Roll- 

Hansen and Roll-Hansen, 1979). In New Zealand, since the development of the 

Nectria flute canker disease is primarily associated with pruned branch stubs, it 

was assumed that these branch stubs were the primary infection court (e.g. Bulman, 

2007). Recent studies by Power and Ramsfield (2006, 2007) however, suggest that 

this is not the only possible infection court for N. fuckeliana. In a study of 90 

pruned and 90 unpruned trees, the pathogen N. fuckeliana was found in 

approximately 22% of trees and no significant difference in frequency of the 

pathogen was found between pruned and unpruned trees. None of the trees 

examined showed symptoms of Nectria flute canker. This suggests that N. 

fuckeliana is able to enter trees prior to pruning using some other infection court/s. 

This paper outlines a number of trials currently being undertaken in southern New 

Zealand to identify possible alternative infection courts for N. fuckeliana. 

2. INFECTION THROUGH STEM WOUNDS 

A field trial was undertaken to examine the importance of different wound types 

and inoculum sources for disease development and fungal infection. Specifically 

the trial aimed to determine whether pruned branch stubs were an effective 

infection court for N. fuckeliana and, following on from Vasiliauskas and Stenlid 

(1997), whether ascospores were the most effective inoculum source. Forty-five 6year-old 

Pinus radiata were subjected to one of three wound types (shallow stem 

wound, deep stem wound or pruned branch stub) and one of three inoculation types 

(ascospore inoculation, conidial inoculation or a water control). Trees were 

assessed for the formation of stem depressions (the typical precursor to flute 

cankers) after 6, 12 and 18 months, after which time they were harvested and the 

137


spread of N. fuckeliana was examined within the tree using isolations. Wound type 

was found to be very important for flute canker development, with trees with deep 

wounds showing largest stem depressions and most spread of N. fuckeliana within 

the tree. Shallow stem wounds also resulted in some stem depressions however 

these were usually small and there was only a little vertical movement of the 

fungus through the stem. Inoculation of branch stubs resulted in few or small stem 

depressions and the fungus was largely contained within the branch trace. Both 

inoculation types (ascospores and conidia) resulted in similar levels of stem 

depressions and fungal spread within the tree. 

3. INFECTION THROUGH BRANCH CROTCHES 

Pinus radiata grown in the southern regions of New Zealand is frequently 

subjected to snow events during the winter months. Due to the acute branching 

angle of P. radiata this often results in severe branch bending and can lead to 

branch breakage. This severe branch bending can lead to openings in bark of the 

branch crotch which may provide an infection court for fungal spores. Forty eightyear-old 

Pinus radiata trees were used to examine this theory. On each tree, six 

branches of similar size were selected on the same or adjacent whorls. Each branch 

was then subjected to one of two bending treatments (bent with string to simulate 

the weight of snow on the branch, or unbent) and one of three inoculum sources 

(control, Acremonium conidia on a colonised twig, or a piece of bark containing N. 

fuckeliana perithecia with ascospores). The inoculum source was glued or stapled 

directly above the branch crotch. Trees were checked after 6 and 12 months for any 

canker development and no change to the trees was observed. After 18 months, 20 

of the trees were felled and dissected through the branch traces. Isolations were 

undertaken to determine whether N. fuckeliana was now present within the stem 

tissue. No N. fuckeliana was isolated. The remaining 20 trees will be monitored for 

a further 6-12 months and may be felled if any external symptoms of Nectria flute 

canker develop. 

4. INFECTION THROUGH BRANCH COLLARS 

Although inoculations directly into pruned stubs were not always successful at 

initiating N. fuckeliana spread throughout the stem (see section 2), the symptoms of 

Nectria flute canker are almost exclusively associated with pruned branches. 

Incidence of Nectria flute canker in a stand can be much higher than 22% (the 

proportion of colonisation recorded in unpruned trees) and so some infection may 

be occurring at the time of pruning. If the branch collar was damaged during 

pruning, it is possible that this branch collar may act as an infection court for N. 

fuckeliana. To investigate this, 41 eight-year-old P. radiata trees were pruned in 

the lower third of the stem and three branch collars on each tree were inoculated 

with an Acremonium spore suspension. Great care was taken to prevent the spore 

suspension spreading onto the rest of the pruned branch surface. The remaining 

138


branch stubs on each whorl were treated as controls and were not inoculated. After 

6 months, eight of the trial trees were showing very slight canker development 

from inoculated sites. Following 12 months stem depressions were recorded above 

17 of the 123 inoculated branch collars. This trial is ongoing and isolations will be 

made from trees felled after 18-24 months to determine whether N. fuckeliana had 

infected the stem and how far it has spread. 

5. DISCUSSION AND FUTHER RESEARCH 

The inoculation experiments described in this paper have given some insight 

into the potential infection mechanisms for N. fuckeliana in P. radiata in New 

Zealand. In the first trial, infection and symptom development was clearly 

demonstrated using both ascospores and conidia from the Acremonium stage. This 

indicates that spores from both these lifestages could potentially play a role in 

infection of this pathogen. In New Zealand however, although the Acremonium 

stage is produced in culture, it is rarely observed in the field. In contrast, perithecia 

producing ascospores of the teleomorph are frequently observed in the field and, 

due to their abundance, are much more likely to play a role in dispersal and 

infection of the pathogen. 

While both deep and shallow stem wounds in the first trial resulted in successful 

infection of N. fuckeliana and development of some stem depressions, it is unlikely 

that these infection mechanisms play an important role in infection in the field. 

Few wounds are found on P. radiata in plantations. Thus wounding is unlikely to 

play a role as a primary infection court for N. fuckeliana. 

Although no N. fuckeliana was isolated from inside the stems in the branch 

crotch trial this does not rule out branch crotches as an infection court for this 

pathogen. During the experiment, it was very difficult to simulate the effect of 

snow weight on branches, particularly any repetitive opening and closing of the 

branch crotch associated with branch movement. As a result, the experimental 

conditions may not have been sufficient to allow penetration of spores into the 

stem. Further trials of this nature are planned. 

6. REFERENCES 

Bulman, L.S., 2007. Nectria pruning trial. Forest Health News 179,1-2. Available from 

http://www.ensisjv.com/NewsEventsandPublications/Newsletters/ForestHealthNews/Fore 

stHealthNewsArchive/tabid/179/Default.aspx [accessed 6 March 2009]. 

Dick, M.A. and Crane, P.E., 2009. Neonectria fuckeliana is pathogenic to Pinus radiata in New 

Zealand. Australasian Plant Disease Notes 4, 12-14. 

Gadgil, P.D., Dick, M.A. and Dobbie, K., 2003. Fungi Silvicolae Novazelandiae: 4. New Zealand 

Journal of Forestry Science 33, 265-272. 

NZFOA (New Zealand Forest Owners Association). 2009. New Zealand Forest Industry Facts and 

Figures 2008/2009 booklet. Available from www.nzfoa.org.nz. [accessed 5 June 2009]. 

139


Power, M.W.P. and Ramsfield, T.D., 2006. Nectria disease of radiata pine. Forest Health News 

165,1-2. Available from 



Power, M.W.P. and Ramsfield, T.D., 2007. Nectria fuckeliana in pruned and unpruned trees. Forest 

Health News 175,1. Available from 



Roll-Hansen, F. and Roll-Hansen, H., 1979. Microflora of sound-looking wood in Picea abies stems. 

European Journal of Forest Pathology 9, 308-316. 

Schultz, M.E. and Parmeter, J.R., 1990. A canker disease of Abies concolor caused by Nectria 

fuckeliana. Plant Disease 74,178-180. 

Smerlis, E., 1969. Pathogenicity tests of four pyrenomycetes in Quebec. Plant Disease Reporter 

53, 979-981 

Vasiliauskas, R. and Stenlid, J., 1997. Population structure and genetic variation in Nectria 

fuckeliana. Canadian Journal of Botany 75, 1707-1713. 

Vasiliauskas, R. and Stenlid, J., 1998. Fungi inhabiting stems of Picea abies in a managed stand in 

Lithuania. Forest Ecology and Management 109,119-126. 

140



PRELIMINARY RESULTS OF MYCOFLORA ASSOCIATED WITH 

CANKERS ON Cupressus sempervirens var. horizontalis (Mill.) GORDON IN 

TURKEY 

ABSTRACT 

Asko Lehtijärvi 1* , H. Tugba Doğmuş- Lehtijärvi 1 , Funda Oskay 1 , 

A. Gülden Aday 1 

1 Suleyman Demirel University, Faculty of Forestry, 32260 Isparta, Turkey 


Natural stands of C. sempervirens in Turkey are among the largest forests of this species 

in the world and are regarded as relicts of the centre of origin of var. horizontalis. However, 

phytopathological status of these stands was not investigated so far. In this study, canker 

formations were investigated in trees, saplings and seedlings of C. sempervirens var. 

horizontalis within natural stands located in Köprülü Kanyon National Park, Antalya and 

Aydıncık, Mersin. Incidence of the cankers and some other disease associated symptoms 

and signs of insect attacks on sampled trees were recorded. Isolations were made from 

cankers, and the obtained fungal cultures identified morphologically. 

Cankers were present on the trunk or branches of 34.4% of the totally 1023 trees 

sampled. Canker incidence was greater in Aydıncık than in Köprülü Kanyon, 38.0 % vs. 

29.8%, respectively. Totally 497 fungal isolates, representing 30 genera, were obtained. 

The most common species isolated from both Aydıncık and Köprülü Kanyon was: 

Phomopsis cf. occulta (44 and 22 %), unidentified coelomycete (22 and 6%), Alternaria 

spp. (5 and 13%), Cladosporium spp. (5 and 5%), Cytospora sp. (4 and 2%) and 

Pestalotiopsis funerea (1 and 37%, respectively). While P. cf. occulta was the most 

common species in Aydıncık, P. funerea - which was rare in Aydıncık - was the most 

frequently isolated species in Köprülü Kanyon. To our knowledge, with the exception of P. 

funerea, these species are new records on cypress in Turkey. Moreover, both P. occulta and 

P. funerea are reported to be pathogenic on cypress, especially under stress conditions. 

Keywords: Cupressus sempervirens var. horizontalis, Canker, Fungi 


Cupressus sempervirens L., the Mediterranean cypress or common cypress, is a 

long established cultivated forest tree species exterior to its natural geographic 

range. However its natural geographic distribution had been restricted to disjoint 

and often relict populations within Iran, Syria, Jordan, Lebanon, Libya, the 

Aegean Islands, Crete, Turkey, and Cyprus, which are thought to be being 

remnants of an extensive C. sempervirens forest, (Raddi and Sümer, 1999; Ducrey 

et al., 1999). The natural stands of Cupressus. sempervirens var. horizontalis 

(Mill.) Gordon in Turkey are considered among the most significant and largest 

natural Mediterranean cypress communities (Neyişçi, 1989; Özçelik, 2005), and 

141


regarded as the relicts of the original source of C. sempervirens var. horizontalis 

due to the high diversity observed among the populations (Koral et al., 1997; Raddi 

and Sümer, 1999; Ducrey et al., 1999). However, they constitute only 1392.5 ha of 

forests within Turkey, where more than 75% of the total is degraded (Anonymous, 

2006). The largest pure and mixed stands (mixed with Pinus brutia Ten.) of the 

species are located in Köprülü Kanyon National Park, Antalya and in Aydıncık, 

Mersin. Other cypress forests in Turkey are located mostly in the south-western 

part of Turkey as small stands mainly mixed with Pinus brutia Ten. (Sabuncu, 

2004). As everywhere else within its distribution area, the Mediterranean cypress 

forests in Turkey have been frequently endangered by human activities, such as 

deforestation and wild fires, as well as by overgrazing. 

Several species of fungi have been associated with diseases of natural and 

cultivated varieties of C. sempervirens. Among these fungi, Seiridium cardinale 

(Wag.) Sutton and Gibson, the causal agent of the canker disease which had caused 

heavy damage in forests, nurseries and ornamental plantations, especially in the 

Mediterranean countries, has taken the most attention (Graniti, 1986, 1998). On the 

other hand, many pathogens, such as Diplodia pinea f.sp. cupressi Solel, Madar, 

Kimchi & Golan, Phomopsis occulta (Sacc.) Trav., Pestalotiopsis funerea (Desm.) 

Steyaert, Fusarium sp. Link, Cytospora sp. and Lasiodiplodia theobromae (Pat.) 

Griffon & Maubl., (syn: Botryodiplodia theobromae (Pat.)) have also been found to be 

the causal agents of the cankers on cypress (Solel et al., 1987; Bruck et al., 1990; 

Madar et al., 1991, 1996; Linde et al., 1997; Ducrey et al., 1999; Gonthier and 

Nicolotti, 2002; Bajo et al., 2008). 

Although there are many reports on the phytopathological problems – especially 

associated with Seiridium cardinale – of Mediterranean cypress where it has been 

introduced, information of the relict stands of C. sempervirens is available only for 

Greece and Cyprus (Xenopoulos and Diamandis, 1985; Tsopelas et al., 2007, 

2008). The only exception is the paper by Sümer (1987) reporting two pathogens in 

the Aegean coast of Turkey, S. cardinale (in Muğla) and P. funerea. No further 

studies have been performed since then. 

In this study, the presence of canker formations, top and crown diebacks, 

foliage symptoms, resin exudation from the trees and insect associations were 

investigated within natural cypress stands in two locations. In addition, isolation of 

fungi from cankered tissues was tried. 

2. MATERIALS and METHODS 

2.1. Survey locations and sampling 

The surveys and samplings were conducted in two natural stands of C. 

sempervirens var. horizontalis located within Köprülü Kanyon National Park in 

Antalya province and in Aydıncık Forestry Enterprise in Mersin, during September 

and December 2008, respectively. The location, altitude, and some topographic and 

stand characteristics of the sampling plots are given in Table 1. 

142


The Köprülü Kanyon National Park (37º01′N and 31º14′E) is located in the 

western part of the Taurus Mountains in Antalya province in southern Turkey. The 

annual average rainfall is 1140.5 mm and the annual average temperature is 18.3 

ºC. The cypress forest in the national park is composed of pure (195.6 ha) and 

mixed stands with P. brutia (255.6 ha) at elevations ranging from 650 to 950 m 

(Anonymous, 2008). 

Aydıncık (36º11′N and 33º27′E) is situated along hillsides of the central part of 

the Taurus Mountains facing Mediterranean Sea coast in Mersin province, 325 km 

east of Antalya. The annual average rainfall is 936.2 mm and the annual average 

temperature is 19.1ºC. While degraded (292.5 ha) and normal (88.5 ha) stands 

comprised a total of 381 ha of cypress forest in Aydıncık, within the same basin the 

total cypress forests made up 1247.5 ha, at elevations from 20 to 120 m, 

representing the largest distribution area of this variety (Özçelik, 2005). The 

cypress forest within Aydıncık, composed of pure and mixed stands (P. brutia) was 

mostly spread along the valley of the Sipahili (Babadili) stream. 

Sampling 

plots 

Table 1: Characteristics of the sampling plots 

Location Latitude 

(N) 

Coordinates 

Longitude 

(E) 

Altitude 

(m a.s.l.) 

143 

Exposure Description 

KK1 Köprülü Kanyon 37 º12′ 31 º09′ 710 S Groups of seedlings and saplings along road side 


KK3 Köprülü Kanyon 37 º13′ 31 º08′ 736 SE Groups of seedlings and saplings along road side 


KK5 Köprülü Kanyon 37 º12′ 31 º09′ 740 SE Groups of seedlings and saplings along road side 


M1 Aydıncık 36° 11' 33° 27' 49 W Degrade, Mixed with P. brutia 

M2 Büyükeceli 36 °11' 33° 27' 6 W Degrade, Mixed with P. brutia 

M3 Aydıncık, Babadili 36°12' 33° 27' 24 SE Degrade, Mixed with P. brutia, Gene protection forest 

M4 Aydıncık, Babadili 36°12' 33° 27' 29 E Degrade, Mixed with P. brutia, Gene protection forest 

M5 Aydıncık, Babadili 36°12' 33° 27' 172 E Pure, Gene protection forest 

M6 Aydıncık, Karaseki 36°10' 33°23' 61 NE Degrade, Pure, along stream 

M7 Aydıncık, Babadili 36° 12 ' 33° 27' 157 E Pure, Gene Protection Forest 

M8 Aydıncık, Babadili 36° 11' 33 °27' 114 NE Pure 

M9 Aydıncık, Babadili 36° 11' 33 °27' 72 E Degrade, Pure 

M10 Aydıncık, Duruhan 36°13' 33°17' 482 N 

Degrade, Mixed with P. brutia, along stream and 

agricultural fields 

In Köprülü Kanyon, seedlings and saplings of C. sempervirens along the road 

sides within 6 sampling plots, and in Aydıncık cypress trees of different age classes


within 10 sampling plots were investigated for the canker formations on branches 

and trunks. In Aydıncık, sampling plots were consist of four circular sub-sampling 

plots with a 10–m–radius, located 25 m to the north, east, south and west from the 

plot centre. While in Köprülü Kanyon the length of the cankers and the height of 

the cankers above ground, as well as tree features were recorded, no such 

measurements were done in Aydıncık. Contrary to the survey conducted in 

Köprülü Kanyon, in Aydıncık trees were also assessed for top and crown dieback, 

resin exudation, foliage symptoms, and insect damage. 

2.2. Fungal isolation and identification 

Branch and trunk samples with cankers were collected from a number of trees 

within the sampling plots and transferred to the laboratory. The samples were 

surface sterilized with 70% ethanol, the outer tissues near the canker margins were 

removed with a sterile scalpel, and small pieces of the affected bark transferred 

onto potato dextrose agar plates (PDA; Merck, Darmstadt, Germany). Some of the 

samples were incubated in moist-chamber in order to induce formation of fruiting 

bodies on plant tissues. The cultures incubated at 25 ºC were identified according 

to their morphological characteristics. 


During the surveys, in Köprülü Kanyon and in Aydıncık, 449 and 574 trees, 

respectively, were examined (totally 1023 trees). Bark cracks and cankers, as well 

as resin drops and moderate to heavy resin flows were present on the trunk, 

branches and twigs at all sites. Of the 1023 trees examined, 34.4% (352) were 

bearing at least one canker. Canker incidence was greater in Aydıncık than in 

Köprülü Kanyon, 38.0 and 29.8%, respectively. Branch cankers were more 

frequent than trunk cankers in Aydıncık (31.7% and 17.9%, respectively), while in 

Köprülü Kanyon trunk cankers were significantly more common. Bark cracks 

exuding resin, especially on branches and twigs, were observed often in Aydıncık, 

where small perennial resin soaked cankers on declining lower branches were also 

found. 

While in Köprülü Kanyon the length of the cankers and the height of the 

cankers above ground, as well as the tree height and diameter were recorded (Table 

2), no such measurements were done in Aydıncık. In Köprülü Kanyon, among the 

seedlings and saplings investigated, the average height and diameter at breast 

height of 134 canker bearing individuals were 360.5 and 5.6 cm, respectively. In 

this site, majority of the cankers observed were on the road–facing parts of the 

saplings, mostly under breast height (mean 81.1cm). On the other hand, grazing 

damage was also remarkably more prevalent in Aydıncık, especially on lower 

branches where canker formations were also common. Therefore it is likely that 

wounds resulting from grazing have worked as suitable entrance points for canker– 

causing pathogens. 

144


Table 2: Results of Köprülü Kanyon sampling area 

Sampling 

plot 

No of trees 

No of 

trees with 

cankers 

Proportion 

of trees with 

cankers 

(%) 

145 

(trees with 

cankers) 

average values 

for; (cm) 

Height D1,3 

Average 

height of 

cankers above 

ground 

(cm) 

KKK1 30 5 16.7 282.6 3.4 66.3 

KKK2 162 62 38.3 385.6 7.3 91.3 

KKK3 127 17 13.4 262.9 6.1 133.0 

KKK4 56 32 57.1 490.0 6.0 119.1 

KKK5 36 15 41.7 250.0 3.3 23.0 

KKK6 38 3 7.9 491.7 7.5 53.6 

Total 449 134 - - - - 

Avarage 74.83 22.33 29.2 360.5 5.6 81.1 

In Aydıncık, the number of trees per sampling plot varied from 28 to 86 with a 

mean value of 57.4 (±21SD). The average tree height and diameter in the whole 

Aydıncık sampling area were 586.7 (±368.8 SD) and 14.9 cm (±12.6 SD), 

respectively. There were significant differences in average diameter and height of 

trees between sampling plots (Table 3). While the highest averages were in the 

sampling plot M7, the lowest ones were in the M8. On the other hand, correlations 

of symptom incidences with tree size (Table 4) were not significant, with the 

exception of the negative correlation between tree diameter and foliage symptoms. 

The highest canker incidence was in the M5 plot (52.3%), followed by the M8, 

M4, M9, M3 plots (range approximately 40-50%). The canker incidence (7.7%) as 

well as the other assessed symptoms had the lowest values in the M6 plot. The 

highest incidence of top dieback, crown dieback, resin exudation, and foliage 

symptoms was in the M9 (23.5%), M4 (18.1%), M8 (66.2%) and M10 plots 

(51.0%), respectively. Insect damage was the most frequent in the M8 plot (53.8%) 

and occasional in the M1 plot (3.6%). 

Table 3: Number and size of trees and incidence of symptoms in the sampling plots in 

Aydıncık. 

Sampling 

plot 

No of trees 

Diameter 

cm 

Tree sizes Number of individuals exhibiting symptoms of; . 

Height 

cm 

Canker 

Top 

dieback 

Crown 

dieback 

Resin 

exudation 

Foliage 

symptoms 

M1 28 17.6±11.9b 555.5±319.8b 6 1 1 4 1 1 

M2 53 15.0±10.2bc 572.8±374.7ab 16 3 1 10 5 1 

M3 83 15.4±11.9bc 609.3±380.3ab 33 8 11 47 5 9 

M4 83 15.2±12.7bc 634.8±415.8ab 36 9 15 50 17 20 

M5 86 13.0±10.0bc 583.3±307.9ab 45 5 7 50 17 22 

M6 39 17.3±11.8b 606.8±264.7ab 3 0 0 3 3 3 

M7 37 24.8±20.0a 734.4±480.1a 12 4 3 20 6 18 

M8 65 10.5±6.0c 497.4±353.1b 32 6 8 43 18 35 

M9 51 12.7±10.7bc 497.4±353.1b 21 12 9 24 23 15 

M10 49 14.6±16.8bc 576.8±481.4ab 14 4 2 27 25 18 

Σ 574 - - 218 52 57 278 120 142 

Avr. 

± SD 

57.4±20.9 14.9±12.6 

586.7±368.8 

Insect 

Damage 

21.8±14.0 5.2±3.7 5.7±5.1 27.8±18.7 12.0±8.9 14.2±10.8

Incidence (%) 

70,0 

65,0 

60,0 

55,0 

50,0 

45,0 

40,0 

35,0 

30,0 

25,0 

20,0 

15,0 

10,0 

5,0 

0,0 


M1 M2 M3 M4 M5 M6 M7 M8 M9 M10 M 

Sampling Plots 

Canker Top dieback Crown dieback Resin exudation Foliage Symtomps Insect damage diameter height 

Figure 1: The mean incidences of canker, top and crown dieback, resin exudation, 

foliage symptoms and insect damage within sampling plots (M1-M10) and in the whole 

sampling area (M) in Aydıncık, as well as the mean diameter and height of the trees (the 

bars on height and diameter lines indicate the standard deviations). 

Top dieback, crown dieback and resin exudation were significantly correlated 

with canker formations (p


species isolated from both Köprülü Kanyon and Aydıncık were; P. cf. occulta (22 

and 44 %), unidentified coelomycete (6 and 22%), Alternaria spp. (13 and 5 %), 

Cladosporium spp. (5 and 5%), Cytospora sp. (2 and 4%) and P. funerea (37 and 

1%), respectively. While P. cf. occulta was the most common species in Aydıncık, 

P. funerea - which was rare in Aydıncık - was the most frequently isolated species 

in Köprülü Kanyon. Fungi isolated from both sampling area agrees slightly with 

those stated in previous studies (Munoz and Ruperez, 1980; Ducrey et al., 1999; 

Madar et al., 1991; Gonthier and Nicolotti, 2002; Bajo et al., 2008). Moreover, P. 

cf. occulta, P. funerea and Cytospora sp. are reported to be pathogenic on cypress, 

especially under stress conditions. However, neither S. cardinale nor other cypress 

canker related Seiridium species was recovered in this study. Nor were there well– 

known canker causing fungal pathogens of cypress, such as B. theobromae and D. 

pinea f.sp. cupressi, among the isolates. This indicates that either the pathogens 

were missing from the studied stands or replaced by other fungi in the sampled 

cankers. On the other hand, as the study areas were large, a sampling strategy 

focusing in sampling only the fresh cankers could have given different results. 

Nevertheless, the absence of e.g. S. cardinale in the study areas may not indicate 

that the native populations would be highly resistant against the pathogen, since the 

previously tested Turkish provenances (including Köprülü Kanyon –Zerk–, but not 

Aydıncık) tended to have only intermediate resistance against S. cardinale (Santini 

and Di Lonardo, 2000). The absence may be due to other factors including 

geographical barriers (Santini and Di Lonardo, 2000). 

In Köprülü Kanyon, P. funerea was isolated nearly from all cankers sampled. This 

species is endemic in Europe and is also present in the native areas of cypress, and 

therefore considered to have co-evolved with C. sempervirens (Santini and Di Lonardo, 

2000). It is considered a weak pathogen of a wide range of conifer hosts including 

species in the following genera: Cupressus, Pinus, Juniperus and Thuja (Madar et al., 

1991; Sinclair et al., 1993; Santamaria et al., 2007). Moreover, it is also thought to be 

capable of replacing other pathogens such as S. cardinale (Sanches and Gibbs, 1995). 

During the survey in Köprülü Kanyon fruiting structures on plant tissues were not 

noticed, however in Aydıncık, there were unripe fruiting structures on the plants. 

Ecology of Cytospora sp., P. funerea and P. cf. occulta could differ between the two 

study areas, however, the differences could have been caused by the different sampling 

times or climate as well. 

In conclusion, canker incidence in natural C. sempervirens var. horizontalis 

stands in southern Turkey was relatively high. To our knowledge, all obtained 

fungal species, except P. funerea, are new records on cypress in Turkey. None of 

the fungi is reported to be an aggressive pathogen, but could be harmful under 

stress conditions. 

ACKNOWLEDGEMENTS 

Financial support from the TUBITAK (Project No. TOVAG-108 O 287) is 

gratefully acknowledged. The authors are thankful to Dr. Gürsel Karaca for the 

identification of fungi. 

147

REFERENCES 


Anonymous, 2006. Orman Varlığımız, T. C. Orman Bakanlığı, Orman Genel Müdürlüğü, Ankara. 

Anonymous, 2008. Antalya İl ve Çevre Orman Müdürlüğü, Köprülü Kanyon Milli Parkı İşletme 

Şefliği Fonksiyonel Orman Amenajman Planı (2008-2017) 

Bruck, R.I., Solel, Z., Ben-Ze'ev, I.S., Zehavi, A., 1990, Diseases of Italian cypress caused by 

Botryodiplodia theobromae Pat. Eur. J. For. Path. 20:392-396. 

Bajo, J., Santamaría, O. and J. J. Diez, 2008. Cultural characteristics and pathogenicity of 

Pestalotiopsis funerea on Cupressus arizonica. Forest Pathology, 38 (4), 263-274. 

Ducrey M. (ed.), Barthélémy D. (ed.), Pichot C. (ed.), Giannini R. (ed.), Raddi P. (ed.), Roques A. 

(ed.), Sales Luis J. (ed.), Thibaut B. (ed.), Teissier Du Cros E.. 1999. Cypress: a practical 

handbook. Florence, Studio Leonardo, 139 p. 

Graniti, A. 1986. Seiridium cardinale and other cypress cankers. Bull. EPPO/OEPP Bull. 16:479– 

486. 

Graniti, A., 1998. Cypress canker: A Pandemic in Progress. Annual Review of Phytopathology. 36: 

91- 114 

Gonthier, P., and G., Nicolotti, 2002. First report of Pestalotiopsis funerea on Cupressocyparis 

leylandii in Italy. Plant Dis. 86, 1402. 

Korol, L., Kara, N., Işık, K and Schiller, G., 1997. Genetic Differentiation Among and within Natural 

and planted Cupressus sempervirens L. Eastern Mediteranean populations. Silva 

Genetica. 46(2-3), p 151- 155. 

Linde, C., Kemp, G.H.J., Wingfield, M.J., 1997. First report of Sphaeropsls canker on cypress in 

South Africa. Eur. J. For. Path. 27:173-177 

Neyişçi, T., 1989. Beşkonak Saf Servi (Cupressus sempervirens L.) Ormanında Ekolojik 

Araştırmalar, Ormancılık Araştırma Enstitüsü Yayınları, Teknik Raporlar Serisi:43, s.49- 

76. 

Madar, Z., Solel, Z., Kimchi M., 1991. Pestalotiopsis canker of cypress in Israel, Phytoparasitica, 

Volume 19 (1);79-81 

Madar, Z., Kimchi M., Solel, Z., 1996. Fusarium canker of Italian cypress. Eur. J. For. Path. 26:107- 

112 

Munoz, C., Ruperez, A., 1980: Causas de la desaparición de los cipreses en España. Bol. Serv. Plagas, 

6: 95-104. 

Özçelik, R., 2005. Aydıncık Yöresi Doğal Dallı Servi (Cupressus sempervirens L. var. horizontalis 

(Mill) Gord) Meşcerelerinde Homojenlik Durumunun ve Gövde Niteliklerinin 

Değerlendirilmesi. Batı Akdeniz Ormancılık Araştırma Müdürlüğü Dergisi, Sayı:6 29-42. 

Raddi, S. and Sümer, S., 1999. Genetic diversity in natural Cupressus sempervirens L. populations in 

Turkey. Biochemical Systematics and Ecology 27. 799-814 

Sabuncu, R., 2004. Dallı Servide Fidan büyüme karakteristikleri Açısından Genetik Çeşitlilik, Batı 

Akdeniz Ormancılık Araştırma Müdürlüğü, Teknik Bülten No: 22, 28 s., Antalya. 

Sanchez, E. and Gibbs, J.N., 1995. The ecology of fungal cankers on Cupressus macrocarpa in 

southern England. Eur. J. For. Path. 25, 266-273 

148


Santamaría, O., Bajo, J., Pajares, J.A. and Diez, J.J., 2007. Susceptibility of Cupressus arizonica and 

Pinus pinea to Pestalotiopsis funerea Isolates. Acta Silv. Lign. Hung., Spec. Edition, p. 

283 

Santini, A. and Di Lonarda, V., 2000. Genetic variability of the ‘bark canker resistance’ character in 

several natural provenances of Cupressus sempervirens. Forest Pathology. 30: 87-96. 

Sinclair, W. A.; Lyon, H. H.; Johnson, W. T., 1993. Diseases of Trees and Shrubs. New York:Cornell 

University Press. 

Solel, Z.,Madar, Z., Kimchi, M., Golan, Y., 1987. Diplodia canker of cypress. Can. J. Plant Pathol. 

9:115-118 

Sumer, S., 1987. The distribution of cypress (Cupressus L.) in Turkey and the current status in its 

pests and diseases, especially cypress canker disease. Istanbul Univ. Orman Fakultesi 

Dergisi 37:56-66. 

Tsopelas, P., Barnes, I., Wingfield M.J., Xenopoulus, S., 2007. Seiridium cardinale on Juniperus 

species in Greece. Forest Pathology. 37:338-347. 

Tsopelas, P., Angelopoulos, A., Nikolaou, K., 2008. Seiridium cardinale is a new threat to cypress 

trees in Cyprus. Plant Pathology 57(4), 784. 

Xenopoulos, S., And Diamandis, S., 1985. A Distribution Map For Seiridium cardinale Causing The 

Cypress Canker Disease In Greece, European Journal of Forest Pathology, V. 15(4) P. 

223-226 

149



SOME MORPHOLOGICAL ASPECTS OF EUTYPELLA CANKER OF 

MAPLE (Eutypella parasitica) 

ABSTRACT 

Nikica OGRIS * , Barbara PIŠKUR, Dušan JURC 

Slovenian Forestry Institute, Večna pot 2, 1000 Ljubljana, Slovenia 

* nikica.ogris@gozdis.si 

Eutypella canker of maple originates from North America and was recently reported 

from Slovenia, Austria and Croatia. Disease distribution and frequency in the surveyed 

forest stands in Slovenia, Eutypella canker shape and its extent on the trunk, fungi present 

in discolored wood, perithecia density, and ascospore discharge were explored. Diseased 

maples were usually grouped into infection centers and the disease occurred on 3–5% of all 

maple trees at surveyed forest stands. However, incidence up to 30% was recorded. The 

canker was usually oval shaped and the average area of the canker was 48% of the affected 

part of the trunk. Canker width measured about a half (0.44) of canker length. 54.8% of all 

isolates (2,276) from discolored wood were identified as Eutypella parasitica. Perithecia 

covered an average of 32% of the total cankered area. A good correlation existed between 

the area with perithecia and the whole cankered area. In average, 647,000 perithecia per 

canker were found. The average discharge was 506,000 ascospores cm –2 h –1 . One Eutypella 

canker discharged from 65 million to 3.3 billion ascospores h –1 , with an average of 1.0 

billion ascospores hour –1 under favorable environmental conditions. The inoculation 

potential of the fungus is enormous but its rapid colonization of European forests is 

prevented by ineffective mode of transmission and slow development of the disease. 

Keywords: shape, area, perithecia density, ascospore discharge, frequency, Acer 


Eutypella canker of maple caused by the fungus Eutypella parasitica R. W. 

Davidson & R. C. Lorenz is a well-known disease in North America in the area 

around the Great Lakes where it was first found and described (Davidson and 

Lorenz, 1938). In Slovenia and Europe, the disease was not reported until 2005 

although it seems to have been present for some time prior to this (Jurc et al., 

2006). The disease was also reported from Austria (Cech, 2007) and Croatia (Ogris 

et al., 2008). The means of the disease introduction into Slovenia is not known. The 

hosts of the disease are maples (Acer spp.). When a disease is introduced to new 

location, new hosts can emerge. Similar scenario was observed with Eutypella 

canker, when field maple (A. campestre L.) has been found to be a new host of E. 

parasitica (Ogris et al., 2005). About 35% of known cankered trees in Slovenia are 

field maples. The most susceptible maple in Slovenia is sycamore maple (A. 

150


pseudoplatanus L., 54% of cankered trees), while only 3.5% trees with Eutypella 

canker are Norway maple (A. platanoides L.). In North America, the disease is a 

common perennial canker on sugar maple (Acer saccharum Marsh.), red maple (A. 

rubrum L.), infrequently occuring on boxelder (A. negundo L.), Norway maple, 

silver maple (A. saccharinum L.), black maple (A. nigrum Mich.), sycamore maple, 

striped maple (A. pennsylvanicum L.), and bigleaf maple (A. macrophyllum Prush.) 

(Davidson and Lorenz, 1938; French, 1969; Kliejunas and Kuntz, 1972; 1974). 

One of the reasons for performing additional research on Eutypella canker was 

the outcome of a spread risk assessment of the disease for Europe (Ogris et al., 

2006). 13% (1,404,000 km 2 ) of Europe's land area was found to be at very high risk 

for E. parasitica due to favorable host range and suitable climatic conditions. 

Regions with very high spread risk extends in the Balkans (Slovenia, Bosnia and 

Herzegovina, Serbia and Montenegro, Croatia), Southern Europe (some parts of the 

Apennines, the central part of the Pyrenees), Central Europe (all parts of Austria 

except the eastern part, the whole Czech Republic, northern and southern parts of 

Slovakia, central and southern part of Germany, almost all of Poland except the 

northeastern part), Western Europe (northern half of Switzerland, eastern part of 

France), and Eastern Europe (some parts of Moldova, eastern region of Ukraine, 

Caucasus). The sycamore maple, field maple, and Norway maple are predicted to 

be the most endangered. 

The aim of this work was to explore the morphological characteristics of the 

Eutypella canker that may explain the as yet unrevealed capacity of the disease to 

spread. This work represents a supplement to the current knowledge of the disease. 

Parts of the study are tests of validity that have been stated in different papers 

earlier but not yet tested; some hypotheses are checked again. This work supplies 

information about Eutypella canker shape, area, fungi present in discolored wood, 

perithecia density, ascospore discharge, the disease distribution tendencies and 

frequency in the stand. 


2.1. Description of the sites 

Samples were taken from six locations. (1) Rožnik hill is an urban forest just 1 

km from the center of Ljubljana, the capital city of Slovenia. Rožnik hill rises 

about 130 m above Ljubljana (429 m above sea level) and covers over 380 

hectares. For analysis, 16 diseased trees (13 sycamore maples, 3 field maples) were 

taken from three infection centers. (2) A single specimen on sycamore maple was 

collected at Topol at Medvode (650 m a.s.l.); this is one of the westernmost 

locations in Slovenia where Eutypella canker has been found and is 9 km far from 

Ljubljana. The other four sites are located in the eastern part of Slovenia. (3) Jelški 

hill (310 m a.s.l.) is 60 km east from Site 1 and is located near Sevnica rising over 

the Sava River. Two specimens on sycamore maple were found at this location and 

both trees were cut down and included in the analysis. (4) The fourth site is 7 km 

151


from Site 3 and is near to Sevnica. It is located on Kremenc hill (350 m a.s.l.) 

where two specimens of Eutypella canker on sycamore maple were found and 

collected on shady side of the hill. (5) A single diseased sycamore maple was 

found at Bohor hill (580 m a.s.l.), near the town of Kozje, which is located 22 km 

east of site 4. (6) Site 6 is located at Rogaška Slatina (230 m a.s.l.) where 55 

Eutypella cankers were found – all on field maple. This site is the most eastern 

place where Eutypella canker of maple was found in Slovenia. It is located about 1 

km from the border with Croatia. At Site 6 one field maple was gathered. Distance 

from Site 1 is 90 km. Altogether, of the 23 diseased trees collected, 19 trees were 

sycamore maple and 4 trees were field maple. Sites 1–5 had rich, rather moist soils 

in common which suits the sycamore maple’s demands for water, while Site 6 

parent material was sandstone, soils were quite warm and dry, and location was on 

sunny side of the hill. 

Site 1 and 6 were chosen to determine the frequency of Eutypella canker of 

maple in forest stands. 

2.2. Common measurable characteristics 

Some basics measurements were made for all specimens collected. (1) The 

position of canker on trunk was measured from the ground to the center of the 

canker which is usually represented by a dead branch stub (Davidson and Lorenz, 

1938). When the centre of the canker was within arm’s reach the position was 

determined by tape measure, otherwise a Haglöf Sweden Vertex III height 

measurer was used. (2) The diameter of trees at breast height was measured by log 

calliper. (3) Canker circumference was determined by tape measure at the centre of 

the canker. (4) Canker length was determined by tape measure. 

2.3. Area and shape of the canker on the trunk 

The canker area was measured and calculated for all 23 specimens collected. 

Area measurement was performed by fastening a transparent plastic foil to canker 

by pins and drawing the outline of the canker using permanent marker. Three 

different densities of perithecia, bark without perithecia, and areas where bark had 

already fallen off were also marked on the foil. The foil was then put down on a 

flat surface with white paper for background and the contours were digitalized. 

Each digital photo was taken with a 10 cm long scale bar to allow for the correct 

calibration of the photos. The areas were calculated using Soft Imaging System 

analySIS ® Pro function for measuring arbitrary areas. The areas of different 

densities of perithecia were used later for calculating ascospore discharge at the 

level of the whole canker. 

2.4. Isolates 

Dissectional study enabled us to determine the places where the fungus actually 

lives and is active. It also enabled us to search for other species of fungi present in 

the canker. Trunk cross sections were taken at 10 cm intervals. The isolations were 

made as described below. Samples were taken within a period of 24 hours after 

152


dissecting the trunk into discs. Samples of discolored or decayed wood were taken 

from each second disc from eight cankered trunks. One trunk was analyzed in 

detail and samples were taken from each disc. At least three samples of healthy 

wood (showing no discoloration) from each trunk were taken as a control. When 

taking samples, attention was given to the margin of decayed wood, the various 

colors of decayed wood, the different phases of decay, and, in some cases, to the 

dried zone of wood observed around the margin of the decayed wood. The samples 

were taken with a boring machine with a wood borer of 12 mm diameter. Between 

each boring the borer was sterilized by flaming with 96% (v/v) ethanol and was 

then cooled down by dipping it in cool distilled water for few seconds. First, a 1–3 

mm deep hole was made to eliminate possible contaminants and after flame 

sterilization of the borer the sample for fungal isolation was taken. The boring 

chips were collected in sterile Petri dishes. Up to five samples were taken per disc. 

From each sample four isolations on 2% (w/v) malt extract agar (MEA) were made 

with two repetitions. The sample was represented by a boring chip 2–3 mm × 2–3 

mm in size. Altogether, 2276 isolations were made. Pure cultures were made of 

every fungus growing from the sample. Cultures were incubated at 24°C for 4 

weeks. 

2.5. Density of perithecia and ascospore discharge 

Three different densities of perithecia were distinguished when the area of the 

Eutypella canker was measured. This enabled an assessment of ascospore 

production of the canker in a more accurate way. Three different densities of 

perithecia were then sampled. Each sample was checked for the maturity of its 

perithecia before it was used in the test. The maturity test was performed on the 

bark area just next to the area of perithecia that was taken into the test of ascospore 

discharge. Mature perithecia are full of dark brown ascospores (Davidson and 

Lorenz, 1938), young perithecia are white inside, and old perithecia are empty 

when moistened. After the maturity test, the samples were cut to approximately 1 

cm 2 . The exact area of the sample was determined after the test using analySIS 

software. Because the samples had been air-dried they had to be immersed in water 

for at least 30 min (Johnson and Kuntz, 1979). We immersed the samples in 

distilled water for 1 h, and then the bark samples with perithecia were put on moist 

filter paper for 3 hours, which is necessary for ascospore discharge to begin 

(Lachance, 1971; Johnson and Kuntz, 1979). The sample with underlaying moist 

filter paper was fixed to a rubber stopper with thin needle. Ascospores were 

discharged into test tubes with a 2 cm diameter to which 2 ml 0.01% (v/v) 

detergent Tween ® 80 solution had been added. Ascospores were allowed to 

discharge for 3 hours at room temperature about 22°C. Ascospores were counted 

using a Bürker-Türk counting chamber. The calculation of the number of 

ascospores discharged per cm –2 h –1 was corrected using the exact area of the 

sample. The samples were also histologically examined and the number and 

maturity of the perithecia were determined. 

153

3. RESULTS 


3.1. Incidence of the disease in forest stands 

Site 1 had the greatest number of diseased trees, altogether 70 trees. Eutypella 

cankers usually form infection centers, while single occurrences are rarely found 

(Kliejunas and Kuntz, 1974; Martinez, 2003) since ascospores are disseminated 

only over short distances (Johnson and Kuntz, 1979). There were four infection 

centers and six single trees distributed around the hill. A full inventory of one 

infection centre at Site 1 was performed. All trees were identified and measured for 

their diameter at breast height (DBH) within an area of 2.7 hectares. In the 

searched area, 20 tree species were determined. The most common species was the 

sycamore maple (41.7% of all trees), followed by the big leaf linden (Tilia 

platyphyllos Scop.) with 15.3%, the common hornbeam (Carpinus betulus L.) with 

10.6%, and the northern red oak (Quercus rubra L.) with 9.7%. Among 606 

sycamore maples in the 2.7 hectare area, 3.3% were diseased by E. parasitica. This 

is within the range of the usual incidence of Eutypella canker (Gross, 1984b). 

At Site 6 on the area of 7.2 ha, frequency of Eutypella canker was determined. 

28.6% of 192 field maples had canker. 

3.2. Common measurable characteristics 

Table 1 shows a summary of the statistics for four variables. The sample size was 

different for each variable measured. Eutypella cankers were found over the entire 

DBH range from thin to large, as previously reported by French (1969). The average 

trunk diameter at breast height was 25 cm. The relative frequency of cankered trees 

among 7 classes showed that 52% of diseased trees had a DBH between 11 and 22 cm. 

65% of all trees with Eutypella canker occurred on first 220 cm of trunk above 

the ground line, and 92% of all cankers occurred on the first 435 cm of trunk. 

These results are comparable to French (1969), who noted that 60% of all cankers 

occurred on the first 244 cm of trunk and 81.5% on the first 488 cm of trunk. 

33 cankers were measured for canker length. 85% of cankers did not exceed a 

length of 120 cm. Gross (1984a) measured 27 trees and the range of canker length 

was from 10 cm to 170 cm with an average of 67 cm. Wide range of canker length 

was directly related to the age of the canker and could be explained as such. 

Table 1: Summary statistics for common measurable characteristics of Eutypella canker 

Trunk DBH 

(cm) 

Vertical 

distribution (cm) 

154 

Length of 

canker (cm) 

Width of 

canker (cm) 

Sample size 38 37 33 31 

Minimum 11 35 30 23 

Maximum 61 1150 233 115 

Average 25 216 102 59 

95% confidence 

interval (±) 

3.6 73.9 18.6 9.5


Canker width was correlated to canker length, which was due to canker shape, 

since the majority of cankers were oval shaped. Regression analysis with a linear 

model (canker width = 14.6 + 0.44 × canker length) gave correlation coefficient of 

0.87. Coefficient 0.44 tells that canker width measured usually about a half of 

canker length. 

Possible entry points for E. parasitica are branch stubs and bark wounds 

(French, 1969). Great majority of cankers were traced to branch stubs as the 

avenue of entry. Only 3 out of 89 cankers were associated with bark wounds and 

all three wounds resulted from logging operations. 

3.3. Area and shape of canker on the trunk 

The largest Eutypella canker measured 1.7 m 2 , although the average was much 

lower, i.e. 0.5 m 2 (Table 2). The canker area varied a lot because it depended upon 

the canker age. The cankered area ranged from 4% to 90% of the trunk area with 

the canker, with an average of 48%. 

The area without bark also depended upon the canker age and thus the whole 

canker area. In order to determine if in fact there was a relationship between the 

canker area without bark and whole canker area, regression analysis using a linear 

model was carried out. The linear model described a relationship between canker 

area without bark and whole canker area. The equation of the model was: area 

without bark = –2.32 + 0.25 × whole canker area. The high correlation coefficient 

(0.83) showed a good linear relationship between the canker area without bark and 

whole canker area. The coefficient of the equation tells that the area without bark 

represented usually a quarter of the whole canker area when the canker was old 

enough to bark fall off. The bark begins to fall off a trunk due to high degree of 

decay or/and high activity of bark beetles. 

Perithecia do not usually develop nearer than the fourth or fifth annual callus 

ring from the margin of the cankers (Davidson and Lorenz, 1938). Therefore, 

Davidson and Lorenz (1938) stated that perithecia are confined to only a small 

central portion of large cankers. During this study, their hypothesis about the area 

size covered with perithecia was tested. The part of their hypothesis was rejected. It 

was confirmed that perithecia are usually located in the central portion of the 

canker but this area is not small. The total area of bark covered with perithecia 

could exceed 68% of the whole canker area. An average of 32% (±7% at 95% 

confidence level) of the canker area was covered with perithecia. Further analysis 

was performed and it was found that the correlation between the total area of 

perithecia and the area of the whole canker was very good. Simple regression 

analysis produced a correlation coefficient of 0.94. A simple regression was made 

using a linear model: total area of perithecia = –3.93 + 0.42 × whole canker area. 

Three different densities of perithecia were delineated. The high densities of 

perithecia were usually located nearer to the canker centre while low densities were 

located nearer to canker margin. It should be noted that a middle density of 

perithecia could hardly be distinguished from high density. Therefore, some 

155


portion of the middle density of perithecia was included in the high density. It was 

suggested that about one-third of the total area covered with perithecia belonged to 

low density class, one third to middle density, and one third to high density class. 

20 out of 23 cankers were oval shaped, two cankers were triangular, and only 

one was shaped irregularly. All triangular shaped cankers had the centre of the 

canker close to the ground line. The irregular shape of the canker area has been 

already observed and explained (Davidson and Lorenz, 1938). The annual 

extension of the cankered areas is usually uniform and therefore the shape of 

canker area is usually oval. However, this extension is occasionally stopped 

suddenly by some unknown cause, around either the entire margin or only a portion 

of it. Such sudden cessation of the extension gives the canker an irregular shape. 

The extension of the canker is faster in the longitudinal direction than in the 

transverse direction. This leads to the elongated oval shape of canker area. Cankers 

could be from 1.32 to 2.62 longer than they are wide while the average 

length/width proportion was 1.74 (± 0.18 at 95% confidence level). 

Within the canker shape analysis it was observed that the trunk gradually grows 

thicker up to canker centre and then the trunk thins down. The thickness of the 

canker was measured for 14 specimens at 10 cm intervals. It was determined that 

the thickness of the Eutypella canker was represented by a parabola very well. 

Polynomial regression using a second order polynomial model was performed for 

each of the 14 specimens. The R 2 was up to 97.8% and the average R 2 was 76.7%. 

This shows again that the canker shape is a regular oval. 

Table 2: Summary statistics for different kinds of areas of Eutypella cankers 

Canker area 

(dm 2 ) Whole Without bark low 

density 

156 

Perithecia (averages) 

middle 

density 

high 

density 

Minimum 12.3 0 0 0 0 0 

Maximum 168.0 43.7 14.9 16.6 45.8 64.7 

Mean 53.3 11.3 6.5 3.9 * 

95% confidence 

interval (±) 

Total 

10.9 20.5 

20.6 6.3 2.2 1.8 7.3 9.2 

* Middle density of perithecia could hardly be distinguished from high density. 

Therefore, some portion of the middle density of perithecia was included in the 

high density. 

3.4. Isolates 

Davidson and Lorenz (1938) stated that a single species of Eutypella has been 

consistently isolated from discolored wood from under the centre and from near the 

margins of the discoloration. Our study strongly supports this statement. From 9 

dissected trees, 97 discs and 237 boring holes, 1896 samples were cultivated on


MEA for possible fungal presence. The most frequent fungus isolated was E. 

parasitica which represented 54.8% of all isolates. The second most frequent 

organisms isolated from discolored wood were bacteria (27.6% of all isolates). 

17.6% of all isolates were represented by 25 macroscopically different species of 

fungi among which were Cladosporium cladosporioides (Fresen.) G.A. de Vries, 

Mucor circinelloides Tiegh., Umbelopsis vinacea (Dixon-Stew.) Arx, Armillaria 

spp., Nectria spp., Pestalotia spp., Fusarium spp., and Pythium spp. 

The controls were made by cultivating 74 boring chips that were taken from 

healthy wood. The result of this test was that 65 of the isolations were sterile and 

only 9 Petri dishes were populated by bacteria and three different genera of fungi. 

No E. parasitica was present in controls. 

Dried healthy wood was present quite often at the center of the canker or near 

the margin of canker. 64 isolations were made for testing for the presence of E. 

parasitica in this area of the wood. After a month of incubation almost all 

isolations were negative and only seven had bacteria. 

As part of testing for the presence of E. parasitica in different parts of the 

wood, 420 isolates were made from the canker margin in the wood. E. parasitica 

was also the dominant fungus here (58.6%). The second most frequently found 

were bacteria. 23.6% of isolates contained eight macroscopically different fungi. 

17.9% of samples were sterile. 

3.5. Growth in pure culture 

Average radial growth in pure culture at room temperature of about 25°C is 

reported to be about 20 mm in seven days (Davidson and Lorenz, 1938). We 

measured the growth rate of 45 pure cultures on 1.5% (w/v) MEA at 24°C; 1712 

measurements were made. The average radial growth per day was 2.4 mm (± 0.1 

mm at 95% confidence level). The slowest measured average radial growth was 0.9 

mm per day and the fastest was 5.6 mm per day. 

3.6. Density of perithecia and ascospore discharge 

When measuring the area of the canker, three different densities of perithecia 

were determined (Table 2). The low density perithecia ranged from 181 to 210 

perithecia cm –2 with an average of 196 perithecia cm –2 . The middle density ranged 

from 234 to 269 perithecia cm –2 with an average of 255 perithecia cm –2 . The high 

density ranged from 301 to 378 perithecia cm –2 with an average of 348 perithecia 

cm –2 . These average densities of perithecia were used for calculating the number of 

perithecia at the whole canker level and the total ascospore production per canker. 

The total number of perithecia per whole canker could be from 25,000 for young 

cankers to over 2,102,000 perithecia for old cankers. The average number of 

peritecia per canker was 647,000 for the 23 Eutypella cankers analyzed. It should 

be noted that not all of these perithecia discharged ascospores because some of 

them were still developing, while others were too old and empty. The maturity test 

was performed on those samples that were used in the study of ascospore 

157


discharge. Maturity of perithecia varied substantially. There were some samples 

that were 100% old and empty, then there were some samples with only young 

perithecia incapable of discharging the ascospores, and there were whole range of 

samples that had a mixture of young, mature and old perithecia. Generally, the 

maturity tests showed that areas of canker with a lower density of perithecia have 

more young perithecia, while those with higher density have more old perithecia. 

Because the maturity test showed that there was no strict rule of maturity of 

perithecia among different densities, the results of ascospore discharge could not be 

shown by low, middle, and high class densities of perithecia but only as average 

value. The range of ascospore discharge was from 360,000 to 718,000 ascospores 

cm –2 h –1 while the average discharge was 506,000 ascospores cm –2 h –1 . These 

results are comparable to the results of Lachance (1971) and Johnson and Kuntz 

(1979) who reported 450,000 ascospores cm –2 h –1 . 

On average, a perithecium discharged 2520 ascospores per hour i.e. 315 octads. The 

average ascospore discharge (506,000 ascospores cm –2 h –1 ) was used for calculating the 

total ascospore discharge of cankers which represents the potential of disease spread. 

One Eutypella canker could discharge from 65 million to 3.3 billion ascospores per 

hour with an average 1.0 billion ascospores per hour under favorable environmental 

conditions. This kind of ascospore production represents enormous inoculation 

potential. 

4. DISCUSSION 

This research pointed out some of morphological aspects of Eutypella canker of 

maple that had not been analyzed before or were hypothesized and not checked, while 

others are checked again. A total of 23 Eutypella cankers were analyzed in detail. This 

is the required minimum for reliable statistics and it is comparable to other dissectional 

studies (Gross, 1984a). 

While ascospore discharge of Eutypella canker can be enormous under favorable 

environmental conditions, the question is raised as to why the disease is not more 

frequent. Specific demands of the fungus for successful colonization are the main 

reason for generally low occurrence of Eutypella canker. The fungus needs an exposed 

xylem for successful infection, i.e. branch stubs or bark wounds. Since the branch stubs 

represent a small area and ascospores are disseminated only over short distances (25 

m), it is hard for infection to take place despite enormous ascospore production. There 

are some other environmental limitations. Ascospore discharge is greatest at 

temperatures between 24 and 28 °C (Lachance, 1971; Johnson and Kuntz, 1979). 

Laboratory tests show no ascospore discharge and dissemination at temperatures below 

4 °C or higher than 36 °C. Free moisture (rainfall) induces mature perithecia to 

discharge the ascospores. At least 3 mm of rain has to penetrate the tree canopy to 

initiate discharge (Lachance, 1971; Johnson and Kuntz, 1979). Spore ejection begins 

about 2 hours after rain has started. High relative humidity alone is not sufficient to 

induce discharge of spores but it can influence the rate of drying of bark on cankers 

and prolongs discharge after periods of rainfall (Johnson and Kuntz, 1979). 

158


The findings of the study show some morphological characteristics of Eutypella 

canker that help in understanding the disease spread. The very high average 

ascospore discharge of 506,000 ascospores cm –2 h –1 , or 1.0 billion ascospores h –1 

for the whole canker area is important for the success of disease spread. The study 

of the isolates showed that E. parasitica is the dominant fungus in infected and 

decayed wood. The fungus has proven its pathogenic ability with progressive 

attack tactics where the maple rarely has a chance to protect itself with callus or 

wound-wood. The Eutypella canker grows faster in longitudinal direction that in 

transverse direction. Therefore, the canker shape is in most cases almost regular or 

elongated oval. When the maple succeeds in defending itself from the fungus by 

forming wound-wood, the fungus can reinfect the wound-wood and bark from the 

underlaying wood. When the host is killed or snapped due to canker progress, the 

fungus acts as a saprobe and continues to produce ascospores for some years. The 

disadvantages of the fungus are its heavy ascospore octads which are disseminated 

only over short distances and the fact that they can infect only exposed xylem that 

occurs up to 4 m from the ground level. 

When a disease is introduced to a new distant location, e.g. another continent, it 

is hard to predict disease behavior and its spread speed. Environmental conditions 

could be more favorable for the disease and thus it could accelerate its spread rate. 

In a new environment new vectors of the disease could be present which could also 

add to the success of disease spread. A third factor that could help the disease to 

spread and establish are hosts. In a new environment new hosts are possible and 

host distribution can be over a wider area and contiguous. A new host, i.e. the field 

maple, was found and described in Slovenia (Ogris et al., 2005), but there are 

numerous other possible hosts (Acer spp.) present in Europe that have not yet been 

identified. There are at least 10 autochthonous maple species in Europe that could 

be the target of E. parasitica (Ogris et al., 2006). An inoculation study should be 

planned and carried out to test possible susceptibility. The results of that study 

would give needed information for more accurate assessment of the disease spread 

risk. 

Eutypella canker has been recognized as a new disease of maple in Europe. 

Despite intensive searching by the Slovenian Forestry Service only 225 Eutypella 

cankers were found from 2005–2009. We suspect that there are many undetected 

cases of Eutypella canker. Since it is assumed that cankers are present for a longer 

time period and they are dispersed over wide area we do not believe that the 

eradication of the disease is possible (Jurc et al., 2005). The disease can also have 

an economical impact. Incidence of the canker in North America is usually less 

than 5% (Gross, 1984b). Stands with over 10% of maples cankered were fairly 

common, and instances of over 40% cankering have been observed; in Slovenia 

there was a case with almost 29 % incidence. The disease frequently kills trees less 

than 7.5 cm in diameter and larger trees are predisposed to wind snap at the canker 

(French, 1969; Kliejunas and Kuntz, 1974). Cankered trees lose up to 50% of their 

merchantable cubic volume because most of the cankers occur below a height of 3 

159


m, which represents the most valuable portion of trunk (Gross, 1984b). Control 

measures are proposed within the framework of sanitation felling procedures. Part 

of the trunk with a canker at least 40 cm below and above the canker margin should 

be removed from the forest and destroyed by fire; when left in forest, the canker 

should be turned with face towards ground. 


The research was funded by Ministry of Agriculture, Forestry and Food. Special 

thanks are due to staff of Slovenian Forestry Service: Mojca Bogovič, Marija 

Kolšek, Tibor Palfy, Dražen Drevenkar, Danijel Pavlin, Aleš Kolman, Aleš Šeško, 

Barbara Slobanja, Nataša Strle, and Jože Gobec who helped with finding and 

providing the cankers. We are most grateful to KPL d. d., Robert Rode for 

providing most of the cankers for the research. We would also like to thank Robert 

Krajnc and Zvone Kastelic for their technical help with the dissectional study, and 

Vesna Rajh for her help with culturing. 

6. REFERENCES 

Cech, T.L., 2007. Erstnachweis von Eutypella parasitica in Österreich. Forstschutz Aktuell 40, 10-13. 

Davidson, R.W., Lorenz, R.C., 1938. Species of Eutypella and Schizoxylon associated with cankers of 

maple. Phytopathology 28, 733-745. 

French, W.J., 1969. Eutypella canker on acer in New York. Technical Publication 94, 56. 

Gross, H.L., 1984a. Defect associated with Eutypella canker of maple. Forestry Chronicle 60, 15-17. 

Gross, H.L., 1984b. Impact of Eutypella canker on the maple resource of the Owen Sound and 

Wingham forest districts. Forest Chronicle 60, 18-21. 

Johnson, D.W., Kuntz, J.E., 1979. Eutypella canker of maple: ascospore discharge and dissemination. 

Phytopathology 69, 130-135. 

Jurc, D., Ogris, N., Jakša, J., Jurc, M., 2005. Is an attempt to eradicate Eutypella canker of maple in 

Europe feasible? , EPPO conference on Phytophthora ramorum and other forest pests. 

EPPO, Falmouth, Cornwall, GB. 

Jurc, D., Ogris, N., Slippers, B., Stenlid, J., 2006. First report of Eutypella canker of Acer 

pseudoplatanus in Europe. Plant Pathology 55, 577. 

Kliejunas, J.T., Kuntz, J.E., 1972. Development of stromata and the imperfect state of Eutypella 

parasitica in maple. Canadian Journal of Botany 50, 1453-1456. 

Kliejunas, J.T., Kuntz, J.E., 1974. Eutypella canker, characteristics and control. The Forestry 

Chronicle 50, 106-108. 

Lachance, D., 1971. Discharge and germinatiion of Eutypella parasitica ascospores. Canadian Journal 

of Botany 49, 1111-1118. 

160


Martinez, I., 2003. Eutypella canker clustering and volume loss in the western upper peninsula of 

Michigan. Northern Journal of Applied Forestry 20, 186-187. 

Ogris, N., Diminić, D., Piškur, B., Kraigher, H., 2008. First report of Eutypella parasitica causing 

cankers on field maple (Acer campestre) in Croatia. Plant Pathology 57, 785. 

Ogris, N., Jurc, D., Jurc, M., 2005. Javorov rak (Eutypella parasitica: Ascomycota: Fungi) na 

gorskem javorju in maklenu: značilnosti in razlike. Gozdarski vestnik 63, 411-418. 

Ogris, N., Jurc, D., Jurc, M., 2006. Spread risk of Eutypella canker of maple in Europe. Bulletin 

OEPP/EPPO Bulletin 36, 475-485. 

161



OCCURRENCE OF Pseudomonas syringae ON POPLAR DAMAGED BY 

NECROSIS AND CANKER 

ABSTRACT 

Irmtraut ZASPEL 1* 

1 Federal Research Institute for Rural Areas, Forestry and Fisheries (vTI) 

Institute of Forest Genetics Eberswalder Chausee 3A 

D-15377 Waldsieversdorf Germany 

*irmtraut.zaspel@vti.bund.de 

In poplar and aspen clones, established in a collection with more than 250 different 

genotypes, in nursery practice as well as in stock plant cultures necrosis and canker 

symptoms have appeared at 1 – 3 year-old shoots for some years. The injuries occur in 

winter season are characterized by ring necrosis at shoots, canker and cracking. The most 

frequent bacteria type that was isolated from damaged clones was identified as 

Pseudomonas syringae by means of 16S rDNA analysis. The pathogenicity of the isolates 

was evident at cuttings of eight several poplar clones tested under greenhouse conditions. 

The deleterious effect was visible at young shoots with symptoms of discoloration and leaf 

spots as well as blackening and wilting of buds and young shoots. The eight poplar 

genotypes differently responded to bacterial infection. 

Keywords: Populus, stem necroses, canker, Pseudomonas syringae 


Populus species are widely distributed and abundant in many different 

environments. A broad range of species and hybrids can be found as nursery crops 

grown for biomass production in short rotation coppice plantations and for 

reforestation and restoration purposes. In nurseries, plant material of the most 

poplar species is normally propagated with hardwood cuttings whereas aspen may 

be propagated from seeds. 

In poplar and aspen clones, established in a collection with more than 250 

different genotypes, in nursery practice as well as in stock plant cultures necrosis 

and canker symptoms had appeared at 1 – 3 year-old shoots in North-Eastern 

Germany for some years. The injuries were characterized by ring-shaped necroses 

with constrictions of the shoot, canker formations and spontaneous cracking. The 

extend of disease symptoms like necroses formation and shoot cracking increased 

during the winter season and disrupted in early spring. This pattern was different 

from the known damages caused by the more common pathogens like 

Aplanobacter populi and Cryptodiaporthe populea. 

162


The frequency of necroses formation was changing depending on from the 

poplar genotype. At some susceptible genotypes, single shoots showed up to 10 

necroses. Some shoots with lesions that did not crack, dried above the damaged 

spots. 

Above and below the smaller necroses and lesions a wound periderm had 

developed, varying in thickness with the poplar genotype (fig. 1-3). Inside the 

shoots, tissue showed a hypertrophic ring-shaped zone with dark discolorations. 

2. METHODS AND RESULTS 

2.1. Bacteria identification 

During the search for the cause of losses, no indication for fungal pathogens or 

phytophagous insects could be found. Rather, investigations of damaged and 

broken shoots resulted in a range of bacterial strains, which were isolated directly 

from the margin of necrotic tissues and discoloured zones in winter season. The 

isolations followed a standard protocol using Yeast extract-Mannitol Agar (YMA) 

(Elkan and Bunn, 1992). The plates were incubated at 28 °C for three days. The 

most frequent type could be identified by means of 16S rDNA sequence analysis 

(primer pairs: fd1/ 926r and 799f/1492r, resp.) as Pseudomonas syringae pv. 

syringae. This species could be found only in the damaged annular areas with inner 

brown discolorations. The shoot segments between the lesions were free of P. 

syringae. Further species like Rahnella sp., Pantoea agglomerans, 

Pseudoclavibacter helvolus, Cellulomonas sp., and Microbacterium oxydans were 

found with lower frequency. Only one strain could be isolated from Xanthomonas 

sp. and X. campestris, resp., Curtobacterium flaccumfaciens, as well as some 

unspecified isolates. 

Figure 1, 2: Ring-shaped necrosis with wound periderm (left) and cracking of shoot 

(right) 

163

2.2. Pathogenicity testing 


Figure 3: Cuttings with small necroses 

The pathogenicity of two strains of P. syringae was analysed at cuttings of 

eight different poplar clones tested at 20-21°C under greenhouse conditions. The 

cuttings that were intact from outward appearance with a length for 12 – 15 cm 

were harvested after a frost period in winter, and were grown with illumination 

(35-60 µE m -2 s -1 ) in beakers with water for 8 days. After bud break, the cuttings 

were inoculated with bacterial suspension (10 8 cfu/ml) for two days, plugged into 

moist sand, and cultivated for further five weeks at 20-22°C with additional light 

of 4 h (180-200 µE m -2 s -1 ) in greenhouse. The deleterious effect caused by the 

bacteria was assessed by counting the cuttings with symptoms weekly. Symptoms 

that were visible on young leaves and shoots had started with discoloration and 

leaf spots after 3 weeks and resulted in blackening and wilting of buds and young 

shoots. In general, 37.8 % and 40.9 % of the cuttings (n=88 and 87, resp.), treated 

with two different P. syringae strains developed severe symptoms on young shoots 

(table 1). Most of the shoots of affected cuttings died off within the observation 

time of five weeks, even though the eight poplar genotypes responded to bacterial 

infection quite differently. The P. maximowiczii hybrids as well as the aspen clone 

were more susceptible than the other clones tested. Within the observation time, 

some single control cuttings of three poplar genotypes (4 % of total) died off by 

unknown causes. 

164


Table 1: Pathogenicity of Pseudomonas syringae strains on poplar clone cuttings 

Species / Hybrid Clone 

165 

Cuttings with visible damages (%) 

P. syringae 

strain 47 

P. syringae 

strain 48 

control 

Populus trichocarpa 30 21 (14) 1 0 (11) 0 (13) 

Populus trichocarpa 872 33 (9) 25 (12) 0 (9) 

Populus trichocarpa 936 27 (11) 45 (11) 0 (10) 

Populus trichocarpa x P. 

deltoides 

Populus tremula x P. 

tremuloides 

Populus deltoides x P. 

maximowiczii 

Populus maximowiczii x P. 

berolinensis 

Populus maximowiczii x P. 

nigra 

995 29 (12) 18 (11) 0 (10) 

L 211 56 (16) 79 (14) 8 (13) 

960 56 (9) 67 (9) 13 (8) 

Geneva 37 (8) 33 (9) 0 (9) 

Rochester 44 (9) 60 (10) 11 (9) 

1 in brackets: number of cuttings used for average 

The limited number of cuttings as well as the fact that some cuttings did not 

root resulted in the different number of replications per clone and treatment. Only 

those cuttings were finally assessed regarding bacteria sensitivity, which showed a 

sufficient root system. The inadequate rooting ability of the poplar clones can 

could have induced water stress resulting in similar wilting symptoms like the 

disease symptoms. 

3. DISCUSSION AND CONCLUSION 

P. syringae is a known pathogen on woody plants, not only in poplars, but also 

in ash, willow, cherry, horse chestnut, and others. In recent time, to P. syringae 

more than 50 pathovars were assigned. On woody plants, the pathogen causes bark 

necroses with slime flux and canker. The newly-discovered pathovar of horsechestnut, 

P. syringae pv. aesculi can act as a cambium destroyer with severe 

dieback (Stobbe et al., 2008; Kaminski et al., 2007).


In poplars, the pathogen played only a secondary role for a long time because 

poplar cultures were less important for timber industry in Germany. In other 

countries like New Zealand, Sweden, and Romania, observations of P. syringae 

were made on poplars for a long time (Spiers, 1990; Ramstedt et al., 1994; Mocanu 

& Poleac, 1965). The pattern of damages that was described were spotted leaves, 

wilting of leaves and shoots in the whole, as well as bark necroses. In current 

investigations in a Chinese poplar breeding program P. syringae pv. syringae was 

identified as the reason for injuries like bark necroses on cuttings of various hybrid 

clones (Xiang et al., 2001). Moreover, this species could be found in symptomless 

hybrid clones of different poplar sections (Ulrich et al., 2008). 

The disease transmission of the pathogen is unclear until now. Possibly 

mechanical bark wounds induced by insects and other animal vectors are 

responsible, considerably earlier in summer. The invasion of bark tissue is also 

possible by bark micro-cracks following weather conditions like summer drought 

or autumn frost. The propagation of the pathogen takes place within a large 

temperature range and can still be found slightly above zero. Sequent changing of 

warm and cold periods with freeze stress could have promoted the infection by the 

pathogen and their distribution within the tissue. The formation of necroses in the 

cold season can be caused by pathovars belonging to ice nucleation inducing 

strains of P. syringae. Those pathotypes are able to induce the formation of ice 

crystals within plant cells downward from -1°C. As a result, the cell walls burst and 

the protoplasm can serve as nutrient resources for further bacteria growth. 

Moreover, some pathovars of the P. syringae group are known as phytotoxine 

producers. Analysed compounds are the lipodepsipeptides Syringomycin and 

Syringopeptin, possessing a cell wall destroying influence (Hutchinson and Gross, 

1997). 

In recent time, poplars became more important as a fast growing tree species for 

biomass production in short rotation coppice plantations, and a high demand for 

suited propagation material exists. A basic precondition of utilizing poplar for this 

purpose is the provision of proved propagation material with high quality and free 

of harmful organisms. The use of cuttings grown in infected stock plant cultures 

can lead to a fast distribution of the disease. It is difficult to appreciate a possible 

role of P. syringae as a serious pathogen for poplar cultures in Germany. 

Therefore, work on epidemiology, vectors, and host-specific association of various 

pathovars is recommended as well as research referring to resistance / 

susceptibility of clones and cultivars of economical importance. 

166



Elkan, G. H. & Bunn, C.R., 1992. The Procaryotes: A Handbook on the Biology of Bacteria – 

Ecophysiology, Isolation, Identification, Applications, pp 2197-2210. EDS. BY A. Balows, 

H.G. Trüper, M. Dworkin, W. Harder & K.H. Schleifer, NEW YORK 

Hutchinson, M.A. & Gross, D.C., 1997. Lipopeptide Phytotoxins Produced by Pseudomonas syringae 

pv. syringae: Comparison of the Biosurfactant and Ion Channel Forming Activities of 

Syringopeptin and Syringomycin. MPMI 10:347-354 

Kaminski, K., Wagner, S. & Werres, S., 2007. Neuartige Krankheit an Rosskastanien. Stadt und Grün 

56:55-57 

Mocanu, V. & Poleac, E., 1965. Studies on bacterial canker of poplar. Stud. Cerc. Inst. For. Bucuresti 

25:211-229 

Spiers, A.G., 1990. Bacterial leaf spot and canker of poplar, willow, and alder. Forest Pathol. New 

Zealand 21:4-7 

Ramstedt, M., Aström, B. & Fircks, H. A. v. (1994): Dieback of poplar and willow caused by 

Pseudomonas syringae in combination with freezing stress. Eur. J. For. Path.24: 305-315 

Stobbe, H., Schmidt, O., Moreth, U., Kehr, R. & Dujesiefken, D., 2008. Pseudomonas: Derzeitige 

Verbreitung. AFZ/Der Wald 4/2008, pp 176-177 

Ulrich, K., Ulrich, A. & Ewald, D., 2008. Diversity of endophytic bacterial communities in poplar 

grown under field conditions. FEMS Microbiol. Ecol. 63:169-180 

Xiang, C.T., Dong, A.R., Liu, X.F., Li, C., Yuan, S.Z. & Zhang, J.H., 2001. Key factors for the 

causing poplar ice nucleation active bacterial canker and its control techniques. J. For. 

Research 12:157-164 

167

Rust Diseases 

169


170



SEASONAL FRUITING AND SPORULATION OF THEKOPSORA AND 

CHRYSOMYXA CONE RUSTS IN NORWAY SPRUCE CONES AND 

ALTERNATE HOSTS IN FINLAND 

Juha KAITERA 1* , E. TILLMAN-SUTELA 1 and A. KAUPPI 2 

1 Finnish Forest Research Institute, Muhos Research Unit, FI-91500, Muhos, Finland. 2 University 

of Oulu, Department of Biology, P.O. Box 3000, FI-90014 Oulu 

ABSTRACT 

*Juha.kaitera@metla.fi 

Seasonal fruiting and sporulation of cone rusts were investigated in Norway spruce 

cones and alternate hosts in 2006-2008. Current-year and one-year-old cones and leaves of 

alternate hosts, Pyrola spp. and Orthilia secunda, were collected from case-stands in 

southern and northern Finland bi-monthly or monthly and checked for rust fruitbodies. 

Fruitbodies and different fruiting structures of the rusts were examined using light 

microscopy (LM), and field emission scanning electron microscope (FESEM). 

Spermogonia of Chrysomyxa pirolata and aecia of Thekopsora areolata developed 

in current-year cones in June, while C. pirolata aecia developed and began to sporulate in 

July. Thekopsora areolata aecia sporulated mainly in previous year’s cones in May-August. 

Uredinia, telia and basidia of C. pirolata developed in overwintered Pyrola spp. and 

Orthilia secunda leaves in May, and sporulated in May-June. Uredinia of T. areolata 

developed in current-year P. padus leaves in June and sporulated in June-August. Telia of 

T. areolata developed in late summer, but no basidia developed in overwintered P. padus 

leaves in March-May. 

Keywords: Cone rusts, Thekopsora areolata, Chrysomyxa pirolata, sporulation 


Good quality seed crops of Picea abies (L.) Karst. are irregular due to insects 

and pathogens reducing both the amount and quality of seed crop in seed orchards 

and natural forests throughout Finland (Kangas, 1940; Rummukainen, 1960; 

Nikula and Jalkanen, 1990; Tillman-Sutela et al., 2004)). Thekopsora areolata (Fr.) 

Magnus, and Chrysomyxa pirolata Wint., cause severe damage on Picea spp. 

throughout the northern hemisphere (Savile, 1950; Gäumann, 1959; Roll-Hansen, 

1965; Ziller, 1974). Thekopsora areolata infects Prunus spp. (Gäumann, 1959), 

while C. pirolata infects species in genera Pyrola, Moneses and Orthilia (Savile, 

1950; Gäumann, 1959; Ziller, 1974). Uredinia and telia develop on alternate hosts 

after aeciospore infection. 

In 2006, florescence and cone crop of Norway spruce were abundant, but due to 

fungal injuries the seed crop was severely reduced in some seed orchards. The aim 

of this study was to collect information of rust sporulation after a serious rust 

outbreak to improve disease control. For a thorough description of the study, see 

Kaitera et al. (2009). 

171



Norway spruce cones were collected in a seed orchard (Stand 1) in southern 

Finland, and in a naturally regenerated stand (Stand 2) in northern Finland. A 

random sample of previous year’s (2006) and current-year (2007) cones, were 

collected in Stand 1 in 5 times in 2007. Similar sampling was performed in Stand 2 

for the current-year cones in 5 times in 2007 and for the previous year’s cones in 8 

intervals in 2006-2007. The cones were cut from sample trees either using branch 

scissors (Stand 1) or a lifting cage (Stand 2). 

Overwintered and current-year leaves of Prunus padus, Pyrola sp. and Orthilia 

secunda were collected along the cone sampling in May-October 2007 in Stand 1, 

and 7-19 times in 2007-8 in Stand 2. In a third group of seed orchards (Stand 3) in 

southern Finland, leaves of P. padus and Pyrola sp. were collected in 8 times in 

2007. Overwintered P. padus leaves were collected in March-May and current-year 

leaves were collected between early May and early October. 

The occurrence, incidence and distribution of rust fruitbodies (spermogonia, 

aecia), and proportion of sporulating fruitbodies were recorded in cones under 

stereo microscope. Leaves of alternate hosts were investigated for the occurrence, 

incidence and stage of sporulation of rust uredinia, telia and basidia per leaf. Rust 

fruiting stages were also selected and further studied using a JEOL JSM 6300F 

field emission scanning electron microscope (FESEM). 

3. RESULTS 

3.1. Rust incidence and sporulation in current-year cones 

In Stand 1, cones collected in late May to mid-June bore no rust fruitbodies. In 

late June, about 2 % of the sample cones carried C. pirolata spermogonia and 5 % 

carried immature T. areolata aecia. None of the aecia were sporulating. The T. 

areolata aecia located on both sides of cone scales along the entire cone. No fungal 

structures resembling T. areolata spermogonia were observed. In the early August, 

7 % of the sample cones bore C. pirolata aecia that located on outer (abaxial) side 

of scales, being currently sporulating or already had finished sporulating and 

ruptured. Two percent of the sample cones carried T. areolata aecia that occurred 

in all the scales of cones. None of the T. areolata aecia sporulated yet. In the early 

October, 2 % of the cones carried both T. areolata and C. pirolata aecia in cone 

scales. Chrysomyxa pirolata aecia were ruptured with only individual aeciospores 

within aecia. Thekopsora areolata aecia were immature and non-sporulating. 

3.2. Rust incidence and sporulation in previous years’ cones 

3.2.1. Stand 1 

Only T. areolata aecia were observed in previous year’s cones. In late May, 35 

% of the sample cones bore T. areolata aecia with 92 % of the cone scales being 

172


infected. All observed aecia located on both sides of cone scales with 96 % of the 

aecia per cone being currently sporulating or had finished sporulating being 

ruptured. From the mid-June to early October, 22 % - 45 % of the sample cones 

carried T. areolata aecia. All infected cones carried aecia on both sides of cone 

scales with 93 % - 100 % of the cone scales per cone carrying aecia. 

3.2.2. Stand 2 

In cones collected in October 2006, 90 % carried T. areolata aecia and 10 % 

carried C. pirolata aecia. Aecia of T. areolata were non-sporulating and located in 

both sides of cone scales with 94 % of the scales per cone being infected. 

Chrysomyxa pirolata aecia had all finished sporulating, locating in 77 % of the 

infected cones on the outer side of cone scales. 

In late March in 2007, 90 % of the scales carried T. areolata aecia on both sides 

of the scales in previous year’s cones that were non-sporulating. About 2 % of 

these cones carried already sporulated and ruptured C. pirolata aecia on outer side 

of the scales with 70 % of the scales carrying aecia per infected cone. In the early 

May of 2007, 43 % of the sample cones carried T. areolata aecia and 7 % carried 

C. pirolata aecia . 

From late May to late June, 95 % of the sample cones bore T. areolata aecia and 

15 % bore C. pirolata aecia. Aecia of T. areolata occurred on both sides of cone 

scales in most of the cones with 86 % - 93 % of the scales per cone carrying 

fruitbodies. All C. pirolata aecia had finished sporulating. 

In late July and early October, 92 % - 94 % of the sample cones carried T. 

areolata aecia, and 0 % - 19 % of them carried C. pirolata aecia. The average 

proportions of cone scales bearing T. areolata aecia were 89 % - 95 % per cone. 

On average, 18 % - 23 % of the scales per cone carried sporulating T. areolata 

aecia. 

3.3. Rust incidence and sporulation on alternate hosts 

3.3.1. Stand 1 

In late May 2007, 1 % of the overwintered O. secunda leaves bore C. pirolata 

uredinia and undifferentiated fruitbodies. Undifferentiated fruitbodies were 

common on O. secunda in late June, but after that they became rare. Uredinia were 

common between mid-June and early August, after which they became rare. No 

sporulation was observed in these uredinia until early August in 2007, after which 

uredinia finished sporulating and ruptured. None of the current-year leaves of P. 

padus bore any T. areolata fruitbodies in late May, but practically all leaves carried 

uredinia from mid-June on and telia without basidia since late-June. 

3.3.2. Stand 2 

In late March 2007, none of the overwintered O. secunda and Pyrola sp. leaves 

carried C. pirolata fruitbodies. Undifferentiated fruitbodies occurred first in early 

173


May, but they were most common between mid-May and late May in 2007-8. 

Uredinia appeared in mid-May, being most frequent in late May with low coverage 

per infected leaf (2 % - 10 %) in 2007. Uredinia were, however, most frequent 

fruitbodies in 2008 with their coverage ranging between 47 % - 83 %. Uredinia 

started to sporulate immediately after their formation and continued throughout the 

sample collection. Telia of C. pirolata were the most frequent fruitbodies in 2007, 

but they were less common than uredinia in 2008. Telia with basidiospores were 

observed throughout the collection, but they were most common between late May 

and mid-June in 2007 and between early and mid-June in 2008. In 2007 telia began 

to rupture from late July on. 

Practically all overwintered P. padus leaves bore T. areolata telia without 

external basidia between late March and late May in 2007-8. Uredinia of T. 

areolata occurred on the lower leaf surface with less frequency than telia on 

overwintered P. padus leaves. Uredinia started to sporulate immediately after 

formation in early June, and they began to rupture in early July. Until mid- 

September, all uredinia had finished sporulating. 

3.3.3. Stand 3 

In late April in 2007, no fruitbodies of C. pirolata occurred on the overwintered 

leaves of O. secunda or Pyrola sp. Undifferentiated fruitbodies occurred on all 

such leaves with the highest coverage of 70 % per leaf in mid-May, after which 

their coverage decreased. First C. pirolata uredinia were observed with a low 

coverage per infected leaf in mid-May. Thereafter, uredinia occurred in increasing 

frequency until early October with a coverage of uredinia per leaf lower than 40 %. 

Sporulation of uredinia started in mid-May and continued until early October. 

Since early July the proportion of uredinia that had finished sporulating increased, 

and after late July uredinia ruptured. 

Telia were the most common fruitbodies of C. pirolata in 2007. The first telia 

appeared in late May in almost all infected leaves with high (87 %) coverage per 

infected leaf. Telia with basidia were frequent until mid-June, when they began to 

rupture. Ruptured telia were common from early July to early October. 

Almost all of the overwintered P. padus leaves carried T. areolata telia without 

basidia in late April. Sporulated and ruptured uredinia occurred on 38 % of the 

current-year sample leaves with a low (6 %) coverage per infected leaf. A few 

uredinia occurred in 17 % of the infected leaves, which all sporulated in late May. 

From mid-May until early October, almost all P. padus leaves carried sporulating 

T. areolata uredinia, and the proportion of uredinia that had finished sporulation 

increased after early July. Telia were observed in all infected leaves between early 

July and early October without external basidia. 

174

4. DISCUSSION 


In this study, T. areolata and C. pirolata, which are causes for severe rust 

epidemics in Finland, fruited and sporulated in young current-year cones the next 

year after a serious rust outbreak. The high incidence of T. areolata aecia in 

previous year’s cones confirmed that it was the main cause for the serious rust 

outbreak in the study areas in 2006. In all stands, T. areolata uredinia and telia 

were frequent on both overwintered and current-year P. padus leaves indicating 

that alternate host infection took frequently place both in 2006-2007. The high 

disease incidence coincided with the incidence of aecia in previous year’s cones, 

too. In this study, T. areolata aecia sporulated mainly in one-year-old cones as 

reported (Jørstad, 1925), but single sporulating aecia could be found already in late 

summer after infection. The observed aeciospore and urediniospore size and 

morphology was in accordance with the reports elsewhere (Gäumann, 1959; Saho 

and Takahashi, 1970). As practically all scales in infected cones bore T. areolata 

aecia, the rust was highly pathogenic and systemic in the cones and hindered 

efficiently seed formation. 

The occurrence and morphology of spermogonia, spermatia, aecia, aeciospores, 

uredinia, urediniospores, telia and basidia of C. pirolata corresponded well to 

earlier reports (Gäumann, 1959; Sutherland et al., 1984; Crane and Hiratsuka, 

2000). As most scales in infected cones were covered by C. pirolata aecia, the rust 

was highly pathogenic and systemic in cones. Therefore, the rust had a great 

impact on cone development causing seed deformation in diseased cones. The 

gelatinuous young fruiting structures, undifferentiated fruitbodies, corresponded to 

those described previously (Crane and Hiratsuka, 2000), and reported to develop 

either into uredinia or telia depending on the amount of moisture and free water. 

5. REFERENCES 

Crane, P.E., Hiratsuka, Y., 2000. Evidence for environmental determination of uredinia and telia 

production in Chrysomyxa pirolata (inland spruce cone rust). Canadian Journal of Botany 

78, 660-667. 

Gäumann, E., 1959. Die Rostpilze Mitteleuropas. Beiträge zur Kryptogamenflora der Schweiz 12, 1- 

1407. 

Jørstad, I., 1925. Norske skogsykdommer I. Nåletresykdommer bevirket av rustsopper, ascomyceter 

og fungi imperfecti. Meddelelser fra det Norske Skogforsøksvesen 62, 19-186. 

Kaitera, J., Tillman-Sutela, E., Kauppi, A., 2009. Seasonal fruiting and sporulation of Thekopsora and 

Chrysomyxa cone rusts in Norway spruce cones and alternate hosts in Finland. Canadian 

Journal of Forest Research (in press) 

Kangas, E., 1940. Cone injuries and seed crop of Norway spruce in 1937. Communicationes Instuti 

Forestalis Fenniae 29, 1-36 

Nikula, A., Jalkanen, R., 1990. Kuusen käpytuholaisten ja –tautien esiintyminen Pohjois-Suomessa 

kesällä 1989. Metsäntutkimuslaitoksen Tiedonantoja 362, 83-89. 

175


Roll-Hansen, F., 1965. Pucciniastrum areolatum on Picea engelmannii. Identification by 

spermogonia. Meddelelser fra det Norske Skogforsøksvesen 22, 389-397. 

Rummukainen, U., 1960. Abundance and quality of seed injuries of Norway spruce. 

Communicationes Instituti Forestalis Fenniae 52, 1-83. 

Saho, H., Takahashi, I., 1970. Notes on the Japanese rust fungi VI. Inoculation experiments on 

Thekopsora areolata (Fr.) Magnus, a cone rust of Picea spp. in Japan. Transactions of the 

Mycological Society of Japan 11, 109-112. 

Savile, D.B.O., 1950. North American species of Chrysomyxa. Canadian Journal of Research, C 28, 

318-330. 

Sutherland, J.R., Hopkins, S.J., Farris, S.H., 1984. Inland spruce cone rust, Chrysomyxa pirolata, in 

Pyrola asarifolia and cones of Picea glauca, morphology of the spore stages. Canadian 

Journal of Botany 62, 2441-2447. 

Tillman-Sutela, E., Kauppi, A., Hilli, A., Kaitera, J., 2004. Fungal injury to seed tissues of Norway 

spruce, Picea abies (L.) Karst. Trees 18, 151-156. 

Ziller, W.G., 1974. The tree rusts of western Canada. Canadian Forestry Service Publications 1329, 

1-272. 

176



PRELIMINARY STUDIES ON GENETIC VARIATION IN 

Gymnosporangium fuscum in the LAKES DISTRICT OF TURKEY 

DETECTED WITH M13 MINISATELLITE MARKER 

ABSTRACT 

Asko LEHTIJÄRVI 1* , H. Tuğba DOĞMUŞ-LEHTIJÄRVI 1 , 

A. GüldenADAY 1 , Funda OSKAY 1 

1 Suleyman Demirel University Faculty of Forestry 32260 CUNUR/ISPARTA 


Gymnosporangium fuscum infections on the trunk and branches of Juniperus excelsa 

are common in natural stands in the Lakes District of Turkey. In the present study, level of 

genetic variation among G. fuscum isolates was estimated. Telial horns were obtained from 

trunk lesions in Sütçüler, Bucak-Aziziye and Beşkonak sites. From each telium DNA was 

extracted by using plant mini kit. PCR amplification profiles were run using the M13 

minisatellite core sequence. Preliminary results indicated low variation among the isolates. 

Key words: European pear rust, Turkey, Minisatellite, M13, genetic variation 


Crimean juniper (Juniperus excelsa Bieb) contributes to 5.6 % of forest area in 

Turkey. It grows on dry rocky slopes of hills and mountains at elevations ranging 

from 150 to 2700 m above sea level, and often forms the tree line in the Taurus 

Mountains. Crimean juniper has been under certain level of protection since 1996 

when all silvicultural treatments in the juniper forests were ceased due to the bad 

condition of the stands (Güner et al., 2000). 

European pear rust is caused by the fungus Gymnosporangium fuscum DC. like 

rusts in general, it alternates between two hosts: J. excelsa and Prunus spp. The 

infections are perennial on the coniferous host, on which in spring it develops the 

characteristic telial horns. 

European pear rust is widely distributed throughout Europe with observations 

(including) extending to Asia Minor (Lebanon, Syria and Turkey) and North Africa 

(Algeria and Morocco). The pathogen has also been introduced to North America 

(California, Washington, and British Columbia) probably through the importation 

of junipers from Europe (Laundon, 1977; Hollebone, 2006). In Turkey, perennial 

lesions caused by the rust are common on Crimean juniper in the Lakes district 

(Doğmuş-Lehtijärvi et al., 2008). 

177


Minisatellite sequences are repeated over the genome and exist in most organisms 

providing an obtainable and highly variable probe and PCR amplification (Karlsson, 

1993; Högberg et al., 1995). In most cases they have been used to study variation 

among populations. 

In our study, we used M13 minisatellite core sequence as a primer in PCR based 

DNA fingerprinting technique to study level of genetic variation among G. fuscum 

populations. 


Telial horns were collected from trunk lesions in Sütçüler, Bucak-Aziziye and 

Beşkonak sites. In Sütçüler three stands 3-8 km apart were sampled. The stands in 

Beşkonak and Bucak-Aziziye were 40 and 70 km west from the Sütçüler stands, 

respectively. 

In each stand telia horns were sampled from ten trees, placed into plastic bags, 

and stored in the laboratory at -20 ºC until DNA extraction. 

Figure 1. Locations of the sampled stands (crosses). 

2.1. DNA extraction and PCR amplification 

Telia were grounded using liquid nitrogen and DNA was extracted with Qiagen 

DNeasy Plant Mini Kit. PCR amplification profiles were obtained using M13 

minisatellite core sequence as a primer. Reactions were performed in volumes of 

50 μl containing Tris-HCl 10 mM, pH 8; dNTPs 0.2 mM; MgSO4 2 mM; Tsg 

polymerase 1,25 U; primer (M13) 2 μM; approximately 10 ng of template DNA. 

PCR was conducted using a hot start step at 95°C for 10 min, followed by 45 

cycles at 95°C for 1 min, 48°C for 30 s, 72°C for 2 min and a final extension at 

72°C for 10 min. 

178


2.2. Analyzes of amplification products 

Amplification products were separated by electrophoresis (90 V for 120 min) in 

1.5 % agarose gels in TAE buffer and length of the products were determined by 

using 100 bp DNA Ladder. The presence or absence of amplification products was 

scored to analyze the variation among the populations. 

3. RESULTS 

The amplifications yielded a total of 18 markers ranging from 300 to 1200 bp in 

size. The amplification profiles were very similar for most of the 

Gymnosporangium telial horns; the M13 primer seemed not detect any significant 

level of variation within 50 samples. 

Figure 2: Amplification products of G. fuscum isolates from different sites. 

4. DISCUSSION 

The very low level of variation detected by M13 amplifications was surprising. 

Within its 2- year life cycle G. fuscum produces relatively limited number of 

genetically identical spores. Each aecidium on pear is initiated by a single 

basidiospore and therefore could be expected to be (at least in practise) genetically 

different from other aecidia. As the fungus lacks an uredinial stage on pear the 

number of infections on pear caused by single genets is not multiplied. As a result, 

genetic variation among aecidiospores infecting junipers should be high. As new 

infections on juniper occur annually, one could expect to find a high level of 

genetic variation among G. fuscum isolates on that host. 

179


As the results are preliminary we can not exclude the possibility of non-optimal 

conditions in the PCR reactions. However, the amplicon profiles looked normal 

without signs of e.g. abnormally long fragments. Therefore other explanations are 

more likely. 

Arbitrarily primed PCR using M 13 core sequence as a primer detects variation 

in several of species of fungi growing on forest trees including such as; 

basidiomycetes Heterobasidion annosum s.l. (Fr) Bref. (Hantula et al., 1996; 

Stenlid et al., 1993)and Fomitopsis pinicola (Schwarts: Fr) Karst. (Högberg et al., 

1995), ascomycetes Ophiostoma ulmi (Buism), Ceratocystis fimbriata f.sp. platani 

(Santini et al., 2000), and Nectria fuckeliana C. Booth (Vasiliauskas and Stenlid, 

1997) and Sphaeropsis sapinea Dyko& Sutton (Xiaoqin et al., 2007) among fungi 

imperfecti. Among biotrophs the primer has been used successfully for powdery 

mildews (ascomycete) but to our knowledge not for smuts and rusts 

(basidiomycetes). It is possible that annealing sites for the M13 primer within G. 

fuscum genome are few. Another reason for the low variation could be that the 

distances between the sampled stands were short. 

Table 1. Presence and absence vector of amplification products. 

Isolates 330bp 360bp 380bp 390bp 400bp 450bp 540bp 550bp 590bp 650bp 660bp 680bp 710bp 810bp 870bp 910bp 950bp 1200bp 

S1.1 1 1 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 

S1.2 1 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 

S1.3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 

St2.1 1 0 1 0 0 0 1 0 0 1 0 0 0 0 0 1 1 1 

St2.2 1 1 0 0 0 0 1 1 0 1 0 0 0 1 0 0 0 0 

St2.3 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 

St2.6 0 0 1 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 

B3.1 0 1 0 0 0 0 1 1 0 1 1 1 0 0 1 0 0 1 

B3.2 0 1 0 0 0 0 1 0 0 1 1 1 0 0 0 0 0 1 

B3.3 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 

B3.4 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 

B4.4 0 0 1 0 0 0 1 1 0 1 0 0 0 0 0 0 1 1 

Be4.5 0 0 1 0 0 0 1 0 0 1 0 0 0 0 0 0 1 1 

Be4.6 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 1 0 0 

Be5.8 1 1 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 

Be5.9 1 1 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 

Be5.10 1 1 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 


This work was supported by State Planning Organisation of Turkish Republic 

(DPT–2003 K 1211020-7). 

180

6. REFERENCES 


Doğmuş-Lehtijärvi, H. T.; Lehtijärvi, A. ; Aday, A. G., 2009. European pear rust on Juniperus 

excelsa L. in south-western Turkey. Volume 39 (1): 35-42. 

Güner, A.; Özhatay, N.; Ekim, T.; Başer, K. H. C. (Eds.), 2000. Flora of Turkey and the East Aegean 

Islands, Vol. XI, Supplement - II, University Press, Edinburgh. 654 p. 

Hintz, W.E., Jeng, R.S., Hubbes, M.M., and Horgren, P.A., 1991. Identification of three populations 

of Ophiostoma ulmi by mitochondrial DNA restriction-site mapping and nuclear DNA 

fingerprinting. Exp. Mycol. 15,316-325. 

Hollebone J.E., 2006. Domestic Regulations of Pear Trellis Rust, Gymnosporangium fuscum Hedw. f. 

[online], Canadian Food Inspection Agency, Directive D-97-01, cited: 21/12/06, revised: 

04/07/06, Plant Health Division, Ottawa, Ontario, Available at the Internet:



FACTORS FAVOURING BROOM RUST INFECTION IN ADVANCE 

PLANTINGS OF Abies alba IN SW-GERMANY 

ABSTRACT 

Tilo PODNER 1 and Berthold METZLER 1* 

1 Forest Research Institute of Baden-Wuerttemberg 

Department of Forest Protection, D- 79100 Freiburg/Br., Germany 

*berthold.metzler@forst.bwl.de 

For ecological reasons, even aged stands of Norway spruce (Picea abies) are going to 

be converted to mixed forests, including silver fir (Abies alba) and other native tree species. 

In order to avoid clear cuttings, the alternative tree species are often introduced into the 

spruce stands by advance plantings. However, after about two decades of planting, several 

stands of planted silver fir turned out to be severely infected by Melampsorella 

caryophyllacearum. If the stems are affected, wood quality is deteriorated by burl 

formation and even more by the risk of secondary infection by wood decay fungi like 

Phellinus hartigii which makes the stems break in timber age. 

A study was performed in order to quantify the disease incidence in advance plantings 

of silver fir under Norway spruce by using circular sample plots. Brooms respective 

cankers formed after Melampsorella-infections in branches and in stems were counted 

separately. Amongst others the stand structure and the presence of caryophyllaceous host 

plants (mainly Stellaria nemorum) bearing the dicaryotic phase of the rust fungus in the 

neighbourhood of the plots were recorded. The presence of alternate host plants turned out 

to be the most crucial factor for disease incidence, whereas, there was no evidence that 

geology, altitude, or stand density could play a major role. Since Stellaria plants were 

mainly found along forest roads or in logging lines, it is recommended that silver fir not be 

planted right beside such places. 


More than 100.000 ha (7.6 %) of the forest area of the SW-German land Baden- 

Wuerttemberg is covered by silver fir Abies alba MILL. This is by far the biggest 

area of this tree species in Germany. In order to achieve a more nature-oriented 

forest, the state forest administration is going to raise the proportion of A. alba to 

11% and to diminish monocultures of Norway spruce (Picea abies), presently by 

far the most dominant forest tree species. In contrast to the latter species, silver fir 

is neither object of butt rot by Heterobasidion spp. nor endangered by severe bark 

beetle attacks. 

In order to avoid clear cuttings, silver fir is often introduced into the spruce 

stands by advance plantings in small gaps. However, after about two decades of 

planting, several stands of planted silver fir turned out to be severely infected by 

Melampsorella caryophyllacearum SCHROET. Forest administration of Baden- 

182


Wuerttemberg reports fir broom rust to be economically important on 575 ha 

(Schroeter et al., 2009). 

The increment of the trees is not directly affected by the rust infection (Solla et 

al., 2006). However, if the stems are affected, wood quality is deteriorated by burl 

formation and even more by secondary infection by wood decay fungi, primarily 

Phellinus hartigii, which makes the stems break in timber age. Thus, besides the 

economical damage the rust fungus is driving higher biodiversity in silver fir stands 

(Holdenrieder, 1994). 

We performed a study in order to quantify the disease incidence in advance 

plantings of silver fir under Norway spruce. In the past, broom rust was designated 

as a major problem in silver fir forest (Heck, 1894), so it should be elucidated 

whether this is true under the given circumstances today. 

Figure 1. M. caryophyllacearum-stem canker 

(arrows) in two Abies alba plants. 


183 

Figure 2. Several cankers on the trunk and 

in branches closed to the trunk of a silver fir. 

Eleven forest stands with advance plantings and two stands with natural 

regeneration of silver fir were selected in the eastern slope of Black Forest in the 

SW-German districts of Breisgau-Hochschwarzwald, Schwarzwald-Baar, and Tuttlingen. 

Altitude and geology are listed in Table 1. Age class and density of 

regeneration and canopy were evaluated according to forest inventory methods 

(Kramer and Akca, 1995). Three to seven circular sample plots of 25 m² each were 

placed at random within these stands. 

Presence of brooms respective cankers formed in consequence of 

Melampsorella-infections in were counted separately for branches and trunks 

(Figure 2). Branch cankers which are closer than 10 cm to the trunk are expected to 

fuse with the stem in a few years and hence were regarded like stem cankers. The 

presence of caryophyllaceous host plants (mainly Stellaria nemorum) bearing the


dicaryotic phase of the rust fungus in the plots and in their neighbourhood were 

recorded. Silver fir can only be infected by the rusts basidiospores, exclusively 

originating from the alternate host. 

Table 1: List of monitoring plots(a.p.: advance planting; n.r. natural regeneration) 

Stand 

Numb 

er 

District Geology 

Forest 

Compartment 

184 

Regeneration 

type 

Altitude 

(m s l) 

N 

plots 

1 Schw.-Baar Braunjura XI_1 a.p. 808 4 

2 Schw.-Baar Keuper IV_2 a.p. 739 4 

3 Schw.-Baar Keuper IV_3 a.p. 737 4 

4 Br.-Hschw. Buntsandstein III_2 a.p. 1036 5 

5 Br.-Hschw. Muschelkalk XXV_6 a.p. 732 3 



8 Br.-Hschw. Muschelkalk XXVII_1 a.p. 722 3 

9 Schw.-Baar Braunjura X_6 n.r. 822 7 

10 Tuttlingen Braunjura Gew.Teilenw. n.r. 802 4 

11 Br.-Hschw. Granit/Gneis Urishof a.p. 1062 4 

12 Schw.-Baar Braunjura XI_1 a.p. 806 4 

13 Br.-Hschw. Granit/Gneis Urishof a.p 1050 4 

3. RESULTS 

Mean 

846 

Total 

53 

Incidence of broom rust in the stands (average of percentage infected firs per 

plot) stretched from 2.2 till 100 % (Table 2). In five stands, 100% were reached; 

the mean amount was 63.8%. The percentage of stem cankers was lower (in 

average by 35.5%) and decreased parallel with the general disease incidence. In 

seven stands, more than 50% of the trees bared stem cankers (mean 42.4 %). 

As alternate host of the rust fungus nearly exclusively S. nemorum was 

recorded. In most cases, it was found numerously at roadsides and in logging lines, 

in the vicinity of the plots rather than in the plots themselves. This plant species 

was found much more frequently in stands with higher disease incidence. 

Neither density of canopy and young stand nor geological factors nor age class 

of the plantings respective regenerations showed evidence to be related with the 

percentage of the diseased silver fir trees. Advance plantings seemed to be more 

infected than natural regenerations.


Table 2: Characteristics and disease incidence of monitoring plots. Stands are given in 

the order of descending disease incidence. (I: seedlings; II: saplings, III: young pole stage) 

Stand 

Number 

n 

A. alba 

counted 

Density of 

young 

stand 

Density of 

canopy 

Age 

Class 

185 

Alternate 

host 

recorded 

Disease 

Incidence 

%* 

Stem 

cankers 

%* 

7 45 +++ 0 I ++ 100 100 

13 33 ++ 0 I ++ 100 93 

2 27 +++ 0 II + 100 76 

11 25 + 0 II ++++ 100 67 

1 14 ++ + II ++ 100 65 

12 15 ++ + I - II ++ 94 60 

5 7 ++ 0 III 0 83 28 

9 n.r. 127 + ++ I - II ++ 70 52 

3 46 +++ 0 I - II 0 39 2 

6 14 +++ 0 II + 22 8 

8 14 ++ 0 II 0 14 0 

4 16 ++ 0 II + 5 0 

10 n.r. 304 +++ +++ I + 2 0 

Total 

687 

4. DISCUSSION 

Mean 

63,8 

* mean of plots 

Mean 

42,4 

The results show the potential of the rust fungi to infect young plantations of 

silver fir up to 100 % and in rare cases up to 100 % incidence of stem canker. Thus, 

M. caryophyllacearum may under certain circumstances still be a serious threat for 

high quality timber growth of A. alba under modern silviculture. However, a 

disease incidence up to 50% of the trees is mostly restricted to harmless branch 

cankers. To provoke a certain amount of stem cankers, the infection pressure must 

be higher. This occurs both in natural regeneration as well as in advance plantings, 

if a close association with an alternate caryophyllaceous host is given. 

Data shows that all age classes from seedling stage till pole stage can equally be 

infected. Roth (1955) found stem cankers between 1.5 and 15.2 m tree height 

(average 6.1 m) in Swiss fir forest. Heck (1894) found stem cankers between 0.5 

and 18.5 m (average 5.0 m) in SW-Germany. Both give evidence that even late 

pole stage firs can also be infected at the leaders or twigs in the upper crown. 

Nicolotti et al. (1994) and Solla and Camarero (2006) stated a positive 

correlation between disease incidence and shorter distance to rivers. This can be 

due to air humidity in sites or regions where humidity is a limiting factor for the 

infection process of the fungus. Furthermore, under German conditions, the main 

alternate host S. nemorum is rather linked with plant associations in sites close to 

ditches, rivers, or to other moist and nutrient rich sites (e.g. “Stellario-Alnetum”)


than to typical silver fir forest (Oberdorfer, 2001). Consequently, the distance to 

rivers may be identical with the source of spore dispersal from alternate host plants. 

Influencing the infection process by opening the canopy to achieve lower air 

moisture seems to be an option in Mediterranean countries rather than in Black 

Forest conditions where moisture is hardly a limiting factor. 

The silvicultural consequences from this study are considered as follows: 

a) Broom rust is a natural phenomenon in silver fir forests. Thus, in close to nature 

forestry some infections on branches must be taken into consideration. 

b) Stem canker incidence up to about 60% in the regeneration can be eliminated during 

successive regular thinnings. Premature elimination of infected trees (sanitation 

treatment) is not necessary, since infection from tree to tree does not take place. 

Furthermore, exaggerative opening of the canopy respective regeneration may promote 

damage by the aphid Dreyfusia nordmannianae (Schröter et al., 2009). 

c) Expensive plantings of silver fir should not take place close to road sides, logging 

lines, or in other disturbed sites where alternate hosts are abundant. These sites should 

be planted with non-host trees like European beech or Norway spruce. 

d) Dense stands may prevent growth of herbaceous alternate hosts. 

e) Selective pruning of infected branches may be meaningful, before cankers are going 

to merge with stems. Too intensive pruning should be avoided since silver fir tends to 

grow epicormic shoots, which may give entrance to new broom rust infections close to 

the trunk. 

REFERENCES 

Heck, C.R., 1894. Der Weisstannenkrebs. Springer Berlin, 163 pp. 

Holdenrieder, O., 1994. Krankheiten der Tanne Abies spp.. Schweiz Beitr Dendrologie 43: 11-21. 

Nicolotti, G, Cellerino, G.P., Anslemi, N., 1994. Distribution and damage caused by Melampsorella 

cariophyllacearum in Italy. Proc. IUFRO Canker, Shoot and Foliage diseases. Vallombrosa 6.- 

11.6.1994: 289-291. 

Oberdorfer, E., 2001. Pflanzensoziologische Exkursionsflora für Deutschland und angrenzende 

Gebiete. Ulmer Verlag Stuttgart 8. Aufl. 1051 pp. 

Oliva, J., Colinas, C., 2007. Canopy openings may prevent fir broom rust (Melampsorella 

caryophyllacearum) infections. Eur J Forest Res 126: 507-512. 

Roth, C., 1955. Die Wachstumsgeschwindigkeit von Weißtannenkröpfen. Schweiz Z Forstwes 106: 

657-665. 

Schroeter, H., Delb, H., Metzler, B., 2009. Waldschutzsituation 2008/2009 in Baden-Wuerttemberg. 

Allgemeine Forstzeitschrift-Der Wald 64: 336-339. 

Solla, A. Camarero, J.J., 2006. Spatial patterns and environmental factors affecting the presence of 

Melampsorella caryophyllacearum infections in an Abies alba forest in NE Spain. Forest 

Pathology 36: 165 – 175. 

Solla, A., Sanchez-Miranda, A., Camarero, J.C., 2006. Radial-growth and wood anatomical changes 

in Abies alba infected by Melampsorella caryophyllacearum: a dendroecological assessment of 

fungal damage. Ann Forest Sci 63: 293-300 

186

Foliage Diseases of Hardwood 

187


188



NON-NATIVE HOSTS AND CONTROL OF Rhytisma acerinum 

CAUSING TAR SPOT OF MAPLE. 

Tom HSIANG 1* , L.X. TIAN 1 , C. SOPHER 1 

Dept. Environmental Biology, Univ. Guelph, Guelph, Ontario, Canada. 

* thsiang@uoguelph.ca 

ABSTRACT 

Tar spot of maple is an increasingly common disease in eastern North America. 

Rhytisma acerinum, causing large tar spot, was apparently introduced from Europe, and 

causes the most extensive problems on introduced maple species such as Acer platanoides 

(Norway maple). However, this pathogen was recently confirmed via molecular methods on 

native North American species of maple, A. saccharum and A. negundo. This raises the 

possibility of pathogenic adaptation to native species that will result in more widespread 

epidemics. Ascospore production on Norway maple was observed to occur over a relatively 

short period annually (May 25 - June 22, 2006; May 25 - July 3, 2007; and May 21 - June 

13, 2008). The duration of spore dispersal was dependent on the frequency of rainfall from 

the start of dispersal. Field studies on fungicidal control of tar spot on Norway maple were 

conducted in summer 2008, using nine chemicals and a water control. All nine chemicals 

were found to be effective if applied between late May and early June. A single application 

was sufficient to control disease in summer 2008. 

Keywords: disease, fungi, Acer, fungicides 


Tar spot of maple is caused by species of the ascomycete genus Rhytisma, and 

has a worldwide distribution wherever maples are found. Tar spot has been 

increasing in abundance across Eastern North America in the last 15 years, with 

leaves of Norway maple (Acer platanoides) bearing multiple black spots. There has 

been relatively little research done on tar spot in North America. The only 

scientific reports have come from Connecticut (Waterman, 1941) and New York 

(Hudler et al., 1987; 1998). The most recent peer-reviewed research report is one 

from New York (Hudler et al., 1998), which found that the fungus Rhytisma 

acerinum is the cause of tar spot on Norway maple, both of which (host and 

pathogen) are immigrant species, while a native fungal species, R. americanum, 

occurs on the native red and silver maples (A. rubrum and A. saccharinum). This is 

probably the reason that a Norway maple may be heavily infected with tar spot 

while an adjacent red maple (A. rubrum) or silver maple (A. saccharinum) may 

have no spots. The work report here continues from the earlier report (Hsiang and 

Tian, 2008) which examined the spore dispersal and identity of the fungus on 

various maples in North America. The purpose of this work was to continue to 

examine the epidemiology of this disease, by gathering overwintered maple leaves 

from southern Ontario weekly from March through August 2007 and 2008, and 

189


inspecting the asci for the presence of filiform ascospores, which initiate infections. 

Another objective of this research was to confirm the genetic identity of the 

organism causing tar spot on a range of maples in Ontario. And the final objective 

was to look at fungicidal control of tar spot. 

2. METHODS 

2.1 Sporulation 

After snowmelt, overwintered leaves of Norway maple bearing tar spots caused 

by Rhytisma acerinum were collected from a copse of maples at the Guelph 

Turfgrass Institute, Guelph, Ontario every week from March through August in 

2007 and 2008. Diseased Norway maple leaves were soaked in distilled water for 

24 h to allow the apothecia to open, and many spots were examined, with several 

cross-sections per spot. The percent asci that were empty was estimated. Maple 

phenology and weather conditions were also recorded at each sampling. 

2.2 Genetic Identity 

Samples of tar spot from a variety of different maple species were collected 

from Ontario and Quebec, Canada in 2007 and 2008. We used the Qiagen 

DNAeasy kit (Qiagen Inc., Mississauga, Ontario, Canada), to extract DNA from 

these samples. This DNA was then amplified with conserved ITS primers which 

target the internal transcribed spacer region of ribosomal DNA spanning the 3' end 

of the 18S gene to the 5' end of the 28S gene. The primer pair, ITS1 

(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) 

were from White et al. (1991). The 12 5 ul reaction mixture for PCR amplification 

contained the following : 10 ng DNA, 1 DNA polymerase buffer, 0 5 ìm of each 

primer, and 1 U Tsg DNA polymerase (Biobasic, Scarborough, Ontario, Canada). 

Amplifications were performed in a GeneAmp PCR System 2400 (Perkin Elmer, 

Norwalk, CT, USA), with an initial denaturation step of 94 for 2 min, followed by 

35 cycles of 94 for 30 s, 55 for 1 min, and 72 for 2 min, and a final extension at 72 

for 7 min. These PCR reactions were sent for sequencing at the Laboratory 

Services Division, University of Guelph with both forward and reverse primers. At 

least two tar spot sequences from each maple species were used for analyses. 

2.3 Fungicidal Control 

The fungicide trials were conducted at the Guelph Turfgrass Institute, Guelph, 

Ontario, Canada on 2 m tall plants. These plants had been obtained from a local 

nursery as bareroot saplings over 2 m tall, and were planted in the local Fox Sandy 

Loam soil in early May 2007. The trees were placed in four rows adjacent to a 

older stand of Norway maple trees. There was 1.5 m between the rows and 1.2 m 

between the trees. Each row was considered a block and consisted of 10 trees. 

Treatments were applied to each tree at two-week intervals but to different 

branches or twigs on each of five dates in 2008: May 6, May 20, June 4, June 17, 

190


June 30. On each date, the number of leaves per twig was assessed, and twigs were 

sprayed until runoff with each treatment (up to 5 mL per twig, but depending on 

the number of leaves and leaf sizes). A plastic board was held behind each twig 

while spraying to prevent overspray onto other twigs. There were nine chemical 

treatments and a water control (Table 1). 

Table 1: Treatments applied to 2 m tall maple trees at the Guelph Turfgrass Institute, 

Guelph, Ontario, Canada, in Spring 2008 for control of tar spot. 

Treatment Common Name Product/ L 

Water control water 0 ml 

Banner MAXX propiconazole (15.6%) 0.245 mL 

Compass 50WG trifloxystrobin (0.16%) 0.175 g 

Daconil Ultrex chlorothalonil (82.5%) 1.5 g 

Dithane DG mancozeb (75%) 3 g 

Eagle WP (Nova) myclobutanil (40%) 0.34 g 

Heritage WG azoxystrobin (50%) 0.3 g 

Rovral Green GT iprodione (25%) 10 mL 

Senator WP thiophanate-methyl (70%) 1 g 

Sulfur sulfur (92%) 10 g 

The number of spots per leaf was assessed weekly from the start of the trial 

until the end of June, and then assessed monthly until the end of September. The 

morphology and phenological state of the maple leaves was also recorded during 

each assessment. 


As observed in previous years (Hsiang & Tian 2008), the first symptoms of tar 

spot on Norway maple in Southern Ontario appeared in late June as small, round, 

light green, chlorotic spots, 2 mm across. Spots enlarged to 15 mm by mid-August, 

and developed small black tar-like raised structures on the adaxial surface with a 

yellow margin. Conidia, which are considered non-infective and possibly 

spermatizing, appeared as a shiny layer on the black stroma at this time. By early 

September, the individual spots merged into a circular black spot up to 2 cm across. 

Overwintered Norway maple leaves collected in March 2007 and 2008, had 

stroma, paraphyses and asci (56-80 µm × 8.5-10.6 µm), but no ascospores were 

visible. By the middle of April, the asci were still undifferentiated, but were found 

to contain globular vacuoles or bodies. The asci became swollen as spores 

developed, and filiform ascospores were first observed in early May, averaging 55 

× 2.0 µm. By late May, after soaking in water, slits in the hysterothecia (modified 

191


apothecia) on the leaf surface opened, and contained a grayish milky substance. At 

this time, Norway maples were abundantly producing and shedding pollen, and 

small samaras were formed, with leaf sizes averaging 10 cm × 15 cm. By late May 

in 2007 and 2008, a few partially filled or empty asci were observed, with 

ascospore release through the tips, and paraphyses becoming curled beside asci 

after spore release. In early June, Norway maple leaves reached their full size (20 

cm × 24 cm), and 10% (2007) to 30% (2008) of the asci had fully discharged their 

spores. By the beginning of July 2008, nearly all the asci were empty and this 

sporulation period was longer than that observed in 2006 (Hsiang and Tian, 2008) 

because of much drier conditions. However in 2008, the sporulation period was 

shortened with full spore release by mid June because of much wetter conditions. 

In 2007, we found a few tar spots on trees tentatively identified as sugar maple 

(A. saccharum). We confirmed the identity of these maple trees based on DNA 

sequencing of a chloroplast gene. The fungal DNA was also sequenced, and it 

turned out to match R. acerinum, the European species. This was very surprising 

since the European fungal species should not occur on a native North American 

maple species. The same trees were visited again in 2008, and samples were 

collected during the growing season. These also yielded DNA confirmed as 

belonging to A. acerinum. In 2008, we also collected specimens of A. campestre 

and A. negundo from Ontario, and other samples of A. saccharum from Quebec. 

All specimens were infected with tar spot caused by R. acerinum as identified by 

sequences of the ITS region. This result was not unexpected for A. campestre since 

both the host and pathogen are European species. However, this was another 

unexpected result for A negundo, and A. saccharum. The first species is considered 

a weed, but the second species is the major source of maple syrup. The occurrence 

of a European tar spot species on North American maple species raises the 

possibility of pathogenic adaptation to native species that could result in epidemics 

more widespread than currently seen on Norway maples. 

In Hsiang & Tian (2008), we predicted that based on spore production periods of R. 

acerinum, "the practical implication is that fungicide protection against tar spot, if 

necessary, needs only to be applied during a very short period, which begins near the 

end of full leaf expansion in Norway maple". We tested this hypothesis in spring 2008 

with application of fungicides at different times. We found that a single fungicide 

application in late May or early June was efficacious in reducing the number of spots 

per leaf assessed on September 2, 2008, from over 20 to none for many of the 

fungicide tested. All fungicides were found to significantly suppress tar spot compared 

to the water control when applied at either of these two times (May 20 or June 4). 

Applications of fungicides on May 6 or June 30 were not effective in reducing tar spot, 

while the application on June 17, which was just at the end of the spore production 

period, was effective for some fungicides but not others. The implication of these 

results is that if fungicides are used, only a single application between late May and 

early June is needed for control of tar spot of Norway maple in Southern Ontario, but 

this may depend on weather and growth, with another application possibly necessary if 

early June weather is dry. 

192

4. REFERENCES 


Hsiang T and Tian XL, 2008. Sporulation and identity of tar spot of maple in Canada. Acta Silvatica 

& Lignaria Hungarica 2007, 71-74. 

Hudler GW, Jensen-Tracy S, Banik MT. 1998. Rhytisma americanum sp. nov.: a previously 

undescribed species of Rhytisma on maples (Acer spp.). Mycotaxon 68, 405-416. 

Waterman AM. 1941. Diseases of shade and ornamental trees: annotated list of specimens received in 

1940 at the New Haven Office, Division of Forest Pathology. Plant Dis. Rep. 25, 181- 

182. 

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal 

RNA genes for phylogenetics. In: Innis MA, Gelfand DA, Sninsky JJ, White TJ. (Eds.), 

PCR Protocols: a guide to methods and applications. Academic Press, San Diego, U.S.A., 

pp. 315 - 322. 


This study was funded by the Ontario Ministry of Agriculture, Landscape 

Ontario, and the National Sciences and Engineering Research Council of Canada. 

Trees were donated by Winkelmolen Nursery, Lynden, Ontario, Canada. 

193



BIOLOGICAL CONTROL TRIALS OF BEECH BARK DISEASE 

UNDER LABORATORY CONDITIONS 

Gaston LAFLAMME 1* , Simon BOUDREAULT 1 , Robert LAVALLEE 1 , 

Martine BLAIS 1 , Jean-Yves BLANCHETTE 2 . 

1 Natural Resources Canada, CFS, Laurentian Forestry Centre, Québec, QC, Canada G1V 4C7 

2 Université de Moncton, Edmundston, N.-B., Canada E3V 2S8 

* Gaston.Laflamme@NRCan-RNCan.gc.ca 

ABSTRACT 

Beech bark disease (BBD) causes mortality of American beech (Fagus grandifolia 

Ehrh.). BBD involves an attack by the beech scale insect Cryptococcus fagisuga Lind. 

followed by the native fungal pathogen Neonectria faginata (Lohman et al.) Cast. & 

Rossman. C. fagisuga was introduced into Halifax, Nova Scotia, from Europe through 

seedlings around 1890. Damage to American beech was observed 20 years later. Our 

objective is to use entomogenous fungi to control the insect. Lecanicillium muscarium 

(Petch) Zare & W. Gams, common in European infested sites, was retained as well as 

Beauveria bassiana (Bals.-Criv.) Vuill. Our first trials were done on non-crawling nymphal 

stage on bark disks, 24 mm in diameter, kept individually in Solo cups ® at 20°C or 25°C. 

To expose the insects, the “wool-like” wax covering the colony was removed. The 

treatment consisted of an application of 125 µL of 10 6 spores/mL of water and oil. A 

second trial was conducted by spraying spore suspensions of L. muscarium (100 µL) on 

eggs kept at 25°C. Both biological control agents reduced the crawlers’ population by 50% 

after 11 days. Eggs treated with L. muscarium showed low mortality, but their 

development was slowed down. Fungi seen on the surface of the eggs invaded the first 

instars. Field trials are underway. 

Keywords: Beech bark disease, Cryptococcus fagisuga, Neonectria faginata, 

Lecanicillium muscarium, entomogenous fungi, Beauveria bassiana 


American beech (Fagus grandifolia Ehrh.) forests suffer significant mortality 

caused by beech bark disease (BBD); this complex disease has a permanent 

negative impact on the forest ecosystem in North America. A symposium on this 

important disease was held in New York State to summarize the status of our 

knowledge on BBD, and to identify the most important knowledge gaps of this 

phenomenon (Evans et al., 2005). Rapidly spreading across eastern North 

America, BBD involves a preliminary attack by the beech scale insect 

Cryptococcus fagisuga Lind. and fungal species of the genus Nectria (Ehrlich, 

1934), now known under the genus Neonectria (Figure 1). The insect C. fagisuga 

was introduced into Canada from Europe, around 1890, through European beech 

(F. sylvatica L.) seedlings planted as ornamentals in Halifax, Nova Scotia, Canada. 

194


Damage to our native American beech was first observed 20 years later. The 

pathogen was thought to be the exotic fungus Neonectria coccinea from Europe, 

but recent taxonomic studies showed that the new species Neonectria faginata 

(=Nectria coccinea var. faginata) is the pathogen of this BBD complex in North 

America (Castlebury et al., 2006). Also, N. ditissima (=Nectria galligena), a 

pathogen causing cankers on Acer spp. and Betula spp. in North America, is often 

involved in the BBD (Houston, 1994). 

A B 

Figure 1: A- The beech scale insect Cryptococcus fagisuga colonizing the bark of the 

American beech (Fagus grandifolia). B- Multiple small cankers caused by Neonectria 

faginata. 

The control of BBD is not an easy task. Different approaches have been 

considered. The selection and propagation of resistant beech is one of them (Koch 

and Carey, 2005; Loo et al., 2005). Using silviculture to improve the health status 

of beech populations in newly infested stands (Heyd, 2005) or aftermath forests 

(Ostrofsky, 2005) is a second approach. Biological control of the scale insect and 

fungal pathogens is a possibility that has been suggested in the past, but so far only 

preliminary trials have been reported (Lonsdale, 1983). 

In our project, we are testing different entomogenous fungi and hyperparasite 

fungi to control the insects and the pathogens involved in the BBD complex. The 

objective of this study is to use entomogenous fungi to reduce the population of C. 

fagisuga under laboratory conditions. 


Since the entomogenous fungus Lecanicillium muscarium (= Verticillium 

lecanii Vegas) was observed to be common in heavily infested sites in England 

(Lonsdale, 1983), it was retained in our first experiment on the non-crawling 

nymphal stage. This instar is a crawling immature but has its stylet fixed in the 

bark and produces the typical “wool-like” wax. We are using the isolate L. 

195


muscarium (Mycotal®). Another fungus, Beauveria bassiana (Bals.-Criv.) Vuill. 

currently being tested against other forest insect pests in our laboratory, has been 

added to part of this trial. 

The first experiment was done on 24 mm diameter bark disks colonized by C. 

fagisuga collected on different trees in the fall and winter. To expose the insect 

nymphs to the fungus, the white “wool-like” wax was gently removed with fine 

tools to facilitate observations. The treatment consisted of an application of 125 µL 

of 10 6 spores/mL of water (added with oil (0.5%) and Tween 80 (0.0025%)). Bark 

disks were kept individually in Solo cups at 20°C (65% HR) and/or 25°C (85% 

HR) and photoperiod of 16D:8L. A control was also used with the same 

formulation but without the spores. Observations were done regularly over a 

period of two weeks. Table 1 presents the total number of live scale insects 

observed on the bark disks in each treatment on samples collected in fall and 

winter. 

Table 1: Total number of scale insects used according to treatments and sampling 

seasons. 

Treatment Sampling season 

196 

Number of bark 

discs 

Total number of live 

non-crawling 

nymphal stage on 

bark discs 

Control-Oil Fall 15 88 

ycotal-Oil Fall 11 119 

Beauveria-Oil Fall 7 84 

Control-Oil Winter 12 70 

Mycotal-Oil Winter 17 99 

The second experiment was run using a spore suspension of L. muscarium (100 

µL of 10 6 spores/mL) with the same formulation as the first experiment, sprayed 

on eggs (61 eggs for the control and 74 for the treatment) and kept at 25°C (85% 

HR and photoperiod of 16D:8L). Observations were done regularly over a period 

of three weeks. 


Both biological control agents reduced the non-crawling nymphal stage 

population by 50% after 10-11 days, but L. muscarium (Mycotal ®) showed 

slightly better results (Figure 2). Mortality of each female was based on apparent 

drying symptoms associated with cuticle darkening and hyphal growth on the 

insect body.

Cumulative mortality (%) 

100 

50 

0 


0 2 4 6 8 10 12 

Days 

197 

Control-OIL-25-fall 

Mycotal-OIL-25-fall 

Beauveria-OIL-25-fall 

Figure 2: Cumulative mortality of Cryptococcus fagisuga exposed to Lecanicillium 

muscarium (Mycotal®), Beauveria bassiana and control over a period of 11 days. 

A higher mortality level of scale insects treated with L. muscarium was 

observed on samples collected in winter, compared with the fall samples. The 

winter mortality may have been caused by very cold temperatures (-35°C) 

measured in February (Environment Canada). Also, the measured mortality rate 

with L. muscarium was increasing much faster, reaching 50% in only 7 days 

compared with 10 days in the previous fall tests (Figure 3). Our observations are in 

agreement with Crosby and Bjorkbom (1958), who consider that severe winter 

temperatures of -35 o F (-37 o C) or lower are lethal to beech scale insects. 

Eggs treated with L. muscarium showed very low mortality, but the treatment 

slowed down their development (Figure 4). Fifty percent hatching was reached 

after 8 and 12 days respectively for the L. muscarium treatment and control. The 

fungus was observed to colonize only the external surface of the egg chorion. 

However, when they hatch, first instars become rapidly infected by the fungus 

already present on the egg chorion. 

Cumulative mortality (%) 

100 

50 

0 

0 2 4 6 8 10 12 

Days 

Control-OIL-25-fall 

Mycotal-OIL-25-fall 

Control-OIL-25-winter 

Mycotal-OIL-25-winter 

Figure 3: Mortality of scale insects over a period of 11 days from samples collected in 

the fall and winter, after treatment with Lecanicillium muscarium (Mycotal®) and control.

Eggs hatching (%) 

100 

50 

0 


0 2 4 6 8 10 12 14 16 18 20 22 

198 

days 

Control-25 

Mycotal-25 

Figure 4: Percentage of Cryptococcus fagisuga’s eggs hatching after treatment with 

Lecanicillium muscarium (Mycotal®) over a 21-day period. 

4. CONCLUSION 

The scale insect Cryptococcus fagisuga, exposed to Lecanicillium muscarium 

(Mycotal®) and Beauveria bassiana under laboratory conditions, reduced the noncrawling 

nymphal stage population by 50%. This percentage could have been 

higher, but the experiment on bark disks cannot last longer than 10 to 12 days; 

because of the high rate of humidity, fungal hyphae invade the disks making 

further observations impossible. The fall population treated with entomogenous 

fungi had a mortality rate reaching 50% in 10 days. Scale insects collected in 

winter show a higher rate of mortality after biological treatment; the difference 

with fall is probably the mortality caused by the very cold temperatures during the 

winter. Finally, if eggs are not directly invaded by fungal hyphae, the young 

crawlers are rapidly colonized by the fungi soon after hatching (data not shown). 

Field trials with these biological control agents will be the next step of this study. 


Castlebury, L.A., Rossman A.Y., Hyten A.S., 2006. Phylogenetic relationships of 

Neonectria/Cylindrocarpon on Fagus in North America. Can. J. Bot. 84, 1417-1433. 

Crosby, D., Bjorkbom J.C., 1958. Timely salvage can reduce losses from beech scale Nectria attack. 

U.S. Forest Serv., Northeastern Forest Experiment Station, Forest Research Note 82, 4p. 

Ehrlich, J., 1934. The beech bark disease. A Nectria disease of Fagus, following Cryptoccus fagi 

(Baer.). Can. J. Res. 10, 593-692. 

Evans, C.A., Lucas J.A., Twery M.J. (Eds.), 2005. Beech Bark Disease: Proceedings of the Beech 

Bark Disease Symposium. General Technical Report NE-331. Newtown Square PA, US 

Department of Agriculture Forest Service, Northern Research Station, 149 p.


Heyd, R.L., 2005. Managing Beech Bark Disease in Michigan In: Evans, C.A., Lucas J.A., Twery 

M.J. (Eds.). Beech Bark Disease: Proceedings of the Beech Bark Disease Symposium. 

General Technical Report NE-331. Newtown Square PA, US Department of Agriculture 

Forest Service, Northern Research Station, pp. 128-132. 

Houston, D.R., 1994. Temporal and spatial shift within the Nectria pathogen complex associated with 

beech bark disease of Fagus grandifolia. Can. J. For. Res. 24, 960-968. 

Koch, J.L., Carey D.W., 2005. The Genetics of Resistance of American Beech to Beech Bark 

Disease: Knowledge through 2004. In: Evans, C.A., Lucas J.A., Twery M.J. (Eds.), 2005. 

Beech Bark Disease: Proceedings of the Beech Bark Disease Symposium. General 

Technical Report NE-331. Newtown Square PA, US Department of Agriculture Forest 

Service, Northern Research Station, pp. 98 – 105. 

Lonsdale, D., 1983. Fungal associations in the buildup and decline of Cryptococcus fagisuga 

populations. In: Proceedings, IUFRO Beech Bark Disease Working Party Conference, 

September 26 - October 8, 1982, Hamden, Connecticut. General Technical Report WO- 

37. Washington, DC: U.S. Department of Agriculture, Forest Service. pp. 99-104. 

Loo, J., Ramirez, M., Krasowski M., 2005. American Beech Vegetative Propagation and Genetic 

Diversity. In: Evans, C.A., Lucas J.A., Twery M.J. (Eds.), 2005. Beech Bark Disease: 

Proceedings of the Beech Bark Disease Symposium. General Technical Report NE-331. 

Newtown Square PA, US Department of Agriculture Forest Service, Northern Research 

Station, pp. 106 – 112. 

Ostrofsky 2005. Management of beech bark disease in aftermath forests. In Evans, C.A., Lucas J.A., 

Twery M.J. (Eds.), 2005. Beech Bark Disease: Proceedings of the Beech Bark Disease 

Symposium. General Technical Report NE-331. Newtown Square PA, US Department of 

Agriculture Forest Service, Northern Research Station, pp. 133-137. 

199



PATHOGENICITY OF Fusarium circinatum NIREMBERG & 

O’DONNELL ON SEEDS AND SEEDLINGS OF RADIATA PINE 

Pablo Martínez-ÁLVAREZ 1 , Juan BLANCO 2 , Milagros de VALLEJO 2 , 

Fernando M. Alves-SANTOS 1 , Julio J. DIEZ 1* 

1 Departamento de Producción Vegetal y Recursos Forestales. ETSIIAA Palencia. Universidad de 

Valladolid. Avenida Madrid, 57. 34004 Palencia. España. 

2 Sección de Producción y Mejora Forestal Servicio de Montes Dirección General de Biodiversidad. 

Gobierno de Cantabria. Calle Rodríguez, nº 5, 1º. 39.071 Santander 

ABSTRACT 

*jdcasero@pvs.uva.es 

Pathogenicity of seven Fusarium circinatum isolates from Northern Spain was 

evaluated on Monterey pine (Pinus radiata) seeds and seedlings. The objectives of our 

study were also to investigate emergence and post-emergence damping-off damage, and to 

observe differences in pathogenicity among the isolates. 

The effect of F. circinatum on seed emergence was approximately 10 to 19% lower than 

the control treatment. However, all F. circinatum isolates severely affected pine seedlings, 

causing 63% to 90% mortality of plants 30-days post inoculation. Sixty days after 

inoculation, isolate FcCa7 killed all the seedlings, while the less aggressive FcCa2 affected 

79% of the plants. We believe this homogeneity in aggressiveness among Fusarium isolates 

may possibly be attributed to the recent introduction of the pathogen in this region. 

Key words. Pitch Canker, Biological control, Pinus radiata, Nurseries, Plant health 

care 


Fusarium circinatum is a pathogenic fungi with great virulence in species of the 

genus Pinus, causing a disease called pitch canker. It was first discovered as a 

pathogen in California during 1986 (Mccain et al., 1987). Since then, F. circinatum 

was also found in Mexico (Rodriguez, 1989), South Africa (Viljoen et al., 1994; 

Nirenberg and O'Donnell, 1998; Crous et al., 2000; Steenkamp et al., 2002; 

Coutinho et al., 2007), Japan (Aoki et al., 2001; Kobayashi, 2007), Chile 

200


(Wingfield et al., 2002; Jacobs et al., 2007), Korea (Cho and Shin, 2004), Italy 

(Carlucci et al., 2007) and Spain (Landeras et al., 2005; Perez-Sierra et al., 2007). 

One of the most important actions to control the disease is to have a better 

understanding about the populations of the fungus, and it behaviour over plants 

host. Thus, the aim of this work is to investigate the effect of F. circinatum over 

seeds and seedlings of Pinus radiata, and to observe the differences in 

pathogenicity between isolates. 


2.1. Fungal material 

Seven different isolates of Fusarium circinatum obtained from Pinus radiata 

plantations of the Autonomous Community of Cantabria, in the northern Spain, 

were used for this study. Malt extract media (20 g/l) was prepared to achieve the 

spore dissolution of the fungus used in the inoculation (50 ml of autoclaved media 

in a Erlenmeyer flask). Once esterilized, four pieces of fungal mycelium grown in 

PDA-S (potato-dextrose-agar with 0.5 g/l of streptomycin sulfate) were placed 

inside the flasks. Production of spores was induced by using an orbital shaker. 

After that, the media was filtered in order to collect only spores in the dissolution. 

In order to obtain the fitted concentration (10 6 spores/ml), we used a Thoma 

counting chamber. 

2.2. Plant material 

A total of 672 seeds were sown to observe the effect of the fungus over the plant 

material. Before sowing them, seeds were washed with sterile distilled water 

repeatedly and kept there for twelve hours. After that, seeds were maintained in 

hydrogen peroxide (3%) for 30 minutes. Finally they were washed twice with 

sterile distilled water to remove the remaining hydrogen peroxide permeating the 

seeds. 

2.3. Substrate. A mixture of peat and vermiculite at 50% were used for the 

experiment. Before filling the nursery trays, the substrates were autoclaved twice 

during one hour at 120 ºC. 

2.4. Seeds sowing 

Seeds were grown in nursery trays, placing four seeds in each hole. Twenty one 

holes were used for each isolate. After sowing, trays were covered with a 

transparent plastic paper to prevent the aerial contaminations. The assay was 

developed in controlled conditions of temperature (20 ºC) and photoperiod (16/8) 

inside a growth chamber (Figure 1). Seedlings were watered once a week, with 

twenty millilitres of sterile distilled water, and checked for the progress of the 

assay. 

201


Figure 1: Growth chamber with the trays inside. 

2.5. Data capture 

Seed germination was measured once a week. Futhermore dead seedlings were 

counted ten weeks after the sowing. At the end of the experiment, attempts to 

reisolate the pathogen from the seedlings were made to verify it presence in the 

necrotic lesions. 

2.6. Statistical analysis 

A Kruskal-Wallis test was performed with Statgraphics Plus 5.1. to find 

differences between germination and mortality taxes of the different isolates. 

3. RESULTS AND DISCUSION 

3.1. Germination 

Despite genus Fusarium is considered as one of the most important causes of 

pre-emergence and post-emergence damping-off (Machon et al., 2006; Pinto et al., 

2006), in our present assay fungus did not cause great damages over seeds but, 

decreasing slightly germination rates. As it can be observed in the Figure 2, 

CONTROL was the treatment where seeds were more germinated. There were 

significant differences between this and the others treatments in which F. 

circinatum was present. On the other hand, no differences were observed among 

the seven isolates of the fungus used in the assay. 

202

Germination (%) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

07/01/2009 






203 


FcCa 1 FcCa 2 

FcCa 3 FcCa 4 

FcCa 5 FcCa 6 

FcCa 7 CONTROL 




Figure 2: Rates of germination of the seeds depending on the isolate of Fusarium 

circinatum used 

3.2. Virulence 

Living plants (% ) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

a 

b 

b 

b 

FcCa 0 FcCa 1 FcCa 2 FcCa 3 FcCa 4 FcCa 5 FcCa 6 FcCa 7 

Figure 3: Percentage of living plants ten weeks after the inoculation according to the 

treatment used 

b 

b 

b 

b


All isolates of F. circinatum were highly virulent and significant differences among 

them were not observed. Aegerter and Gordon (2006) obtained the rates of seedling 

mortality ranging from 3.5 to 52%, however in our investigation most of the seedlings died 

after ten weeks of the inoculation. On the other hand, 70% of seedlings were still alive in 

case of the treatment where the fungus was not present (p-value < 0.001). 


1. The effect of Fusarium circinatum over seed germination was small, 

reducing the rate of germinated seeds in between 10 and 20%. No differences were 

seen in germination among the seven isolates used. 

2. Mortality of Pinus radiata seedlings inoculated with the Fusarium circinatum 

was high for the seven isolates. Four isolates killed all the P. radiata seedlings. 

3. No big differences were found in virulence among the seven isolates. 


We thank the Government of the Autonomous Community of Cantabria, the 

Ministry of Agriculture, and the Ministry of Environment (INIA-CIFOR) for 

financial support. We also want to thank Mohammed Masum Ul Haque for the 

revision of the article. 

REFERENCES 

Aegerter, B.J., Gordon, T.R., 2006. Rates of pitch canker induced seedling mortality among Pinus 

radiata families varying in levels of genetic resistance to Gibberella circinata (anamorph 

Fusarium circinatum). Forest Ecology and Management 235, 14-17. 

Aoki, T., O'Donnell, K., Ichikawa, K., 2001. Fusarium fractiflexum sp. nov. and two other species 

within the Gibberella fujikuroi species complex recently discovered in Japan that form 

aerial conidia in false heads. Mycoscience 42, 461-478. 

Carlucci, A., Colatruglio, L., Frisullo, S., 2007. First report of pitch canker caused by Fusarium 

circinatum on Pinus halepensis and P. pinea in Apulia (Southern Italy). Plant Disease 91, 

1683-1683. 

Cho, W.D., Shin, H.D., 2004. List of plant diseases in Korea., Fourth edition ed. 

Coutinho, T.A., Steenkamp, E.T., Mongwaketsi, K., Wilmot, M., Wingfield, M.J., 2007. First 

outbreak of pitch canker in a South African pine plantation. Australasian Plant Pathology 

36, 256-261. 

Crous, P.W., Phillips, A.J.L., Baxter, A.P., 2000. Phytopathogenic Fungi from South Africa. 

University of Stellenbosch, Department of Plant Pathology Press. 

Jacobs, A., Coutinho, T.A., Wingfield, M.J., Ahumada, R., Wingfield, B.D., 2007. Characterization 

of the pitch canker fungus, Fusarium circinatum, from Chile. South African Journal of 

Science 103, 253-257. 

Kobayashi, T., 2007. Index of fungi inhabiting woody plants in Japan. Host, Distribution and 

Literature. Zenkoku-Noson-Kyoiku Kyokai Publishing Co., Ltd. 

Landeras, E., García, P., Fernández, Y., Braña, M., Fernández-Alonso, O., Méndez-Lodos, S., Pérez- 

Sierra, A., León, M., Abad-Campos, P., Berbegal, M., Beltrán, R., García-Jiménez, J., 

Armengol, J., 2005. Outbreak of pitch canker caused by Fusarium circinatum on Pinus 

spp. in Northern Spain. Plant Disease 89, 1015-1015. 

204


Machón, P., Santamaría, O., Pajares, J.A., Alves-Santos, F.M., Diez, J.J., 2006. Influence of the 

ectomycorrhizal fungus Laccaria laccata on pre-emergence, post-emergence and late 

damping-off by Fusarium moniliforme and F.oxysporum on Scots pine seedlings. 

Symbiosis 42, 153-160. 

Mccain, A.H., Koehler, C.S., Tjosvold, S.A., 1987. Pitch canker threatens Californian pines. 

Californian Agriculture 41, 22-23. 

Nirenberg, H.I., O'Donnell, K., 1998. New Fusarium species and combinations within the Gibberella 

fujikuroi species complex. Mycologia 90, 434-458. 

Peréz-Sierra, A., Landeras, E., León, M., Berbegal, M., García-Jiménez, J., Armengol, J., 2007. 

Characterization of Fusarium circinatum from Pinus spp. in northern Spain. Mycological 

Research 111, 832-839. 

Pinto, P.M., Alonso, J.A.P., Fernández, V.P., Casero, J.J.D., 2006. Fungi isolated from diseased 

nursery seedlings in Spain. New Forests 31, 41-56. 

Rodríguez, R.G., 1989. Pitch canker on Pinus douglasiana, pines indigenous to San Andrés Milpillas, 

Municipal of Huajicori, Nay., City of Juarez, Chihuahua. Mexico. 

Steenkamp, E.T., Wingfield, B.D., Desjardins, A.E., Marasas, W.F.O., Wingfield, M.J., 2002. Cryptic 

speciation in Fusarium subglutinans. Mycologia 94, 1032-1043. 

Viljoen, A., Wingfield, M.J., Marasas, W.F.O., 1994. 1st Report of Fusarium subglutinans f. sp. pini 

on Pine-Seedlings in South-Africa. Plant Disease 78, 309-312. 

Wingfield, M.J., Jacobs, A., Coutinho, T.A., Ahumada, R., Wingfield, B.D., 2002. First report of the 

pitch canker fungus, Fusarium circinatum, on pines in Chile. Plant Pathology 51, 397- 

397. 

205



POWDERY MILDEW ON WOODY PLANTS IN THE CZECH 

REPUBLIC 

Dagmar PALOVČÍKOVÁ 1* , Hana DANČÁKOVÁ, 

Hana MATOUŠKOVÁ, Jindřiška JUNÁŠKOVÁ, Libor JANKOVSKÝ* 

1 Mendel University of Agriculture and Forestry, Faculty of Forestry and Wood Technology, 

Department of Forest Protection and Wildlife Management, Zemědělská 3, 613 00 Brno, Czech 

Republic 

ABSTRACT 

*palovcik@mendelu.cz 

There were identified 30 different species of powdery mildew on woody plants in the 

Czech Republic. From this number of identified Erysiphales is Phyllactinia roboris 

reported as a missing species actually. Eleven species of reported powdery mildews can be 

termed alien for the Czech Republic, including oak powdery mildew Erysiphe alphitoides 

(syn. Microsphaera alphitoides Griff.) which is naturalized species throughout Europe now. 

Newly recorded species are Erysiphe arguata, E. azaleae, E. elevata, E. flexuosa, Erysiphe 

palczewskii, Erysiphe syringae, Erysiphe vanbruntiana var. sambuci-racemosae. Erysiphe 

euonymi-japonici was reported from herbarium specimen in 1941 only. 

Keywords: Powdery mildews, Erysiphales, Alien species 


Several important alien diseases of woody plants were introduced in Europe 

within 20th century. The largest number of newly discovered alien diseases is 

belonging to the powdery mildew Erysiphales. Powdery mildew was observed by 

Theoprastis on roses 300 year B.C. already. The survey of taxonomy of this group 

is given eg. by Jaczewski (1927), Blumer (1967), Braun et al. (1978, 1981, 

1987, 2006, 2007), Zheng (1985), Gelyuta (1989), Takamatsu et al. (2007) etc. 

The main area of powdery mildew distribution is temperate zone of Northern 

Hemisphere. Occurrence in tropics and subtropics is rare, in conidial stage mostly. 

Some genera of powdery mildews occur also in boreal and arctic areas, eg. in 

Scandinavia, Northern America, polar areas of Russia, Island and Greenland 

(Braun, 1995). 

Preliminary list of alien disease in the Czech Republic (CR) include more than 

30 most important species, including 4 quarantine pests, most of them belonging to 

Erysiphales. The aim of this paper is to evaluate of spectrum of powdery mildews 

in the CR focused to alien species. 

206



Distribution, identification and pathology of individual species of powdery 

mildew have been studied on set of 240 examined samples collected on amenity 

trees and woody plants in parks in the CR within 2004 - 2008. Leaves infected with 

powdery mildew were collected in North and South Moravia and East Bohemia. 

Identification was provided according Braun (1987, 1995) and Paulech C. (1995), 

taxonomy was corrected by Takamasu (2007). Identification was made according 

to morphological features; critical findings were confirmed by H.D. Shin, new 

species as Erysiphe elevata and E. azaleae were confirmed on the bases of DNA. 

Herbarium specimens are deposited at Herbarium of Department of Forest 

Protection and Wildlife Management, Faculty of Forestry and Wood Technology. 

3. RESULTS, DISCUSSION 

There were identified 30 different species of powdery mildew on woody plants 

belonging to following genera: Erysiphe, Microsphaera, Phyllactinia, 

Podosphaera, Sawadaea, Sphaerotheca, Uncinula, Uncinuliella (Tab. 1). From this 

number of identified Erysiphales is Phyllactinia roboris reported as a missing 

species actually and Erysiphe euonymi-japonici (Vienn.-Bourg.) U. Braun & S. 

Takamatsu is known only from herbarium specimen collected in 1941; recent 

records are missing. Nearly 11 species of reported powdery mildews can be termed 

alien, although origin of several species is not clear. Newly recorded species are 

Erysiphe arguata, E. azaleae, E. elevata, E. flexuosa, Erysiphe palczewskii, 

Erysiphe syringae, Erysiphe vanbruntiana var. sambuci-racemosae. 

Table 1. List of powdery mildews observed in the CR 

Powdery 

Mildew 

Erysiphe adunca (Wallr.) Fr. 

Hosts Origin/ 

distribution 

(syn. Uncinula adunca (Wallr.) Lév.) 

Salix appendiculata, 

S. caprea, S. renii 

Erysiphe adunca var. adunca 

(Wallr.) Fr. 

(syn. Uncinula adunca var. adunca 

(Wallr.) Lév.) 

Populus nigra 

Erysiphe 

alphitoides 

(Griffon & 

Maubl.) U. 

Braun & S. 

Takam. 

(syn. 

Microsphaera 

alphitoides var. 

Quercus robur, 

Q. petraea, Q. 

cerris, 

Q. robur 

'Fastigiata', 

Q. glandifera, 

Castanea sativa 

- / Europe, 

Asia, N. 

America 

- / all Europe, 

all Asia, N. 

America 

Asia ?/ today 

nearly global 

First 

record 

from 

Europe 

1876 

Portugal, 

1906/1907 

spreading 

throughou 

t Europe; 

207 

1909 

outbreak 

References First 

record 

in the 

CR 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun 1987 

References 

2006 Palovčíková 

et al 2007 


et al 2007 

1907 (?) 

Cejp et 

Skalický 

1954, 

Příhoda1959

Powdery 

Mildew 

alphitoides 

Griffon & 

Maubl.) 

Erysiphe arcuata 

U. Braun, 

V.P.Heluta and 

S. Takam. 

Erysiphe azaleae 

(U. Braun) U. 

Braun & S. 

Takam) 

(syn. 

Microsphaera 

azaleae U. 

Braun) 

Erysiphe 

berberidis D.C. 

(syn. 

Microsphaera 

berberidis (DC.) 

Lév. 

Erysiphe elevata 

(Burrill) U. 

Braun & S. 

Takam. 

(syn. 

Microsphaera 

elevata Burrill) 

Erysiphe 

euonymi (DC.) 

(syn. 

Microsphaera 

euonymi (DC.) 

Sacc.) 

Erysiphe 

euonymijaponici 

(Vienn.- 

Bourg.) U. 

Braun & S. 

Takamatsu 

(Microsphaera 

euonymijaponici 

Vienn.- 

Bourg.) 

Erysiphe 

flexuosa (Peck) 

U. Braun et S. 

Takamatsu 

(syn. 

Uncinuliella 

flexuosa (Peck) 

U. Braun) 

Hosts Origin/ 

distribution 

Carpinus betulus 

(after revision; 

reported as a E. 

carpinicola 

previously) 

Rhododendron 

spp. 

Berberis 

thunbergii 

'Atropurpurea' 

B. vulgaris, 

B. vulgaris x 

rubra, 

Mahonia 

aquifolium 


Japan, Far 

East? 

North America 

- /all Europe, 

Central Asia, 

Turkey, Iran 

208 

First 

record 

from 

Europe 

Western 

Europe 

Germany, 

Hungary, 

Ukraine 

2006 

Germany 

1997 


record 

in the 

CR 

Braun et al. 

2006 

Pastirčáková et 

al. 2008 

Braun 1997, 

Inmann et al. 

2000 

Braun 1987 

Paulech 1995 

Catalpa 

bignonioides North America 2002 Vajna et al 

2003, 

Euonymus 

europaeus 

- /all Europe, 

Central Asia, 

Turkey 

Euonymus spp. Asia /Europe, 

Asia, 

N.America, 

S.America, 

Australia, 

Aesculus x 

carnea 

A. 

hippocastaneum, 

A. pavia 

New Zealand 

North 

America/ 

North America 

Ale-Agha et al. 

2004 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

2000 Ale-Agha et al. 

2000, 

Ing et Spooner 

2002, 

Zimmermanno 

va- 

Pastircakova et 

al. 2002 

References 


et al. 2007 

Palovčíková 

2003 et 

Dančáková 

2005, 

Lebeda et al. 

2007, 

Bacigálová, 

Marková 

2006 


et 

Dančáková 

2005, 

2005 Ale-Agha et 

al. 2004, 


et al. 2007 


et al.2007 

1931 

Piskoř 

by 

Prague 

Herb 

specimen M- 

0016258 The 

Erysiphales 

Collection at 

the 

Botanische 

Staatssamml 

ung 

München, 


et 

Dančáková 

2005, 


et al 2007

Powdery 

Mildew 

Erysiphe 

hedwigii (Lév.) 

U. Braun & S. 

Takam. 

(syn. 

Microsphaera 

hedwigii Lév.) 

Erysiphe 

lonicerae (DC.) 

(syn. 

Microsphaera 

lonicerae (DC.) 

G. Winter) 

Erysiphe ornata 

var. europaea 

(U.Braun) 

U.Braun & S. 

Takam. 

(syn. 

Microsphaera 

ornata var. 

europaea 

U.Braun) 

Erysiphe 

palczewskii 

(Jacz.) Braun & 

Takamatsu 

(syn. 

Microsphaera 

palczewskii 

Jacz.) 

Erysiphe 

penicillata 

(Wallr.) Link 

(syn. 

Microsphaera 

penicillata 

(Wallr.) Lév.) 

Erysiphe 

syringae 

Schwein. 

(syn. 

Microsphaera 

syringae 

(Schwein) H. 

Magn.) 

Erysiphe tortillis 

(Wallr.) Link 

(syn. 

Microsphaera 

tortilis (Wallr.) 

Speer 

Erysiphe 

vanbruntiana 

var. sambuciracemosae 

(U.Braun) U. 

Braun & S. 

Takamatsu 

(syn. 


Hosts Origin/ 

distribution 

Viburnum 

lantana 

-/ Europe, 

Armenia, 

Siberia 

Lonicera nigra - / all Europe, 

Central Asia, 

Japan 

Alnus glutinosa 

Betula pendula 

Crataegus 

monogyna 


Central Asia 

Caragana spp. Asia/ Europe. 

Asia 

Alnus glutinosa - / all Europe, 

Asia (Iran, 

Siberia, East 

USSR, Japan), 

N.America 

Syringa vulgaris, 

S. chinensis 

Viburnum opulus 

Cornus 

sanguinea 

Sambucus 

racemosa 

N.America/ 

N.America, 

Europa, 

Siberia, 

Australia 

- / all Europe 

- / 

North 

America, Asie 

First 

record 

from 

Europe 

209 

Hungary 

2005 


record 

in the 

CR 

References 

Braun 1987 


et al. 2007 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun1995, 

Braun & 

Takamatsu 

2000, Gelyuta 

et Minter 1998, 

Vajna 2006b 

Braun 1987 

Sinclair 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 


et al 2007 


et al 2007 

2006 

Lebeda et al. 

2008 


et al 2007 

2004 

2005 

2005 


et 

Dančáková 

2005, 


et al 2007 


et al 2007 


et 

Dančáková 

2005, 


et al 2007

Powdery 

Mildew 

Microsphaera 

vanbruntiana 

var.sambuciracemosae 

U.Braun) 

Microsphaera sp. 

(Microsphaera 

penicillata s.l.) 

Phyllactinia 

fraxini (DC.) 

Fuss 

Phyllactinia 

guttata (Wallr.) 

Lév. 

Phyllactinia mali 

(Duby) U. Braun 

Phyllactinia 

roboris (Gachet) 

Blumer 

Podosphaera 

clandestina 

(Wallr.) Lév. 

Podosphaera 

clandestina var. 

clandestina 

(Wallr.) Lév. 

Podosphaera 

pannosa (Wallr.) 

de Bary 

(syn. 

Sphaerotheca 

pannosa (Wallr.) 

Lév.) 

Podosphaera 

tridactyla 

(Wallr.) de Bary 

Hosts Origin/ 

distribution 

Sorbus 

intermedia 

F.excelsior, 

F.excelsior 

´Hessei´ 

F. angustifolia 

Betula pendula, 

B.verrucosa, 

B.verrucosa 

'Yongii,, 

B. papyrifera, 

Cornus mas, 

Corylus avellana, 

C. avellana 

'Concorta‚ 

C 

.avellana´Hetero 

phylla´, 

C. colurna, C. 

maxima 

'Purpurea', 

Crataegus 

monogyna , 

Fagus sylvatica, 

Salix sp. 

Crataegus 

monogyna 

Quercus spp. – 

not confirmed 

within past years; 

in red list 

Sorbus 

intermedia 

Crataegus 

oxyacantha 



Turkey, Asia, 

N.America, 

N.Africa 

-/ global 


Asia, 

N.America, 

N.Africa 

- / South 

Europe, Asia, 

S. America 


Asia, 

N.America 


Asia, 

N.America 

210 

First 

record 

from 

Europe 

1885 – 

Slovakia 

?? 


record 

in the 

CR 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Rosa rugosa -/global Braun 1987 

Padus avium - / all Europe, 

Asia, America, 

Australia, New 

Zealand 

Sinclair 1987 

Braun 1987 

Paulech 1995 

References 


et al 2007 


et al 2007 


et al 2007 


et al 2007 


et al 2007 


et al 2007

Powdery 

Mildew 

Sawadaea 

bicornis (Wallr.) 

Homma 

Sawadaea 

tulasnei (Fuckel) 

Homma 

Uncinula 

prunastri var. 

prunastri (DC.) 

Sacc. 


Hosts Origin/ 

distribution 

Acer campestre, 

A. ginnala, A. 

negundo, 

A. platanoides, 

A. 

pseudoplatanus, 

A. saccharinum 

Acer ginnala, 

A. palmatum 

'Dissectum', 

A. platanoides 


Asia, New 

Zealand 


Asia 

Prunus sp. - / Europe, 

Central Asia 

First 

record 

from 

Europe 

211 


record 

in the 

CR 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

Braun 1987 

Paulech 1995 

References 


et 

Dančáková 

2005, 


et al 2007 


et al 2007 

Oak powdery mildew Erysiphe alphitoides (Griffon & Maubl.) U. Braun & S. 

Takam. (syn. Microsphaera alphitoides Griff.) is most important species for 

forestry as a naturalized species throughout Europe now. The origin of this species 

is unclear, although this species is widespread in Europe, Asia, North and South 

America, Australia and New Zealand. The first occurrence on this species is origin 

from limited area in Portugal from 1876 – 1877, in 1906 – 1907 were reported 

spreading of this species in many countries in Europe, in 1909 is mentioned 

outbreak of this species in Western Europe. Some sources note, that this species 

were introduced from Northern America (eg. Cejp et Skalický, 1954), some other 

authors assume, that this species were introduced to Asia, however recent genetic 

studies shows affinity to other species of powdery mildews in tropical areas in 

South East Asia (Limkaisang et al., 2006). Ufnalski et Przybyl (2004) show 

genetic diversity of oak powdery mildew. 

Rhododendron powdery mildew Erysiphe azaleae (U. Braun) U. Braun & S. 

Takam. (syn. Microsphaera azaleae U. Braun), probably introduced from North 

America or Asia (Inman et al., 2000), has been from Europe recorded in England, 

Germany, Switzerland (Inman et al., 2000), and Poland (Piatek, 2003; Shin & 

Mulenko, 2004) over recent years. Rhododendron powdery mildew has been firstly 

recorded in the CR by in 2003 by Lebeda et al. (2007) and furthermore reported by 

Bacigálová and Marková (2006). Species is widespread in parks and gardens across 

CR actually. One of reasons of spreading is trade with plant material with 

combination of favorable climatic conditions within past years. 

The catalpa powdery mildew Microsphaera elevata Burrill is a native species in 

North America (Braun 1987). From Europe was recorded in Europe by Ale-Agha 

et al. (2000). Actually is reported from the Germany, Hungary, Poland, Slovakia,


Switzerland, United Kingdom, etc. (Ale-Agha et al., 2004; Vajna et al., 2004; 

Pastirčáková et al., 2006; etc.). Is it widespread in plantation in towns in the CR 

now (Ale-Agha et al., 2004; Palovčíková et al., 2007). Some latest records are 

origin from Bulgaria (Denchev et al., 2008), Romania and from Italy (own 

observations, not published). Reasons of spreading are the same – trade with plant 

material and favorable climate. Some other species on Catalpa Erysiphe catalpae 

Simonyanis was not reported from CR up to date. This species is confused with E. 

elevata in some European countries frequently (Ale-Agha et al., 2004). 

Horse chestnut mildew E. flexuosa (Peck) U. Braun & S. Takam (syn. 

Uncinuliella flexuosa (Peck) U. Braun.) on Aesculus spp., was firstly reported from 

Europe by Ale-Agha et al. (2000), Ing and Spooner (2002) and others. It is a 

common powdery mildew species infecting Aesculus trees in North America 

(Glawe and Dugan, 2007) and Europe - Croatia, France, Germany, Lithuania, 

Poland, Romania, Serbia, Slovakia, Slovenia, Switzerland, Ukraine, and United 

Kingdom (Braun, 1987; Heluta and Voytyuk, 2004; Pricop & Tănase, 2007; 

Zimmermannová-Pastirčáková et al., 2002; Kiss et al., 2004). From the Czech 

Republic is reported by Zimmermannová-Pastirčáková et al. (2002) and 

Palovčíková et al. (2007). 

Some other new species for the CR is Erysiphe arcuata U. Braun, V. P. Heluta 

and S. Takam. on hornbeams Carpinus betulus, previously (Palovčíková et al., 

2007) reported this species as Erysiphe carpinicola (Hara) U. Braun & S. Takam. 

Braun et al. (2006) re-examined European powdery mildew collections on C. 

betulus (including the anamorph Oidium carpini) from Germany, Hungary and 

Ukraine, and described them as a new species E. arcuata, contrary to previous 

records. Pastirčaková et al. (2008) reports this species from Slovakia. Previous 

records of E. carpinicola from Hungary (Vajna, 2006a) and from Poland 

(Wołczanska, 2007; Piatek, 2004) probably regarded as E. arcuata as well. 

Caragana powdery mildew Erysiphe palczewskii Braun & Takamatsu (syn. 

Microsphaera palczewskii Jacz.) is native to Asia, however it has been introduced 

into many European countries (Gelyuta and Gorlenko, 1984; Braun, 1995; Gelyuta 

and Minter, 1998; Braun et al., 2006; Vajna, 2006b). During the summer of 2006 

were severe Erysiphe palczewskii recorded in the CR into area of Central 

Moravia as well (Lebeda et al., 2008). 

Erysiphe syringae Schwein. (syn. Microsphaera syringae (Schwein) H. Magn.) 

and Erysiphe vanbruntiana var. sambuci-racemosae (U. Braun) U. Braun & S. 

Takamatsu is common species across the CR actually and it was recorded in 2005 

(Palovčíková et al., 2007). 

Erysiphe euonymi-japonici (Vienn.-Bourg.) U. Braun & S. Takamatsu is 

reported from herbarium specimen No. M-0016258, collected in 1931 at Piskoř by 

Prague and specimen is deposited in powdery mildew collection at München, 

Germany (Botanische Staatssammlung München), although recent records are 

missing. 

212



The largest number of newly discovered alien disease comes from the powdery 

mildew group Erysiphales. Newly recorded species are Erysiphe arguata, E. 

azaleae, E. elevata, E. flexuosa, Erysiphe palczewskii, Erysiphe syringae, Erysiphe 

vanbruntiana var. sambuci-racemosae. Erysiphe euonymi-japonici is reported 

from herbarium specimen in 1941 only. 

Explication of its spreading could be climatic conditions within past years and 

also by the interest about this group within past 10 years. The occurrence of 

powdery mildew has not serious impact on health on observed woody plants 

actually. Powdery mildew is problem for nurseries and trade with plant material. 

5. ACKNOWLEDGEMENT 

Paper was supported by MSM 6215648902. 

6. REFERENCES 

Ale-Agha, N., Bolay, A., Braun, U., Feige, B., Jage, H., Kummer, K., Lebeda, A., Piątek, M., Shin, 

H.D., Zimmermannová-Pastirčaková, K., 2004. Erysiphe catalpae and Erysiphe elevata 

in Europe. Mycological Progress 3(4), 291 – 296. 

Ale-Agha, N., Braun, U., Feige, B., Jage, H., 2000. A new powdery mildew disease on Aesculus spp. 

introduced in Europe. Cryptogamie Mycologie 21, 89-92. 

Bacigálová, K., Marková, J., 2006. Erysiphe azaleae (Erysiphales) – a new species of powdery 

mildew for Slovakia and further records from the Czech republic. Czech Mycology 58(3- 

4), 198-199. 

Blumer, S., 1967. Echte Mehltaupilze (Erysiphaceae) ein Bestimmungsbuch für die in Europa 

vorkommenden Arten. Gustav Fischer Verl. Jena, pp. 436. 

Braun, U., 1978. Beiträg zur Systematik und Nomenklatur der Erysiphales. Feddes Report. 88, 655- 

665. 

Braun, U., 1981. Miscellaneous notes on Erysiphaceae II. Feddes Report. 92, 499-513. 

Braun, U., 1987. A Monograph of the Erysiphales (Powdery Mildews). Beihefte zur Nova Hedwigia 

89, 700. 

Braun, U., 1995. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, pp. 

337. 

Braun, U., Heluta, V., Takamatsu, S., 2007. Validation of two species of the genus Erysiphe 

(Erysiphales). Schlechtendalia 16, 99–100. 

Braun, U., Takamatsu, S., Heluta, V., Limkaisang, S., Divirangkoon, R., Cook, R., Boyle, H., 2006. 

Phylogeny and taxonomy of powdery mildew fungi of Erysiphe sect. Uncinula on 

Carpinus species. Mycological Progress 5, 139–153. 

Cejp, K., Skalický, V., 1954. Plodná padlí na dubech v Československu, Microsphaera alphitoides 

GriffonetMaublanc a Phyllactinia roboris (Gachet) Blumer [Powdery mildews on oaks in 

213


Czechoslovakia, Microsphaera alphitoides GriffonetMaublanc a Phyllactinia roboris 

(Gachet) Blumer]. Preslia 26, 43–54. 

Denchev, M, C. et al., 2008. New records of fungi, fungus-like organisms, and slime moulds from 

Europe and Asia: 1-6. Mycologia Balcanica 5 (93), 93–96. 

Gelyuta, V. P., Minter, D.W., 1998. Microsphaera palczewskii. IMI Descriptions of Fungi and 

Bacteria N0. 1375, Surrey, UK: CABI Bioscience. 

Gelyuta, V.P., 1989. Flora gribov Ukrajiny. Mučnisto-rosjanije griby. Naukova Dumka AN USSR, 

Kijev, pp. 256. 

Gelyuta, V.P., Gorlenko, M.V., 1984. Microsphaera palczewskii Jacz. in the USSR. Mikologia i 

Fitopatologia 18, 177-182. 

Glawe, D.A., Dugan, F.M., 2006. First report of Erysiphe (Uncinuliella) flexuosa in western North 

America. – Pacific Northwest Fungi 111, 1-11. [http://www.pnwfungi.org] 

Heluta, V.P., Voytyuk, S.O., 2004. Uncinula fl exuosa Peck, a new invasive species of the powdery 

mildew fungi (Erysiphales) in Ukraine. – Ukrainskiy Botanicheskiy Zhournal 61(5), 17- 

25. (In Ukrainian) 

Ing, B., Spooner, B., 2002. The Horse Chestnut powdery mildew Uncinula flexuosa in Europe. – 

Mycologist 16, 112-113. 

Inman, A.J., Cook, R.T.A., Beales, P.A., 2000. A contribution to the identity of Rhododendron 

powdery mildew in Europe. Journal of Phytopathology 148, 17-27. 

Jaczewski, A.A., 1927. Karmannyj opredeliteľ gribov 2. Mučnisto-rosjanije griby. Leningrad, pp. 

626. 

Kiss, L., Vajna, L., Fischl, G., 2004. Occurrence of Erysiphe flexuosa (syn. Uncinula flexuosa) on 

horse chestnut (Aesculus hippocastanum) in Hungary. Plant Pathology 53: 245. [online] 

 

Lebeda, A., Mieslerova, B., Sedlářová, M., 2008. First report of Erysiphe palczewskii on Caragana 

arborescens in the Czech Republic. Plant Pathology 57(4), 779. 

Lebeda, A., Sedlarova, M., Jankovsky, L., Shin, H.D., 2007. First report of rhododendron powdery 

mildew on Rhododendron spp. in the Czech Republic. Plant Pathology 56 (2), 354-354. 

Limkaisang, S., Cunnington, J.H., Wui, L.K., Salleh, B., Sato, Y., Divarangkoon, R., Fangfuk, 

W., To-anun, Ch., Takamatsu, S., 2006. Molecular phylogenetic analyses reveal a close 

relationship between powdery mildew fungi on some tropical trees and Erysiphe 

alphitoides, an oak powdery mildew. Mycoscience, 47 (6), 327-335. 

Palovčíková, D., Dančáková, H., 2005. Bionomie a zástupci čeledi padlí v České republice. [The 

bionomy and species of powdery mildew in the Czech Republic]. Lesnická práce 11, 

600–601. 

Palovčíková, D., Dančáková, H., Junášková, J., Matoušková, H., Jankovský, L., 2007. Druhové 

spektrum padlí na dřevinách v České republice, nové druhy padlí dřevin v ČR, [The 

powdery mildews on woody plants in the CZ. Some new species of powdery mildews in 

the CR]. In Kodrík, M. - Hlaváč, P. Ochrana lesa 2007. Zvolen: Technická univerzita vo 

Zvolene, katedra ochrana lesa a polovnictva, 2007, 71-79. 

Pastirčáková, K., Pastirčák, M. & Juhásová, G., 2006. The Catalpa powdery mildew Erysiphe elevata 

in Slovakia. Cryptogamie Mycologie 27, 31-34. 

Pastirčáková, K., Takamatsu, S., Shiroya, Y. and Pastirčák, M., 2008. European Hornbeam Powdery 

Mildew Erysiphe arcuata in Slovakia. J. Phytopathology 156, 597–601. 

214


Paulech, C., 1995. Flóra Slovenska, X/1, Huby Múčnatkotvaré (Erysiphales). [Flora of Slovakia, 

Powdery mildews (Erysiphales)]. Veda, Bratislava, 291. 

Piatek, M., 2003. Erysiphe azaleae and Erysiphe syringae-japonicae introduced in Poland. 

Mycotaxon 87, 121-126. 

Piątek, M., 2004. First report of powdery mildew (Oidium carpini) on Carpinus betulus in Poland. 

Plant Pathology 53, 246. (First published online: New Disease Reports 8, 

http://www.bspp.org.uk/ndr/jan2004/2003-67.asp) 

Pricop, C., Tănase, C., 2007. Erysiphe flexuosa (Peck) U. Braun & S. Takamatsu (Fungi, 

Ascomycota) – a new species in Romania. – Analele Ştiinţifice ale Universităţii “Al. I. 

Cuza”, Iaşi, Biologie vegetală 532, 104-107. 

Příhoda, A., 1959. Lesnická fytopatologie. [Forest Pathology]. SZN Praha, 363. 

Shin, H.D., Mulenko, W., 2004. The record of Erysiphe azaleae (Erysiphales) from Poland and its 

anamorph. Mycobiology 32, 105-109. 

Sinclair, W.A., Lyon, H., 1987. Diseases of trees and shrubs. Comstock Publishing Associates, Ithaca 

and London, pp. 575. 

Takamatsu, S., Braun, U., Limkaisang, S., Kom-un, S., Sato, Y., Cunnington, J.H., 2007. Phylogeny 

and taxonomy of the oak powdery mildew Erysiphe alphitoides sensu lato. Mycological 

Research 111, 809–826. 

Ufnalski, K., Przybyl, K., 2004. Variability in morphology of Microsphaera alphitoides Griffon et 

Maubl. in Poland. Acta Soc. Bot. Pol. 73, 233–237. 

Vajna, L., 2006a. Powdery mildew caused by Erysiphe carpinicola on Carpinus betulus in Hungary: 

the first European report. Plant Pathology 55, 575. (First published online: New Disease 

Reports 12, http://www.bspp.org.uk/ndr/jan2006/2006-08.asp 

Vajna, L., 2006b. First report of powdery mildew on Caragana arborescens in Hungary caused by 

Erysiphe palczewskii. (First published online: New Disease Reports 8, 

http://www.bspp.org.uk/ndr/july2006/2006-22.asp). 

Vajna, L., Fischl, G., and Kiss, L., 2004. Erysiphe elevata (syn. Microsphaera elevata), a new North 

American powdery mildew fungus in Europe infecting Catalpa bignonioides trees. Plant 

Pathology 53, 244. 

Wołczanska, A., 2007. First report of Erysiphe carpinicola s.l. (perfect state) in Poland. Plant Pathol 

56, 354. 

Zheng, R.Y., 1985. Genera of the Erysiphaceae. Mycotaxon 22, 209-263. 

Zimmermannova-Pastircakova, K., Adamska, I., Blaszkowski, J., Bolay, A., Braun, U., 2002. 

Epidemic spread of Erysiphe flexuosa (North American powdery mildew of horsechestnut) 

in Europe. Schlechtendalia 8, 39-45. 

215

Abiotic Diseases And Other Diseases 

217


218



URBAN TREE HEALTH OF 49 GREEN SPACES IN MADRID (SPAIN) 

Eva ALFONSO CORZO 1 *, M.J. GARCIA-GARCIA 1 , J.A. SAIZ de OMEÑACA 1 

ABSTRACT 

1 Technical University of Madrid, Madrid, Spain 

* alfonso_corzo@hotmail.com 

In order to improve the management of the urban tree health in Madrid, a sample of 49 

green spaces was evaluated. Data were obtained by visual assessment in 6 different districts 

of the city, during a period of 3 or 4 years. Diseases, pests and other problems were 

identified for each species in every green area, without considering the number of trees. 

The health status of the trees declined along the period and there were few differences 

among the districts. The main problems in trees were stem injury, dead branches, epicormic 

shoots and decay, and the most damaged species were Siberian elm (Ulmus pumila), Black 

locust (Robinia pseudoacacia), Box elder (Acer negundo), and Plane tree (Platanus 

hispanica). Decay was related with stem injury. Biotic diseases were encountered less 

frequently than abiotic, and they affected a smaller rank of species. The results showed a 

positive association between naturalness of species and their health status, with a higher 

damage risk among the exotic ones. Based on their health features, a ranking of the less 

suitable species to be grown in Madrid is given. 

Keywords: urban green space, tree health, shrub, naturalness, abiotic disease 


The city constitutes a hostile environment for ornamental vegetation because 

many adverse conditions may affect the plants living in it: from environmental 

factors such as urban heat island, air pollution or mechanical stem injury to biotic 

stresses such as pests and diseases. Several authors have reported different 

difficulties which are related with the urban environment (Impens and Delcarte, 

1979; Rocray, 1983; Berrang et al., 1985). These factors not only injure the plants, 

but, some of them also predispose plants to suffer from another diseases 

(Kozlowski, 1985), interacting synergistically. 

In order to improve vegetation management of the green spaces in Madrid, the 

city council commissioned a survey to the Forestry Pathology Department of the 

Technical University of Madrid, which was carried out from 2005 to 2008. 

The study has four principal objectives in trees, shrubs, vines and seasonal 

flowers populations: 

219


Following up their health status. 

Identifying main problems and the most affected species. 

Evaluating if there would be an association between naturalness of trees 

species and their health condition. 

Proposing a ranking of the less suitable species, taking into consideration 

their health features. 

2. THE STUDY SITE 

The study was undertaken in six districts of Madrid. This city is the capital and the 

most populated city of Spain (about 3.2 million inhabitants). It is located at a latitude of 

40°26′ N and a longitude of 3°41′ W with an altitude of 667m.a.s.l. The climate is 

temperate Mediterranean with a marked continentality. The monthly mean minimum 

temperature is 2.6º C in January and maximum, 31.2º C in July. August is the driest 

month with only 10mm of precipitation, being 436mm the annual value. 

Madrid has more than 1,500 public green spaces which occupy more than 9% of 

its area. Besides, there are more than 300,000 street trees, without taking into 

account those of green spaces. 

3. METHODOLOGY 

The city is administratively divided into 21 districts, and the studied green 

spaces are distributed throughout six of them: Arganzuela, Barajas, Hortaleza, 

Retiro, Salamanca and Villa de Vallecas. 

A randomized representative sample of 25% of the green spaces in each district 

was taken. Samples were collected for each year along the period 2005-2008, 

although in 2007 only the green spaces of Arganzuela were examined. 

Consequently, as a result of the random process, only a few green spaces were 

evaluated all the years. An interesting temporary evolution was expected, so, only 

the green spaces which were common to all the years in the period were analyzed 

in this survey. 

Sampling is a more and more used technique because of the expensiveness of 

complete inventories, and it may be an accurate method for revealing the general 

patterns and trends in street tree populations (Jaenson et al., 1992). Complete 

inventories, such as the one which was carried out with 81,000 trees in Brussels 

(Impens and Delcarte, 1979), are much more precise, but, they would not be 

necessary if the management and conservation of green spaces was the target, since 

“all data collected must be related to the goals of the inventory” (Smiley and 

Baker, 1988). 

To sum up, 49 green spaces were examined in the whole of the six districts and 

they represented about 10% of the total green spaces (Figure 1). 

220


A periodicity of one or two years was thought as adequate (Harris et al., 2004). 

The seasons during which the inventories were compiled depended on the district, 

but in all cases, an inspection was conducted in autumn and, another one, in spring, 

so as to find out the different features than could be observed whether plants keep 

their foliage or not. 

4470000 4480000 4490000 

¨ 

Scale 1: 400.000 

0 2.500 5.000 10.000 15.000 

Legend 

Number of examined 

green spaces 

Arganzuela: 11 

Barajas: 9 

Hortaleza: 13 

Retiro: 5 

Salamanca: 4 

Villa de Vallecas: 7 

m 

221 

4 

5 

11 

410000 420000 430000 440000 450000 

Figure 1. Number of examined green spaces in the inventoried districts. 

Data were collected by professors and collaborators of the Forestry Pathology 

Department. They were trained so that they could recognize the major health 

problems of the ornamental species, before conducting the visual inspection in each 

area. Just in case they were not able to recognize something, both a photograph and 

a vegetal sample were taken, in order to identify them in lab, with the aid of 

bibliography. The information recorded in each green space and in each year 

consisted of: date; name of the green space; district and ward where it was located; 

problems affecting the soil; problems which were related with watering; all tree, 

shrub, vine or seasonal flowers species which were found in the green space; and 

all the diseases, pest and other problems or disturbances which were observed for 

each species. 

Visual assessment was chosen as a tool for predicting the health status of the 

plants. Visual evaluation is frequently a controversial issue since some authors 

defend the idea that it can be a reliable means to predict internal decay (Kennard et 

al., 1996), whereas others think that this procedure is insufficient (Dunster, 1996). 

Therefore, the present study intended only to be a first approximation of the plant 

health condition, trying to predict failure situations, so that a possible further 

13 

7 

9


survey could be focused on those riskiest cases. Nevertheless, predicting failure 

situations is a difficult task, as most guidelines have been developed after the 

failure has already occurred, and few analyses of the ability to predict have been 

performed (Harris et al., 2004). 

All the green spaces were thoroughly inspected and the collected data were 

computerized in spreadsheets in order to facilitate their analysis. The unit for this 

analysis was defined as SYG, which stands Species-Year-Green space. It referred to 

one species which was observed in a certain year (2005, 2006, 2007 or 2008) and in a 

specific green space. From now on, it will be mentioned by simply using SYG. 


4.1 Tree and shrub condition declines. 

The health condition of trees and shrubs declines. In 2005, 52.5% of SYGs were 

damaged, while in 2008 it accounted for 82.6% (Table 1). The figures for shrubs 

were smaller than those for trees, but they also increased, from 25.1% in 2005 to 

58.1% in 2008 (Table 2). A rise in the number of the disturbances in vegetation is 

seen as the most likely cause in both cases. In fact, the number of these 

disturbances increased by four times in trees and three times in shrubs during the 

period. However, this higher level of disturbances is not attributed to more types of 

disturbances, since these did not increase in tune with the others. Therefore, some 

disturbances have become more frequent in the last years. 

Regarding data collected in each district, there was a general decreasing 

tendency similar in the percentage of undamaged SYGs. 

Table 1. Temporary evolution of damaged tree SYGs. Undamaged, damaged and 

percentage of damaged tree SYGs, in each district, for each year, and in all the inventoried 

green spaces. 

Tree SYGs 

Undamaged 

2005 2006 2007 2008 

Damaged 

% of damaged 

Undamaged 

Damaged 

Arganzuela 33 33 50.0 29 39 57.4 23 47 67.1 10 56 84.8 

Barajas 25 24 49.0 20 46 69.7 13 56 81.2 

Hortaleza 45 51 53.1 47 50 51.5 16 96 85.7 

Retiro 19 11 36.7 14 12 46.2 7 21 75.0 

Salamanca 4 9 69.2 5 9 64.3 2 13 86.7 

Villa de 

Vallecas 

222 


18 31 63.3 14 44 75.9 14 53 79.1 

TOTAL 144 159 52.5 129 200 60.8 23 47 67.1 62 295 82.6 

Undamaged 

Damaged 


Undamaged 

Damaged 

% of damaged


Table 2. Temporary evolution of damaged shrub SYGs. Undamaged, damaged and 

percentage of damaged shrub SYGs, in each district, in each year, and in all the inventoried 

green spaces. 

Shrub 

SYGs 

Undamaged 

2005 2006 2007 2008 

Damaged 


Undamaged 

Damaged 

Arganzuela 53 10 15.9 49 30 38.0 55 30 35.3 29 60 67.4 

Barajas 38 13 25.5 21 42 66.7 33 34 50.7 

Hortaleza 79 52 39.7 68 56 45.2 62 92 59.7 

Retiro 17 3 15.0 17 14 45.2 18 10 35.7 

Salamanca 24 2 7.7 16 10 38.5 9 20 69.0 

Villa de 

Vallecas 

223 


51 8 13.6 23 45 66.2 31 36 53.7 

TOTAL 262 88 25.1 194 197 50.4 55 30 35.3 182 252 58.1 

4.2 Few differences are encountered among the districts. 

There are few differences in the average percentage of damaged tree or shrub 

SYGs among the districts (Table 3). A ji-squared test shows that these figures are 

not significantly different at greater than the 90% level. This result was expected 

since there are not big differences in climate or in soil composition among the 

districts. 

Table 3. Mean percentage of damaged SYGs. Mean figures of undamaged, damaged 

and percentage of damaged tree SYGs, in each district, and in all the green spaces. 

SYGs 

Undamaged 

Tree mean 

2005-2008 

Damaged 

Undamaged 

Damaged 


Undamaged 

Shrub mean 

2005-2008 

Arganzuela 24 44 64.8 47 33 41.1 

Barajas 19 42 68.5 31 30 49.2 

Hortaleza 36 66 64.6 70 67 48.9 

Retiro 13 15 52.4 17 9 34.2 

Salamanca 4 10 73.8 16 11 39.5 

Villa de Vallecas 15 43 73.7 35 30 45.9 

All green spaces 111 219 66.3 216 178 45.3 


Undamaged 

Damaged 

Damaged 


% of damaged


Analysis of means shows that the districts which differ the most of the global 

mean are Retiro and Salamanca. In both of them, the areas of the studied green 

spaces reached lower figures than the rest of the districts. A possible explanation is 

that the bigger the area of green spaces observed is, the more representative of the 

district it becomes; however it is likely that an area threshold exists, so from this 

point the results will be stable. 

4.3 Main problem in trees is stem wounds. 

The major problem in trees is stem wounds, followed by dead branches, 

epicormic shoots and decay (Table 4). 

Table 4. Percentage of affected SYGs by 4 main disturbances. In each year, during the 

whole period and in all the inventoried green spaces. 

224 

% of SYGs 

Disturbances 2005 2006 2007 2008 All years 

Stem wounds 13.2 22.8 31.4 36.4 25.2 

Dead branches 10.2 8.2 18.6 33.6 18.0 

Epicormic shoots 4.3 12.2 1.4 31.9 15.9 

Decay 13.5 17.9 17.1 12.6 14.8 

Stem wounds is also the most important problem identified in some districts, 

such as Arganzuela, Barajas, Hortaleza and Villa de Vallecas. The cause of this 

high frequency was mostly unknown, but some SYGs with stem wounds had, at the 

same time, sunburns lesions (11.2%) or human damages (9.0%) like those which 

were caused by lawn mowers, vehicles, tree shelters, stakes, and so forth. 

Therefore, these disturbances may have caused some of the stem wounds. 

Stem wounds were also very common in several urban tree surveys (Rocray, 

1983; Jaenson et al., 1992; Chacalo et al., 1994, Fostad and Pedersen, 1994; 

Cumming et al., 2001; Ayuntamiento de Madrid, 2009), besides, in the last three 

ones, the injuries were mainly caused by mechanized machinery and automobiles. 

Neither of them mentions any kind of sunburn lesion on the bark, nor the one 

conducted in street trees of Madrid. 

Another consideration is the importance of SYGs which were damaged by 

decay. More than 60% of the SYGs with decay had, at the same time, stem 

wounds, which showed a possible relationship between these two variables. The 

explanation is that wounds can be penetrated by organisms which produce decay, 

such us fungi (Agrios, 2005). Therefore, the abundance of these two factors could 

indicate bigger internal defects of the trees and, trees could turn into hazardous 

because some decays might end up in failure. Besides, the strength loss due to 

decay is greater when it is produced by peripheral wounds, as in this survey (Kane 

et al., 2001). Any conifer SYG was affected by decay, maybe because of the 

existence of resin, as it was explained by Rodríguez Barreal et al referring to 

cypress (Rodríguez Barreal et al., 2000).


4.4 Main problem in shrubs, vines and seasonal flowers is dead plants. 

The mayor problem is the high death rate. In shrubs, it is followed by aphids, 

powdery mildew and decaying plants. 

4.5 The most damaged tree species are Siberian elm, black locust, box elder 

and plane tree. 

Siberian elm (Ulmus pumila), black locust (Robinia pseudoacacia), box elder 

(Acer negundo) and plane tree (Platanus x hispanica) are the species which reach 

the greatest proportions of observed disturbances (Table 5). In fact, only the 

problems of 16 species accounted for 70% of the total. That would imply that some 

species are far more prone to problems; they would be the “key plants” (Raupp et 

al, 1985). Hence, these species require the biggest efforts in maintenance and 

conservation. 

Table 5. Disturbances for the 20 most affected tree and shrub species. Relative abundance, 

percentage of total disturbances and frequency of SYGs with disturbances in each species, for all the 

years and for all the inventoried green spaces. (*) accumulated percentage until that species. 

Tree species 

% of 

total 

SYGs 

% of total 

disturbances 


with 

disturbances 

Ulmus pumila 6.3 11.0 83.6 

Robinia 

pseudoacacia 

6 8.9 85.9 

Acer negundo 4.7 8.2 88.0 

Platanus x 

hispanica 

Prunus 

cerasifera var. 

atropurpurea 

Populus alba 

var. fastigiata 

Tilia 

platyphillos 

4.5 6.8 85.4 

225 

Shrub species 

Nerium 

oleander 

Cotoneaster 

sp. 

Pittosporum 

tobira 

Eonymus 

europaeus 


total 

SYGs 

% of total 

disturbances 


with 

disturbances 

5.3 10.5 73.1 

6 7.5 60.0 

4.8 6.6 55.0 

3 6.2 84.2 

6.5 5.3 71.0 Rosa sp. 4.8 5.7 60.7 

2.2 4.8 95.7 

Viburnum 

tinus 

5.5 5.2 42.0 

2.1 3.8 81.8 Pyracantha sp. 3.8 4.8 58.3 

Cedrus sp. 4.7 3.6 66.0 Berberis sp. 2.1 4.1 70.4 

Populus nigra 2.1 3.6 100.0 

Morus alba 2.8 3.4 73.3 

Sophora 

japonica 

Rosmarinus 

officinalis 

Mahonia 

aquifolia 

4.4 3.7 49.1 

2.2 3.0 50.0 

2.5 3.1 77.8 Laurus nobilis 1.3 2.9 70.6 

Acer sp. 2 3.0 85.7 Juniperus sp. 4.5 2.7 36.8 

Cupressus sp. 6.4 2.7 38.2 

Olea europaea 1.9 2.6 70.0 

Gleditsia 

triacanthos 

1.8 2.4 84.2 

Photinia 

serrulata 

Lavandula 

latifolia 

Cotoneaster 

horizontalis 

2.3 2.4 44.8 

3.3 2.3 41.5 

2.5 2.0 35.5 

Pinus pinea 4.7 2.2 (75.5% * ) 46.0 Arbutus unedo 1.6 1.9 (71.7% * ) 35.0 

Eleagnus 

angustifolia 

0.9 2.2 100.0 

Populus alba 1.5 2.0 75.0 

Cercis 

siliquastrum 

1.2 1.9 92.3 

Salix sp. 1.4 1.7 93.3 

Spirea 

hypericifolia 

Hibiscus 

syriacus 

Prunus 

laurocerasus 

Escallonia 

rubra 

1.3 1.8 52.9 

1.5 1.8 52.6 

2.5 1.8 34.4 

2.3 1.7 41.4


There are some differences in health condition among tree species. For 

example, Siberian elm and black locust are very damaged as well as very abundant, 

whereas cypress (Cupressus sp.), umbrella pine (Pinus pinea) and cedar (Cedrus 

sp.) are very frequent but not so damaged. 

The most important problem for Siberian elm is bad shaped trees. This term is 

used to describe the plants with bad structured crowns or trunks, for example, those 

trees with hanging small branches or leaning stems. Hanging branches seem to be 

very common in this species (Saiz de Omeñaca and Prieto Rodríguez, 2004). 

Dead branches are frequent for black locust, and this was also showed in 

another survey (Rodríguez Barreal et al., 2000). 

Box elder has stem wounds as its main problem. If this problem was associated 

with decay it could make trees fail, since the wood of box elder is very susceptible 

to decay and has a practical inability to close its wounds (Saiz de Omeñaca and 

Prieto Rodríguez, 2004). Powdery mildew is found as well in some green spaces, 

which is ordinary in this species (Saiz de Omeñaca and Prieto Rodríguez, 2004). 

Anthracnose is observed in most of the green spaces where plane trees are 

grown. This fungal disease is produced by Apiognomonia veneta (Sporonema 

platani) and their first symptoms are not identified until the beginning of the 1970s 

in central Spain (Tello et al., 2000). Since that moment, the presence of the fungi 

has been known about in street trees in Madrid (Rodríguez Barreal, 1986). It 

remains unclear whether it affects less its precursor Plantanus orientalis (Villalva 

Quintana, 2005) than to the own hybrid (Rodríguez Barreal, 1986), although it 

seems that “the different genotypes of the hybrids allow differences in disease 

severity among trees growing under the same environmental conditions, though 

eventually all trees are affected to some degree or another” (Tello et al., 2000). 

The abundance of epicormic shoots and adventitious branches (3 rd and 4 th problem) 

could be related to this disease, since the infestation of the fungi in adventitious 

buds produces a much greater number of them (Tello et al.2000), however, it could 

be also associated with the tendency to create them when the planting conditions of 

plane trees are not appropriate (Saiz de Omeñaca and Prieto Rodríguez, 2004). 

4.6 The most damaged shrub species are oleander, cotoneaster, Japanese 

cheesewood and European spindle. 

Oleander (Nerium oleander), cotoneaster (Cotoneaster sp.), Japanese 

cheesewood (Pittosporum tobira) and European spindle (Euonymus europaeus) are 

the most damaged species (Table 5). 

Main problem of oleander is the bacteria Pseudomonas syringae subsp. 

savastanoi, which affected about half of green spaces every year. The former 

produces galls in flower buds, so those plants become weaker and with aesthetic 

harms (Villalva Quintana, 2005). Dead plants are the principal problem affecting 

cotoneaster and Japanese cheesewood, the second regarding European spindle, and 

the third concerning oleander. Aphids were in more than 24% of SYGs of oleander, 

226


cotoneaster and Japanese cheesewood, and their importance was lower in European 

spindle, with an affected 10.5%. The latter species was affected by powdery 

mildew in more than 70% of the SYGs where European spindle was found. This 

disease is induced by the fungi Microsphaera euonymi-japonici and it has a high 

incidence among this species in cold areas of the Iberian Peninsula (Villalva 

Quintana, 2005). 

4.7 The most damaged vine species is ivy. 

Ivy (Hedera helix) is the most affected vine species as well as the most 

abundant vine. Its most frequent problems are dead plants and sunburn lesions on 

its leaves. Sunburn lesions appeared because, even though it is a shade tolerant 

species which grows in the understorey layer in nature, in many of the cases it grew 

in green spaces under full sun situations. 

4.8 Biotic diseases are encountered less frequently than abiotic in trees, 

although the result was the opposite in shrubs. 

In this survey, biotic diseases were due to organisms such as viruses, bacteria, 

pests and fungi. On the contrary, abiotic diseases consisted of problems caused by 

meteorological and physical agents, by human activities and, by other factors 

whose origin is a priori unknown, such as cracks, stem wounds, tumours, etc. Dead 

plants were not included in any of the former types. 

In trees, abiotic diseases comprised about 60% of total disturbances in each year 

(Table 6). The mayor contributions to the high incidence of abiotic diseases are due 

to stem wounds, dead branches and epicormic shoots, since they are the most 

frequent problems for trees. Similar results were also obtained in a survey in 

Quebec (Rocray, 1983). 

Table 6. Percentage of abiotic diseases of the total of disturbances. In each year in trees 

and shrubs of all the inventoried green spaces. 

% of abiotic diseases 2005 2006 2007 2008 

Trees 58.8 69.1 56.6 79.7 

Shrubs 19.7 47.9 27.6 23.7 

The principal problem in green spaces is the abiotic stresses when they are 

compared with biotic diseases. This fact should lead to the consideration of the 

maintenance and conservation practise which is being applied mainly to the 

vegetation of green spaces, because most damages could be avoided if some 

recommendations were followed. Various efforts were observed about this issue in 

this survey, for instance, the use of stakes and tree shelters in new plantations, 

however, in many cases, the achieved effect was just the opposite of the expected 

one, since stems were leaned and the friction between the trunk and the object 

caused the wounds which were intended to be avoided. Not only the staff in charge 

of the conservation of green spaces are responsible for these problems, but also the 

227


designers or planners of the green spaces, since some disturbances such as sunburn 

lesions or leaning stems by light deficit are generally due to inadequate designs. In 

fact, in natural environment most of these problems are very unusual. For all these 

reasons, the municipal green spaces management programmes should be look 

through in order to adapt conservation strategies to deal better with abiotic 

problems. 

Besides, abiotic diseases were much less frequent in shrubs, with 20-48% of 

total disturbances depending on the considered year. Aphids were responsible of a 

great number of the biotic diseases, since it was the second problem, after dead 

plants. However, this result would have been pretty different if dead plants had 

been considered as an abiotic or biotic agent. 

4.9 Abiotic diseases affect a greater rank of tree and shrubs species. 

Abiotic diseases affect a greater variety of species (Table 7), which is 

reasonable if it is taken into account the fact that they are prompted by human 

activities or physical agents. However, biotic diseases seemed to be more specific 

in some plant species; for example, lace bugs (Corythuca ciliata), leaf beetle 

Galerucella luteola and Pseudomonas syringae subsp. savastanoi affected only one 

species (plane tree, Siberian elm and oleander, respectively). Concerning pests, this 

result would confirm the idea held by some authors who maintain that most 

herbivorous pests are specialized and only eat few taxa of plants (Rocray, 1983; 

Galvin, 1999; Raupp et al., 2001). 

Table 7. Affected species by biotic and abiotic diseases. Tree and shrub species affected 

by biotic and abiotic diseases and the percentage of the total species, in all the years and in 

all the inventoried green spaces. 

Trees Total 

Affected by 

biotic 

diseases 

Affected by 

abiotic 

diseases 

228 

Shrubs Total 

Affected by 

biotic 

diseases 

Affected by 

abiotic 

diseases 

Species 73 38 57 Species 77 32 40 


species 

100 52.1 78.1 


species 

100 41,6 51,9 

4.10 Positive association between naturalness of tree species and their 

health status. 

Pyšek’s criteria are used to define the naturalness of the tree (Pyšek , 1995). It is 

considered the national scale, therefore, all those species defined as natural of 

Spain according to those criteria, are classified as native in this survey. 

Bibliography is used to make easier this controversial task (López González, 2002; 

Real Jardín Botánico, 2009). 

A ji-squared test on the data shows that the relationship between health status 

(damaged or undamaged SYG) and naturalness (native or exotic SYG) is 

significant at 95% level (Table 8). The probability for an exotic SYG to be 

damaged is greater (0.68) than the probability for a native SYG (0.59). However,


although these proportions were significantly different for a hypothesis test at 95% 

level, with a greater level, they were not different. Thus, the risk of being damaged 

is only slightly higher for exotic SYGs than for native SYGs. 

Table 8. 2x2 contingency table of tree SYGs. 

SYGs 

Naturalness 

229 

Health status 

Undamaged Damaged 

Native 92 134 

Exotic 266 567 

This seems to be a coherent result since native species are expected to be better 

adapted, although there are authors who maintain that exotic species do better than 

native ones because their pests and diseases have not yet arrived from their home 

country (Schimdt and Kerenyine-Nemstothy, 1999). Similarly, Harris explains that 

native species sometimes do not perform as well as exotic ones (Harris et al., 

2004). Therefore, as it remains unclear what kind of species should be planted 

more frequently, it should be consider that exotic flora affects native and overall 

species richness throughout the globe (Alvey, 2006) while native species improve 

the sustainability of urban forests (Clark et al., 1997). In any case, the 

recommendation of not planting invasive exotic species should be followed (Alvey, 

2006). 

4.11 Ranking of less suitable species to be grown in Madrid. 

An algorithm to establish which tree and shrub species are less adapted to the 

urban environment of Madrid is created. On one hand, a quantitative scale is 

established to asses the severity of the observed disturbances, assigning greater 

coefficients to the most serious disturbances (Table 9). On the other, a qualitative 

scale takes into consideration: a) the number of disturbances which appeared 

within each species, and b) the proportion of damaged SYGs. The result of 

multiplying each severity coefficient by the number of disturbances (a) is weighted 

with the proportion of damaged SYGs (b) within each species. The outcome is a 

ranking with the least suitable species, where the species with the highest grade 

appear on top (Table 10 and Table 11). 

Table 9. Severity classes of disturbances with coefficients. 

Severity classes of disturbances Coefficients 

Hazardous 0.5 

Pretty serious 0.3 

Less serious 0.2 

Acceptable 0.1 

This kind of species suitability ranking has been observed in other surveys 

(Impens and Delcarte, 1979; Raupp and Noland, 1984; Nielsen et al., 1985; Ball,


1987; Rodríguez Barreal et al., 2000), although in some of them the way in which 

the results are obtained is not specified, so comparison is difficult. In spite of this, 

in the research carried out in the street trees of Madrid (Rodríguez Barreal et al., 

2000), black locust appears as not very desirable species. Otherwise, this was 

considered very advisable species in another survey (Raupp and Noland, 1984) 

since it did not suffer from pest problems unlike the present survey, where many 

black locust SYGs were affected by aphids and wood borer insects. 

Table 10. Ranking of ten least suitable tree and shrub species. Percentage of damaged 

SYGs, severity of disturbances (coefficient*number of disturbances) and final value, in all 

the years and in all the inventoried green spaces. 

Order 

1 

Tree species 

Robinia 

pseudoacacia 


damaged 

SYGs 

Severity of 

disturbances 

valuation 

Final 

value 

230 

Tree species 


damaged 

SYGs 

Severity of 

disturbances 

valuation 

Final 

value 

85,9 64,3 55,3 Nerium oleander 73,1 20,6 15,1 

2 Ulmus pumila 83,6 64,0 53,5 Cotoneaster sp. 60,0 20,9 12,5 

3 Acer negundo 88,0 47,0 41,4 

4 

5 

Platanus x 

hispanica 

Populus alba var. 

fastigiata 

Eonymus 

europaeus 

84,2 12,2 10,3 

85,4 37,6 32,1 Pyracantha sp. 58,3 16,4 9,6 

95,7 32,0 30,6 

Pittosporum 

tobira 

55,0 16,7 9,2 

6 Populus nigra 100,0 24,2 24,2 Rosa sp. 60,7 14,6 8,9 

7 

Prunus cerasifera 

var. atropurpurea 

71,0 27,3 19,4 

8 Tilia platiphyllos 81,8 23,2 18,0 

Berberis 

thunbergii 

‘Atropurpurea’ 

Rosmarinus 

officinalis 

70,4 11,8 8,3 

49,1 14,5 7,1 

9 Sophora japonica 77,8 22,0 18,0 Viburnum tinus 42,0 16,6 7,0 

10 Acer sp. 85,7 19,8 17,0 Mahonia aquifolia 50,0 7,9 4,0 

5. REFERENCES 

Agrios, G.N., 2005. Plant Pathology. 5 th Ed. San Diego, Ca: Elsevier Academic Press Publications, 

922 pp. ISBN 0-12-044565-4, p. 88 

Alvey, A.A., 2006. Promoting and preserving biodiversity in the urban forest. Urban Forestry & 

Urban Greening, 5, 195-201 

Ball, J., 1987. Efficient monitoring for an urban IPM program. Journal of Arboriculture, 13:7, 174- 

177 

Berrang, P., Karnosky, D.F. and Stanton, B.J., 1985. Environmental factors affecting tree health in 

New York City. Journal of Arboriculture, 11:6, 185-189 

Chacalo, A., Aldama A., Grabinsky, J., 1994. Street tree inventory in Mexico City. Journal of 

Arboriculture, 20:6, 222-226 

Clark, J.R. et al., 1997. A model of urban forest sustainability. Journal of Arboriculture, 23:1, 17-30 

Cumming, A.B. et al., 2001. Forest Health Monitoring Protocol applied to roadside trees in Maryland. 

Journal of Arboriculture, 27:3, 126-138


Dunster, A.J., 1996. Hazard tree assessments: developing a species profile for western hemlock. 

Journal of Arboriculture, 22:1, 51-57 

Fostad, O. and Pedersen, P.A., 1997. Vitality, variation, and causes of decline of trees in Oslo Center 

(Norway). Journal of Arboriculture, 23:4, 155-165 

Galvin, M.F., 1999. A methodology for assessing and managing biodiversity in street tree 

populations: a case of study. Journal of Arboriculture, 25:3, 124-128 

Harris, R.W., Clark, J.R., Matheny, N.P., 2004. Arboriculture: Integrated management of landscape 

trees, shrubs and vines. Fourth edition. Prentice Hall, pp. 123, 406, 408 

Impens, R.A., Delcarte, E., 1979. Survey of urban trees in Brussels, Belgium. Journal of 

Arboriculture, 5:8, 169-176 

Jaenson, R. et al., 1992. A statistical method for the accurate and rapid sampling of urban street tree 

populations. Journal of Arboriculture, 18:4, 171-183 

Kane, B., Ryan D., Bloniarz, D.V., 2001. Comparing formulae that assess strength loss due to decay 

in trees. Journal of Arboriculture, 2001, 27:2, 78-87 

Kennard, D.K.; Putz, F.E.; Niederhofer, M., 1996. The predictability of tree decay based on visual 

assessment. Journal of Arboriculture, 22:5, 249-254 

Kozlowski, T.T., 1985. Tree growth in response to environmental stresses. Journal of Arboriculture, 

11:4, 97-111 

López González, G., 2002. Guía de los árboles y arbustos de la Península Ibérica y Baleares. Madrid: 

Ediciones Mundiprensa, 894 pp. ISBN: 84-8476-050-2 

Nielsen, D.G. et al., 1985. Common street trees and their pests problems in the North Central United 

States. Journal of Arboriculture, 11:8, 225-232 

Proyecto Madrid: un alcorque, un árbol, 2009 [on line]. Ayuntamiento de Madrid. Área Temática de 

Medio Ambiente. Madrid. [19 th of February, 2009]. 

 

Pyšek, P., 1995. Alien and native species in Central European floras: a quantitative comparison. 

Journal of Biogeography, 25, 155-163 

Raupp, M.J. and Noland, R.M., 1984. Implementing landscape plant management programs in 

institutional and residential settings. Journal of Arboriculture, 10:6, 161-169 

Raupp, M.J. et al., 1985. The concept of Key plants in Integrated Pest Management for landscapes. 

Journal of Arboriculture, 11:11, 317-322 

Raupp, M.J. et al., 2001. Plant species diversity and abundance affects the number of arthropod pests 

in residential landscape. Journal of Arboriculture, 27:4, 222-229 

Real Jardín Botánico. Flora Ibérica [on line]. Centro Superior de Investigaciones Científicas. 4th of 

February, 2009, [8th of March, 2009]. 

Rocray, D., 1983. Problems affecting urban trees in Quebec City. Journal of Arboriculture, 9:6, 167- 

169 

Rodríguez Barreal, J.A. et al., 2000. Estudio fitopatológico del arbolado de alineación urbana de 

varios distritos de Madrid. In: Comunicaciones XXVII Congreso nacional de parques y 

jardines públicos, 22-24 November 2000, Sevile, Spain, pp. 213-223 

231


Rodríguez Barreal, J.A., 1986. Principales enfermedades sobre el Platanus hybrida Brot. en las 

grandes ciudades. Montes. Revista de Ámbito Forestal, 12, 43-50 

Saiz de Omeñaca, J. A. y Prieto Rodríguez, A., 2004. Arboricultura Urbana. Centro de Estudios De 

Técnicas Aplicadas del CEDEX, pp. 53-57 

Schimdt, G. and Kerenyine-Nemstothy, K., 1999. Urban Tree Health in Budapest. In: Lemattre, M., 

Lemattre, P., Lemaire, F. (Eds.), Proceedings of the International Symposium on Urban 

Tree Health, 1 September 1999, Paris, France, pp. 183-188 

Smiley, E.T., and Baker, F.A., 1988. Options in street tree inventories. Journal of Arboriculture, 14:2, 

36-42 

Tello, M.L., Redondo, C. and Mateo-Sagasta E., 2000. Health status of plane trees (Platanus ssp.) in 

Spain. Journal of Arboriculture, 26:5, 246-254 

Villalva Quintana, S., 2005. Plagas y enfermedades de jardines. Editorial Mundi-Prensa, pp. 110, 132 

232



CHARACTERISATION OF CZECH Ophiostoma novo-ulmi ISOLATES 

Milon DVOŘÁK 1* , Libor JANKOVSKÝ 1 , J . KRAJŇÁKOVÁ 2 

1 Department of Forest Protection and Wildlife Management, Faculty of Forestry and Wood 

Technology, Mendel University of Agriculture and Forestry, Brno, Zemedelska 3, 613 00 Brno, 

Czech Republic 

2 Department of Biology and Plant Protection, Unit of Plant Biology, University of Udine, Via 

Cotonificio 108, 33100 Udine, Italy 

ABSTRACT 

* klobrc@centrum.cz 

Ophiostoma novo-ulmi was recorded for the first time in the area of the Czech Republic 

in 2006, although it was suspected since early 1960´s. During the years 2006 and 2007, 58 

isolates were collected. Isolated strains of the DED causal agent were determined by PCR 

and RFLP molecular methods. DNA of each sample was isolated from cultured mycelium, 

amplified at cu, and col1 gene regions and restricted by Hph I and Bfa I endonucleases. 

Strains were determined according to both of these two gene regions. An old species 

Ophiostoma ulmi (Buism.) Nannf. was not noticed in any case. Every sample belongs to the 

species Ophiostoma novo-ulmi Bras., and both known subspecies americana (5 isolates) 

and novo-ulmi (29 isolates) were present. Additionally, 13 strains of Ophiostoma novo-ulmi 

were more particularly tested for vegetative compatibility type, mating type, fertility with 

both subspecies and cerato-ulmin production. Among these 13 strains only 3 seemed to be 

non-hybridized ssp. novo-ulmi and only one non-hybridized ssp. americana, the remainder 

(9 strains) was intraspecific hybrids. 5 of the tested strains were of mating type A and 

mating type B occurred 8-times. None of these strains was compatible with any other. High 

frequency of intraspecific hybrids (24 isolates) is remarkable and shows on a frequent 

occurrence of sexual hybridization. Cerato-ulmin production did not show any significant 

differences according to strain subspecies. Virulence of one O. novo-ulmi strain (M3) was 

tested on two Dutch resistant cultivars, 13-year-old elms ´Groeneveld´ and ´Dodoens´. Only 

5 weeks after inoculation were sufficient period for 30 – 90% defoliation of cultivar 

´Groeneveld´, ´Dodoens´ with only 0 – 5% seemed to be much more resistant. 

Keywords: Dutch Elm Disease, PCR-RFLP, elm, infection tests 


Ophiostoma ulmi and O. novo-ulmi – causal agents of Dutch elm disease (DED) 

has been threatening elms in the Czech Republic since 1930's, as well as in the 

entire Northern Hemisphere. The first occurrence of Dutch elm disease in the 

Czech Republic caused by Ophiostoma ulmi (Buism.) Nannf. was noted by prof. 

Peklo (Polák, 1932) who found infected trees in elm alleys in Prague and 

Poděbrady in 1932. 

233


A newer and more aggressive form was since 1970´s distinguished into two 

races - an Eurasian (EAN), probably originated in Moldavia and the Ukraine, and a 

North American race isolate (NAN). In 1991, the more aggressive form was 

described by Brasier as a new species O. novo-ulmi Bras (Brasier 1991). Ten years 

later, Brasier et al. (2001) designated races EAN and NAN as subspecies of O. 

novo-ulmi ssp. novo-ulmi and O. novo-ulmi ssp. americana. Specific group of DED 

pathogens are hybrids of O. novo-ulmi subspecies. 

O. novo-ulmi, its subspecies and their hybrids were for the first time recorded 

in the Czech Republic by Dvořák et al. (2006, 2007) . The aim of present study is 

a complex characterisation of strains, which are actually spreading in the area of 

the Czech Republic. 


2.1. Isolation of the pathogen: Coordinates of position and altitude of every 

infected elm with inner DED symptoms was achieved by GPS. Samples of twigs 

were cut from different parts of drying crowns and cultivated on cycloheximide 3% 

MEA medium. Each strain was deposited into the culture collection of MUAF 

Brno. 

2.2. Molecular-biological characterisation: DNA was obtained from pure 

MEA cultures by PowerSoil DNA Kit (Mo Bio). Identification of species and 

subspecies was performed by the mean of Polymerase Chain Reaction (PCR) and 

Restriction Fragment Length Polymorphism (RFLP) using two gene regions. The 

former is a cerato-ulmin (cu) gene region, described in more detail in Pipe et al. 

(1997) and the latter gene region is called col1 and encodes colony type (Konrad et 

al., 2002). Amplified fragments of these two gene regions were restricted by 

endonucleases, Hph I used for cu gene region and Bfa I for col1 region (Konrad et 

al., 2002). RFLP fragments were visualized on 3% agarose gel and evaluated. 

Sequencing was provided in a few cases and submitted to Gen Bank. 

2.3. Production of cerato-ulmin: Amount of cerato-ulmin produced by liquid 

cultures of 15 isolates was determined by chromatography (Scala et al., 1994). 

The tested group of isolates was composed from 4 cultures of ssp. novo-ulmi, 2 

cultures of ssp. americana and 9 strains of genetic hybrids of precedent strains. In 

this tested group, well known isolates H328 ssp. novo-ulmi and 182E ssp. 

americana were used as reference strains. Liquid cultures of dilutions 1:1, 1:2, 1:4 

and 1:8 were stirred to obtain turbid milky solutions. The turbidity of the samples 

at the various dilutions was immediately assayed for optical density at 400 nm. 

Results of the dilution with the most variable values represent the best 

measurement for comparing the cu-production of the strains. 

2.4. Mating type, vegetative compatibility and fertility tests: General 

characterisation of 13 isolates has been performed according to Brasier (1981). A 

special medium – Elm Sapwood Agar was used. Occurrence of elm sapwood in the 

234


medium is necessary for obtaining synnemata and perithecia, essentially important 

for classifying into mating type (A or B), vegetative compatibility groups and 

fertility tests (identification of subspecies). 

2.5. Infection tests: Isolate M3 was inoculated into sapwood of 10 living elms 

which represents in vitro cloned progenies of two elm hybrids – ´Groeneveld´ and 

´Dodoens´ (Krajnakova and Longauer, 1996). The experimental plot is situated 

near to Banská Štiavnica (coordinates: N 48°28´ E 18°58´, 590 m a. s. l.) 5 

representative trees per each hybrid were inoculated and observed according to 

Solla et al. (2005). 

3. RESULTS 

3.1. Ratios of O. novo-ulmi subspecies: Altogether 58 isolates were achieved 

from nearly the entire area of the Czech Republic. The isolated strains were 

identified as O. novo-ulmi and both subspecies novo-ulmi (29) and americana (5) 

were found, as well as their hybrids (24). Decreasing trend in occurrence of 

Ophiostoma ulmi confirms the results of other authors (Brasier, 1991; Hoegger et 

al., 1996; Konrad et al., 2002). They suppose that Ophiostoma ulmi disappeared by 

the end of the 1970's. 

3.2. Production of cerato-ulmin: Absorbances of the samples were very 

variable. Dilution with most variable results was 1:4. Statistical analysis (z-test) 

did not show any differences in cerato-ulmin production between subspecies and 

hybrids. Interesting exception is M9, which produces no cerato-ulmin, although it 

was isolated from infected branch. Culture of M9 seems to be d-infected. 

3.3. Mating type, vc-type and fertility response variability: Among 13 

isolates investigated both mating types occur; 9 isolates are of B type, 4 of A type. 

Vc-tests showed on high diversity of strains. Any isolate was not compatible with 

any other, although two of them were collected from the same tree. Fertility tests 

revealed 3 subspecies americana and 10 ssp. novo-ulmi. In comparison with 

identification by molecular tools there is some relation with cu-region, isolate M10 

is the only exception. 

3.4. Infection tests: Isolate M3 caused extremely high defoliation on resistant 

elm hybrid ´Groeneveld´ and low defoliation on the hybrid ´Dodoens´. 


Methods which have been used proved to be useful in the recognition of 

diversity in DED causal agent populations. From the distribution of isolates is 

evident that we cannot draw any borders between areas which are occupied only by 

ssp. novo-ulmi or by ssp. americana. In many cases such areas were observed 

where both subspecies and their hybrids are overlapping and where more than one 

strain of pathogen is responsible for dying of a tree. This phenomenon was 

235


concluded by negative vc-type tests of two isolates from one tree. This is 

confirmed by many authors (Brasier et al., 1998; Santini, unpublished). High 

variability of mating types and subspecies is an evidence of postepidemic phase of 

DED (Konrad et al., 2002; Brasier et al., 2004). Differences in cerato-ulmin 

production among subspecies which are described by Brasier et al. (2001) and 

others were not confirmed. Production of cerato-ulmin by hybrids and ssp. novoulmi 

is not different, production by ssp. americana is also not different, but there 

were only two isolates ssp. americana tested. Infection tests on living trees are 

useful for assessment of the resistance of each species or elm hybrid and are much 

more reliable by use of older plant material than common 3-year-old trees. (Solla et 

al., 2005). Cultivar ´Groeneveld´ showed very low resistance against currently 

spread strain of Ophiostoma novo-ulmi. 


The author wishes to thank Drs. Alberto Santini and Alejandro Solla for 

sharing their experience with laboratory and field work. 

The results presented herein were obtained from projects supported by MSM 

6215648902. 

6. REFERENCES 

Brasier, C. M., 1981. Laboratory investigation of Ceratocystis ulmi, Compendium of Elm Diseases, 76 

– 79. 

Brasier, C. M., 1991. Ophiostoma novo-ulmi sp. nov., Causative Agent of Current Dutch Elm Disease 

Pandemics. Mycopathologia, 115(3), 151 – 161. 

Brasier, C. M., Kirk, S. A., Pipe, N. D., et al., 1998. Rare interspecific hybrids in natural populations 

of the Dutch elm disease pathogens Ophiostoma ulmi and O. novo-ulmi. Mycol. Res., 

102(1), 45 – 57. 

Brasier, C. M., Kirk S. A., 2001. Designation of the EAN and NAN Races of Ophiostoma novo-ulmi 

as Subspecies. Mycological Research, 105, 547 - 554. 

Brasier, C., Buck, K., Paoletti, M., Crawford, L., Kirk, S., 2004. Molecular analysis of evolutionary 

changes in populations of Ophiostoma novo-ulmi. Invest. Agrar.: Sist. Recur. For., 13(1), 

93 – 103. 

Dvořák, M., Palovčíková, D., Jankovský, L., 2006. The occurrence of endophytic fungus 

Phomopsis oblonga. Journal of Forest Science, 52(11), 531 – 535. 

Dvořák, M., Tomšovský, M., Novotný, L. et al., 2007. Contribution to identify the causal agents of 

Dutch elm disease in the Czech Republic. Plant Protection Science, 43(4), 142 - 145. 

Hoegger, P. J., Binz, T., Heiniger, U., 1996. Detection of genetic variation between Ophiostoma ulmi 

and the NAN and EAN races of O. novo-ulmi in Switzerland using RAPD markers. 

European Journal of Forest Pathology, 26. 57 - 68. 

236


Konrad, H., Kirisits, T., Riegler et al., 2002. Genetic evidence for natural hybridization between the 

Dutch elm disease pathogens Ophiostoma novo-ulmi ssp. novo-ulmi and O. novo-ulmi ssp. 

americana. Plant Pathology, 51. 78 - 84. 

Krajňáková, J. and Longauer, R., 1996. Culture initiation, multiplication and identification of in vitro 

regenerants of resistant hybrid elms. Lesníctví - Forestry 42(6). 261 – 270. 

Pipe, N. D., Buck, K. W., Brasier, C. M., 1997. Comparison of the cerato-ulmin (cu) gene sequences 

of the Himalayan Dutch elm disease fungus Ophiostoma himal-ulmi with those of O. ulmi 

and Ophiostoma novo-ulmi suggests that the cu gene of O. novo-ulmi is unlikely to have 

been acquired recently from O. himal-ulmi. Mycol. Res., 101(4). 415 – 421. 

Polák, O., 1932. Ohrožení našich jilmů houbou Graphium ulmi (Referát o přednášce p. prof. Ph. Dr. 

Jar. Pekla). Československý les, 12(11). 87 – 89. 

Scala, A., Tegli, S., Comparini, C. et al., 1994. Influence of fungal inoculum on cerato-ulmin 

production; purification of cerato-ulmin and detection in elm sucker cuttings. Petria, 4. 57 

– 67. 

Solla, A., Bohnens, J., Collin et al., 2005. Screening European Elms for Resistance to Ophiostoma 

novo-ulmi. Forest Science, 51(2). 134 – 141. 

237



HAIL DAMAGE OF FOREST TREES IN WESTERN CANADA 

ABSTRACT 

Yasuyuki HIRATSUKA 1* 

1 Northern Forestry Centre, Canadian Forest Service 

Edmonton, Alberta CANADA 

* yahirats@nrcan.gc.ca 

Hail and hail storms damage agricultural and horticultural crops, as well as vehicles, 

houses and other buildings; these weather events also cause various degrees of damages to 

forest trees. Western Canada, with its diverse topography and varied weather systems, is 

known to have frequent hail storms. In the Canadian Rockies in the fall of 2008, a severe 

discoloration of foliage and many dead branches were observed over several hectares of a 

subalpine fir (Abies laciocarpa (Hook.)Nutt.) stand. After examining the symptoms and 

topographical features of the affected area, it was concluded that the damage was caused by 

a hail storm. Hail damage as well as other weather-related damage to forest trees, such as 

frost damage and drought damage, are often predisposing factors of branch and foliage 

symptoms associated with pathogenic fungi belonging to such genera as Nectria, 

Cytospora, and Sphaeropsis, and this weather-related damage should be considered when 

diagnosing forest tree health problems. 

Keywords: hail damage, western Canada, non-biotic tree diseases, predisposition 


Hail or hail storms usually occur at the front of storm systems from spring to 

fall but rarely during cold winter weather. Hail is formed when updrafts in 

thunderclouds carry rain drops upward into extremely cold areas of the cloud and 

form ice particles; updrafts carry the ice particles to the cold region of the storm 

clouds, where the size of the ice particles increases. When the ice particles become 

too heavy to be supported by the updraft, they fall to the ground at speeds of up to 

100 km/h. Hail storms can cause damage to crops, houses, and vehicles as well as 

injuries to people and animals. Hail damages to forest trees have often been 

reported (Benjamin, 1957; Grayburn, 1957; Hiratsuka and Zalasky, 1993; Laut and 

Elliott, 1966; Nelson, 2009; Riley, 1953). 

Hail storms occur more frequently along mountain ranges because winds 

(moving in a horizontal direction) react to the change in topography, shifting 

upwards within thunderstorms and creating favorable conditions for the creation of 

hail and hail storms. Hail storms are known to occur throughout many parts of the 

238


world mostly in temperate zones. Bangladesh has reported some of the largest 

hailstones ever measured and more hail-related human deaths than anywhere else 

in the world. In Canada, the foothills area of the Rocky Mountains, especially in 

the province of Alberta, is known to have more incidences of hail storms. Hail 

damage can be localized in small areas but areas as big as 10-km wide are also 

recorded. 

2. OBSERVATIONS 

In the fall of 2008, at Mount Assineboine Provincial Park, in British Columbia, 

Canada, I observed wide areas of natural forests of mature subalpine fir (Abies 

laciocarpa (Hook.)Nutt.) that were severely discoloured with many dead branches. 

No fungal or other biotic signs were present. After close examination of the 

damaged branches and topographical features of the area, I concluded that the 

symptoms were most likely caused by hail that occurred early in the summer, a few 

months before my visit. Symptoms included half- healed wounds on the upper side 

of the branches and many fallen branches on the ground. Needles positioned 

beyond the wounds on branches were often discoloured. Also, the damaged stands 

were facing a lake and the damage occurred mostly on the exposed side of the 

stand, indicating that the hail storm hit sideways from the direction of the lake. 


Hail damage as well as other harmful non-biotic conditions, such as severe 

drought and frost damage, will serve as predisposition factors to fungal and 

bacterial shoot and stem diseases. Trees in the affected areas need to be carefully 

examined and diagnosed. These climatic and physiological damages to trees 

initially do not have signs of fungi or bacteria, but they are often invaded by certain 

fungi or bacteria later, and they are often misdiagnosed as caused by secondary 

fungal invaders. Genera of fungi such as Cytospora, Nectria, and Sphaeropsis are 

known to be in this category of fungi on stems and branches of forest trees 

(Blodget et al., 1997; Zwolinski et al., 1995). In our recent publication of forest 

tree diseases of west-central Canada (Hiratsuka et al., 2004; Hiratsuka, 1987) we 

used expressions such as “Nectria and Cytospora associated with canker of broad 

leaf trees—” rather than “Nectria canker” or “Cyotspora canker”. So called 

“Screloderris canker” caused by Gremmeniella abiteina is also likely triggered by 

one or more non-biotic predisposition factor. 

It is important to consider non-biotic factors, including hail damage, as 

important predisposing conditions when we diagnose forest tree health problems, 

especially in cold climatic regions such as those in Canada. 

239



Benjamin, D.M., 1957. Hail damage to five-year-old red pine in northern Wisconsin. For. Sci. 3:249- 

252. 

Blodget, J.T., Stanosz, G.R., Kruger, E.L.,1997. Sphaeropsis sapinea and water stress in a red pine 

plantation in central Wisconsin. Phytopathology 87:429-434. 

Grayburn, A.W., 1957. Hail damage to exotic forests in Canterbury. New Zealand J. For. 7: 50-57. 

Hiratsuka, Y., 1987. Forest tree diseases of the prairie provinces. Can. For. Serv., North. For. Cent. 

Inf. Rep. NOR-X-286. 142 p. 

Hiratsuka, Y., Langor, D.W., Crane, P.E., 2004. Field guide to forest insects and diseases of Canadian 

prairie provinces. Second Edition. Can. For. Serv., North. For. Cent. Spec. Publ. 297 p. 

Hiratsuka, Y, Zalasky, H, 1993. Frost and other climate-related damage of forest trees in the Prairie 

Provences. Can. For. Serv., North. For. Cent. Inf. Rep. NOR-X-331. 

Laut, J.G., Elliott, K.R., 1966. Extensive hail damage in northern Manitoba. For. Chron. 42:198. 

Nelson, S., 2009. Some tree troubles not caused by insects or diseases. Sustainable horticultural 

information. http://gardenline.usask.ca/trees/some.html 

Riley, C.G., 1953. Hail damage in forest stands. For. Chron. 29:139-143. 

Zwolinski, J.B., Swart, W.J., Wingfield, M.J., 1995. Association of Sphaeropsis sapinea with insect 

infestation following hail damage of Pinus radiata. For. Ecol. Manag. 72:2 

240

Extended Abstracts 

241


242



THREATENING TREE DISEASE IN EAST AFRICA 

Pia BARKLUND 1* , Jane NJUGUNA 1,2 , Abdella GURE 3 , Philip NYEKO 4 , 

Katarina IHRMARK 1 and Jan STENLID 1 

1 Department of Forest Mycology and Pathology SLU, Box 7026,75007 Uppsala Sweden. 

2 Kenya Forest Research Institute, P.O. Box 20412 Nairobi City Square 00200, Kenya. 

3 Wondo Genet College of Forestry and Natural Resources, Hawassa University, P.O. Box 128 

Shashemane Ethiopia 

4 Department of Forest Biology and Ecosystems Management, Makerere University,P.O Box 

7062, Kampala, Uganda. 

ABSTRACT 

*pia.barklund@mykopat.slu.se 

Severe and extensive outbreaks of a dieback and canker disease have recently 

been observed on Grevillea robusta in Kenya, Uganda and to a lesser extent in 

Ethiopia. Grevillea is an excellent agroforestry tree species grown intensively in 

east Africa to improve agricultural land use and rural livelihoods, and provide food 

security. Our recent studies on the disease indicate that 50-80% tree mortality 

occurs on severely infected farms. It is caused by Botryosphaeria spp., a fungal 

genus containing many species and more than one pathogenic species can occur in 

diseased trees. Samples were taken from Grevillea trees growing in different 

agroecological zones and from some other tree species with similar symptoms. 

Morphological and molecular methods were used to identify species and to study 

differences between populations in different agroecological zones as well as 

countries. 

The disease is more severe in dry areas than wet ones, emphasizing the need 

for proper species-site matching. Several other tree species, including indigenous 

and exotics, were found infected by Botryosphaeria in the region. Especially 

alarming is the attack on different Eucalyptus species. 

Such disease outbreaks may be attributed to increased tree planting in 

agroforestry and commercial tree plantations in the region. Increased acreage and 

number of trees/ha leads to an enlarged number of potential hosts, and a larger 

population size for pathogens to evolve genetically into more aggressive 

genotypes. Moreover, complex threats can arise when previously isolated fungal 

species brought together by human interference hybridize posing threats to tree 

hosts previously immune from their effects. Implications of the dieback and canker 

disease on the scaling up of agroforestry technologies and commercial forestry in 

the region are discussed. 

Kewords: Grevillea robusta, Eucalyptus spp. Botryosphaeria, dieback and 

canker disease 

243

References: 


Toljander, Y. Toljander ,Y.K., Nyeko, P., Stenström, E., Ihrmark, K. and Barklund, P. 2007. First 

Report of Canker and Dieback Disease of Grevillea robusta in East Africa Caused by 

Botryosphaeria spp. Plant Disease 91(6):773 + suppl. 

Abdella, G., Slippers, B. Stenlid, J., 2005. Seed-borne Botryosphaeria spp. from native Prunus and 

Podocarpus trees in Ethiopia, with a description of the anamorph Diplodia rosulata sp. 

nov. Mycol. Res. 109 (9): 1005–1014. 

Gezahgne, A., Roux, J and Wingfield, M., 2003. Diseases of exotic Eucalyptus and pinus species in 

Ethiopian plantations. S. Afr. J. Sci. 99:29. 

244


Serial: A, Number: Special Issue, Year: 2009, ISSN: 1302-7085, Page: 245 

PREMATURE DEFOLIATION OF Cedrus libani IN SOUTH-WESTERN 

TURKEY 

Asko Lehtijärvi 1* and H. Tuğba Doğmuş-Lehtijärvi 1 

1 Süleyman Demirel University, Faculty of Forestry, 32260 Isparta, Turkey 


Cedrus libani A. Rich forests are presently found mainly in the Taurus 

Mountains of Turkey while only small populations of the once extensive and 

magnificent cedar forests remain in Lebanon and Syria. There are some 600 000 ha 

of C. libani forests in Turkey, most of which are mixed stands. Wood of C. libani 

is economically important as it is highly resistant to decay, durable and easy to 

process by hand tools and machines. In addition to economical value C. libani 

forests are significant from historical, cultural and aesthetic point of view, and 

therefore actions for sustainable usage and restoring degraded stands have been 

initiated. 

In some C. libani stands in the lakes district of Turkey browning of needles 

occurred in spring, especially in the lower part of the canopy. The disease was 

observed both on saplings growing as understory in mixed forest as well as on 

approximately 10–m–tall trees in an even–aged stand. A close investigation 

revealed ascomata on 1–year–old needles still attached to the twigs. Often only the 

ascomata-bearing part of the needle was brown while other parts had remained 

green. In the lower part of the canopy of a sapling major part of the needles could 

be diseased. On a single branch showing signs of serious premature defoliation 

proportion of needles bearing ascomata was 49.3 % of the total dry weight of the 

needles, while the corresponding value for more or less healthy needles was 37.4%. 

Chlorotic or damaged needles without ascomata made up 13.2% of the total needle 

dry weight. 

The morphological characteristics of the ascomata were very similar to those of 

Ploioderma cedri S. Singh, S.N. Khan & B. Misra occurring on C. deodara in 

India, but asci and ascospores were somewhat larger. The frequent fruiting on dead 

parts of an otherwise green needle indicates that the fungus is the causal agent of 

the disease. 

245



CONTRIBUTIONS TO THE PHYLOGENY OF EUROPEAN 

Porodaedalea SPECIES (BASIDIOMYCETES, HYMENOCHAETALES) 

Michal TOMŠOVSKÝ 1 , Libor JANKOVSKÝ 1* 

1 Faculty of Forestry and Wood Technology, Mendel University of Agriculture and Forestry in 

Brno, Zemědělská 3, CZ – 613 00 Brno, Czech Republic; e-mails: tomsovsk@mendelu.cz, 

ABSTRACT 

*jankov@mendelu.cz. 

The genus Porodaedalea is a taxonomically difficult complex of morphologically 

similar species causing white pocket rot of living conifers. The evolutionary relationships 

of European species were examined using sequences of the internal transcribed spacer 

(ITS) region of the nuclear ribosomal DNA and of translation elongation factor 1 alpha 

(tefa). Our results confirm the occurrence of Porodaedalea chrysoloma, P. pini and P. 

laricis in Europe. P. laricis is newly reported in Fennoscandia on Picea and in the Central 

European mountains (Alps, High Tatras, and Bohemian Forest) on Larix and Pinus spp. 

These specimens had been previously identified as Porodaedalea chrysoloma or Phellinus 

vorax (an invalidly described species). Although frequently confused, P. chrysoloma and P. 

laricis can be distinguished on the basis of pore morphology. We also report our finding of 

P. pini on Larix. In general, the tefa sequences are more variable than the ITS sequences 

and reveal the remarkable affinity of some Scandinavian and Central European specimens 

to those from Central Asia. 


The genus Porodaedalea includes parasites on conifers, causing white pocket 

rot. The genus belongs to one of the most taxonomically difficult groups of 

hymenochaetoid pore fungi. The so-called Phellinus pini group was raised to the 

generic level by Fiasson and Niemelä (1984). The basidiocarps are perennial, 

effused-reflexed to pileate, solitary to imbricate, and corky to woody hardness. The 

colour is rust brown to dark grey on the upper surface, while the poroid surface is 

ochre brown or rust brown to umbre brown, and more or less shining. The pores 

are circular to angular, tending to split and becoming irregular to daedaleoid and 

labyrinthine. Setae are commonly present in the hymenium. In some areas the 

species are reported to be economically important pathogens of conifers 

(Lannenpaa et al., 2008; Černý, 1989; Lehtijärvi et al., 2007). The genus has 

previously been treated as part of a broadly conceived genus Phellinus s.l. 

(Ryvarden and Gilbertson, 1994), but molecular studies have revealed the 

heterogeneity of that genus (Wagner and Fischer, 2002). Therefore smaller, more 

homogeneous genera are currently accepted. 

246


The genus Porodaedalea is comprised of a rather small number of species. 

Nevertheless, the substrate specificity and exact distribution of each species are 

poorly known due to the lack of microscopic characters suitable for exact 

identification at the species level (Fischer, 1996). In Europe, two species are 

traditionally recognized, Porodaedalea pini (Brot.) Murrill and Porodaedalea 

chrysoloma (Fr.) Fiasson & Niemelä, with the former species restricted to Pinus 

and the latter species restricted to Picea as specific hosts. A third species, 

Porodaedalea laricis (Jacz. ex Pilát) Niemelä (Niemelä et al., 2005), is distributed 

on Larix from the European part of Russia to Siberia and the Russian Far East and 

is probably present in China (Dai, 1999). Fischer (2000) discovered this species on 

a non-indigenous Larix trees in Southern Finland and proposed for it the new name 

Porodaedalea niemelaei M. Fischer. This name has been synonymised with P. 

laricis by Niemelä et al. (2005). 

Indigenous stands of Larix decidua, Pinus cembra and Pinus mugo in the 

mountains of Central Europe (Alps, High Tatras) are inhabited by species differing 

from P. chrysoloma and P. pini (Černý, 1985; Fischer, 2000). These populations 

may belong to P. laricis or an undescribed species. The name Phellinus vorax has 

been applied to specimens from this region. However, the combination Phellinus 

vorax is based on incorrectly published basionym Daedalea vorax Harkness. 

Therefore, the name is unavailable, although it has been commonly used 

(Breitenbach and Kränzlin, 1986). The fungus named Daedalea vorax, a Western 

American species growing on Pseudotsuga menziesii, was later correctly described 

as Phellinus gilbertsonii M.J. Larsen (Larsen, 2000). 

Molecular taxonomy methods are frequently used as tools for the identification 

of fungal taxa. Such methods as RFLP (Fischer, 1996) and sequencing of various 

regions of nuclear ribosomal DNA (Fischer, 2000; Wagner and Fischer, 2002) have 

been used to reveal the evolutionary relationships of the species. The sequence of 

the ITS region of the ribosomal DNA also completes the neotypification of 

Phellinus chrysoloma (Larsen and Stenlid, 1999). The aim of the present study is to 

elucidate the identification of Porodaedalea specimens occurring in various parts 

of Europe, using sequences of the ITS region of the nuclear ribosomal DNA (ITS) 

and of translation elongation factor 1 alpha (tefa). The study is focused mainly on 

specimens that have been previously identified as Phellinus vorax. 


In total, 30 specimens of Porodaedalea were included in the study. Either 

fungal cultures or herbarium specimens were used for DNA analyses. 

DNA was isolated from dried fungal material or from fresh cultures that were 

grown on Petri dishes with MEA medium (3% Malt extract, 0.5% peptone, 1.5% 

agar; Himedia, Mumbai, India) using the PowerSoil DNA Isolation Kit (Mo-Bio, 

Carlsbad, USA). PCR reactions were set up according to standard protocols, 

247


supplemented with 5% (v/v) bovine serum albumin (BSA) as a PCR enhancer. 

DNA fragments encompassing the ITS and tefa DNA regions were amplified using 

the primer combinations ITS1/ITS4 and EF595F/EF1160R, respectively (White et 

al., 1990; Kauserud and Schumacher, 2001). The DNA was PCR-amplified as in 

previous studies (Tomšovský et al., 2006) using a Mastercycler® ep thermocycler 

(Eppendorf, Hamburg, Germany). In cases when amplification of the ITS and tefa 

regions was difficult, the primer pairs ITS1F/ITS4B and EF-526F/EF-1567R, 

respectively, were used in nested PCR (for primer sequences, see Gardes and 

Bruns, 1993; O’Donnell et al., 1998). 

The amplified fragments were sequenced by the DNA Sequencing Service of 

Macrogen Inc. (Seoul, Korea). We added an ITS sequence from the Porodaedalea 

chrysoloma neotype (Genbank acc. no. AF123440; Larsen and Stenlid, 1999) to the 

data set. ITS and tefa sequences of Onnia leporina were chosen as outgroups based 

on the results of Wagner and Fischer 2002. 

Sequences of each individual marker were aligned using the Clustal W 

algorithm in BioEdit and adjusted manually. To determine whether the datasets 

from different genetic markers were in significant conflict, partition homogeneity 

tests were performed between the markers in all possible pair-wise combinations. 

The tests were done in PAUP 4.0b10 using 100 replicates and the heuristic general 

search option. The null hypothesis of congruence was rejected if p < 0.01 

Phylogenies were generated in MrBayes version 3.1.2.The best-fit model and 

parameters given by MrModeltest were used in the analyses. Markov chains were 

initiated from a random tree and were run for 2,000.000 generations; the samples 

were taken every 100th generation. Posterior probabilities (PP) were used as 

Bayesian branch supports on the consensus trees. In addition, bootstrap branch 

support values (BP) were estimated in PAUP 4.0b10 under the maximum 

parsimony criterion using 1000 replicate datasets with random sequence addition 

during each heuristic search. 

3. RESULTS 

Partition homogeneity tests showed significant conflict between the two genetic 

markers used (p ≤ 0.01). This did not allow us to perform a combined analysis of 

the ITS and tefa sequence data. The results of the phylogenetic analyses of the two 

datasets are ambiguous. The ITS phylogram shows three main groups, while the 

tefa phylogram shows four. In ITS data set, the most basal lineage within the 

ingroup is composed of P. chrysoloma specimens from the Czech Republic, 

Estonia, Romania, and Southern Sweden, including the P. chrysoloma neotype. 

This P. chrysoloma group is also consistent in the tefa phylogram. 

The second group includes P. pini specimens from the Czech Republic, Estonia, 

Croatia, Lithuania, and Sweden, including a specimen growing on Larix. The 

position of this group is variable; it forms a well supported terminal clade in the 

ITS phylogram, but it is placed in the centre of the tefa phylogram. 

248


In the ITS phylogram, the third clade is composed of P. laricis specimens from 

European part of Russia, Kazakhstan and the Russian Far East, Fennoscandia, and 

the Central European mountains (Alps, High Tatras, Bohemian Forest). However, 

this group is not consistent in both analyses. In the tefa phylogram, five sequences 

from the Czech Republic, Norway, Sweden, and Kazakhstan are excluded from this 

group due to the presence of unique nucleotide substitutions at positions 166 and 

408 in the alignment. Nevertheless, this distant clade is poorly supported. 

4. DISCUSSION 

The topologies of the two gene regions (ITS, tefa) delimiting Porodaedalea 

species are inconcordant, so they do not follow phylogenetic species recognition 

(according to Taylor et al., 2000). Nevertheless, the phylogram topologies of these 

two regions have been found to be incongruent in other studies (Kauserud et al., 

2007; Ota and Hattori, 2008). The most surprising result in our study is the division 

of the homogeneous P. laricis ITS group into two groups in the tefa dataset. 

However, the PP and BP values of the P. laricis B group in the tefa phylogram are 

low. Therefore, we suggest that the name P. laricis is adopted for all specimens 

included in the P. laricis ITS group that were originally identified as P. 

chrysoloma. Almost all sequenced specimens from Fennoscandia that were 

identified as Phellinus chrysoloma are unrelated to the neotype of that species and 

most likely belong to P. laricis instead. Our results resemble those of Černý (1985, 

1989), who placed these Fennoscandian specimens growing on Picea in Phellinus 

vorax, an incorrectly published name synonymous with Phellinus laricis (Černý, 

1985). In any case, the distribution of genuine P. chrysoloma in North 

Fennoscandia is questionable. The species occurs without doubt in southern 

Sweden and Finland (Larsen and Stenlid 1999; Fischer 2000), but the northern 

limit of its distribution is unclear. 

The occurrence and host affinity of Porodaedalea is worth a detailed 

discussion. Niemelä et al. (2005) assumed strict host specificity of Porodaedalea 

species, and therefore they set the westernmost limits of P. laricis in accordance 

with the natural occurrence of Larix sibirica in Russia. Although Fischer (2000) 

examined a specimen growing on artificially planted Larix from Finland, it was 

reported to be an introduced fungus due to the non-indigenous state of its host. 

According to our results, P. laricis is widely distributed in Fennoscandia, using 

spruce as its host. 

In Central Europe, the elevation (≥ 1400 m in the High Tatras in Slovakia) and 

native distribution of the hosts (Pinus and Larix) are reported to be crucial for the 

occurrence of Phellinus vorax (= P. laricis) (Černý, 1989). Our observations 

support this belief; P. laricis growing on Pinus mugo in the Bohemian Forest (= 

Šumava Mts., Czech Republic) occurs under different climatic conditions than P. 

pini inhabiting Pinus sylvestris in the adjacent area. While the only collection of P. 

laricis there was recorded at ca. 1300 m, the highest elevation recorded for P. pini 

249


is 825 m, and the centre of distribution of P. pini is around 700 m or below 

(Tomšovský, 2002). Kotlaba (1984) confirms the distribution of P. pini between 

155-780 m in elevation in the former Czechoslovakia. Jahn (1963) points out the 

occurrence of P. chrysoloma (under the name of Phellinus pini var. abietis) not 

only on Picea, but also on Abies and Larix. These host species are also cited by 

more recent publications (Kotlaba, 1984; Černý, 1989; Ryvarden and Gilbertson, 

1994), but we did not obtain a specimen from Abies. Our results confirm that fungi 

on Larix may belong to either P. laricis or P. pini. The native status of the host 

trees, correlated with elevation, is crucial for occurrence of the respective species. 

Collections of P. pini from Larix have been mentioned previously by Černý 

(1985, 1989) and Kotlaba (1984), while Ryvarden and Gilbertson (1994) reported 

Pinus as the only host genus of this fungus. Therefore, the host spectrum of P. pini 

might extend to non-indigenous conifers. 

The complex phylogeographical structure of Euroasian Porodaedalea deserves 

to be studied in detail. Questions about the histories of local populations are posed 

by the occurrence of a common nucleotide substitution among geographically 

distant specimens from Scandinavia, the Czech Republic, and Kazakhstan (i.e., the 

"P. laricis B" group). Historical changes in host distributions probably led to geneflow 

and introgression of new genotypes that may have survived in local areas. 


This work was supported by the Czech Science Foundation, project no. 

521/07/J039. 

6. REFERENCES 

Breitenbach, J., Kranzlin, F., 1986. Fungi of Switzerland, vol. 2, Heterobasidiomycetes, 

Aphyllophorales, Gasteromycetes. Mykologia, Lucerne 

Černý, A., 1985. Taxonomic study in the Phellinus pini group. Česká mykologie 39: 71-84 

Černý, A., 1989. Parazitické dřevokazné houby [Parasitic wood-decaying fungi]. Státní zemědělské 

nakladatelství, Praha 

Dai, Y.C., 1999. Phellinus sensu lato (Aphyllophorales, Hymenochaetaceae) in East Asia. Acta 

Botanica Fennica 166: 1-115 

Fischer, M., 1996. Molecular and microscopical studies in the Phellinus pini group. Mycologia 88: 

230-238 

Fischer, M., 2000. Porodaedalea (Phellinus pini group, Basidiomycetes) in Europe: a new species on 

Larix sibirica, P. niemelaei. Karstenia 40: 43-48 

Gardes, M., Bruns, T.D., 1993. ITS primers with enhanced specificity for basidiomycetes-application 

to the identification of mycorhizae and rusts. Molecular Ecology 2: 113-118 

Jahn, H., 1963. Mitteleuropäische Porlingen (Polyporaceae s. lato) und ihr Vorkommen in Westfalen. 

Westfälische Pilzbriefe 4: 91-112 

250


Kauserud H, Schumacher T (2001) Outcrossing or inbreeding: DNA Markers provide evidence for 

type of reproductive mode in Phellinus nigrolimitatus (Basidiomycota). Mycol. Res. 105: 

676-683 

Kauserud, H., Hofton, T.H., Saetre, G.P., 2007. Pronounced ecological separation between two 

closely related lineages of the polyporous fungus Gloeoporus taxicola. Mycological 

Research 111: 778-786. 

Kotlaba, F., 1984. Zeměpisné rozšíření a ekologie chorošů (Polyporales s.l.) v Československu 

[Geografical distribution and ecology of polypores (Polyporales s.l.) in Czechoslovakia]. 

Academia, Praha. 

Larsen, M.J., 2000. Phellinus gilbertsonii sp. nov. from western North America causing heart-rot of 

coastal Douglas-fir. Folia Cryptog Estonica 37: 51-54 

Larsen, M.J., Stenlid, J., 1999. Neotypification of Phellinus chrysoloma. Folia Cryptog Estonica 34: 

9-13 

Lannenpaa, A., Aakala, T., Kauhanen, H., Kuuluvainen, T., 2008. Tree mortality agents in pristine 

Norway spruce forests in northern Fennoscandia. Silva Fennica 42: 151-163 

Lehtijärvi, A., Lehtijärvi, H.T.D., 2007. Occurrence of Porodaedalea pini (Brot.: Fr.) Murr. in pine 

forests of the lake district in south-western Turkey. Phytopathologia Mediterranea 46: 

316-319 

Niemelä, T., Kinnunen, J., Larsson, K.H., Schigel, D.S., Larsson, E., 2005. Genus revisions and new 

combination of some North European polypores. Karstenia 45: 75-80 

O'Donnell, K., Kistler, H.C., Cigelnik, E., Ploetz, R.C., 1998. Multiple evolutionary origins of the 

fungus causing Panama disease of banana: Concordant evidence from nuclear and 

mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of 

USA 95: 2044–2049 

Ota, Y., Hattori, T., 2008. Relationships among three Japanese Laetiporus taxa based on phylogenetic 

analysis and incompatibility tests. Mycoscience 49: 168-177. 

Ryvarden, L., Gilbertson, R.L., 1994. European polypores, vol.2. Synopsis Fungorum 

6.Fungiflora, Oslo. 

Taylor, J.W., Jacobson, D.J., Kroken, S., Kasuga, T., Geiser, D.M., Hibbett, D.S., Fisher, M.C., 2000. 

Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and 

Biology 31: 21-32. 

Tomšovský, M., 2006. Molecular phylogeny of European Trametes (Basidiomycetes, Polyporales) 

species based on LSU and ITS (nrDNA) sequences. Nova Hedwigia 82: 269-280. 

Wagner, T., Fischer, M., 2002. Proceedings towards a natural classification of the worldwide taxa 

Phellinus s.l. and Inonotus s.l., and phylogenetic relationships of allied genera. Mycologia 

94: 998-1016 

White, T.J., Bruns, T.D., Lee, S.B., Taylor, J.W., 1990. Amplification and direct sequencing of fungal 

ribosomal RNA genes for phylogenetics. Academic Press, New York 

251

Abstracts 

253


254



EXAMINING THE GEOGRAPHIC DISTRIBUTION OF Diplodia pinea 

AND D. scrobiculata: 

A CASE STUDY FROM MINNESOTA, USA 

J. S. ALBERS 1 , Denise R. SMITH 2 , Glen R. STANOSZ 2* 

1 Division of Forestry, Minnesota Department of Natural Resources, Grand Rapids, MN, 55744, USA 

2 Department of Plant Pathology, University of Wisconsin-Madison, WI, 53706, USA 


Although the shoot blight and canker pathogen Diplodia pinea is more 

commonly reported and is distributed in native and exotic pine stands in much of 

the world, a second very similar and closely related fungus, D. scrobiculata, has 

been detected in the USA, Mexico, France, Israel, Italy, and Spain, and is likely 

present in other countries. Both of these fungi are associated with red pine (Pinus 

resinosa) and jack pine (P. banksiana) in the northcentral and northeastern USA. 

Their distribution in Minnesota was studied by examination of seed cones (on 

which these fungi sporulate). 100 cones collected from the forest floor of each of 

109 red pine stands and 28 jack pine stands were visually examined for Diplodia 

pycnidia and conidia. At least one of these fungi was detected from 106 of 109 red 

pine stands and from all jack pine stands. Mean frequencies of positive red and 

jack pine cones, respectively, were 27% (range 0-84%) and 12% (range 2-41%). 

PCR assays confirmed pathogen identity for subsets of cones. D. pinea was 

detected from cones collected at 102 of 109 red pine stands (69% of red pine cones 

tested), and 18 of 28 jack pine stands (18% of jack pine cones tested). In contrast, 

D. scrobiculata was detected from cones collected at only 26 of 109 red pine 

stands (7% of red pine cones tested), but 26 of 28 jack pine stands (79% of jack 

pine cones tested). These fungi sometimes co-occurred in stands of either host, and 

occasionally both were detected from individual cones of either host. Although 

differences between D. pinea and D. scrobiculata in host association, presence at a 

given location, and frequency of occurrence at a given location were apparent, each 

was found across the entire area surveyed. 

255



FOREST INVASIVE ALIEN FUNGAL SPECIES PRESENT IN LIVE 

PLANT MATERIAL 

Jean A. BERUBE 1* 

1 Canadian Forest Service, Natural Resources Canada, Ste-Foy, Qc, Canada G1V 4C7. 

*jberube@cfl.forestry.ca 

An early warning system based on a random sampling of asymptomatic live 

plant material arriving in Canada is used to detect alien fungal pests. Forty-six 

sample lots collected by Canadian Food Inspection Agency (CFIA) inspectors from 

the province of Quebec were analyzed by cloning the fungal ribosomal ITS present 

in the plant tissues. We obtained 101 fungal species associated with 36 different 

host plants from the USA, France, the Netherlands and Thailand. Six fungal 

species found in this study could have a low to moderate potential impact and 11 

could have a low potential impact for Canadian forests. Another 14 species could 

not be assessed given the limited scientific information available. In all cases, the 

potential impact evaluations of these 31 species originate from the fact that these 

species are new to science and/or belong to genera and families where pathogenic 

species are common. The alien fungal introductions with a potential to affect 

Canadian forests were found at a significant frequency (12.4%) and were present in 

every sample lot sent by CFIA. The 70 other species found in this study were nonpathogenic 

fungi; weak to moderately virulent, common and cosmopolitan species; 

or virulent species found on tropical hosts only. 

256



NEW ADVANCES IN THE STUDY OF THE TAXONOMY OF THE 

EUROPEAN RACE OF GREMMENIELLA ABIETINA 

Leticia BOTELLA 1 , Julio Javier DIEZ 1 , Jarkko HANTULA 2* 

1 Laboratorio de Entomología y Patología Forestal, Departamento de Producción Vegetal 

Recursos Forestales, E.T.S.I.I.A.A., Universidad de Valladolid, “Campus La Yutera”, Avda. Madrid, 

44, 34004, Palencia, Spain. 

2 Finnish Forest Research Institute (METLA), Unit of Vantaa. Joikiniemenkuja, 1, PL 18, FI- 

0130. Finland. 

* jarkko.hantula@metla.fi 

In order to investigate the taxonomy of the European race of Gremmeniella 

abietina var. abietina ten Spanish isolates were randomly chosen among 91 to be 

analyzed genetically and compared with 7 Swiss isolates biotype Alpine, 10 

Finnish isolates biotype A and 10 Finnish isolates biotype B randomly chosen in 

the same way. RAMS markers CCA, CGA and GAAA1000 supported by sequence 

analysis of the locus GAAA1000 were used in this report to study the genetic 

variability of Spanish and Swiss isolates in respect of the rest of European biotypes 

and, thus, to establish what biotype they belong to. Philogenic relationships among 

A, B, Alpine and Spanish sequences analyzed based on the neighbour-joining 

method showed that Alpine type, that is, Swiss sequences, is more closely related 

to B type, and Spanish isolates appear clearly separated from the rest of the 

biotypes. 

Keywords: Brunchorstia pinea – European race – Pinus halepensis – RAMS 

– taxonomy. 

257



STUDIES ON THE SIGNIFICANCE, CAUSAL AGENTS AND 

CONTROL METHODS OF DAMPING- OFF DISEASE IN FOREST 

NURSERIES OF AEGEAN AND LAKES DISTRICT 

H. Tuğba DOĞMUŞ LEHTİJÄRVİ 1* and Gülay TURHAN 2 

1 Suleyman Demirel University, Faculty of Forestry, 32260 Isparta, Turkey 

2 Aegean University, Faculty of Plant Protection, 35100, Bornova- İzmir, Turkey 

*tugba@orman.sdu.edu.tr 

The survey of containerized and bare rooted seedlings of Pinus brutia (Ten.), 

Pinus nigra subsp. pallasiana (Lamb.)Holmboe, Cedrus libani (A. Rich), Pinus 

pinea (L.) and Ailanthus glandulosa (Desf.) showed that damping- off intensity 

was higher in the nurseries of Lakes District than that of Aegean District. The most 

prevalent fungi were found Fusarium spp., Rhizoctonia solani (Kühn.), Pythium 

spp., Alternaria spp. and Macrophomina phaseolina with the rates of 53, 19, 10, 10 

and 6 %, respectively. 

Five hundred fifty fungal isolates were collected from diseased seedlings and 

108 of them were tested for their pathogenicity. Total 283 fungi and 200 bacteria 

were isolated from natural forest soil and among them, Gliocladium virens, 

Trichoderma koningii, Penicillium ademetzi, Myrothecium verrucaria, 

Paecilomyces lilacinus, 2 Streptomyces and 3 unidentified bacteria were found to 

have strong antibiotic activity against the selected pathogenic isolates. Five 

fungicides, propomocarp, hymexazole, thiram, PCNB and propineb, were 

evaluated under in vitro against the antagonists. Antagonistic isolates showed a 

very high degree of sensitivity to the fungicides with the exception of 

promomocarp and hymexazole. 

In vivo studies were carried out as biological, chemical and integrated control of 

5 damping- off pathogens on P. brutia and P. nigra. After soil infestation with 

pathogens, the fungicides were applied by soil drenching and the antagonist 

application was achived by seed coating. Propomocarp and hymexazole were 

found more effective than the other fungicides and gave the best results when they 

were used with the antagonists in combination. 

Key words: Pythium spp. , Macrophomina phaseolina, Rhizoctonia solani, 

Alternaria alternata, Fusarium spp., Chemical control, biological control. 

258



A FOLIAR DISEASE OF Celtis glabrata IN THE LAKES REGION 

Gürsel KARACA 2* , Tuğba DOĞMUŞ-LEHTİJÄRVI 1 , Hüseyin FAKIR 1 

1 University of Süleyman Demirel, Faculty of Forestry, Isparta 

2 University of Süleyman Demirel Faculty of Agriculture, Isparta 

*gkaraca@ziraat.sdu.edu.tr 

Celtis species are widely distributed in Turkey and has 4 species. One of them is 

C. glabrata (Steven ex Planchon) and is found in the Lakes region. A fungal 

disease was commonly observed on Celtis leaves with irregular, large, black spots 

on both sides and velvety apperance on the lower side. Disease incidence was so 

high that all the leaves of the trees showed symptoms with varying degrees. As a 

result of the microscopic examination of the lower leaf surfaces, the fungus was 

identified as Sirosporium celtidis (Biv., Bern. Ex Sprengel) M. B. Ellis. Since C. 

glabrata is not grown in forest nurseries in our country, the fungus is not 

economically important. However, it can cause defoliation and poor growth of 

trees in natural ecosystems. 

259



DETERMINATION OF MACROMYCETES IN THE REGION OF 

KOCAELI 

Ayhan KARAKAYA¹* 

1 Poplar and Fast Growing Forest Trees Research Institute 

P.O. Box 93 41001 Kocaeli/Turkey 

* ayhankarakaya68@hotmail.com 

This study entitled “Determination of Macromycetes in the Region of Kocaeli” 

was carried out to identify macrofungi species growing in the province of Kocaeli. 

The aim of these types of studies can be summarized as to identify species, to 

determine its rank in the systematic and to delineate the species’in distribution 

area. 

In the first step, the literature on the macrofungi was studied, and the relevant 

information was collected. The samples were collected following determining the 

field sites . All of the relevant information on the samples collected was recorded. 

Each sample was later carefully excavated, bagged separately and transferred to the 

lab. 

The internal morphological characteristics of the reproductive organs including 

the cap and lamella of the samples were determined. The cap characteristics 

including shape, dimension, color, color change, centrality, and lamella or pore 

structure, and the odor and degree of density of the succulent part were determined. 

Various features of the stem including length, color, color change, and the 

existence of stem as well as the ring and residuals, if existed, were also noted. 

Moreover, in order to determine spore print, one reproductive organ was 

sampled for each sample brought to the lab. The porous part of the cap was placed 

on a white sheet and protected from air currents that would sweep the fallen 

pollens. At least 12 hours later, spore print’s color was captured on the sheet. 

The macrofungi was identified after the information collected from the field 

sites and the lab study had been compared with the literature. At the end of the 

study, 89 macrofungi species, 79 of which belonged to the Basidiomycetes class 

and 10 of which were of the Ascomycetes class were indentified in the province of 

Kocaeli. 

Keywords: Macrofungi, Kocaeli, forest, systematic, phytopatology. 

260



ARE SUBPOPULATIONS OF Heterobasidion parviporum 

DIFFERENTIATED BY LOCAL CLIMATE? 

Michael M. MÜLLER 1* , Nicola LA PORTA 2 , Jaana EKOJÄRVI 1 , Jarkko 

HANTULA 1 , Kari KORHONEN 1 

1 Finnish Forest Research Institute, Box 18, 01301 Vantaa, Finland 

2 IASMA Research and Innovation Centre, Fondazione Edmund Mach, Environment and 

Natural Resources Area, Via E. Mach 1, S. Michele all'Adige 38010, Italy 

* Michael.mueller@metla.fi 

We determined the decomposition rate (DR) of spruce wood by representatives 

of different subpopulations of Heterobasidion parviporum at various temperatures. 

Sixty three H. parviporum isolates originating from geographically distant and 

climatically varying environments (Finland, Denmark, Italy and Central Siberia) 

were cultivated at eight temperatures between 6 o C and 33 o C on Norway spruce saw 

dust as the only substrate. Decomposition activity was determined as the 

production of carbon dioxide. The optimal temperature for decomposition varied 

considerably between the isolates and ranged between 20 o C and 30 o C. The activity 

of all isolates decreased drastically at temperatures from 30 o C to 33 o C, being at 

33 o C only 7 % of that at 30 o C. The highest between-isolate variations in DR were 

at the extremes of the applied temperature scale, at 33°C and 6°C. 

The DR of the four subpopulations did not differ significantly from each other 

at any temperature, neither was found any variation according to the age of the 

cultures (0.3 - 16 y) (ANOVA). However, the Italian and Siberian isolates were 

collected from several locations in which the climate varied considerably, and the 

highest monthly average temperature of each district explained partly the DR of the 

isolates at 6 o C (p = 0.017). When only the Italian isolates were included in the 

ANOVA, a similar significant variation was found (p = 0.043, n = 15). The highest 

monthly average temperature of the location correlated negatively with the DR of 

H. parviporum at 6 o C. Hence, local climate affects significantly the DR of H. 

parviporum. 

Gene variation of different isolates was studied with six microsatellites and by 

determining the DNA sequences of three sequence characterized amplified regions. 

Interestingly, no significant genetic variation was found between Italian, Danish 

and Finnish isolates. This suggests that there is significant gene flow between these 

subpopulations of H. parviporum, and that the variation in DR at 6 o C between 

isolates from different localities may be a consequence of other factors than 

restricted gene flow. 

261



ATTEMPTS TO NATURALLY REGENERATE RED PINE CAN BE 

THREATENED BY 

DIPLODIA SHOOT BLIGHT DAMAGE TO UNDERSTORY SEEDLINGS 

B. W. OBLINGER 1 , Denise R. SMITH 1 , Glen R. STANOSZ 1* 

Department of Plant Pathology, University of Wisconsin-Madison, WI, 53706, USA 


Changes in red pine (Pinus resinosa) management, due to aesthetic and 

biodiversity concerns, include creation of harvest units with irregular edges, long 

borders of mature trees, and retention of some overstory trees within a harvested 

area. Also, in contrast to traditional even-aged management in which trees of one 

age class are grown, clearcut at final harvest, and replaced by planted seedlings, 

there is increasing interest in natural regeneration and developing multi-aged red 

pine stands. However, crowns of red pines can be sources of abundant inoculum of 

the shoot blight pathogen Diplodia pinea. To determine if Diplodia shoot blight 

threatens young, naturally regenerated red pine in the understory, six replicate plots 

were established in each of four mature plantations in central Wisconsin. The 

frequency of standing, dead seedlings bearing shoot blight symptoms or signs of 

the pathogen, and the incidence and severity of shoot blight damage to live 

seedlings were recorded. Mean seedling mortality ranged from 13-30% and mean 

incidence of blighted living seedlings ranged from 94-100% at all sites. The mean 

frequency of live seedlings with their terminal leaders killed in the past was from 

55-94%. Mean severity of damage to live seedlings, on a 0-3 scale, was ÿ2.16 at 

all sites. Results of a PCR assay confirmed pathogen identity. These results 

support previous research and concern that shoot blight pathogens threaten young 

red pines in the understory. 

262



SOME FUNGAL SPECIES ON Pinus pinaster Ait. AND Pinus radiata 

D. Don PLANTATIONS IN MARMARA REGION OF TURKEY 

Fazıl Selek 1* 

1 Poplar and Fast Growing Forest Trees Research Institute 

P.O. Box 93 41001 Kocaeli/Turkey 

* selek@kavak.gov.tr 

The global forest areas decrease with the growing world population. The 

protection of the natural forest is necessary and the most of wood production 

should be done from outside of the natural forest. 

The industrial plantation give yields about 13,8-55,9 m3/ha/year for rotation 

between 10-30 years. The industrial plantations entrepreneurship gains importance 

as an effective sector in the countriers such as Chile, Brasil, USA, South African, 

New Zealand, Australia, South Korea 

Regular afforestation began in 1955 in Turkey. The plantation of Forestry began 

in 1963. The studies and researchs on Fast Growing Forest trees were given to the 

Poplar Research Institute from General Directorate of Forestry in 1968 

Marmara Region is located on the the Northwest of Turkey. The East 

Longitudes of region are 25 0 50 ’ -30 0 55 ’ , the North latitudes of region are 39 0 06 ’ - 

42 0 05 ’ 

The area of the Marmara Region is 67300 Km 2 

Totally in the Turkey, there are 42 185 hectares plantation areas of Pinus 

pinaster and 949 hectares plantation areas of Pinus radiata 

The aim of this study is to determine the harmful fungi on P. pinaster and P. 

Radiata plantations of the Marmara Region. The observation in plantation were 

done in 2003. Until now, the following fungal species have been identified: Pluteus 

plautus, Lenzites striata, Pleurotus astreatus, Schizophyllum commune and Streum 

purpuretum 

Keywords: Pinus pinaster, Pinus radiata plantations, harmful fungi. 

263



RESPONSE OF Alnus tenuifolia TO INOCULATION WITH Valsa 

melanodiscus 

Glen R. STANOSZ 1* , L. M. TRUMMER 2 , J. K. ROHRS-RICHEY 3 , G. C. 

ADAMS 4 , J. T. WORRALL 5 

1 Department of Plant Pathology, University of Wisconsin-Madison, WI, 53706, USA 

2 USDA Forest Service, Forest Health Protection, Anchorage, AK, 99503, USA 

3 Department of Biology and Institute of Arctic Biology, University of Alaska Fairbanks, AK, 99775, 

USA 

4 Department of Plant Pathology, Michigan State University, East Lansing, MI, 48824, USA 

5 USDA Forest Service, Forest Health Management, Gunnison, CO, 81230, USA 


Valsa melanodiscus (anamorph Cytospora umbrina) is associated with cankered 

and killed alder (Alnus) stems in western North America from Colorado to Alaska. 

The responses of thinleaf alder (A. tenuifolia) stems to inoculation with each of two 

isolates of V. melanodiscus were studied in south-central Alaska. At each of two 

sites, eight stems per isolate were wounded to expose both inner bark and sapwood 

and inoculated in early May 2007 by placing a colonized agar plug over the wound. 

Sterile agar plugs were applied to wounded control stems. Sunken, elongated 

cankers similar to those with which V. melanodiscus has been associated resulted 

on inoculated stems. In contrast, wounded control stems exhibited strong callus 

production and wound closure. In September 2007, cankers were harvested and 

lengths were recorded. Mean canker lengths measured externally (data for both 

isolates pooled) at the two sites were 45 (range 20-156) mm and 73 (range 22-201) 

mm. Analysis of variance of log transformed data revealed strong support for effect 

of location (P = 0.04), but not that of isolate (P = 0.12) or interaction (P = 0.20) on 

canker length. The fungus was reisolated from each inoculated stem, but not from 

any control stem. The ability of V. melanodiscus to cause cankers on thinleaf alder 

stems is confirmed, and these results support the conclusion that this pathogen is a 

cause of alder dieback in western North America. 

264



GREMMENIELLA INFECTIONS ON SEEDLINGS AFTER 

REPLANTING SEVERELY INFECTED PINE FOREST 

Elna STENSTRÖM 1* , Maria JONSSON 1 , Kjell WAHLSTRÖM 1 

1 Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences, 

Uppsala, Sweden 

*elna.stenstrom@mykopat.slu.se 

During 1999 and 2001 the most severe Gremmeniella abietina epidemic ever 

appeared in Sweden. More than 300 000 ha forest were severely attacked and the 

forest industry lost milliards of SEK. Big forest areas, with at least 50 000 ha, 

needed to be clear cut in advance followed by replanting. 

For the out-planting experiment pine seedlings were planted on three different 

locations in Dalarna in Sweden, that were clear-cut in advance due to severe 

Gremmeniella infection. The forest had been clear-cut in 2001 and this study was 

conducted during 2002-2005. Each site contained one clear cut area and a nearby 

Gremmeniella infected forest. Seedlings were planted on clear-cut areas with and 

without remaining twigs and branches, at the edge of the clear-cut areas, as well as 

in the adjacent forest. In total at least 200 seedlings were planted on each area. The 

areas were replanted every year with new one year old seedlings received from a 

forest nursery. The disease incident was determined visually the year after 

plantation and then the infection was confirmed with PCR using Gremmeniella 

specific primers. 

For seedling planted at the clear cut areas, the infection decreased from 50 - 

90% infected seedlings planted one year after felling to 0 - 55% planted the second 

year after felling and to 0 -38% for seedling planted three years after felling. After 

four years there was almost no infection on the clear-cut areas. The variation was 

big between the sites. Two and three years after felling there were almost no 

differences between seedlings planted on areas with or without twigs and branches. 

However seedling planted in the adjacent diseased forest became much more 

infected then seedlings planted on the clear cut areas. For seedlings planted in the 

forest one year after felling almost all seedlings became infected. Two and three 

years after felling they became infected to up to 50 % and even four years after 

felling 15-40 % of the seedlings became infected. The seedlings planted close to 

the forest edge were always more infected then the seedlings out on the clear-cut 

areas but less infected than the seedlings in the forest. 

It is remarkable that the disease incidence on seedlings in the forest still is high 

after 3-4 years but we assume that the snow cover during winter have promoted the 

infections in small seedlings. From inventory in mature forest in the same areas it 

265


has been found that the disease incidence decreased after some years after the 

severe outbreaks in 1999 and 2001. In spite of this it means that several years after 

a severe infection there is still a lot of viable spores left, particularly in the forest. 

More then two years after felling it seems to be a trend that seedlings planted in the 

middle of the clear-cut areas were less infected then seedling planted close to the 

forest. The variation between infections in the forest on the different sites was low 

compared to infections on the clear cut areas. The general conclusion is that it is 

advisable to wait with replanting with pine seedlings at least two years after felling 

severely Gremmeniella infected stands. Then the risk of infection form twigs and 

branches left on the clear cut area also is smaller. 

266


List of participants 

Anna Hopkins 

Scion (New Zealand Forest research Institute) 

Scion, Private Bag 3020, Rotorua 3010, New Zealand 

Anna.Hopkins@scionresearch.com 

Antti Uotila 

Helsinki University, Hyytiälä Forestry Field Station 

Hyytiäläntie 124, 35500 Korkeakoski, Finland 

antti.uotila@helsinki.fi 

Asko Lehtijärvi 

Suleyman Demirel University 

SDU, Faculty of forestry, Dept. of Botany, 32260, Cunur, Isparta, Turkey 

asko@orman.sdu.edu.tr 

Ayhan Karakaya 

Poplar and Fast Growing Forest Trees Research Institute 

Kavakçılık Araştırma Müdürlüğü 41001 Başiskele, Kocaeli, Türkiye 

ayhankarakaya68@hotmail.com 

Ayşe Gülden Aday 


SDU, Faculty of forestry, Dept. Of siviculture, 32260, Cunur, Isparta, Turkey 

guldenaday@orman.sdu.edu.tr 

Banu Karabıyık 

T. C. Orman Genel Müdürlüğü 

Orman İdaresi ve Planlama Dairesi Başkanlığı, 7 nolu Bina Orman Genel 

Müdürlüğü Tesisleri Gazi Ankara, Türkiye 

bnkarabiyik@hotmail.com 

Berthold Metzler 

Forest Research Institute Baden-Wuerttemberg 

Wonnhaldestr, 4D-79100 Freiburg/Br. Germany 

berthold.metzler@forst.bwl.de 

Dagmar Palovcikova 

Dpt. of Forest Protection and Wildlife Management, Faculty of Forestry and Wood 

Technology, Mendel University of Agriculture and Forestry, Brno 

Zemedelska 3, 613 00 Brno, Czech Republic 

palovcik@mendelu.cz 

Denise Smith 

University of Wisconsin-Madison 

Dept. of Plant Pathology, 1630 Linden Drive, Madison, WI 53706 

dzs@plantpath.wisc.edu 

267


Elna Stenström 

Department of forest mycology and pathology 

SLU, Box 7026, S-75007 Uppsala, Sweden 

elna.stenstrom@mykopat.slu.se 

Erhard Halmschlager 

İnstitute of forest Entomology, Forest Pathology and Forest Protection, Dept. Of 

Forest and Soil Sciences, University of Natural Resources and Applied Life 

Sciences Vienna (BOKU), Vienna 

Hasenauerstraße 38 A-1190 Wien 

erhard.halmschlager(at)boku.ac.at 

Eva Alfonso Corzo 

Universidad Politécnica de Madrid, Escuela Técnica Superior de Ingenieros de 

Montes Plaza de la Constitución, 8 Bajo Derecha Alcorcón, MADRID (Spain) 

alfonso_corzo@hotmail.com 

Faruk Ş. Özay 

Poplar And Fast Growing Forest Tree Researc İnstitude 

Kavakçılık Araştırma Müdürlüğü 41001 Başisleke /Kocaeli, Türkiye 

Fax: 0262 311 69 72 

Faruk@kavak.gov.tr 

Fazıl SELEK 


Kavakçılık Araştırma Müdürlüğü 41001 Başiskele/ KOCAELİ, TÜRKİYE 

selek@kavak.gov.tr 

Funda Oskay 



foskay@orman.sdu.edu.tr 

Gaston Laflamme 

Canadian Forest Service 

1055 rue du P.E.P.S. Quebec, Qc Canada GIV 4C7 

Laflamme@rncan.gc.ca 

Gürsel Karaca 


SDU, Faculty of Agriculture, Dept. Of plant protection, 32260, Cunur, Isparta, 

Turkey 

gkaraca@ziraat.sdu.edu.tr 

Irmtraut Zaspel 

Institute of Forest Genetics 

Eberswalder Chausee 3A, 15377 Waldsieversdorf, Germany 

irmtraut.zaspel@vti.bund.de 

268


Juha Kaitera 

Finnish Forest Research Institute 

Muhos Research Unit, Kirkkosaarentie 7, FI-91500 Muhos, Finland 

juha.kaitera@metla.fi 

Julio Javier Diez Casero 

University Of Valladolid, Spain 

Dpt. Producción Vegetal, Campus “La Yutera” Edif. 

E. Av. Madrid, 44, 44004. Palencia. Spain 

Jdcasero@Pvs.Uva.Es 

Kazım ULUER 


Kavakçılık Araştırma Müdürlüğü 41001 Başiskele/ KOCAELİ, TÜRKİYE 

uluer@kavak.gov.tr 

Leticia Botella Sánchez 

University Of Valladolid, Spain 

Dpt. Producción Vegetal, Campus “La Yutera” Edif. 

E. Av. Madrid, 44, 44004. Palencia. Spain 

Lbotella@pvs.uva.es 

Libor Jankovsky 




jankov@mendelu.cz 

Maria Jesus Garcia-Garcia 

Technical University of Madrid, Madrid, Spain 

Dpto. Proyectos y Planificacion Rural. E.T.S.I. de 

Montes. Universidad Politecnica de Madrid. Ciudad Universitaria s/n - 28040. Madrid. 

Spain 

mariajesus.garcia.garcia@upm.es 

Martti Vuorinen 

The Finnish forest Research Institute 

Metla, Suonenjoki Research Unit, Juntintie 154, 77600 Suonenjok, Finland 

martti.vuorinen@metla.fi 

Mertcan Karadeniz 



karadenizmertcan@gmail.com 

Michael Müller 

The Finnish forest Research Institute 

Finnish Forest Resaerch Institute, P. O. Box 18, 01301 Vantaa, Finland 

Michael.Mueller@metla.fi 

269


Michal Tomsovsky 


Technology, Mendel University of Agriculture and Forestry, Brno Zemedelska 3, 613 

00 Brno, Czech Republic 

tomsovsk@mendelu.cz 

Milon Dvorak 




klobrc@centrum.cz 

Mustafa Uygun 

Konya Orman Bölge Müdürlüğü 

Konya, Turkey 

mustafauygun@ogm.gov.tr 

Nevzat Gürlevik 


SDU, Faculty of forestry, Dept. Of siviculture, 32260, Cunur, Isparta, Turkey 

gulevik@orman.sdu.edu.tr 

Nikica Ogris 

Slovenian Forestry Institute 

Slovenian Forestry Institute, Nikica Ogris, Vecna pot 2, 1000 Ljubljana, Slovenia 

nikica.ogris@gozdis.si 

Oscar Santamaría 

University of Extremadura 

Escuela de Ingenierías Agrarias. Ctra. de Cáceres s/n, 06071 Badajoz, SPAIN 

osantama@unex.es 

Pablo Martínez Álvarez 

University of Valladolid 

Departamento de Producción Vegetal y Silvopascicultura. Campus La Yutera. 

Edificio E. Avda. Madrid 44 34004 Palencia (Spain) 

pmtnez@pvs.uva.es 

Paolo Capretti 

DiBA Department of Agricultural Biotechnology Sect. of Plant Pathology. 

Piazzale delle Cascine, 28 50144 FIRENZE ITALY 

paolo.capretti@unifi.it 

Petr Stastny 




svezi.mirka@email.cz 

270


Pia Barklund 

Department of Forest Mycology and Pathology, SLU 

Box 7026, SE-75007 Uppsala, Sweden 

Pia.Barklund@mykopat.slu.se 

Sabrina Reignoux 

The University of Edinburgh Institute of Evolutionary Biology 

West Main Road, Edinburgh 

EH9 3JT 

s0676163@sms.ed.ac.uk 

Sarah Green 

Forest Research 

Northern Research Station, Roslin, Midlothian, Scotland EH25 9SY 

sarah.green@forestry.gsi.gov.uk 

Tom Hsiang 

Department of Environmental Biology, University of Guelph, Guelph, Ontario, 

Canada 

thsiang@uoguelph.ca 

Tuğba Doğmuş-Lehtijärvi 



tugba@orman.sdu.edu.tr 

Yasuyuki Hiratsuka 

Canadian Forest service 

Nothern Forestry Centre 12304 66A Avenue, Edmonton, Alberta T6H 1Z3, Canada 

Yasu.Hiratsuka@NRCan-RNCan.gc.ca 

271


272

sdu faculty of forestry journal special edition 2009 - Orman Fakültesi

Create successful ePaper yourself

Delete template?

Save as template?